Rapid Detection of Pityophthorus juglandis (Blackman) (Coleoptera, Curculionidae) with the Loop-Mediated Isothermal Amplification (LAMP) Method

Abstract

The walnut twig beetle Pityophthorus juglandis is a phloem-boring bark beetle responsible, in association with the ascomycete Geosmithia morbida, for the Thousand Cankers Disease (TCD) of walnut trees. The recent finding of TCD in Europe prompted the development of effective diagnostic protocols for the early detection of members of this insect/fungus complex. Here we report the development of a highly efficient, low-cost, and rapid method for detecting the beetle, or even just its biological traces, from environmental samples: the loop-mediated isothermal amplification (LAMP) assay. The method, designed on the 28S ribosomal RNA gene, showed high specificity and sensitivity, with no cross reactivity to other bark beetles and wood-boring insects. The test was successful even with very small amounts of the target insect’s nucleic acid, with limit values of 0.64 pg/µL and 3.2 pg/µL for WTB adults and frass, respectively. A comparison of the method (both in real time and visual) with conventional PCR did not display significant differences in terms of LoD. This LAMP protocol will enable quick, low-cost, and early detection of P. juglandis in areas with new infestations and for phytosanitary inspections at vulnerable sites (e.g., seaports, airports, loading stations, storage facilities, and wood processing companies).

Full text

plants
Article
Rapid Detection of Pityophthorus juglandis (Blackman)
(Coleoptera, Curculionidae) with the Loop-Mediated
Isothermal Amplification (LAMP) Method
Domenico Rizzo 1, Salvatore Moricca 2, * , Matteo Bracalini 2, Alessandra Benigno 2, Umberto Bernardo 3,
Nicola Luchi 4, Daniele Da Lio 5, Francesco Nugnes 3, Giovanni Cappellini 1, Chiara Salemi 5,
Santa Olga Cacciola 6and Tiziana Panzavolta 2


Citation: Rizzo, D.; Moricca, S.;
Bracalini, M.; Benigno, A.;
Bernardo, U.; Luchi, N.; Da Lio, D.;
Nugnes, F.; Cappellini, G.; Salemi, C.;
et al. Rapid Detection of Pityophthorus
juglandis (Blackman) (Coleoptera,
Curculionidae) with the
Loop-Mediated Isothermal
Amplification (LAMP) Method.
Plants 2021,10, 1048. https://
doi.org/10.3390/plants10061048
Academic Editor:
William Underwood
Received: 30 March 2021
Accepted: 20 May 2021
Published: 22 May 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
1Laboratory of Phytopathological Diagnostics and Molecular Biology, Plant Protection Service of Tuscany,
Via Ciliegiole 99, 51100 Pistoia, Italy; domenico.rizzo@regione.toscana.it (D.R.);
giovanni.cappellini@regione.toscana.it (G.C.)
2Department of Agricultural, Food, Environmental and Forestry Science and Technology (DAGRI), Plant
Pathology and Entomology Section, University of Florence, Piazzale delle Cascine 28, 50144 Florence, Italy;
matteo.bracalini@unifi.it (M.B.); alessandra.benigno@unifi.it (A.B.); tiziana.panzavolta@unifi.it (T.P.)
3Portici Unit, Institute for Sustainable Plant Protection, National Research Council (IPSP-CNR), P. le Enrico
Fermi 1, 80055 Portici, Italy; umberto.bernardo@ipsp.cnr.it (U.B.); francesco.nugnes@ipsp.cnr.it (F.N.)
4Florence Unit, Institute for Sustainable Plant Protection, National Research Council (IPSP-CNR), Via
Madonna del Piano 10, 50019 Sesto Fiorentino, Italy; nicola.luchi@ipsp.cnr.it
5
Department of Agricultural, Food and Agro-Environmental Sciences, University of Pisa, Via del Borghetto 80,
56124 Pisa, Italy; daniele.dalio@hotmail.com (D.D.L.); chiarasalemi93@gmail.com (C.S.)
6Department of Agriculture, Food and Environment, University of Catania, 95123 Catania, Italy;
olgacacciola@unict.it
*Correspondence: salvatore.moricca@unifi.it
Abstract: The walnut twig beetle Pityophthorus juglandis is a phloem-boring bark beetle responsible,
in association with the ascomycete Geosmithia morbida, for the Thousand Cankers Disease (TCD) of
walnut trees. The recent finding of TCD in Europe prompted the development of effective diagnostic
protocols for the early detection of members of this insect/fungus complex. Here we report the
development of a highly efficient, low-cost, and rapid method for detecting the beetle, or even just its
biological traces, from environmental samples: the loop-mediated isothermal amplification (LAMP)
assay. The method, designed on the 28S ribosomal RNA gene, showed high specificity and sensitivity,
with no cross reactivity to other bark beetles and wood-boring insects. The test was successful even
with very small amounts of the target insect’s nucleic acid, with limit values of 0.64 pg/
µ
L and
3.2 pg/
µ
L for WTB adults and frass, respectively. A comparison of the method (both in real time and
visual) with conventional PCR did not display significant differences in terms of LoD. This LAMP
protocol will enable quick, low-cost, and early detection of P. juglandis in areas with new infestations
and for phytosanitary inspections at vulnerable sites (e.g., seaports, airports, loading stations, storage
facilities, and wood processing companies).
Keywords: bark beetle; invasive species; molecular identification; thousand canker disease; walnut
1. Introduction
Pityophthorus juglandis Blackman (Coleoptera, Curculionidae, Scolytinae), also known
as the Walnut Twig Beetle (WTB), native to northern Mexico and the southwestern United
States, is the main vector of Geosmithia morbida Kolaˇrik (Ascomycota, Hypocreales) (GM),
the fungus responsible for the Thousand Cankers Disease (TCD) of walnut trees [
1
,
2
]. This
disease originated in the western US [
3
] and damages mainly individuals of the non-native
black walnut (Juglans nigra L.), widely planted in this part of the country as an ornamental
and nut-bearing tree, while the walnut species native to the southwestern US, such as
Juglans major (Torr.) A. Heller (Arizona walnut), are less susceptible [
4
]. Over the past
Plants 2021,10, 1048. https://doi.org/10.3390/plants10061048 https://www.mdpi.com/journal/plants

Plants 2021,10, 1048 2 of 16
30 years, G. morbida and P. juglandis have spread pervasively in many areas of the western
US and have also been introduced to some eastern states [
4
]. In the newly-invaded
areas, the bark beetle also attacks other walnut species whose susceptibility to the fungal
disease varies.
Plants showing TCD symptoms have been detected starting from 2013 in Europe [
5
,
6
].
This fungus-insect association was found in northern and central Italy—the only European
country where TCD is at present reported—mainly on black walnuts, although it was also
reported on an English walnut (Juglans regia L.) growing close to an infected black walnut
plantation [
7
]. The English walnut, widespread and widely cultivated in Europe for nut
production, is considered less susceptible to the disease. However, GM induced cankers on
J. regia also in the US. In fact, in a survey on TCD incidence in J. regia orchards in California,
Yaghmour et al. [
8
] identified many trees of this species and of its Paradox hybrid rootstock
(J. hindsii ×J. regia) with TCD symptoms and WTB activity.
J. regia is a globally popular and valued tree crop, considered an important tradi-
tional nut tree in Europe. Used for human nutrition since ancient times, this deciduous,
medium-sized, mesophytic tree can be found throughout southern and western Europe
and is widely cultivated in its south-central and southeastern areas [
9
,
10
]. Today it can be
frequently found intercropped with the non-native J. nigra, whose cultivation for timber
production has been strongly encouraged by the European Union in recent decades [
10
].
This consociation between the two species can lead not only to a wider spread of TCD in
Europe, but it also increases the likelihood of the disease jumping onto J. regia.
TCD is caused by the combined activity of WTBs and GM. P. juglandis is not the only
beetle on which GM propagules have been found. Various beetle species (Curculionidae:
Cossoninae and Platypodinae) collected from GM-infected plants have also been found
to carry the fungus on their body, although their effective ability to transmit the infection
to walnut trees is not proven [
11
]. Currently, WTB is the only beetle whose capability
to vehiculate the disease on walnuts has been proven [
1
]. In addition, WTB behavior is
fundamental for disease development because TCD is the outcome of multiple, repeated
attacks by the beetle on the walnut’s branches and stems, which cause numerous holes,
around which cankers then develop and coalesce [12].
Both G. morbida and its vector P. juglandis are regulated in Europe as quarantine pests,
listed in Annex II part B of the Commission Implementing Regulation (EU) 2019/2072 [
13
].
Special requirements for the import and movement within the Union territory of plants for
planting, as well as of wood from the genera Juglans and Pterocarya (Juglandaceae), are laid
down in Annexes VII and VIII of the same EU Regulation. Furthermore, EU Regulation
2016/2031 specifies the general requirements for surveys of quarantine organisms within
EU territory [
14
]. These regulatory measures prove the strong need to monitor Europe
for both the presence of new outbreaks and, at entry points, for the import-export of
walnut material (plants for planting and timber) to prevent the possible introduction and
subsequent spread of this insect-fungus complex.
Current survey protocols for identifying the various stages of P. juglandis are not
straightforward. Survey protocols are not simple and are difficult to implement due to the
cryptic life stages of the parasite hidden within the trees. Adult morphological identification
requires entomological experience, as is the case with many small-sized bark beetles. The
morphological identification is even more troublesome for the preimaginal stages, which
are indistinguishable from other similar-sized bark-beetle larvae [
15
]. Many of the issues
related to WTB are common to those of other wood-boring beetles of quarantine significance.
For example, for some species morphological identification is hampered by the existence of
cryptic species [
16
]. Management programs to counter alien pest invasions are negatively
influenced by various factors such as inadequate monitoring protocols, lack of international
standards for phytosanitary measures, poor coordination between stakeholders, and public
resistance to implementation of control strategies [
17
,
18
]. Because of these difficulties, the
development and implementation of fast and accurate molecular methods to rapidly detect
the insect are urgently needed.

Plants 2021,10, 1048 3 of 16
One such new, versatile molecular detection method is loop-mediated isothermal
amplification (LAMP) [
19
,
20
]. This technique is cost-effective and more rapid than real-time
PCR assays [
21
–
23
]. Molecular assays based on LAMP have been developed to diagnose
a range of parasitic infections in both humans and animals (e.g., malaria, leishmaniasis,
and cysticercosis) [
24
]. Recently, several LAMP tests have also been devised for the
identification of invasive plant pathogens [
25
–
28
] and insect pests [
29
–
31
], both for field
applications and in the laboratory. The LAMP technique is a robust and suitable technique
for in situ application owing to its low infrastructure requirements and minimal operator
training [
32
]. The method also allows detection through biological traces, such as insect
frass, esuviae, and saliva of target organisms, as also demonstrated for other non-native,
invasive species [33–36].
This study aimed to develop a diagnostic protocol based on LAMP assays, in both
real-time and visual detection, for the early and reproducible diagnosis of the preimaginal
stages, frass and adults of P. juglandis.
2. Results
2.1. Nucleic Acid Extraction from Frass and Insects
The mean concentration of DNA extracts from frass and WTB adults was
325.6 ±32 ng/µL
and 148
±
22.1 ng/
µ
L, respectively. The average A260/280 ratios were 2.02
±
0.2 and
1.72
±
0.4 for frass and adult insects, respectively. The quality of DNA extracted from
insects (Table 1), verified by the qPCR probe [
37
], was good, with a mean Cq value of
20.8
±
2.5. Similarly, the LAMP protocol based on Tomlinson et al. [
38
] on DNA frass from
WTB showed a mean value of Tamp of 16.8 ±3.2 (min:s).
Table 1.
Repeatability and reproducibility of real time LAMP assay on frass measured as standard
deviation (SD).
Sample No.
Real Time LAMP Protocol
Repeatability SD Reproducibility SD
Assay 1 Assay 2
1 0.01 0.00 0.04
2 0.05 0.03 0.08
3 0.15 0.01 0.01
4 0.03 0.14 0.06
5 0.04 0.09 0.01
6 0.09 0.06 0.07
7 0.03 0.01 0.03
8 0.04 0.06 0.08
2.2. LAMP Assay Conditions
The optimal reaction mix for the real-time LAMP assay consisted of 10
µ
L Isothermal
Master Mix OptiGene (ISO-001), 0.2
µ
M of F3/B3, 0.4
µ
M of LoopF/LoopB, 0.8
µ
M of
FIP/BIP, and 2
µ
L of template DNA (5 ng/
µ
L) in a final volume of 20
µ
L. The real-time
LAMP reaction was performed at 65
◦
C for 30 min, followed by an annealing analysis from
65 to 95
◦
C, ramping up by 0.5
◦
C/s, which determined the formation of melting curves.
The melting peak for WTB samples of frass was 90.5 ◦C±0.5 ◦C (Figure 1).

Plants 2021,10, 1048 4 of 16
Plants 2021, 10, x FOR PEER REVIEW 4 of 16
protocol was conducted on the DNA of both WTB and non-targets extracted from frass.
The reaction was performed at 65 °C for 30 min, followed by an additional cycle of 80 °C
for 2 min.
Figure 1. Real-time LAMP amplification curves from adults (green with circles) and frass (red
with triangles) of WTB.
2.3. Diagnostic Sensitivity, Specificity, and Accuracy of the LAMP Assay
Assays on target and non-target samples (Table 2) did not show any non-specific am-
plification, only WTB producing amplification curves. A unique amplification curve was
generated by each WTB sample, regardless of the starting matrix, thus confirming the
specificity of the LAMP assay. In the case of the visual LAMP assay, only WTB was de-
tected by the LAMP reaction, while none of the non-target organisms were amplified
(Supplementary Data Table S1). For both protocols, diagnostic sensitivity, diagnostic spec-
ificity and relative accuracy were equal to 100%. The end-point PCR protocols designed
to evaluate and compare the analytical sensibility (LoD) were also assayed on all target
and non-target samples, showing a diagnostic specificity of 100%, the same as the LAMP
assay developed in this study.
Table 2. List of target and non-target insects and biological material used in this study. PPS-T: Plant Protection Service of
Tuscany, Laboratory of Phytopathological Diagnostics and Molecular Biology; UF: University of Florence; UP: University
of Pisa; CREA-AE: Council for Agricultural Research and Economics-Agriculture and Environment (Florence).
Species Classification Matrix Collection
Date Supplier Source
Plant/Device Hosts
Pityophthorus juglandis
Coleoptera,
Curculionidae,
Scolytinae
frass 2018 PPS-T J. nigra Juglans spp.
Pterocarya spp.
adult 2018 UF J. nigra
Pityophthorus pubescens (Marsham) adult 2018 UF trap conifers
Ips sexdentatus (Börner) adult 2018 UF trap conifers
Ips typographus (Linnaeus) adult 2014 PPS-T trap conifers
Orthotomicus erosus (Wollaston) adult 2018 UF trap conifers
Hylurgus ligniperda (Fabricius) adult 2018 UF trap conifers
Tomicus destruens (Wollaston) adult 2018 UF trap conifers
Figure 1.
Real-time LAMP amplification curves from adults (green with circles) and frass (red with
triangles) of WTB.
The optimal visual LAMP reaction mixture was also 20
µ
L: 2
µ
L Isothermal Buffer
10
×
, 0.6 mM dNTPs, 2 mM MgSO4, 0.15 mM HNB, and 0.2 M Betaine, plus the following
final concentrations of the LAMP primers: 0.2
µ
M for F3/B3, 0.4
µ
M for LoopF/LoopB,
0.8
µ
M for FIP/BIP, 0.32 U/
µ
L Bst 3.0, and 2
µ
L of template DNA (5 ng/
µ
L). The visual
LAMP protocol was conducted on the DNA of both WTB and non-targets extracted from
frass. The reaction was performed at 65
◦
C for 30 min, followed by an additional cycle of
80 ◦C for 2 min.
2.3. Diagnostic Sensitivity, Specificity, and Accuracy of the LAMP Assay
Assays on target and non-target samples (Table 2) did not show any non-specific
amplification, only WTB producing amplification curves. A unique amplification curve
was generated by each WTB sample, regardless of the starting matrix, thus confirming
the specificity of the LAMP assay. In the case of the visual LAMP assay, only WTB was
detected by the LAMP reaction, while none of the non-target organisms were amplified
(Supplementary Data Table S1). For both protocols, diagnostic sensitivity, diagnostic
specificity and relative accuracy were equal to 100%. The end-point PCR protocols designed
to evaluate and compare the analytical sensibility (LoD) were also assayed on all target
and non-target samples, showing a diagnostic specificity of 100%, the same as the LAMP
assay developed in this study.

Plants 2021,10, 1048 5 of 16
Table 2.
List of target and non-target insects and biological material used in this study. PPS-T: Plant Protection Service of
Tuscany, Laboratory of Phytopathological Diagnostics and Molecular Biology; UF: University of Florence; UP: University of
Pisa; CREA-AE: Council for Agricultural Research and Economics-Agriculture and Environment (Florence).
Species Classification Matrix Collection
Date Supplier Source
Plant/Device Hosts
Pityophthorus juglandis
Coleoptera,
Curculionidae,
Scolytinae
frass 2018 PPS-T J. nigra Juglans spp.
Pterocarya spp.
adult 2018 UF J. nigra
Pityophthorus pubescens
(Marsham) adult 2018 UF trap conifers
Ips sexdentatus (Börner) adult 2018 UF trap conifers
Ips typographus
(Linnaeus) adult 2014 PPS-T trap conifers
Orthotomicus erosus
(Wollaston) adult 2018 UF trap conifers
Hylurgus ligniperda
(Fabricius) adult 2018 UF trap conifers
Tomicus destruens
(Wollaston) adult 2018 UF trap conifers
Xyleborinus saxesenii
(Ratzeburg) adult 2018 UF trap
several host
genera (including
Juglans)
Anisandrus dispar
(Fabricius) adult 2020 CREA-AE Malus sp.
several host
genera (including
Juglans)
Xyleborus monographus
(Fabricius) adult 2020 CREA-AE trap
polyphagous
(including
Juglans)
Xylosandrus compactus
(Eichhoff)
frass 2018 PPS-T Laurus nobilis several host
genera
adult 2018 PPS-T Laurus nobilis
Xylosandrus crassiusculus
(Motschulsky) adult 2018 UP Malus sp. several host
genera
adult 2019 UP Malus sp.
Xylosandrus germanus
(Blandford) adult 2019 UF trap
several host
genera (including
Juglans)
Lepturges confluens
(Haldeman)
Coleoptera,
Cerambicidae adult 2020 PPS-T Juglans sp.
several host
genera (including
Juglans)
Zeuzera pyrina
(Linnaeus)
Lepidoptera,
Cossidae larva 2017 PPS-T Olea europaea
several host
genera (including
Juglans)
2.4. Blind Panel Validation of the Assay
In the blind panel test, only WTB samples (frass and adults) amplified, with a mean
Tamp value equal to 12.98
±
0.24 (min:s) and 8.74
±
0.16 (min:s) from frass and WTB
adults, respectively. The average melting peaks were equal to 90.83
◦
C
±
0.00 and
90.75
±
0.09. The non-target insects and frass did not amplify (
Supplementary Data Table S2
).
Specificity, sensitivity, and accuracy of the results were all 100%. The visual LAMP data
were comparable to the real-time LAMP data as only the WTB samples amplified, while
the nontargets gave no amplification.
2.5. Repeatability and Reproducibility of the Diagnostic Methods
Repeatability and reproducibility were estimated only on WTB frass samples and
showed very low SD values (Table 1), varying from 0 to 0.15 (mean Tamps equal to
12.97 ±1.06).
2.6. Limit of Detection (LoD) of the LAMP Assay and Comparison with qPCR (Probe) and
Conventional PCR (End-Point) Assays
The LoD was obtained for both the real-time LAMP assay and for the visual LAMP.
Dilutions from 10 ng/
µ
L to 5.12 fg/
µ
L of insect and artificial frass DNA were amplified

Plants 2021,10, 1048 6 of 16
in triplicate. The LoD for the real-time LAMP assay was 0.64 pg/
µ
L with a Tamp value
of 13.96
±
1.76 (min:s) for adult insects and 3.2 pg/
µ
L, with a Tamp value of 13.59
±
1.38
(min: s), for WTB frass. In the visual LAMP assay, the LoD was similar to that of the
real-time LAMP assay (Tables 3and 4, Figures 2–5).
Table 3.
LoD assay (comparison among different methods) based on WTB adults using 1:5 serial dilutions (from 10 ng/
µ
L
to 5.12 fg/
µ
L) and the real-time LAMP protocol. The serial dilutions are the same ones used for the qPCR probe [
31
] and
the Real Time and visual LAMP (this study).
Dilutions
Real Time LAMP Visual LAMP
qPCR Probe
P. juglandis
(Rizzo et al., 2020a)
End-Point PCR
(14F/125R)
Tamp Means ±SD Mean Melting
Temperatures ±SD
Positive (+)/
-Negative (−)Cq Means ±SD Positive
(+)/-Negative (−)
10 ng/µL6.76 ±0.42 91.00 ±0.00 + 18.31 ±1.15 +
2.0 ng/µL7.76 ±0.09 90.75 ±0.35 + 20.69 ±0.67 +
0.4 ng/µL8.25 ±0.01 90.5 ±0.00 + 23.05 ±0.34 +
0.08 ng/µL9.60 ±0.54 91.00 ±0.00 + 24.57 ±0.21 +
0.016 ng/µL10.17 ±0.12 91.00 ±0.00 + 26.85 ±0.47 +
3.2 pg/µL12.92 ±2.30 90.75 ±0.35 + 28.35 ±0.43 +
0.64 pg/µL13.96 ±1.76 91.00 ±0.00 + 30.16 ±0.17 +/−
0.128 pg/µL n/a n/a 32.30 ±0.05 n/a
0.0256 pg/µL n/a n/a 33.53 ±0.64 n/a
5.12 fg/µL n/a n/a n/a n/a
Table 4.
LoD assay (comparison among different methods) based on artificial DNA from WTB frass using serial 1:5 dilutions
(from 10 ng/
µ
L to 2.38 fg/
µ
L) and the real-time LAMP protocol. The end-point PCR (14F/125R) developed in this study
was also evaluated and compared for each dilution.
Dilutions
Real Time LAMP Visual LAMP qPCR Probe P. juglandis
(Rizzo et al., 2020a) End-Point PCR
Tamp Means ±SD Positive (+)/-Negative
(−)Cq Means ±SD Positive (+)/-Negative
(−)
10 ng/µL 6.70 ±0.01 + 25.67 ±1.64 +
2.0 ng/µL 7.33 ±0.02 + 28.69 ±1.67 +
0.4 ng/µL 8.11 ±0.06 + 29.05 ±0.34 +
0.08 ng/µL 9.16 ±0.08 + 31.64 ±1.21 +
0.016 ng/µL 9.65 ±0.59 + 33.76 ±1.47 +
3.2 pg/µL 13.59 ±1.38 + 35.64 ±1.74 +
0.64 pg/µL n/a n/a n/a n/a
0.128 pg/µL n/a n/a n/a n/a
0.0256 pg/µL n/a n/a n/a n/a
5.12 fg/µL n/a n/a n/a n/a
Plants 2021, 10, x FOR PEER REVIEW 6 of 16
0.64 pg/µL 13.96 ± 1.76 91.00 ± 0.00 + 30.16 ± 0.17 +/−
0.128 pg/µL n/a n/a 32.30 ± 0.05 n/a
0.0256 pg/µL n/a n/a 33.53 ± 0.64 n/a
5.12 fg/µL n/a n/a n/a n/a
Table 4. LoD assay (comparison among different methods) based on artificial DNA from WTB frass using serial 1:5 dilu-
tions (from 10 ng/µL to 2.38 fg/µL) and the real-time LAMP protocol. The end-point PCR (14F/125R) developed in this
study was also evaluated and compared for each dilution.
Dilutions Real Time LAMP Visual LAMP qPCR Probe P. juglandis
(Rizzo et al., 2020a) End-Point PCR
Tamp Means ±SD Positive (+)/-Negative (−) Cq Means ±SD Positive (+)/-Negative (−)
10 ng/µL 6.70 ± 0.01 + 25.67 ± 1.64 +
2.0 ng/µL 7.33 ± 0.02 + 28.69 ± 1.67 +
0.4 ng/µL 8.11 ± 0.06 + 29.05 ± 0.34 +
0.08 ng/µL 9.16 ± 0.08 + 31.64 ± 1.21 +
0.016 ng/µL 9.65 ± 0.59 + 33.76 ± 1.47 +
3.2 pg/µL 13.59 ± 1.38 + 35.64 ± 1.74 +
0.64 pg/µL n/a n/a n/a n/a
0.128 pg/µL n/a n/a n/a n/a
0.0256 pg/µL n/a n/a n/a n/a
5.12 fg/µL n/a n/a n/a n/a
Figure 2. Capillary electrophoresis using the QIAxcel Capillary Electrophoresis System (QIAgen, Valencia, CA, USA) of
end point PCR carried out with the primers 14F/125R on serial 1:5 dilutions of WTB adult DNA.
Figure 3. LoD assay of visual LAMP based on WTB adults using serial 1:5 dilutions (from 10 ng/µL to 5.12 fg/µL).
Figure 2.
Capillary electrophoresis using the QIAxcel Capillary Electrophoresis System (QIAgen, Valencia, CA, USA) of end
point PCR carried out with the primers 14F/125R on serial 1:5 dilutions of WTB adult DNA.

Plants 2021,10, 1048 7 of 16
Plants 2021, 10, x FOR PEER REVIEW 6 of 16
0.64 pg/µL 13.96 ± 1.76 91.00 ± 0.00 + 30.16 ± 0.17 +/−
0.128 pg/µL n/a n/a 32.30 ± 0.05 n/a
0.0256 pg/µL n/a n/a 33.53 ± 0.64 n/a
5.12 fg/µL n/a n/a n/a n/a
Table 4. LoD assay (comparison among different methods) based on artificial DNA from WTB frass using serial 1:5 dilu-
tions (from 10 ng/µL to 2.38 fg/µL) and the real-time LAMP protocol. The end-point PCR (14F/125R) developed in this
study was also evaluated and compared for each dilution.
Dilutions Real Time LAMP Visual LAMP qPCR Probe P. juglandis
(Rizzo et al., 2020a) End-Point PCR
Tamp Means ±SD Positive (+)/-Negative (−) Cq Means ±SD Positive (+)/-Negative (−)
10 ng/µL 6.70 ± 0.01 + 25.67 ± 1.64 +
2.0 ng/µL 7.33 ± 0.02 + 28.69 ± 1.67 +
0.4 ng/µL 8.11 ± 0.06 + 29.05 ± 0.34 +
0.08 ng/µL 9.16 ± 0.08 + 31.64 ± 1.21 +
0.016 ng/µL 9.65 ± 0.59 + 33.76 ± 1.47 +
3.2 pg/µL 13.59 ± 1.38 + 35.64 ± 1.74 +
0.64 pg/µL n/a n/a n/a n/a
0.128 pg/µL n/a n/a n/a n/a
0.0256 pg/µL n/a n/a n/a n/a
5.12 fg/µL n/a n/a n/a n/a
Figure 2. Capillary electrophoresis using the QIAxcel Capillary Electrophoresis System (QIAgen, Valencia, CA, USA) of
end point PCR carried out with the primers 14F/125R on serial 1:5 dilutions of WTB adult DNA.
Figure 3. LoD assay of visual LAMP based on WTB adults using serial 1:5 dilutions (from 10 ng/µL to 5.12 fg/µL).
Figure 3. LoD assay of visual LAMP based on WTB adults using serial 1:5 dilutions (from 10 ng/µL to 5.12 fg/µL).
Plants 2021, 10, x FOR PEER REVIEW 7 of 16
Figure 4. Capillary electrophoresis using the QIAxcel Capillary Electrophoresis System (QIAgen, Valencia, CA, USA) of
end point PCR carried out with the primers 14F/125R on serial 1:5 dilutions of artificial DNA from WTB frass.
Figure 5. LoD assay of Visual LAMP based on artificial DNA from WTB frass using serial 1:5 dilutions (from 10 ng/µL to
5.12 fg/µL).
3. Discussion
Vectors are fundamental in the epidemiology of many diseases [39,40]. This is espe-
cially true for those diseases caused by pathogens that, like G. morbida, require an active
vector for being successfully introduced into plants. In these pathogen-vector associa-
tions, a prompt detection of the insect vector at an early stage of the invasion process con-
stitutes an important breakthrough, especially in surveillance efforts targeting non-native
species at points-of-entry and initial outbreaks in uninfested areas. Hence, a quick identi-
fication of WTB, allowing for the timely phytosanitary felling of affected plants, could
successfully reduce beetle infestations and thus the amount of TCD. However, correctly
distinguishing P. juglandis is not always straightforward, as this beetle can be mistaken
for bark beetles of similar size; furthermore, distinctive diagnostic features for the
preimaginal stages are also lacking. Morphological identification can therefore be techni-
cally demanding, requiring time and expert personnel. Moreover, when a large number
of samples have to be examined, these checks take on a greater weight [15]. Efficient, high-
performance molecular diagnostic methods that provide accurate non-morphological
identification of WTB would offer new opportunities for effectively managing this EU-
regulated pest complex.
We have developed such a species-specific, highly performing LAMP assay for mon-
itoring P. juglandis, even in the absence of specimens on attacked trees abandoned by bee-
tles. The method has also proven to be effective with only biological traces, such as frass
(average Tamp 12.97 ± 1.06). Moreover, the assay was not affected by the degradation of
the initial matrix. In fact, P. juglandis DNA was positively detected even from frass col-
lected from dry twigs stored for two years at room temperature.
To analyze the presence of targets, accurate and reliable DNA extraction from sample
matrices with different physical and chemical properties are required. Our protocol con-
firmed the effectiveness of our extraction method [31], which provided good and repro-
ducible results with all the tested matrices. Furthermore, our method is quick; up to 24
samples (single insects or frass) could be processed in about an hour. The overall LAMP
Figure 4.
Capillary electrophoresis using the QIAxcel Capillary Electrophoresis System (QIAgen, Valencia, CA, USA) of end
point PCR carried out with the primers 14F/125R on serial 1:5 dilutions of artificial DNA from WTB frass.
Plants 2021, 10, x FOR PEER REVIEW 7 of 16
Figure 4. Capillary electrophoresis using the QIAxcel Capillary Electrophoresis System (QIAgen, Valencia, CA, USA) of
end point PCR carried out with the primers 14F/125R on serial 1:5 dilutions of artificial DNA from WTB frass.
Figure 5. LoD assay of Visual LAMP based on artificial DNA from WTB frass using serial 1:5 dilutions (from 10 ng/µL to
5.12 fg/µL).
3. Discussion
Vectors are fundamental in the epidemiology of many diseases [39,40]. This is espe-
cially true for those diseases caused by pathogens that, like G. morbida, require an active
vector for being successfully introduced into plants. In these pathogen-vector associa-
tions, a prompt detection of the insect vector at an early stage of the invasion process con-
stitutes an important breakthrough, especially in surveillance efforts targeting non-native
species at points-of-entry and initial outbreaks in uninfested areas. Hence, a quick identi-
fication of WTB, allowing for the timely phytosanitary felling of affected plants, could
successfully reduce beetle infestations and thus the amount of TCD. However, correctly
distinguishing P. juglandis is not always straightforward, as this beetle can be mistaken
for bark beetles of similar size; furthermore, distinctive diagnostic features for the
preimaginal stages are also lacking. Morphological identification can therefore be techni-
cally demanding, requiring time and expert personnel. Moreover, when a large number
of samples have to be examined, these checks take on a greater weight [15]. Efficient, high-
performance molecular diagnostic methods that provide accurate non-morphological
identification of WTB would offer new opportunities for effectively managing this EU-
regulated pest complex.
We have developed such a species-specific, highly performing LAMP assay for mon-
itoring P. juglandis, even in the absence of specimens on attacked trees abandoned by bee-
tles. The method has also proven to be effective with only biological traces, such as frass
(average Tamp 12.97 ± 1.06). Moreover, the assay was not affected by the degradation of
the initial matrix. In fact, P. juglandis DNA was positively detected even from frass col-
lected from dry twigs stored for two years at room temperature.
To analyze the presence of targets, accurate and reliable DNA extraction from sample
matrices with different physical and chemical properties are required. Our protocol con-
firmed the effectiveness of our extraction method [31], which provided good and repro-
ducible results with all the tested matrices. Furthermore, our method is quick; up to 24
samples (single insects or frass) could be processed in about an hour. The overall LAMP
Figure 5.
LoD assay of Visual LAMP based on artificial DNA from WTB frass using serial 1:5 dilutions (from 10 ng/
µ
L to
5.12 fg/µL).
3. Discussion
Vectors are fundamental in the epidemiology of many diseases [
39
,
40
]. This is espe-
cially true for those diseases caused by pathogens that, like G. morbida, require an active
vector for being successfully introduced into plants. In these pathogen-vector associations,
a prompt detection of the insect vector at an early stage of the invasion process constitutes
an important breakthrough, especially in surveillance efforts targeting non-native species
at points-of-entry and initial outbreaks in uninfested areas. Hence, a quick identification of
WTB, allowing for the timely phytosanitary felling of affected plants, could successfully
reduce beetle infestations and thus the amount of TCD. However, correctly distinguishing
P. juglandis is not always straightforward, as this beetle can be mistaken for bark beetles of

Plants 2021,10, 1048 8 of 16
similar size; furthermore, distinctive diagnostic features for the preimaginal stages are also
lacking. Morphological identification can therefore be technically demanding, requiring
time and expert personnel. Moreover, when a large number of samples have to be exam-
ined, these checks take on a greater weight [
15
]. Efficient, high-performance molecular
diagnostic methods that provide accurate non-morphological identification of WTB would
offer new opportunities for effectively managing this EU-regulated pest complex.
We have developed such a species-specific, highly performing LAMP assay for mon-
itoring P. juglandis, even in the absence of specimens on attacked trees abandoned by
beetles. The method has also proven to be effective with only biological traces, such as frass
(average Tamp 12.97
±
1.06). Moreover, the assay was not affected by the degradation of
the initial matrix. In fact, P. juglandis DNA was positively detected even from frass collected
from dry twigs stored for two years at room temperature.
To analyze the presence of targets, accurate and reliable DNA extraction from sam-
ple matrices with different physical and chemical properties are required. Our protocol
confirmed the effectiveness of our extraction method [
31
], which provided good and re-
producible results with all the tested matrices. Furthermore, our method is quick; up to
24 samples (single insects or frass) could be processed in about an hour. The overall LAMP
protocol took roughly an hour and a half, from sample preparation to nucleic acid extrac-
tion and isothermal reaction. Amplificability tests to check the efficacy of the extraction
protocols revealed the absence of inhibitors in DNA extracts from either insects or frass.
Performance assays to assess the diagnostic accuracy gave values of 100%. The LAMP test
was highly specific, as confirmed by the absence of cross-reactions with various non-target
species; this result was further corroborated by the 100% correspondence of amplicons to
their homologous sequences. Moreover, the internal blind panel test, performed for both
real-time and visual LAMP, showed a precise correspondence among the results obtained
in the same laboratory by different operators.
In the molecular detection of plant parasites, the determination of analytical sen-
sitivity of the assay is crucial. In our study, analytical sensitivities starting from serial
1:5 dilutions from both WTB adults and insect frass proved high, with limit values of
0.64 pg/
µ
L and 3.2 pg/
µ
L, respectively. These figures fall within the ranges obtained
in similar investigations [
31
,
35
,
36
]. A comparison of the method (both real-time and vi-
sual) with conventional PCR did not reveal significant differences in terms of LoD, in
contrast to similar investigations targeting other organisms [
35
]. This was probably due to
a sound design of end-point PCR primers optimized in SYBR Green qPCR (data not shown).
Conversely, when compared with a qPCR assay that used a hydrolysis probe [
35
], our
new LAMP protocols showed lower analytical sensitivity in assays carried out only with
adult insects: 25.6 fg/
µ
L (qPCR) vs. 0.64 pg/
µ
L (LAMP). The same analytical comparison
could not be performed using P. juglandis frass due to the unavailability of this biological
sample in previous investigations [
31
]. The repetition of the qPCR Probe with the same
samples analyzed in LAMP showed, conversely, a better analytical sensitivity of the LAMP
compared to the first technique. Finally, repeatability and reproducibility proved excellent,
with standard deviation values of inter-run and intra-run variability lower or equal to
0.5 [41].
Our LAMP assays represent valuable tools for quickly gaging the presence of the
P. juglandis beetle/GM pathogen complex, which is moving eastward in North America
and into Eurasia [
12
,
42
,
43
]. On the European and Asian continents this disease complex, in
addition to devastating plantations of the widespread J. nigra, could cause the decline of
J. regia throughout its vast native range, both in urban and orchard landscapes. To prevent
the destruction that this complex has wrought in the United States, it is essential that, in
the recent-introduction areas (Italy), as well as in those that are currently disease-free (the
rest of Europe and Asia), fast, accurate and repeatable diagnostic tools become available
for prompt detection of early outbreaks. These methods will allow surveying for TCD
at regular intervals in quarantined areas and buffer zones, as well as checking plants for
planting and fresh wood with bark (i.e., timber, logs, and firewood).

Plants 2021,10, 1048 9 of 16
Several DNA amplification technologies have been set up for detecting the members of
this insect-fungus complex [
31
,
44
–
46
]. We have developed a cheap isothermal amplification
method that guarantees simplicity, sensitivity, and reproducibility equal or superior to
previous methods. Moreover, it has the great advantage of being portable, so it can easily
be used either at entry points (e.g., ports, airports) or at more general inspection sites (e.g.,
nurseries, loading stations, storage facilities, and wood processing companies). Given these
promising results, we are working on the development of a similar protocol focused on the
fungal partner (GM).
4. Materials and Methods
4.1. Sampling
The investigation was performed on a J. nigra plantation (43
◦
46
0
N, 11
◦
25
0
E, about
115 m above sea level) in the province of Florence (Tuscany, Italy), where an outbreak
of this insect/fungal disease complex had previously occurred [
42
,
43
]. In April 2018,
24 symptomatic samples (small branches, about 26 cm in diameter) were randomly col-
lected from walnut trees throughout the plantation. Branches were checked for the presence
of WTB emergence holes on their surface, then bark was peeled off to check for underbark
tunnels (Figure 6); adult insects were sampled from galleries and stored in 70% ethanol. The
beetle had been previously molecularly identified by end-point PCR amplification [
31
,
42
]
by targeting a portion of the mitochondrial cytochrome oxidase subunit 1 (COI) gene [
47
].
All the collected twig samples were stored at room temperature for about a year and a
half before being further processed. At this time, the phloematic tissue harboring frass
was collected from the twigs and used for the tests. To validate the diagnostic method
developed in the present study, different non-target xylophagous insects were also LAMP
tested (Table 2). These included insects associated with the same host plants and/or species
taxonomically related to the target P. juglandis, whose early developmental stages can be
mistaken for those of WTB. Adults of all species were included in the assay except for
Zeuzera pyrina (Linnaeus) (Lepidoptera: Cossidae), for which only the larvae were tested.
For both the WTB and Xylosandrus compactus (Eichhoff) (Coleoptera, Curculionidae, Scolyti-
nae) the frass was also tested in addition to the adult specimens. Non-WTB adult insects
were likewise stored in 70% ethanol, and all insect adults were identified by morphological
traits [
48
]. In some cases, freshly collected material (adult insects, larvae, or frass) was
directly used for DNA extraction. In other cases, dried samples, stored at the University
of Florence (UF), the Council for Agricultural Research and Economics-Agriculture and
Environment (CREA-AE), and the University of Pisa (UP) were used (storage at 12–16
◦
C,
relative humidity: 50%).
4.2. DNA Extraction
The DNA extraction protocol was performed both on frass (tested fresh and from sam-
ples stored up to two years) and adult insects (Table 2), according to Rizzo et al. [
31
],
with modifications. Collected frass samples (c. 600 mg) were homogenized (15 sec;
30 oscillations/sec) in 10-mL steel jars by using a Mixer Mill MM 200 (Retsch, Torre
Boldone, Italy). DNA extraction was performed by the 2% CTAB extraction method and
was followed by purification [
36
] with the Maxwell
®
RSC PureFood GMO purification
kit and authentication kit provided with the automated purificator MaxWell 16 (Promega,
Madison, WI, USA), according to the manufacturer’s protocol (Catalog number selected:
AS1600). The amount of DNA (ng/
µ
L) and the A260:280 ratios were assessed for each
extract using the QIAxpert spectrophotometer (Qiagen, Hilden, Germany). In addition, to
verify the quality (and the relative amplificability) of the DNA extracted from the insect
and frass samples, a qPCR [
37
] with a probe (18S Universal rRNA) and LAMP [
38
] reaction
(COX gene) were carried out, using 10 ng in both reactions.

Plants 2021,10, 1048 10 of 16
Plants 2021, 10, x FOR PEER REVIEW 9 of 16
4. Materials and Methods
4.1. Sampling
The investigation was performed on a J. nigra plantation (43°46′ N, 11°25′ E, about
115 m above sea level) in the province of Florence (Tuscany, Italy), where an outbreak of
this insect/fungal disease complex had previously occurred [42,43]. In April 2018, 24
symptomatic samples (small branches, about 26 cm in diameter) were randomly collected
from walnut trees throughout the plantation. Branches were checked for the presence of
WTB emergence holes on their surface, then bark was peeled off to check for underbark
tunnels (Figure 6); adult insects were sampled from galleries and stored in 70% ethanol.
The beetle had been previously molecularly identified by end-point PCR amplification
[31,42] by targeting a portion of the mitochondrial cytochrome oxidase subunit 1 (COI)
gene [47]. All the collected twig samples were stored at room temperature for about a year
and a half before being further processed. At this time, the phloematic tissue harboring
frass was collected from the twigs and used for the tests. To validate the diagnostic
method developed in the present study, different non-target xylophagous insects were
also LAMP tested (Table 2). These included insects associated with the same host plants
and/or species taxonomically related to the target P. juglandis, whose early developmental
stages can be mistaken for those of WTB. Adults of all species were included in the assay
except for Zeuzera pyrina (Linnaeus) (Lepidoptera: Cossidae), for which only the larvae
were tested. For both the WTB and Xylosandrus compactus (Eichhoff) (Coleoptera, Curcu-
lionidae, Scolytinae) the frass was also tested in addition to the adult specimens. Non-
WTB adult insects were likewise stored in 70% ethanol, and all insect adults were identi-
fied by morphological traits [48]. In some cases, freshly collected material (adult insects,
larvae, or frass) was directly used for DNA extraction. In other cases, dried samples,
stored at the University of Florence (UF), the Council for Agricultural Research and Eco-
nomics-Agriculture and Environment (CREA-AE), and the University of Pisa (UP) were
used (storage at 12–16 °C, relative humidity: 50%).
Figure 6. Black walnut branches infested by P. juglandis with an indication (red arrows) of the frass
sampling sites.
4.2. DNA Extraction
The DNA extraction protocol was performed both on frass (tested fresh and from
samples stored up to two years) and adult insects (Table 2), according to Rizzo et al. [31],
with modifications. Collected frass samples (c. 600 mg) were homogenized (15 sec; 30 os-
cillations/sec) in 10-mL steel jars by using a Mixer Mill MM 200 (Retsch, Torre Boldone,
Figure 6.
Black walnut branches infested by P. juglandis with an indication (red arrows) of the frass
sampling sites.
4.3. Design of the LAMP and Conventional PCR End-Point Primers
LAMP reactions were carried out using six primers (F3/B3, FIP/BIP, and LoopF/LoopB),
designed to specifically target the 28S ribosomal RNA gene of the WTB isolate PR09-635
(accession number: KP201676.1). Primers (Table 5) were designed using the LAMP De-
signer software (OptiGene Limited, Horsham, UK) and synthesized by Eurofins Genomics
(Ebersberg, Germany). A better view of the annealing sites of the LAMP primers on the
nucleotide sequence, as well as the amplicon produced, is shown in Figure 7.
Table 5.
LAMP primers designed to target WTB DNA. For each primer, the nucleotide position on the reference sequence
is reported.
Primer Name Length (nt) Sequence 50-30Nucleotide Position Product Size (bp) Reference Sequence
Pjug_B3 18
GTCGCAGATCGGTCTTAAG
538-519
160 bp KP201676
Pjug_BIP(B1c + B2) 39
ACATGTTGGCGATCGGACCG
AGAACTCGACAGCTAACAG
446-465
509-489
Pjug_F3 19 TCGATCTAAGGTCCACGG 303-321
Pjug_FIP(F1c + F2) 39
CGGTCGAACGCTCATAGGA
GGTTAACGGACCCGTGAAAT
429-449
350-331
Pjug_LoopB 19 TGCCGATTCTGACATCCG 468-486
Pjug_LoopF 18
AACCGTTCGTATACCGTCG
401-382
Plants 2021, 10, x FOR PEER REVIEW 10 of 16
Italy). DNA extraction was performed by the 2% CTAB extraction method and was fol-
lowed by purification [36] with the Maxwell
®
RSC PureFood GMO purification kit and
authentication kit provided with the automated purificator MaxWell 16 (Promega, Madi-
son, WI, USA), according to the manufacturer’s protocol (Catalog number selected:
AS1600). The amount of DNA (ng/µL) and the A260:280 ratios were assessed for each
extract using the QIAxpert spectrophotometer (Qiagen, Hilden, Germany). In addition, to
verify the quality (and the relative amplificability) of the DNA extracted from the insect
and frass samples, a qPCR [37] with a probe (18S Universal rRNA) and LAMP [38] reac-
tion (COX gene) were carried out, using 10 ng in both reactions.
4.3. Design of the LAMP and Conventional PCR End-Point Primers
LAMP reactions were carried out using six primers (F3/B3, FIP/BIP, and
LoopF/LoopB), designed to specifically target the 28S ribosomal RNA gene of the WTB
isolate PR09-635 (accession number: KP201676.1). Primers (Table 5) were designed using
the LAMP Designer software (OptiGene Limited, Horsham, UK) and synthesized by Eu-
rofins Genomics (Ebersberg, Germany). A better view of the annealing sites of the LAMP
primers on the nucleotide sequence, as well as the amplicon produced, is shown in Figure
7.
Table 5. LAMP primers designed to target WTB DNA. For each primer, the nucleotide position on the reference sequence
is reported.
Primer Name Length
(nt) Sequence 5′-3′ Nucleotide
Position
Product
Size (bp)
Reference
Sequence
Pjug_B3 18 GTCGCAGATCGGTCTTAAG 538-519
160 bp KP201676
Pjug_BIP(B1c + B2) 39 ACATGTTGGCGATCGGACCGAGAACTCGACAGCTAACAG 446-465
509-489
Pjug_F3 19 TCGATCTAAGGTCCACGG 303-321
Pjug_FIP(F1c + F2) 39 CGGTCGAACGCTCATAGGAGGTTAACGGACCCGTGAAAT 429-449
350-331
Pjug_LoopB 19 TGCCGATTCTGACATCCG 468-486
Pjug_LoopF 18 AACCGTTCGTATACCGTCG 401-382
Figure 7. Annealing sites of the LAMP primers on the 28S ribosomal RNA gene sequence of P.
juglandis (accession number, KP201676.1): F3/B3 (black), LoopB/LoopF (purple), B2/F2 (red),
F1c/B1c (blue).
The specificity of the primers was further tested using BLAST
®
(Basic Local Align-
ment Search Tool; http://www.ncbi.nlm.nih.gov/BLAST, accessed on 24 February 2021)
[49]. Moreover, sequences similar to the WTB LAMP amplicon were downloaded from
GenBank and used for alignments to emphasize the in-silico specificity of the primers de-
signed in the study. The alignments were performed using the MAFFT software imple-
mented in Geneious 10.2.6 [50], set with the default parameters (Figure 8).
Figure 7.
Annealing sites of the LAMP primers on the 28S ribosomal RNA gene sequence of P. juglandis (accession number,
KP201676.1): F3/B3 (black), LoopB/LoopF (purple), B2/F2 (red), F1c/B1c (blue).
The specificity of the primers was further tested using BLAST
®
(Basic Local Alignment
Search Tool; http://www.ncbi.nlm.nih.gov/BLAST, accessed on 24 February 2021) [
49
].
Moreover, sequences similar to the WTB LAMP amplicon were downloaded from GenBank

Plants 2021,10, 1048 11 of 16
and used for alignments to emphasize the in-silico specificity of the primers designed in
the study. The alignments were performed using the MAFFT software implemented in
Geneious 10.2.6 [50], set with the default parameters (Figure 8).
Plants 2021, 10, x FOR PEER REVIEW 11 of 16
Figure 8. Partial sequence alignment of the 28S ribosomal RNA gene resulting from the in-silico LAMP amplicon of WTB
(accession number, KP201676.1) and similar sequences of insects present in GenBank. The alignment is displayed here in
three sections to better visualize the differences between the WTB sequence (in yellow) and the homologous sequences.
Figure 8.
Partial sequence alignment of the 28S ribosomal RNA gene resulting from the in-silico LAMP amplicon of WTB
(accession number, KP201676.1) and similar sequences of insects present in GenBank. The alignment is displayed here in
three sections to better visualize the differences between the WTB sequence (in yellow) and the homologous sequences.

Plants 2021,10, 1048 12 of 16
In order to compare the analytical sensibility, specificity, and reliability of the devel-
oped Real Time and visual LAMP protocols, a conventional PCR (end-point) assay was
also developed to detect WTBs (Table 6). Primers for this assay were designed based on the
28S ribosomal RNA gene (accession number: KP201676.1), using the Oligo Architect
TM
Primers and Probe Online software (Sigma–Aldrich, St. Louis, MO, USA) with the follow-
ing specifications: a 100 to 380 bp product size, a Tm (melting temperature) of 55 to 65
◦
C, a
primer length of 18 to 28 bp, and the absence of a secondary structure whenever possible.
Table 6.
Conventional PCR and qPCR protocols used for diagnostic comparisons with the LAMP assay. 1 5
0
-Hexachloro-
Fluorescein-CE Phosphoramidite (HEX); 2 Black Hole Quancher 1 (BHQ1).
Primers Sequence (50-30)Length Annealing Type of Protocol Reference
Pjug_14_F GCATAGTAGGGACCTCACTTAGTG 112 bp 55 ◦CEnd point This study
Pjug_125_R ATAAAGGCATGGGCTGTTACTACA
Pjug_253_F TCCCACGTCTTAATAATATAAG
183 bp 55 ◦CqPCR Probe Rizzo et al., 2020a
Pjug_435_R CTCCTGCTATATGAAGACTA
Pjug_281_P Hex_ACTCTTACCACCATCATTAACATTCCT_BHQ1
4.4. LAMP (Real Time and Visual) and End-Point PCR Assay Optimization
The real-time LAMP reactions were performed using the Isothermal Master Mix (ISO-
001) made by OptiGene Limited (Horsham, UK) on a CFX96 thermocycler (Biorad, Berkeley,
CA, USA) on the samples listed in Table 2. Each isothermal reaction was performed in
duplicate, in a final volume of 20
µ
L and using 2
µ
L of target DNA. Negative controls
(NTC) were included for each reaction. A melting curve was generated by increasing the
temperature from 65
◦
C to 95
◦
C with a 10 s interval every 0.5
◦
C, at the end of the LAMP
reaction [51].
The real-time LAMP reactions (amplification and melting curves) were analyzed by
using the CFX Maestro 1.0 software (Biorad, Hercules, CA, USA). All real-time LAMP
parameters (isothermal amplification time, primer concentration, and annealing temper-
ature (through a thermal gradient)) were evaluated according to Rizzo et al. [
36
]. PCR
products were further analyzed using a QIAxcel Capillary Electrophoresis System (QIAgen,
Valencia, CA, USA) with the inclusion of a 25 bp DNA marker. The QIAxcel system uses
ScreenGel software that determines the base pair number of each amplicon in individual
PCR reactions.
In the visual LAMP protocol, LAMP reactions were carried out in duplicate using the
Bst 3.0 DNA polymerase (New England Biolabs, Ipswich, MA, USA) in a total volume of
20
µ
L. Hydroxynapthol Blue (HNB) was included in the reaction mixture [
52
] so the color
change (from violet to blue) was evaluated at the end of the reaction. Parameters were the
same as the real-time LAMP (above). The visual LAMP product reactions were observed by
the naked eye under natural light and also photographed using a conventional smartphone
camera. If the color changed to light blue the samples were positive, while negative
samples remained purple. Moreover, to verify the occurrence of LAMP amplification
(as performed for real-time LAMP), the LAMP amplicons were analyzed by the QIAxcel
Capillary Electrophoresis System (QIAgen) with the inclusion of a 25 bp DNA marker.
All set-up and executions of LAMP reactions were done in a conventional lab bench
using designated pipettes and filter tips; imaging analysis was performed in separate
rooms. Validation of the conventional PCR assay was carried out by optimizing the primer
concentration (0.4–0.6
µ
M) and annealing temperatures (ranging from 52
◦
C to 60
◦
C).
The target and non-target samples were the same as those used for the LAMP assay. PCR
amplifications were run on a MyCycler thermocycler (Biorad, Hercules, CA, USA); the
products were subsequently analyzed by the QIAxcel Capillary Electrophoresis System
(QIAgen, Hilden, Germany) with the inclusion of a 25 bp DNA marker.

Plants 2021,10, 1048 13 of 16
4.5. Performance Characteristics of the LAMP Assay
Sensitivity, specificity, and accuracy of the real-time and visual LAMP assays were
evaluated after the optimization of the LAMP protocols using the target DNA samples
(Table 2). Samples with a Tamp (time amplification—min:s) value [
27
,
53
] greater than
30 (min:s) were considered negative. In the case of the visual LAMP, the diagnostic
specificity was verified by naked eye assessment of the color change of the reaction
mixture. These parameters are in accordance with the EPPO standards on diagnostics:
PM7/98-4 [54]
. The end-point PCR protocols, designed to evaluate and compare perfor-
mance characteristics of the LAMP assay, were also tested on all target and non-target DNA
samples (Table 2).
4.6. Blind Panel Validation of the Assays
An internal blind panel test was performed on 6 WTB adults, 8 WTB frass samples,
the non-WTB specimens (Table 2), and 4 X. compactus frass samples. The test was carried
out in the laboratory of the Plant Protection Service of Tuscany, Pistoia, Italy, using both
the real-time and visual LAMP protocols, as reported above. Additionally, the conven-
tional end-point PCR was tested by the internal blind panel. All DNA samples had been
previously diluted to a final concentration of 5 ng/
µ
L. Samples were tested in duplicate;
negative controls (No Template Control, NTC) were also included. Based on the blind
panel results, the true positives, false negatives, true negatives, and false positives were
assessed according to the EPPO requirements outlined by PM7/98-4 [54].
4.7. Repeatability and Reproducibility
Repeatability and reproducibility parameters were also assessed in the blind panel
on 8 samples of WTB DNA extracted from frass. The intra-run variation (repeatability)
and the inter-run variation (reproducibility) were assessed through standard parameters,
such as mean, standard deviation, and Tamp (min:s). Eight samples in triplicate, diluted
to a final concentration of 5 ng/
µ
L, were tested in two separate series. The mean value
and standard deviation were calculated for each sample and for each series of samples,
to estimate the repeatability. The reproducibility of each protocol was performed in the
same way: by comparing the data of two series of samples by two operators on different
dates [55,56].
4.8. Limit of Detection (LOD)
The detection limit (LoD) was estimated for each methodology using a 10-fold 1:5
serial dilution (from 10 ng/
µ
L to 2.38 fg/
µ
L). Dilutions were carried out on DNA extracted
from adult insects and frass. In the latter case, an artificial frass DNA (100 ng/
µ
L) was
obtained by adding the frass of another species (X. compactus) to 5 ng/
µ
L of adult WTB
DNA to reach a final concentration of 10 ng/
µ
L, adding 2
µ
L per reaction. A total of
10 dilutions were amplified in triplicate using the real-time and visual LAMP protocols
described above.
4.9. Comparison between Conventional PCR and qPCR
The same serial dilutions used to determine the analytical sensitivity (LoD) of the
LAMP assay were applied to a series of amplifications by end-point PCR and qPCR as a
diagnostic and sensitivity comparison with the LAMP assay designed in this study. Table 6
lists the protocols used for these comparisons.
5. Conclusions
The developed LAMP assay represents a quick, low-cost diagnostic tool for use
during phytosanitary inspections for WTB. It is expected to improve survey programs for
P. juglandis
detection using this new diagnostic strategy, also tracking the WTB through its
biological traces, which would reveal the insect’s previous presence. Our LAMP assay thus

Plants 2021,10, 1048 14 of 16
completes and improves the array of diagnostic protocols currently available to detect the
harmful TCD disease, of which the WTB is the only known vector.
Supplementary Materials:
The following are available online at https://www.mdpi.com/article/
10.3390/plants10061048/s1, Table S1: Tamp means
±
SD for adult and frass samples of P. juglandis.
Table S2. Tamp means ±SD for the samples included in the blind panel.
Author Contributions:
Conceptualization, D.R., D.D.L., U.B., N.L. and C.S.; methodology, D.R.,
D.D.L., U.B., N.L. and C.S.; formal analysis, D.R., D.D.L., N.L., U.B., T.P. and S.M.; investigation, S.M.,
T.P., M.B. and A.B.; resources, S.M., T.P., D.R. and S.O.C.; data curation, D.R., U.B., F.N., S.M. and T.P.;
writing—original draft preparation, D.R., D.D.L., U.B., G.C., S.M., F.N. and T.P.; writing—review and
editing, D.R., S.M., M.B., A.B., U.B., N.L., D.D.L., F.N., G.C., C.S., S.O.C. and T.P.; supervision, S.M.,
T.P. and S.O.C. All authors have read and agreed to the published version of the manuscript.
Funding: This research received no external funding.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement:
The data presented in this study are available on request from the
corresponding author.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Tisserat, N.; Cranshaw, W.; Leatherman, D.; Utley, C.; Alexander, K. Black Walnut Mortality in Colorado Caused by the Walnut
Twig Beetle and Thousand Cankers Disease. Plant Heal. Prog. 2009,10, 10. [CrossRef]
2.
Seybold, S.J.; Dallara, P.L.; Hishinuma, S.M.; Flint, M.L. Detecting and Identifying the Walnut Twig Beetle: Monitoring Guide-
lines for the Invasive Vector of Thousand Cankers Disease of Walnut. 2013. Available online: http://ipm.ucanr.edu/PDF/
PESTNOTES/WTB_trapping.pdf (accessed on 15 January 2021).
3.
Kolaˇrik, M.; Freeland, E.; Utley, C.; Tisserat, N. Geosmithia morbida sp. Nov. A new phytopathogenic species living in simbiosis
with the walnut twig beetle (P. juglandis) on Juglans in USA. Mycologia 2011,103, 325–332. [CrossRef]
4.
Utley, C.; Nguyen, T.; Roubtsova, T.; Coggeshall, M.; Ford, T.M.; Grauke, L.J.; Graves, A.D.; Leslie, C.A.; McKenna, J.;
Woeste, K.; et al
. Susceptibility of Walnut and Hickory Species to Geosmithia morbida.Plant Dis.
2013
,97, 601–607. [Cross-
Ref]
5. Montecchio, L.; Faccoli, M. First Record of Thousand Cankers Disease Geosmithia morbida and Walnut Twig Beetle Pityophthorus
juglandis on Juglans nigra in Europe. Plant Dis. 2014,98, 696. [CrossRef] [PubMed]
6.
Moricca, S.; Bracalini, M.; Benigno, A.; Ginetti, B.; Pelleri, F.; Panzavolta, T. Thousand Cankers Disease Caused by Geosmithia
morbida and Its Insect Vector Pityophthorus juglandis First Reported on Juglans nigra in Tuscany, Central Italy. Plant Dis.
2019
,
103, 369. [CrossRef]
7.
Montecchio, L.; Fanchin, G.; Simonato, M.; Faccoli, M. First Record of Thousand Cankers Disease Fungal Pathogen Geosmithia
morbida and Walnut Twig Beetle Pityophthorus juglandis on Juglans regia in Europe. Plant Dis.
2014
,98, 1445. [CrossRef] [PubMed]
8.
Yaghmour, M.A.; Nguyen, T.L.; Roubtsova, T.V.; Hasey, J.; Fichtner, E.J.; Debuse, C.; Seybold, S.J.; Bostock, R.M. First Report of
Geosmithia morbida on English Walnut and its Paradox Rootstock in California. Plant Dis. 2014,98, 1441. [CrossRef] [PubMed]
9.
Huntley, B.; Birks, H.J.B. An Atlas of Past and Present Pollen Maps for Europe: 0–13 000 B.P.; Cambridge University Press: Cambridge,
UK, 1983.
10.
Pelleri, F.; Castro, G.; Marchi, M.; Fernandez-Moya, J.; Chiararbaglio, P.M.; Giorcelli, A.; Bergante, S.; Gennaro, M.; Manetti, M.C.;
Plutino, M.; et al. The walnut plantations (Juglans spp.) in Italy and Spain: Main factors affecting growth. Ann. Silvic. Res. 2020,
44, 14–23.
11.
Chahal, K.; Gazis, R.; Klingeman, W.; Hadziabdic, D.; Lambdin, P.; Grant, J.; Windham, M. Assessment of Alternative Candidate
Subcortical Insect Vectors From Walnut Crowns in Habitats Quarantined for Thousand Cankers Disease. Environ. Èntomol.
2019
,
48, 882–893. [CrossRef] [PubMed]
12.
Seybold, S.J.; Klingeman, W.; Hishinuma, S.M.; Coleman, T.W.; Graves, A.D. Status and Impact of Walnut Twig Beetle in Urban
Forest, Orchard, and Native Forest Ecosystems. J. For. 2019,117, 152–163. [CrossRef]
13.
Regulation (EU) 2019/2072 of 28 November 2019, Establishing Uniform Conditions for the Implementation of Regulation (EU)
2016/2031 of the European Parliament and the Council, as Regards Protective Measures against Pests of Plants, and Repealing
Commission Regulation (EC) No 690/2008 and Amending Commission Implementing Regulation (EU) 2018/2019. 10.12.2019
Official Journal of the European Union L 319/1. Available online: http://data.europa.eu/eli/reg_impl/2019/2072/2020-10-06
(accessed on 18 January 2021).

Plants 2021,10, 1048 15 of 16
14.
Regulation (EU) 2016/2031 of the European Parliament of the Council of 26 October 2016 on Protective Measures against
Pests of Plants, Amending Regulations (EU) No 228/2013, (EU) No 652/2014 and (EU) No 1143/2014 of the European Parlia-
ment and of the Council and Repealing Council Directives 69/464/EEC, 74/647/EEC, 93/85/EEC, 98/57/EC, 2000/29/EC,
2006/91/EC and 2007/33/EC. OJ L 317 23.11.2016, 4. Available online: http://data.europa.eu/eli/reg/2016/2031/oj (accessed
on 18 January 2021).
15.
Wilstermann, A.; Hoppe, B.; Schrader, G.; DelBianco, A.; Vos, S. Pest survey card on Geosmithia morbida and its vector Pityophthorus
juglandis.EFSA Support. Publ. 2020,17, 1894E. [CrossRef]
16.
Rugman-Jones, P.F.; Hoddle, C.D.; Hoddle, M.S.; Stouthamer, R. The Lesser of Two Weevils: Molecular-Genetics of Pest Palm
Weevil Populations Confirm Rhynchophorus vulneratus (Panzer 1798) as a Valid Species Distinct from R. ferrugineus (Olivier 1790),
and Reveal the Global Extent of Both. PLoS ONE 2013,8, e78379. [CrossRef] [PubMed]
17.
Milosavljevi´c, I.; El-Shafie, H.A.F.; Faleiro, J.R.; Hoddle, C.D.; Lewis, M.; Hoddle, M.S. Palmageddon: The wasting of ornamental
palms by invasive palm weevils, Rhynchophorus spp. J. Pest Sci. 2019,92, 143–156. [CrossRef]
18.
Meurisse, N.; Rassati, D.; Hurley, B.P.; Brockerhoff, E.G.; Haack, R.A. Common pathways by which non-native forest insects
move internationally and domestically. J. Pest Sci. 2019,92, 13–27. [CrossRef]
19.
Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplifica-
tion of DNA. Nucleic Acids Res. 2000,28, E63. [CrossRef] [PubMed]
20.
Notomi, T.; Mori, Y.; Tomita, N.; Kanda, H. Loop-mediated isothermal amplification (LAMP): Principle, features, and future
prospects. J. Microbiol. 2015,53, 1–5. [CrossRef]
21.
Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell.
Probes 2002,16, 223–229. [CrossRef]
22.
Wang, D.; Huo, G.; Ren, D.; Li, Y. Development and evaluation of a loop-mediated isothermal amplification (lamp) method for
detecting Listeria monocytogenes in raw milk. J. Food Saf. 2010,30, 251–261. [CrossRef]
23.
Wang, D.; Zhang, G.; Lu, C.; Deng, R.; Zhi, A.; Guo, J.; Zhao, D.; Xu, Z. Rapid Detection of Listeria monocytogenes in Raw Milk
with Loop-Mediated Isothermal Amplification and Chemosensor. J. Food Sci. 2011,76, M611–M615. [CrossRef]
24.
Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP): Recent progress in research and development.
J. Infect. Chemother. 2013,19, 404–411. [CrossRef]
25.
Blaser, S.; Diem, H.; von Felten, A.; Gueuing, M.; Andreou, M.; Boonham, N.; Tomlinson, J.; Müller, P.; Utzinger, J.; Frey, J.E.; et al.
From laboratory to point of entry: Development and implementation of a LAMP-based genetic identification system to prevent
introduction of quarantine insect species. Pest Manag. Sci. 2018,74, 1504–1512. [CrossRef] [PubMed]
26.
Luchi, N.; Ioos, R.; Santini, A. Fast and reliable molecular methods to detect fungal pathogens in woody plants. Appl. Microbiol.
Biotechnol. 2020,104, 2453–2468. [CrossRef] [PubMed]
27.
Stehlíková, D.; Luchi, N.; Aglietti, C.; Pepori, A.L.; Diez, J.J.; Santini, A. Real-time loop-mediated isothermal amplification assay
for rapid detection of Fusarium circinatum.BioTechniques 2020,69, 11–17. [CrossRef]
28.
Rizzo, D.; Luchi, N.; Da Lio, D.; Bartolini, L.; Nugnes, F.; Cappellini, G.; Bruscoli, T.; Salemi, C.; Griffo, R.V.; Garonna, A.P.; et al.
Development of a loop-mediated isothermal amplification (LAMP) assay for the identification of the invasive wood borer Aromia
bungii (Coleoptera: Cerambycidae) from frass. 3 Biotech 2021,11, 1–12. [CrossRef] [PubMed]
29.
Hsieh, C.-H.; Wang, H.-Y.; Chen, Y.-F.; Ko, C.-C. Loop-mediated isothermal amplification for rapid identification of biotypes
B and Q of the globally invasive pest Bemisia tabaci, and studying population dynamics. Pest Manag. Sci.
2012
,68, 1206–1213.
[CrossRef]
30.
Fekrat, L.; Aghl, M.Z.; Tahan, V. Application of the LAMP Assay as a Diagnostic Technique for Rapid Identification of Thrips
tabaci (Thysanoptera: Thripidae). J. Econ. Èntomol. 2015,108, 1337–1343. [CrossRef]
31.
Rizzo, D.; Da Lio, D.; Bartolini, L.; Cappellini, G.; Bruscoli, T.; Bracalini, M.; Benigno, A.; Salemi, C.; Del Nista, D.;
Aronadio, A.; et al
. A duplex real-time PCR with probe for simultaneous detection of Geosmithia morbida and its vector
Pityophthorus juglandis.PLoS ONE 2020,15, e0241109. [CrossRef]
32.
Kogovšek, P.; Hodgetts, J.; A Hall, J.; Prezelj, N.; Nikolic, P.; Mehle, N.; Lenarˇciˇc, R.; Rotter, A.; Dickinson, M.; Boonham, N.; et al.
LAMP assay and rapid sample preparation method for on-site detection of flavescence dorée phytoplasma in grapevine. Plant
Pathol. 2015,64, 286–296. [CrossRef]
33.
Bracalini, M.; Cerboneschi, M.; Croci, F.; Panzavolta, T.; Tiberi, R.; Biancalani, C.; Macconni, S.; Tegli, S. Alien pest molecular
diagnostics: Can DNA traces be exploited to assess the damage caused by the western conifer seed bug on stone pine fructification?
Bull. Insectology 2015,68, 51–60.
34.
Poland, M.T.; Rassati, D. Improved biosecurity surveillance of non-native forest insects: A review of current methods. J. Pest Sci.
2019,92, 37–49. [CrossRef]
35.
Rizzo, D.; Taddei, A.; Da Lio, D.; Nugnes, F.; Barra, E.; Stefani, L.; Bartolini, L.; Griffo, R.; Spigno, P.; Cozzolino, L.; et al.
Identification of the Red-Necked Longhorn Beetle Aromia bungii (Faldermann, 1835) (Coleoptera: Cerambycidae) with Real-Time
PCR on Frass. Sustainability 2020,12, 6041. [CrossRef]
36.
Rizzo, D.; Taddei, A.; Da Lio, D.; Bruscoli, T.; Cappellini, G.; Bartolini, L.; Salemi, C.; Luchi, N.; Pennacchio, F.; Rossi, E. Molecular
Identification of Anoplophora glabripennis (Coleoptera: Cerambycidae) From Frass by Loop-Mediated Isothermal Amplification. J.
Econ. Èntomol. 2020,113, 2911–2919. [CrossRef] [PubMed]

Plants 2021,10, 1048 16 of 16
37.
Ioos, R.; Fourrier, C.; Iancu, G.; Gordon, T.R. Sensitive Detection of Fusarium circinatum in Pine Seed by Combining an Enrichment
Procedure with a Real-Time Polymerase Chain Reaction Using Dual-Labeled Probe Chemistry. Phytopathology
2009
,99, 582–590.
[CrossRef]
38.
Tomlinson, J.; Dickinson, M.; Boonham, N. Detection of Botrytis cinerea by loop-mediated isothermal amplification. Lett. Appl.
Microbiol. 2010,51, 650–657. [CrossRef] [PubMed]
39.
Purcell, A.H. Insect Vector Relationships with Procaryotic Plant Pathogens. Annu. Rev. Phytopathol.
1982
,20, 397–417. [CrossRef]
40.
Panzavolta, T.; Panichi, A.; Bracalini, M.; Croci, F.; Ginetti, B.; Ragazzi, A.; Tiberi, R.; Moricca, S. Dispersal and Propagule Pressure
of Botryosphaeriaceae Species in a Declining Oak Stand is Affected by Insect Vectors. Forest 2017,8, 228. [CrossRef]
41.
Teter, S.; Steffen, L. Real-Time qPCR: Guidelines for a Comparison of Reagent Performance; Application Note 2020, #AN299; Promega
Corporation: Milan, Italy, 2020.
42.
Moricca, S.; Bracalini, M.; Benigno, A.; Ghelardini, L.; Furtado, E.L.; Marino, C.L.; Panzavolta, T. Observations on the non-native
thousand cankers disease of walnut in Europe’s southernmost outbreak. Glob. Ecol. Conserv. 2020,23, e01159. [CrossRef]
43.
Moricca, S.; Bracalini, M.; Benigno, A.; Ghelardini, L.; Furtado, E.L.; Marino, C.L.; Panzavolta, T. Thousand cankers disease in
Juglans: Optimizing sampling and identification procedures for the vector Pityophthorus juglandis, and the causal agent Geosmithia
morbida.MethodsX 2020,7, 101174. [CrossRef] [PubMed]
44.
Lamarche, J.; Potvin, A.; Pelletier, G.; Stewart, D.; Feau, N.; Alayon, D.I.O.; Dale, A.L.; Coelho, A.; Uzunovic, A.;
Bilodeau, G.J.; et al
. Molecular Detection of 10 of the Most Unwanted Alien Forest Pathogens in Canada Using Real-Time PCR.
PLoS ONE 2015,10, e0134265. [CrossRef]
45.
Oren, E.; Klingeman, W.; Gazis, R.; Moulton, J.; Lambdin, P.; Coggeshall, M.; Hulcr, J.; Seybold, S.J.; Hadziabdic, D. A
novel molecular toolkit for rapid detection of the pathogen and primary vector of thousand cankers disease. PLoS ONE
2018
,
13, e0185087. [CrossRef]
46.
Moore, M.; Juzwik, J.; Miller, F.; Roberts, L.; Ginzel, M.D. Detection of Geosmithia morbida on Numerous Insect Species in Four
Eastern States. Plant Heal. Prog. 2019,20, 133–139. [CrossRef]
47.
Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase
subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994,3, 294–299. [PubMed]
48. Balachowsky, A. Coléoptères scolytides. Faune de France, 50; Librairie de la Facultédes Sciences: Paris, France, 1949; p. 320.
49.
Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol.
1990
,215, 403–410.
[CrossRef]
50.
Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al.
Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data.
Bioinformatics 2012,28, 1647–1649. [CrossRef]
51.
Abdulmawjood, A.; Grabowski, N.; Fohler, S.; Kittler, S.; Nagengast, H.; Klein, G. Development of Loop-Mediated Isothermal
Amplification (LAMP) Assay for Rapid and Sensitive Identification of Ostrich Meat. PLoS ONE 2014,9, e100717. [CrossRef]
52.
Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.-I. Colorimetric detection of loop-mediated isothermal amplification
reaction by using hydroxy naphthol blue. BioTechniques 2009,46, 167–172. [CrossRef]
53. Aglietti, C.; Luchi, N.; Pepori, A.L.; Bartolini, P.; Pecori, F.; Raio, A.; Capretti, P.; Santini, A. Real-time loop-mediated isothermal
amplification: An early-warning tool for quarantine plant pathogen detection. AMB Express 2019,9. [CrossRef]
54.
EPPO (European and Mediterranean Plant Protection Organization). PM 7/98 (4) Specific requirements for laboratories preparing
accreditation for a plant pest diagnostic activity. EPPO Bull. 2019,49, 530–563. [CrossRef]
55.
Dhami, M.K.; Dsouza, M.; Waite, D.W.; Anderson, D.; Li, D. Real time PCR Assay for the Identification of the Brown Marmorated
Stink Bug (Halyomorpha halys). Front. Mol. Biosci. 2016,3, 5. [CrossRef]
56.
Koohkanzade, M.; Zakiaghl, M.; Dhami, M.K.; Fekrat, L.; Namaghi, H.S. Rapid identification of Bactrocera zonata (Dip.: Tephritidae)
using TaqMan real-time PCR assay. PLoS ONE 2018,13, e0205136. [CrossRef]