ArticlePDF Available

Comparative Study of Three DNA-based Information Hiding Methods

Authors:

Abstract

Cryptography is the science of protecting information by transforming data into formats that cannot be recognized by unauthorized users. Steganography is the science of hiding information using different media such as image, audio, video, text, and deoxyribonucleic acid (DNA) sequence. The DNA-based steganography is a newly discovered information security technology characterized by high capacity, high randomization, and low modification rate that leads to increased security. There are various DNA-based methods for hiding information.. In this paper, we compared three DNA-based techniques (substitution, insertion, and complementary) in terms of its capacity, cracking property, Bit Per Nucleotide (BPN), and payload. The selected algorithms combine DNA-based steganography and cryptography techniques. The results show that the substitution technique offers the best BPN for short secret messages and offers the best imperceptibility feature. We also found that both the substitution and the complementary method have a threshold BPN. On the other hand, the insertion method does not have a threshold BPN and it is more difficult to crack.
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 45
Comparative Study of Three DNA-based Information Hiding
Methods
Nisreen Suliman Terkawi nisreenterkawi@gmail.com
Computer Science Department,
Imam Mohammad Ibn Saud
Islamic University
Riyadh, 11564, Saudi Arabia
Lamia Berriche lberriche@psu.edu.sa
Computer Science Department,
Prince Sultan University
Riyadh, 12435, Saudi Arabia
Amjad Ali Alamar aamr@imamu.edu.sa
Computer Science Department,
Imam Mohammad Ibn Saud
Islamic University
Riyadh, 11564, Saudi Arabia
Maimounah Abdurahman Albrahim Maimounah6@gmail.com
Computer Science Department,
Imam Mohammad Ibn Saud
Islamic University
Riyadh, 11564, Saudi Arabia
Wafaa Saad Alsaffar wafaa.alsaffar@gmail.com
Computer Science Department,
Imam Mohammad Ibn Saud
Islamic University
Riyadh, 11564, Saudi Arabia
Abstract
Cryptography is the science of protecting information by transforming data into formats that
cannot be recognized by unauthorized users. Steganography is the science of hiding information
using different media such as image, audio, video, text, and deoxyribonucleic acid (DNA)
sequence. The DNA-based steganography is a newly discovered information security technology
characterized by high capacity, high randomization, and low modification rate that leads to
increased security. There are various DNA-based methods for hiding information.. In this paper,
we compared three DNA-based techniques (substitution, insertion, and complementary) in terms
of its capacity, cracking property, Bit Per Nucleotide (BPN), and payload. The selected algorithms
combine DNA-based steganography and cryptography techniques. The results show that the
substitution technique offers the best BPN for short secret messages and offers the best
imperceptibility feature. We also found that both the substitution and the complementary method
have a threshold BPN. On the other hand, the insertion method does not have a threshold BPN
and it is more difficult to crack.
Keywords: Information Security, Steganography, Substitution, Insertion, Complementary Pair.
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 46
1. INTRODUCTION
The transmission of sensitive information through the Internet faces high risks. Therefore,
exchanging messages between senders and receivers is required to be in a confidential manner
to avoid attacks. Sensitive data protection from unauthorized access is provided by two major
techniques; steganography and cryptography [1]. Cryptography is a technique for preventing third
parties from reading a secret message by converting it to an encrypted format which is
incomprehensible for intruders. Some of the methods applied in the encryption are Playfair,
Rivest Shamir Adleman (RSA), and Advanced Encryption Standard (AES) [2]. Steganography is
a technique of hiding a secret message inside a cover message making it unnoticeable to any
illegal read. The cover media could be text [3], image [4] [5][6], audio [7], video [8], and the
Deoxyribonucleic Acid (DNA) sequence [9]. A double layer of security is provided by some
approaches that combine steganography with cryptography where a secret message is first
encrypted then an encrypted message is hidden in a cover media. They are notable for achieving
confidentiality and low cracking probabilities [10].
Data hiding based on the DNA sequence has been attracting much attention due to its potential
storage capacity [11]. Several DNA steganography approaches have been proposed [12] [13]
[14]. DNA-based steganography relies on three techniques; insertion technique where the secret
message is inserted into the DNA sequence, a complementary technique where some DNA
components are complemented based on the secret message, and the substitution technique
where some DNA components are substituted by the secret message data.
In this paper, we focused on DNA-based steganographic techniques, because it has advantages
such as the huge data storage capacity and the high imperceptibility [6][7][8]. We also compared
three double-layered security techniques: combined DNA-based Playfair cryptography and
substitution technique [15], a combined Playfair cryptography and complementary technique [16],
and a combined XOR-based cryptography and insertion technique [17].
In section 2, we describe how DNA sequences are used for cryptography and steganography. In
section 3, we present the three methods and their performance criteria. In section 4, we present
our results and discussions.
2. DNA-BASED DATA PROTECTION
This section focuses on DNA sequences, DNA-based cryptography, and DNA-based
steganography.
2.1 DNA Sequence
The Deoxyribo Nucleic Acid (DNA) comprises six molecules; a sugar molecule called
deoxyribose, a phosphate molecule, and four different nitrogenous bases (Adenine (A), Thymine
(T), Cytosine (C), and Guanine (G)). These molecules are bound such that two long strands are
twisted around like a ladder. Each strand is made up of units of nucleotides which consists of
three basic molecules: sugar (S), a phosphate (P) group, and one of four nitrogen bases. The
nitrogenous bases are Purines (A and G) and Pyrimidines (T and C). Every DNA can be viewed
as a sequence of bases (AAGTCGATCGATCATCGATCATACGT). Every three adjacent bases
constitute a unit known as the codon which corresponds to a specific amino acid. Exactly 61
codons of the total 64 codes for 20 amino acids. The presence of ‘STARTand ‘STOP’ codons
signal the end of protein synthesis in all living organisms. Each amino acid has a name, an
abbreviation, and a character symbol from the English alphabet, see TABLE 1. DNA sequences
are of a huge size which allows them to provide high embedding capacity to hide the huge data
[18], [19].
DNA sequences can be encoded using a binary code. A 2-bit code representation (00-01-10-11)
is needed to encode the four DNA bases. Consequently, there are 4! =24 code permutations. The
simplest Binary Coding Rule (BCR) to encode the 4 nucleotide bases (A, T, C, G) is: 0(00), 1(01),
2(10), 3(11) respectively [20] .
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 47
TABLE 1: Amino Acids and their Codons.
2.2 DNA Based Cryptography
In 1999, authors of [21] proposed a cryptosystem using DNA. They developed a one-time pad
encryption algorithm using DNA substitution and a bit-wise XOR scheme based on molecular
computation. Going forward, [13] proposed another cryptosystem based on the manipulation of
DNA binary strands. Other symmetric and asymmetric cryptosystems were proposed later [22],
[23]. The Playfair algorithm is symmetric encryption based on substitution technique. The
technique encrypts pairs of letters (bigrams or diagrams) by processing them in plaintext as units
rather than as single letters. The Playfair algorithm uses 5 × 5 matrices of letters constructed
using a keyword known at both the sender and receiver sides. The cipher replaces each pair of
letters in the plaintext with another pair of letters [1]. In [24], they proposed a Playfair encryption
based on amino-acids structures. The authors converted a plaintext message to a binary format
and represented pairs of bits by their nucleoid symbol using the BCR. Afterward, they converted
the DNA sequence to a sequence of amino acids using information presented in TABLE 2.
Further, they encrypted the sequence of letters using a Playfair cipher. The advantage of this
method over the non-DNA-based Playfair is its ability to encrypt messages with letters, numbers,
and special characters. In [25], the authors proposed a DNA-based encryption for cloud storage.
2.3 DNA Based Steganography
DNA-based steganography uses DNA sequence from the National Center for Biotechnology
Information (NCBI) [26] to hide data [12] [13] [27] [28]. DNA steganography starts by converting
the DNA sequence into binary using a BCR code then the binary secret message is hidden in the
DNA sequence using insertion, substitution, or complementary rule method [14]. DNA-based
steganography is also categorized as blind and non-blind. In blind steganography, the secret
message is extracted at the receiver side without the need for prior knowledge of the DNA
reference sequence. The DNA-based steganographic approaches are the insertion,
complementary rule-based, and substitution technique.
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 48
a) Insertion Technique
For this technique, the secret message is inserted in a DNA reference sequence. In [14], the
secret message and the DNA reference sequence were translated into binary. The DNA
sequence and the secret message were divided into equal-sized segments. This allows for easy
insertion of each part of the secret message after each part of the DNA reference. The final
stego-message is then converted into a DNA sequence. The main drawbacks of this technique
are the increase in redundancy and the length of faked DNA which is higher than the length of the
original DNA [14]. In [29], they proposed a technique composed of two phases. In the first phase,
the secret data is encrypted using a DNA and Amino Acids-Based Playfair cipher. While in the
second phase the encrypted data is hidden into some reference DNA sequence using an
insertion technique. Their insertion method is based on dividing both the encrypted DNA
sequence and the reference DNA sequence into segments of a random number of DNA
nucleotides. Then, they insert each segment of encrypted DNA sequence before the segments of
reference DNA sequence respectively.
TABLE 2: Alphabet-Amino Acids Correspondences.
b) Complementary Rule-Based Technique
Here, the secret data is hidden in the DNA reference sequence using a complementary rule for
the nucleotides; for example, ((AC) (CG) (GT) (TA)). In a study conducted by [14], the DNA
sequence was parsed for the longest complimentary substrings. A longer substring of nucleotide
and its complement are further inserted into the DNA sequence before the found complementary
substrings. Afterward, the secret DNA message nucleotide is inserted in special positions that
depend on the position of the complementary substring. An earlier study proposed an RSA
encryption followed by complementary rule-based steganography where the complemented
nucleotides are selected based on a random number [29]. In a previous study [30], the authors
complement the secret message initially converted to a DNA sequence. Then, they select a DNA
reference sequence that should be known at the receiver side. They form a message which is a
sequence number where the numbers correspond to the indexes of the appearance of the pairs
of the nucleotide of the DNA complemented secret message in the selected DNA reference
sequence. In [31], the authors proposed a DNA hiding technique based on complementing the
codon postfix nucleotide.
Amino-Acid Codon
Alphabet
Amino-Acid Codon
Alphabet
UUA, UUG
O
GCU, GCC, GCA, GCG
A
CCU, CCC, CCA, CCG
P
UAA, UGA, UAG
B
CAA, CAG
Q
UGU, UGC
C
CGU, CGC, CGA, CGG
R
GAU, GAC
D
UCU, UCC, UCA, UCG
S
GAA, GAG
E
ACU, ACC, ACA, ACG
T
UUU, UUC
F
AGA, AGG
U
GGU, GGC, GGA, GGG
G
GUU, GUC, GUA, GUG
V
GAU, GAC
H
UGG
W
AUU, AUC, AUA
I
AGU, AGC
X
AAA, AAG
K
UAU
Y
CUU, CUC, CUA, CUG
L
UAC
Z
AUG
M
AAU, AAC
N
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 49
c) Substitution Technique
Regarding the substitution technique, the selected positions in the reference DNA sequence are
substituted by other bases depending on the binary sequence of the secret message [14].
Selected positions may be generated randomly [14], using a lookup substitution table [29], [32],
or using the Least Significant Base (LSB) substitution mechanism [24],[15]. The main advantage
of this technique is preserving the length of the DNA sequence after hiding the secret message.
3. METHODOLOGY
We compared three recent hybrid blind DNA encryption and data hiding techniques [15][17]. The
three methods involves encrypting the secret message and hiding the encrypted message in a
DNA reference sequence. In our deductive approach, we started by comparing the three
approaches performance measures. Further, we conducted experiments with different DNA
reference sequences from the NCBI dataset.
3.1 The Substitution Method [15]
In [15], authors used the DNA-based Playfair method for encryption and the substitution method
for steganography.
FIGURE 1: Sender side of the substitution method in [8].
Initially, the secret message is transformed into its corresponding ASCII code, then to binary
using 8-bits coding. The binary secret message is then converted to a DNA nucleotide using 4-
bits BCR using data presented in TABLE 3 which maps every 4 bits binary message to two 2-bits
DNA nucleotides. The DNA of the secret message is then converted to amino acids. Next,
Playfair with a secret key is used to encrypt the amino acid form of the secret message. Further,
the cipher message is converted back to DNA by selecting a codon corresponding to each amino
acid; the indexes of the codons are stored in an ambiguous message. FIGURE 1 shows the
sender-side architecture.
DNA
Nucleotides
DNA
Nucleotides
Binary
Representation
AA
GG
1000
AC
GA
1001
AG
GC
1010
AT
GT
1011
CC
TT
1100
CA
TA
1101
CG
TC
1110
CT
TG
1111
TABLE 3: 4-bit BCR used in [8].
LSBase
Substitution
Playfair
Encryption
Sender Side Encryption
Message
Fake DNA
Secret Key
Ambiguity
Encrypted
Msg
DNA Sequence
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 50
After encrypting the message, the steganography process starts by using LSBase substitution
[24]. The LSBase method hides the secret message by substituting the least significant base of
each codon in the reference DNA sequences. Both the ciphered DNA message and the ambiguity
message are converted back to binary representation. The ciphered DNA message conversion
uses 4-bits BCR. Then, they hide the binary ciphered DNA message bits and the binary ambiguity
bits in the reference sequence. If LSBase is a purine base, it is substituted by (G) to encode 1 of
the secret messages or (A) to encode 0. If the LSBase is a pyrimidine base, it is substituted by
(C) to encode 1 of the secret messages or (U) to encode 0. The innovation idea 3:1 ratio is used
to hide 3 bits of binary cipher message followed by 1 bit of binary ambiguity.
At the receiver side, first, the ciphered message and ambiguity are extracted using the LSBase
method. Then Playfair decryption using the same secret key is applied, see FIGURE 2. The use
of a 4-bit binary coding rule increases the algorithm security, so the likelihood of making a correct
guess of the binary coding rule is decreased from
 of a 2-bit BCR to
. Also, the use of the 3:1
rule avoids the addition of an indicator message to separate the secret message from the
ambiguous message.
FIGURE 2: Receiver side of the substitution method in [8].
3.2 The Insertion Method [17]
In [17], they used the XOR operation for encryption and the insertion method for steganography.
First, the secret message is converted into ASCII code then into a binary sequence. The binary
sequence of the secret data is split into 8-bit binary segments. An 8-bit key K1 is then XORed
with the first 8 bits of the message. The resulting XOR value is again XORed with the next 8 bits
of the message and so forth. All the results are finally concatenated to form the cipher message.
Afterward, a binary converted DNA sequence is divided into segments using a randomly
generated key K2 which should be a number less than the minimum DNA sequence length and
the secret message length. The binary bits of ciphers are inserted one by one at the beginning of
each segment. The resulting binary sequence is converted into DNA bases using the dictionary
rule and sent as Fake DNA. At the receiver, only the two keys K1 and K2 are needed with the
fake DNA message to extract the secret one. FIGURE3 shows the insertion method sender and
receiver.
Receiver Side Decryption
Encrypted
Msg
Playfair
Decryption
Fake DNA
Message
Ambiguity
Secret Key
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 51
FIGURE3: Sender and receiver of the insertion method in [10].
3.3 The Complement Method [16]
In [16], the authors relied on two layers of techniques to provide higher security. Firstly, they
applied a DNA-based Playfair encryption algorithm followed by a complementary substitution
steganography technique. At the sender side, a DNA-based Playfair cryptography produces a
cipher DNA message and an ambiguity message was adopted. Moving forward, a Generic
Complementary Base Substitution (GCBS), based on TABLE 4, was employed to embed the
cipher message with the ambiguity sequence into a DNA cover sequence. To indicate the end of
the secret message, they embed a palindromic sequence bounded with two nucleotide T after the
message. To preserve the length of the DNA sequence, the resultant DNA sequence from the
previous step was truncated. Their GCBS doubles the embedding capacity compared to [14]. The
final resultant DNA-sequence was inserted into the original one using the insertion method [14].
This step aims to provide the receiver with the reference sequence.
The receiver extracts the reference sequence first, locates the palindrome, and extracts the
embedded message by comparison with the previously obtained reference sequence. Finally, it
decrypts the message using Playfair deciphering module, see FIGURE 4.
Base
Generic Complement
A
C
C
T
G
A
T
G
TABLE 4: Complementary Rule.
K2
Insertion
XOR
Sender Side
Message
Fake DNA
K1
XOR
Extraction
Fake DNA
Encrypted
Msg
K2
K1
Message
Message
Receiver Side
Encrypted
Msg
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 52
FIGURE 4: Sender and Receiver of the Complementary Technique in [9].
3.4 Comparison Criteria
We compared the three proposed hybrid techniques with regards to four parameters; capacity
measure, payload measure, BPN measure, and cracking probability measure.
a) Capacity
Defined in [14] as the total length of increased DNA sequence after the insertion of the secret
information. In line with [15], the cipher message and ambiguity bits substitute DNA reference
sequence nucleotide, so the capacity is equal to the length of the DNA reference sequence . In
[16], a DNA sequence hides as much message nucleotide as its length, and the DNA sequence
with the embedded secret message is inserted in itself. So, the capacity in [16] is   . In [17],
every two bits of the secret message are converted to a nucleotide and inserted into the DNA
reference sequence. So, the capacity is equal to +
where is the DNA reference
sequence length and is the secret message length in bits.
b) Payload
Defined in [14] as the length of the new sequence after the extraction of the reference DNA
sequence. In [15], the DNA reference sequence length is preserved which gives a zero payload
value. As per [16], a DNA sequence embeds as much nucleotide as itself and is embedded in
itself which gives a payload of . On the word of [17], every 2 bits of the secret message are
inserted as a nucleotide in the DNA reference sequence which gives a payload value of
.
c) BPN measure
Defined in [14] as the number of hidden bits per nucleotide.
  
 Eq. 1
On the report of [15], they embed  in nucleotide. Consequently,  
. However,
the used LSBase algorithm can hide only one bit per codon. Consequently, only
codons are
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 53
used for the embedding process. Besides,
of the codons are used for data and
is used to
embed the ambiguity information. So, the maximum bpn is
=
.
In [16], they embed  in nucleotide. Consequently,  
. Each DNA cipher
message nucleotide is hidden in one cover DNA sequence nucleotide. So, 2-bits of data can be
hidden in each nucleotide of a DNA sequence of length ( bits per nucleotide). The
DNA cipher message includes both the encrypted secret message and the ambiguity of the DNA-
based Playfair. Besides, each encrypted secret message codon corresponds to one ambiguity
number. So, ¾ of the DNA sequence is used to embed the secret message whereas ¼ is used
to embed the ambiguity message. So, the threshold BPN is

 =
.
In [17], the total number of hidden bits is |M| and the length of the fake DNA sequence is
|S|+|M|/2. So, the bpn is 

. This method embeds unrestricted length messages into any DNA
sequence.
d) Cracking Probability
The possibility for the intruder to crack the fake DNA to extract the hidden secret depends on the
factors. As reported by [15], there are three pieces of information that the intruder should crack to
extract the secret message namely the DNA reference sequence, binary coding rule, and LSB
substituted permutations. There are 163 million DNA sequences available publicly. For the binary
coding rule, there are 16 pairs (AA, AC, AG….) and each pair can be presented by a sequence of
4 bits, so there are  possibilities to represent the pairs with 4 bits. The least significant base
substitution rule has two possibilities for the pyrimidine substitution and two possibilities for the
purine substitution; 4 possible LSBase substitution rules. Accordingly, the cracking probability of
the technique is


Eq. 2
As stated in [16], the attacker has to find the following information to discover the secret
message: The random number generator, the two seeds used in the insertion phase, the
complementary rule, and the binary coding rule. The total number of possible seeds is  
[16], where is the length of the DNA sequence in bits. There are 6 possibilities of
complementary rules such that Each nucleotide is encoded with two bits,
so the possible number to encode the 4 nucleotides is . Accordingly, the cracking probability is
 
 Eq. 3
According to [17], the attacker needs the following information to crack the secret message: The
DNA sequence, the binary coding scheme, the sizes of the secret message and the prefix DNA,
the keys used for the insertion phase, and the XOR combinations. The probability to predict the
reference DNA sequence is
. Each of the 4 nucleotides is encoded with 2 bits. So, the total
number of binary codes is   . For a fake DNA sequence of bits, there are   
possibilities of secret messages of  bits and DNA sequence of bits such that   .
The total number of guesses of segmented DNA message is   [17]. Whereas, the total
number of guesses of the segmented secret message is   [17]. The total number of
possible XOR operations of a key of length 8 bits and a message of length m is  .
Accordingly, the cracking probability of the insertion technique is
 




 Eq. 4
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 54
Measures
Substitution
Method [15]
Complementary
Substitution
Method[16]
Insertion Method[17]
Actual
Capacity
(nucleotide)
|S|
2*|S|
  
Payload
(nucleotide)
0

BPN (bits
per
nucleotide)
 

  
Cracking
Probability

 
 

 

 





is the number of bits in the Fake DNA
sequence.
is the number of bits in the secret
message.
is the number of bits in the reference DNA
sequence.
TABLE 5: Performance criteria of the three methods.
TABLE 5 shows the capacity, payload, BPN, and cracking probability of the three methods. It is
highlighted that the substitution method offers the lowest payload of value 0 which increases the
imperceptibility of its stego-message. On the other hand, the complementary method payload is
constantly equal to and the payload of the insertion method depends on the message length.
This makes the later method more perceptible than the others. Also, we notice that the
substitution method offers a higher bpn. But the later method embeds secret message bits only in
the lowest significant base, this limits its usage to large DNA sequences. Especially, as only
is dedicated to the embedding of the secret message, the secret message length should not
exceed
. Consequently, a secret message of length is embedded in a DNA sequence of
minimum length  . In the complementary method, only
of the DNA sequence is used for
the secret message embedding which limits its use to DNA sequences of a length exceeding
.
The insertion method does not have any constraint on the length of the DNA sequence.
4. RESULTS AND DISCUSSION
We conducted the experiments of the three methods on the following input: a secret message M
of size 1000 Bytes containing letters, numbers, and special characters. The Playfair secret key is
’SECURITY’. Also, we used eight different DNA reference sequences from the NCBI database to
measure each capacity, payload, and BPN. The National Center for Biotechnology Information
(NCBI) houses a series of databases relevant to biotechnology and biomedicine and is an
important resource for bioinformatics tools and services. Major databases include GenBank for
DNA sequences. All these databases are available online [26].
DNA reference
Number of
nucleotides
Capacity
(nucleotide)
Payload(nucleotide)
BPN
AC153526
200117
200117
0
0.0399766137
AC166252
149814
149814
0
0.0533995488
AC167221
204841
204841
0
0.0390546814
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 55
AC168901
191136
191136
0
0.0418550142
CS236146
118777
118777
0
0.0673531071
JX978467
9270
Short DNA sequence
NC_021114
8870
Short DNA sequence
NC_021116
8958
Short DNA sequence
TABLE 6: Results for Substitution Technique.
DNA reference
Number of
nucleotides
Capacity
(nucleotide)
Payload
(nucleotide)
BPN
AC153526
200117
204117
4000.0
0.0391932078
AC166252
149814
153814
4000.0
0.0520108703
AC167221
204841
208841
4000.0
0.0383066543
AC168901
191136
195136
4000.0
0.0409970482
CS236146
118777
122777
4000.0
0.0651587838
JX978467
9270
13270
4000.0
0.6028636021
NC_021114
8870
12870
4000.0
0.6216006216
NC_021116
8958
12958
4000.0
0.6173792252
TABLE 7: Results for Insertion Technique.
DNA reference
Number of
nucleotides
Capacity
Payload
BPN
AC153526
200117
400234
200117
0.0199883068
AC166252
149814
299628
149814
0.0266997744
AC167221
204841
409682
204841
0.0195273407
AC168901
191136
382272
191136
0.0209275071
CS236146
118777
237554
118777
0.0336765535
JX978467
9270
18540
9270
0.4314994606
NC_021114
8870
17740
8870
0.4509582864
NC_021116
8958
17916
8958
0.4465282429
TABLE 8: Results for Complement Technique.
Concerning TABLE 6, we noticed that the substitution technique proposed in [15] is limited for
use with long DNA sequences. A secret message of length is embedded in a DNA sequence
of minimum length  ; a message of length 8000 bits could be embedded in a DNA sequence
of minimum length 32000 nucleotides.
We observed from TABLE 6, TABLE 7 and TABLE 8 that the payload of the substitution
technique is the lowest (equal to zero). The payload of the insertion method depends on the
secret message length; so it's identical for all the DNA sequences. On the other hand, the
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 56
payload of the complementary technique is the highest as the DNA sequence is embedded into
itself. When the payload is low, the stego-message becomes less perceptible. Hence, the
LSBase substitution technique is the less perceptible technique.
Also, we noticed from TABLE 6, TABLE 7, and TABLE 8 that the substitution technique gives the
highest BPN for the first five DNA sequences whilst the complementary techniques provide the
smallest BPN. The main backdrop of the complementary technique is the fact that the DNA
sequence is inserted into itself thereby doubling the fake DNA sequence size. However, one
advantage of this technique is that only the secret message is hidden into the sequence
compared to the two previous methods where an ambiguous message is also embedded.
The authors [33] compared different DNA-based steganography approaches, blind or non-blind
with and without encryption. Findings from their study did not provide the BPN threshold. In our
study, the BPN measure threshold was computed and the findings showed that the BPN measure
of both the substitution and complementary techniques are upper bounded by a threshold that
limits their embedding capacities.
5. CONCLUSION
Data transfer through the Internet has become necessary and important but the transmission of
sensitive information through the Internet is at high risk. it is unreliable and unsafe. Therefore,
exchanging messages between the sender and receiver is required to be in a confidential manner
to avoid being hacked or susceptible to threats through the internet. Currently, many algorithms
have been extracted in the field of steganography based on DNA to prevent unauthorized access
and increase data security. For that purpose, we compared three blind hybrid steganography
techniques: substitution technique, insertion technique, and complementary technique. We
analyzed the performance of the three techniques. Findings from the study analysis revealed that
the substitution payload was 0 which increases the imperceptibility of the message. We also
noticed that for short secret messages, the substitution technique offers the best BPN. On the
other hand, because of the use of the least significant bases only for the embedding of the secret
message this method is restricted to DNA sequences longer than four times the length of the
message. Also, this method has the highest cracking probability. Besides, we observed that both
the substitution and the complementary methods have a threshold BPN. Unlike the two
aforementioned techniques, the insertion method is unrestrictedly used to embed secret
messages with low cracking probability enabling it to store large messages in DNA sequences.
Nevertheless, the insertion approach is more perceptible than the previous ones as its payload
depends on the secret message length.
6. REFERENCES
[1] W. S. and L. Brown, Computer security: principles and practice, Third. Pearson, 2015.
[2] A. M. Qadir and N. Varol, “A review paper on cryptography,” 7th Int. Symp. Digit. Forensics
Secur. ISDFS 2019, 2019, doi: 10.1109/ISDFS.2019.8757514.
[3] N. Alghamdi and L. Berriche, “Capacity Investigation of Markov Chain-Based Statistical Text
Steganography: Arabic Language Case,” in Proceedings of the 2019 Asia Pacific
Information Technology Conference, 2019, pp. 3743, doi: 10.1145/3314527.3314532.
[4] N. Hamid, A. Yahya, R. B. Ahmad & Osamah, and M. M. Al-Qershi, “Image Steganography
Techniques: An Overview,” Int. J. Comput. Sci. Secur., no. 6, p. 168, 2012.
[5] M. E. Saleh, A. A. Aly, and F. A. Omara, “Enhancing Pixel Value Difference (PVD) Image
Steganography by Using Mobile Phone Keypad (MPK) Coding,” Int. J. Comput. Sci. Secur.,
vol. 9, no. 2, pp. 96107, 2015.
[6] N. Pandian, “An Image Steganography Algorithm Using Huffman and Interpixel Difference
Encoding,” Nithyanandam Pandian Int. J. Comput. Sci. Secur., no. 8, p. 202, 2014.
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 57
[7] S. Mishra, V. K. Yadav, M. C. Trivedi, and T. Shrimali, “Audio steganography techniques: A
survey,” in Advances in Intelligent Systems and Computing, 2018, vol. 554, pp. 581589,
doi: 10.1007/978-981-10-3773-3_56.
[8] S. Raja Ratna, J. B. Shajilin Loret, D. Merlin Gethsy, P. Ponnu Krishnan, and P. Anand
Prabu, “A Review on Various Approaches in Video Steganography,” in Lecture Notes on
Data Engineering and Communications Technologies, vol. 33, Springer, 2020, pp. 626632.
[9] P. Johri, A. Mishra, S. Das, and A. Kumar, “Survey on steganography methods (text, image,
audio, video, protocol and network steganography),” Proc. 10th INDIACom; 2016 3rd Int.
Conf. Comput. Sustain. Glob. Dev. INDIACom 2016, 2016.
[10] M. S. Taha, M. S. Mohd Rahim, S. A. Lafta, M. M. Hashim, and H. M. Alzuabidi,
“Combination of Steganography and Cryptography: A short Survey,” IOP Conf. Ser. Mater.
Sci. Eng., 2019, doi: 10.1088/1757-899X/518/5/052003.
[11] D. Panda, K. A. Molla, M. J. Baig, A. Swain, D. Behera, and M. Dash, “DNA as a digital
information storage device: hope or hype?,” 3 Biotech, vol. 8, no. 5. Springer Verlag, May
01, 2018, doi: 10.1007/s13205-018-1246-7.
[12] C. T. Clelland, V. Risca, and C. Bancroft, “Hiding messages in DNA microdots,” Nature,
1999, doi: 10.1038/21092.
[13] A. Leier, C. Richter, W. Banzhaf, and H. Rauhe, “Cryptography with DNA binary strands,”
BioSystems, 2000, doi: 10.1016/S0303-2647(00)00083-6.
[14] H. J. Shiu, K. L. Ng, J. F. Fang, R. C. T. Lee, and C. H. Huang, “Data hiding methods based
upon DNA sequences,” Inf. Sci. (Ny)., 2010, doi: 10.1016/j.ins.2010.01.030.
[15] G. Hamed, M. Marey, S. A. El-Sayed, and M. F. Tolba, “Hybrid technique for
steganography-based on DNA with n-bits binary coding rule,” Proceedings of the 2015 7th
International Conference of Soft Computing and Pattern Recognition, SoCPaR 2015, 2016.
[16] A. Khalifa, A. Elhadad, and S. Hamad, “Secure blind data hiding into pseudo dna sequences
using playfair ciphering and generic complementary substitution,” Appl. Math. Inf. Sci., 2016,
doi: 10.18576/amis/100427.
[17] P. Malathi, M. Manoaj, R. Manoj, V. Raghavan, and R. E. Vinodhini, “Highly Improved DNA
Based Steganography,” Procedia Computer Science, 2017.
[18] Q. Wang and C. Smith, “Molecular Biology of the Cell (Fifth Edition),” Biosci. Educ., 2008,
doi: 10.3108/beej.11.r4.
[19] “The Structure of DNA.” http://ircamera.as.arizona.edu/Astr2016/text/nucleicacid1.htm
(accessed Mar. 28, 2021).
[20] D. A. Zebari, H. Haron, and S. R. M. Zeebaree, “Security issues in DNA based on data
hiding: A review,” International Journal of Applied Engineering Research. 2017.
[21] J. H. Gehani, A., LaBean, T.H., Reif, “DNA-based Cryptography.,” Proc. 5th DIMACS Work.
DNA Based Comput., 1999.
[22] M. X. Lu, X. J. Lai, G. Z. Xiao, and L. Qin, “Symmetric-key cryptosystem with DNA
technology,” Sci. China, Ser. F Inf. Sci., 2007, doi: 10.1007/s11432-007-0025-6.
[23] X. J. Lai, M. X. Lu, L. Qin, J. S. Han, and X. W. Fang, “Asymmetric encryption and signature
method with DNA technology,” Sci. China, Ser. F Inf. Sci., 2010, doi: 10.1007/s11432-010-
0063-3.
Nisreen Suliman Terkawi, Lamia Berriche, Amjad Ali Alamar, Maimounah Abdurahman Albrahim & Wafaa
Saad Alsaffar
International Journal of Computer Science and Security (IJCSS), Volume (15) : Issue (2) : 2021 58
[24] A. Khalifa, “LSBase: A key encapsulation scheme to improve hybrid crypto-systems using
DNA steganography,” Proceedings - 2013 8th International Conference on Computer
Engineering and Systems, ICCES 2013, 2013.
[25] A. Majumdar, A. Biswas, A. Majumder, S. K. Sood, and K. L. Baishnab, “A novel DNA-
inspired encryption strategy for concealing cloud storage,” Front. Comput. Sci., vol. 15, no.
3, pp. 118, Jun. 2021, doi: 10.1007/s11704-019-9015-2.
[26] “National Center for Biotechnology Information.” https://www.ncbi.nlm.nih.gov/ (accessed
Mar. 28, 2021).
[27] I. Peterson, “Hiding in DNA,” Muse, no. 22, 2001.
[28] B. Shimanovsky, J. Feng, and M. Potkonjak, “Hiding data in DNA,” Lect. Notes Comput. Sci.
(including Subser. Lect. Notes Artif. Intell. Lect. Notes Bioinformatics), 2003, doi: 10.1007/3-
540-36415-3_24.
[29] A. Atito, A. Khalifa, and S. Z. Rida, “DNA-Based Data Encryption and Hiding Using Playfair
and Insertion Techniques,” J. Commun. Comput. Eng., 2011, doi: 10.20454/jcce.2012.242.
[30] A. O. Mohammad Reza Abbasy, Pourya Nikfard and and M. R. N. Torkaman, “DNA Base
Data Hiding Algorithm,” Int. J. New Comput. Archit. Their Appl., vol. 2, no. 1, pp. 183192,
2012.
[31] S. DehiaaKahdum, Ghaith AdillAl-Bawee and M. NsaifJasim, “A Proposed DNA Postfix
Hiding Method,” Int. J. Recent Technol. Eng., vol. 8, no. 4, pp. 1204712051, 2019, doi:
10.35940/ijrte.C5321.118419.
[32] J. S. Taur, H. Y. Lin, H. L. Lee, and C. W. Tao, “Data hiding in DNA sequences based on
table lookup substitution,” Int. J. Innov. Comput. Inf. Control, 2012.
[33] G. Hamed, M. Marey, S. A. El-Sayed, and M. F. Tolba, “Comparative study for various DNA
based steganography techniques with the essential conclusions about the future research,”
Proc. 2016 11th Int. Conf. Comput. Eng. Syst. ICCES 2016, pp. 220225, Jan. 2017, doi:
10.1109/ICCES.2016.7822003.
... Each one of these techniques has its way of implementation, benefits, and limitations. Even hybrid algorithms of these techniques have been proposed to improve upon them [60]. In the attempt of improving the performance of currently used DNA steganography algorithms, a new trend has evolved. ...
Article
Full-text available
In the last two decades, the field of DNA-based steganography has emerged as a promising domain to provide security for sensitive information transmitted over an untrusted channel. DNA is strongly nominated by researchers in this field to exceed other data covering mediums like video, image, and text due to its structural characteristics. Features like enormous hiding capacity, high computational power, and the randomness of its building contents, all sustained to prove DNA supremacy. There are mainly three types of DNA-based algorithms. These are insertion, substitution, and complementary rule-based algorithms. In the last few years, a new generation of DNA-based steganography approaches has been proposed by researchers. These modern algorithms overpass the performance of the old ones either by exploiting a biological factor that exists in the DNA itself or by using a suitable technique available in another field of computer science like artificial intelligence, data structure, networking, etc. The main goal of this paper is to thoroughly analyze these modern DNA-based steganography approaches. This will be achieved by explaining their working mechanisms, stating their pros and cons, and proposing suggestions to improve these methods. Additionally, a biological background about DNA structure, the main security parameters, and classical concealing approaches will be illustrated to give a comprehensive picture of the field.
Conference Paper
Full-text available
Abstract — With the internet having reached a level that merges with our lives, growing explosively during the last several decades, data security has become a main concern for anyone connected to the web. Data security ensures that our data is only accessible by the intended receiver and prevents any modification or alteration of data. In order to achieve this level of security, various algorithms and methods have been developed. Cryptography can be defined as techniques that cipher data, depending on specific algorithms that make the data unreadable to the human eye unless decrypted by algorithms that are predefined by the sender.
Article
Full-text available
The establishment of a secure communication between two communicating parties is becoming a difficult problem due to the likelihood of attacks and other unintentional changes during an active communication over an unsecured network. However, the security of secret information can be secured using either cryptography or steganography. Steganography refers to the practice of concealing a message (with no traceability) in a manner that it will make no meaning to anyone else except the intended recipient, while cryptography, on the other hand, refers to the art of converting a plaintext (message) into an unreadable format. Thus, steganography conceals the existence of a secret message while cryptography alters the message format itself. Both steganographic and cryptographic techniques are powerful and robust. In this paper, the major aim is to review several ways of combining steganographic and cryptographic techniques to achieve a hybrid system. Moreover, some of the differences between cryptographic and steganographic techniques were presented as well.
Article
Full-text available
Information security and confidentiality are a key concern, particularly with the rampant growth and use of the internet. Along with the growth comes the incidents of unauthorized information access which are countered by the use of varied secure communication techniques, namely; cryptography and data hiding. More recent trends are concerned with the application of DNA cryptography and data hiding by using it as a carrier thereby making use of its bio-molecular computational properties. This paper provides a survey of recently published DNA based data hiding algorithms which make use of DNA to safeguard critical data being transmitted over an insecure communication channel. Several DNA-based data hiding techniques will be discussed with particular emphasis on strength and weaknesses of the algorithm in question; algorithms are compared based on the cracking probability, double layer of security, single or double hiding layer, blindness, and much more. This will be useful for future research in the design of more efficient and reliable of secure DNA data hiding techniques.
Article
Full-text available
Steganography facilitates to conceal the confidential information within mediums like image, video, audio, DNA, etc. In this paper, the DNA steganography is developed by using improved DNA insertion algorithm for improving the security to the information. In this paper the modification of the DNA insertion algorithm is used because of its low cracking probability. The confidential information like secret messages and document images are hidden inside the DNA sequence and the performance is measured by calculating the cracking probability, BPN, payload and capacity.
Conference Paper
Full-text available
Information security and confidentiality has become of prime concern and importance as a result of the notifiable and explosive growth of the internet. Also, with the growth of information technology and communication techniques, unauthorized access for sensitive data increases daily. There are a lot of widely used techniques in the communication and computer security fields like; cryptography and steganography to protect sensitive data from attackers. New fields of DNA based cryptography and steganography are emerging to provide data security using DNA as a carrier by exploiting its bio-molecular computational abilities. In this paper, the authors compare various DNA based steganography by using important security parameters with explaining the main DNA based steganography strategies that each one is considered as a building block for most of the other steganographic schemes, which are: The substitution, insertion and complementary pair based algorithms. Finally, on this base some suggestions are given to help future researchers to design or improve the DNA storage techniques for secure data storage through more efficient, reliable, high capacity and biologically preserved DNA steganography techniques.
Article
Over the last few years, the need of a cloud environment with the ability to detect illegal behaviours along with a secured data storage capability has increased largely. This study presents such a secured cloud storage framework comprising of a deoxyribonucleic acid (DNA) based encryption key which has been generated to make the framework unbreakable, thus ensuring a better and secured distributed cloud storage environment. Furthermore, this work proposes a novel DNA-based encryption technique inspired by the biological characteristics of DNA and the protein synthesis mechanism. The introduced DNA based model also has an additional advantage of being able to decide on selecting suitable storage servers from an existing pool of storage servers on which the data must be stored. A fuzzy-based technique for order of preference by similarity to ideal solution (TOPSIS) multi-criteria decision-making (MCDM) model has been employed to achieve the above-mentioned goal. This can decide the set of suitable storage servers and also results in a reduction in execution time by keeping up the level of security to an improved grade. This study also investigates and analyzes the strength of the proposed S-Box and encryption technique against some standard criteria and benchmarks, such as avalanche effect, correlation coefficient, information entropy, linear probability, and differential probability etc. After the avalanche effect analysis, the average change in cipher-text has been found to be 51.85%. Moreover, thorough security, sensitivity and functionality analysis show that the proposed scheme guarantees high security with robustness.
Conference Paper
Nowadays, there is a high motivation to develop techniques of sending secret information as a result of the need to transfer some data in a secret way. Steganography is one of the important techniques in this field. In particular, statistical text steganography is classified as an immune technique against the majority of steganalysis techniques compared to other steganography techniques. On the other hand, although Arabic is the official language of many countries, many steganography techniques remain unexplored for it. In this work, we implemented a Markov Chain (MC) encoder/decoder combined with Huffman Coding (HC) for Arabic text steganography. Additionally, we computed an upper bound and a lower bound for the stego-text length that depends on the designed encoder/decoder parameters. The proposed Arabic steganography technique capacity performance was investigated for different encoder parameters and secret message length. We found that applying some constraints on the MC increases the embedding capacity till it reaches an upper limit floor.
Article
The total digital information today amounts to 3.52 × 10²² bits globally, and at its consistent exponential rate of growth is expected to reach 3 × 10²⁴ bits by 2040. Data storage density of silicon chips is limited, and magnetic tapes used to maintain large-scale permanent archives begin to deteriorate within 20 years. Since silicon has limited data storage ability and serious limitations, such as human health hazards and environmental pollution, researchers across the world are intently searching for an appropriate alternative. Deoxyribonucleic acid (DNA) is an appealing option for such a purpose due to its endurance, a higher degree of compaction, and similarity to the sequential code of 0’s and 1’s as found in a computer. This emerging field of DNA as means of data storage has the potential to transform science fiction into reality, wherein a device that can fit in our palms can accommodate the information of the entire world, as latest research has revealed that just four grams of DNA could store the annual global digital information. DNA has all the properties to supersede the conventional hard disk, as it is capable of retaining ten times more data, has a thousandfold storage density, and consumes 10⁸ times less power to store a similar amount of data. Although DNA has an enormous potential as a data storage device of the future, multiple bottlenecks such as exorbitant costs, excruciatingly slow writing and reading mechanisms, and vulnerability to mutations or errors need to be resolved. In this review, we have critically analyzed the emergence of DNA as a molecular storage device for the future, its ability to address the future digital data crunch, potential challenges in achieving this objective, various current industrial initiatives, and major breakthroughs.