ArticlePDF Available

Figures

Content may be subject to copyright.
477
ISSN 1022-7954, Russian Journal of Genetics, 2021, Vol. 57, No. 4, pp. 477–488. © Pleiades Publishing, Inc., 2021.
Russian Text © The Author(s), 2021, published in Genetika, 2021, Vol. 57, No. 4, pp. 464–477.
Y-Chromosome Haplogroup Diversity
in Khazar Burials from Southern Russia
I. V. Kornienkoa, b, *, T. G. Faleevaa, b, c, d, T. G. Schurre, O. Yu. Aramovaa, c, M. A. Ochir-Goryaevaa,
E. F. Batievaf, E. V. Vdovchenkovc, N. E. Moshkovg, h, i, V. V. Kuk anovaa,
I. N. Ivanovj, Yu. S. Sidorenkob, k, and T. V. Tatarinoval, m, n, o
a Kalmyk Scientific Center of the Russian Academy of Sciences, Elista, 358000 Russia
b Federal Research Center The Southern Scientific Centre of the Russian Academy of Sciences, Rostov-on-Don, 344006 Russia
c Southern Federal University, Rostov-on-Don, 344090 Russia
d 111th Main State Center of Medical Forensic and Criminalistics Examinations, Branch № 2, Rostov-on-Don, 344000 Russia
e The University of Pennsylvania Museum of Archeology and Anthropology, Philadelphia, PA, 19104 USA
f Azov History, Archaeology and Palaeontology Museum-Reserve, Azov, 346780 Russia
g Synthetic and Systems Biology Unit, Biological Research Centre, Szeged, 6726 Hungary
h Doctoral School of Interdisciplinary Medicine, University of Szeged, Szeged, 6720 Hungary
i HSE University, Moscow, 101000 Russia
j North-Western State Medical University named after I.I. Mechnikov, St. Petersburg, 191015 Russia
k National Medical Research Centre for Oncology, Rostov-on-Don, 344037 Russia
l Department of Biology, University of La Verne, La Verne, California, CA, 91750 USA
m Siberian Federal University, Krasnoyarsk, 660041 Russia
n Kharkevich Institute for Information Transmission Problems, Russian Academy of Sciences, Moscow, 127051 Russia
o Vavilov Institute of General Genetics, Russian Academy of Sciences, Moscow, 119991 Russia
*e-mail: ikornienko@yandex.ru
Received May 16, 2020; revised July 12, 2020; accepted August 25, 2020
Abstract—Genetic studies of archaeological burials open up new possibilities for investigating the cultural-
historical development of ancient populations, providing objective data that can be used to investigate the
most controversial problems of archeology. In this work, we analyzed the Y-chromosomes of nine skeletons
recovered from elite burial mounds attributed to the 7th–9th centuries of the Khazar Khaganate in the mod-
ern Rostov region. Genotyping of polymorphic microsatellite loci of the Y chromosome made it possible to
establish that among the nine skeletons studied, three individuals had R1a Y-haplogroup, two had C2b, and
one each had G2a, N1a, Q, and R1b Y-haplogroups. Such results were noteworthy for the mixture of West
Eurasian and East Asian paternal lineages in these samples. The Y-chromosome data are consistent with the
results of the craniological study and genome-wide analysis of the same individuals in showing mixed genetic
origins for the early medieval Khazar nobility. These findings are not surprising in light of the history of the
Khazar Khaganate, which arose through its separation from the Western Turkic Khaganate and establishment
in the North Caucasus and East European steppes.
Keywords: Khazars, East European steppes, burial mounds, ancient DNA, Y-STR, Y-SNP
DOI: 10.1134/S1022795421040049
INTRODUCTION
The Khazar Khaganate arose during the early Mid-
dle Ages of the eastern European steppes [1–4]. Its
influence on the region is reflected in a wide range of
sources, including those written in Arab, Byzantine,
and Khazar [5, 6]. The Khazar Khaganate controlled
the steppes from the Black Sea to the Aral Sea at dif-
ferent periods of its history, with this region extending
from the Caucasus Mountains in the south to the for-
ests of the middle reaches of the Volga and Dnieper
rivers in the north. The steppes of the Lower Volga and
Lower Don rivers were the main territory of the Khaz-
ars, as evidenced by the large accumulation of various
archaeological sites there. These sites include cult
constructions unusual in design and size, such as
Tsimlyanskaya Square, the Blue Mamai pyramid and
the Bolshoi Orlovka barrow [7], and also the agglom-
eration of fortified settlements with powerful defensive
walls of brick and stone (e.g., Sarkel, Right-Bank
HUMAN
GENETICS
478
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
KORNIENKO et al.
Tsimlyanskoye, Kamyshovskoye, recently opened
Bashant-I-II) [8–11].
In this region, a high density of burial mounds dat-
ing to the 7th–9th centuries CE is observed, with
more than 300 funerary monuments being identified.
Among the goods recovered from these burials were
Byzantine coins, which have been used to date the
burials with considerable accuracy. Their location in
the former territory of the Khazar Khaganate has led
scholars to identify these burials as being “Khazar,” as
well as containing the remains of individuals repre-
senting noble warriors [9, 12].
The typological classification of mass serial objects
from these burials is the main method for identifying
the relative chronology of their manufacture, both in
prehistoric and classical periods. For example, based
on the classification of silver belt buckles and the Byz-
antine coins found in it, burial 1 in burial mound 3
from the Verbovy Log-IX group dates back to the rule
of Emperor Justinian II (705–711 CE). Similarly, the
shape and design of the earlier form of the silver buckle
from burial 1in the mound 2 of the Kuteinikov-II
group indicated that it was made in the second half of
the 7th and beginning of the 8th centuries CE. For the
Middle Ages, it is possible to provide typologies of
objects of material culture with absolute dates, based
on presence of coins and the abundance of written
sources. Furthermore, using this typological
approach, fishing rod and stirrups from the mound 37
from the new group were dated to the second half of
the 8th– beginning of the 9th centuries.
An elite military burial was typically placed in its
own mound, with ritual ditches being dug around a
latitudinally oriented grave pit with a lining. The
deceased were stretched out on their backs with their
heads oriented in an east-to-west direction and
accompanied by the symbolic burial of a bridled riding
horse in the form of a scarecrow from a whole
skinned horse head with left foot bone and hooves.
The stuffed animals were placed in the grave pit so
that they imitate the position of a lying horse. An
indicator of high social rank was the diverse inven-
tory of burial goods, including luxury and prestige
items such as metal belts, silver and gilded vessels,
jewelry, and Byzantine gold coins. The latter were
used not for their intended purpose, but rather as sta-
tus objects in the graves [13–19].
Craniological analysis of skulls from these 7th–
9th century CE burial mounds from the Lower Don
and the Lower Volga regions revealed mostly individ-
uals with mixed Asian and European features [20–23].
After examining a series of 86 adults and four children,
Batieva (2002) established the prevalence of skulls
with Asian features (70%). The European component
of the male sample resembled that of representatives
from the synchronous Saltovo-Mayatskaya and, pre-
ceding in time, Sarmatian cultures of the Lower Don
and Lower Volga. The Asian male and female skulls
were most similar to those of the Huns of Transbaika-
lia and the Türkic-speaking nomads of southern Sibe-
ria, the Altai region, and Kazakhstan [23].
In this study, we employed DNA analysis genetic of
human remains to explore the origin and ethnic com-
position of the Khazars of the early Middle Ages. We
analyzed the Y-chromosome variation in skeletons
from rich burials from the late 7th–early 9th centuries
CE through Y-STR and SNP genotyping. While
impossible to provide a full genetic profile of the pop-
ulation of the entire Khazar Khaganate, our study
results have significantly complemented the fragmen-
tary written evidence and limited samples of fine art
available for these burials. Moreover, they provide an
objective basis for studying elite military burials from
the steppe domain territory of the Khazar Khaganate,
as identified from evidence of funerary rites, thereby
clarifying interpretations of them based solely on the
archaeological literature. Moreover, our analysis of
Y-chromosome diversity among Khazar elite burials
supports the conclusion of earlier studies that the
Khazar Khaganate was a multi-ethnic state.
MATERIALS AND METHODS
Samples
For the DNA analysis, we have selected samples
from burial mounds based on chronological charac-
teristics (dating to the 7th–9th centuries), geographi-
cal location (domain territory of the Khazar Khaga-
nate), gender (male) and the degree of bone preserva-
tion (Table 1).
The long tubular bones of nine male skeletons from
elite military burials located in the lower reaches of the
Don River (modern Rostov region) were subject to
ancient DNA analysis (Fig. 1, Table 1).
The following bones were selected for molecular
genetic analysis: the skeleton no. 67—the left
humerus, no. 457—the left ulna, no. 531—the right
tibia and left ulna, no. 619—the left femur, no. 656—
the right the tibia, no. 1251—the left humerus,
no. 1564—the left tibia, no. 1566—the right humerus,
no. 1986—the right humerus and left tibia.
Craniological analysis [31] was previously per-
formed on skeletons nos. 67, 531, 619, 656, 1564, and
1986 [23, 32]. Skeletons nos. 531, 656, and 1564 pos-
sessed a complex of craniometric features of European
individuals, whereas nos. 67 and 619 showed Asian
features. Based on visual inspection (due to the poor
preservation of the skull), skeleton no. 457, also, pre-
sumably, had Asian features, and skeleton no. 1986
exhibited mixed Eurasian features [32]. Skeletons
no s. 1251 and 15 66 ha d no skulls.
Laboratory Facilities
The sample preparation of bones was carried out in
a room that was continuously irradiated for two days
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
Y-CHROMOSOME HAPLOGROUP DIVERSITY IN KHAZAR BURIALS 479
using a five-tube closed-type Desar-7 five-tube irradi-
ator-recirculator (total radiation power was 100 W).
Further, the floors and walls of the room were treated
with a 10% commercial bleach solution containing
active chlorine and left for another day with the
Desar-7 irradiator-recirculator turned on.
Sample Preparation
The samples were processed in a separate room
using personal sterile protective equipment (dispos-
able gowns, masks, hats, and gloves). To minimize the
loss of authentic ancient DNA, the bone surface was
not bleached. Instead, after grinding, the bone powder
was treated with the cell lysis buffer (CLB, a specially
developed lysis solution, that minimizes loss of active
DNA matrix and reduces sample contamination).
This method is based on a unique method of differential
lysis of ancient bone material with simultaneous selective
hydrolysis of modern contaminating DNA [33].
The bone powder was obtained using the following
steps. The surface of the bones was cleaned using a
portable drill PB-01 using sterile cutters separate for
each bone. The bone powder obtained from the sur-
face layer was removed. The milling cutter was then
replaced, and 1 to 2 grams of bone powder was
obtained from the compact layer of each bone. The
powder was transferred into separate sterile 50 mL
tubes. Differential elimination of the possible contam-
ination of modern DNA was performed using a CLB
lysing solution [33]. The subsequent procedure for
decalcification of bone powders was performed by a
single treatment with a solution of 1% sodium dodecyl
sulfate in 0.5 M EDTA, and then twice with a solution
of 0.5 M EDTA.
Isolation of DNA from Bone Powder
DNA was extracted from bone powders through
phenol—organic extraction [34]. Four mL of lyse
solution (10 mM Tris-HCl, pH 8.3; 50 mM KCl;
2.5 mM MgCl2; 0.45% Tween 20), 200 μL Proteinase K
(10 mg/mL) and 100 μL of a 2 M solution of dithioth-
reitol were added to each sample. To control the purity
of the reagents in the process of DNA extraction, a
sample containing the reagents used in the isolation
Table 1. Location, dating and race of the examined skeletons
Bg.—burial ground, “no data”—due to the absence of a skull, the ra cial t yp e of skeletons n os . 12 51 and 15 66 coul d n ot be established.
Skeleton inv. no.
(code of the anthropological
collection)
Location, dating Antropological type
67 Bg. Krivolimansky I, barrow no. 52, burial 1, 9th centuries AD [25].
Martynovsky district, khutor Kryvyi Liman
Asian
457 Bg. Kirovsky V, mound no. 2, burial 1, Khazar time [26].
Martynovsky district, khutor Novosadkovka
Asian?
531 Bg. Podgornensky IV, mound no. 22, burial 1, 8th–9th centuries
AD [27]. Dubovsky district, between khutor Kharseev
and H. Podgornensky
European
619 Bg. Pod gornensky V, mo und no. 5, burial 1, 7th–8th centuries AD
[fourteen]. Dubovsky district, khutor Podgornensky
Asian
656 Bg. Verbovy Log IX, mound no. 3, burial 1, 7th–8th centuries AD
[fourteen]. Dubovsky district, khutor Verbovy Log
European
1251 Bg. Kuteinikov II, mound no. 2, burial 1, end of the 7th–begin-
ning of the 8th centuries AD [28]. Zimovnikovsky district,
st. Kuteinikovskaya
No data
1564 Bg. Frequent barrows, barrow no. 3, burial 1, first half of the
8th century AD [29]. Belokalitvensky district, to the NE
from the station Krasnodonetskaya
European
1566 Bg. Frequent barrows, barrow no. 9, burial 1, first half of the
8th century AD [29]. Belokalitvensky district, st. Krasnodonetskaya
No data
1986 Bg. Talovy, barrow no. 3, bur ial 1, second half of the 8th–early 9th
centuries AD [13, 30]. Oryol district, khutor Kamyshovka
Mixed Eurasian
480
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
KORNIENKO et al.
process (blank sample) was also extracted. After thor-
ough mixing, the samples were incubated at 56°C for
2 h, and then at 40°C for 16 h in a shaker-incubator SI-
300 (JEIOTECH). Following the incubations, an
equal volume of the phenol-chloroform-isoamylol
mixture (25 : 24 : 1) was added and shaken for 40 s on
a vortex at maximum speed. The contents of the tubes
were centrifuged for 10 min at 5000 g. The upper aque-
ous phase was carefully transferred to a sterile 15 mL
tube without affecting the interphase. The phenol-
chloroform-isoamylol extraction procedure was
repeated one more time. An equal volume of the chlo-
roform-isoamylol mixture (24 : 1) was added to the
aqueous solution containing DNA, vortexed for 30 s,
and the contents of the tubes were centrifuged for
10 min at 5000 g. The upper aqueous phase with DNA
was further purified and concentrated using Amicon
Ultra-4, ultracel30k columns. The concentration pro-
cedure was carried out as follows. After washing twice
with sterile deionized water (4 mL each), washed one
more time with sterile TE buffer (4 mL each). The
final volume of purified DNA was ~100 μL. The
DNAs of samples no s. 67, 457, 531, 619, 656, 1251,
Fig. 1. Map of the location of the burials from which the studied anthropological material originates: 1, nos. 67, 2, 457, 3, 5 31, 4,
619, 5, 656, 6, 1251, 7, 1564, 8, 1566, 9, 1986.
60 km0
Rostov-on-Don
12
3
45
6
9
7, 8
Manych
Kagal’nik
Eya
Tuzlov
Mius
Aksai
Don
Don
Sal
Tsimlyansk Reservoir
SEA OF AZOV
Seversky Donets
Derkul
Aidar
Kalitva
Chir
Khoper
Medveditsa
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
Y-CHROMOSOME HAPLOGROUP DIVERSITY IN KHAZAR BURIALS 481
1564, 1566 and 1986 were carried out in three inde-
pendent extractions.
Validation of DNA libraries obtained from samples
67, 531, 619, 65 6, 1251, 15 64, 156 6 a nd 1986 was vali-
dated earlier [24].
Y-Chromosome STR Genotyping
AmpFlSTR Yfiler kit. Amplification of the Y chro-
mosome regions was carried out using the AmpFlSTR
Yfiler kit (Applied Biosystems). This kit contains 17
different STR loci including DYS45 6, DYS389 I,
DYS390, DYS389II, DYS458, DYS19, DYS385 a/b,
DYS393, DYS391, DYS439, DYS635, DYS392, YGATA
H4, DYS437, DYS438. AmpliTaq Gold DNA-Poly-
merase (Applied Biosystems) was added to the com-
mercial reaction mixture in an amount of 1 Unit for
every 10 μL of the polymerase chain reaction (PCR)
mixture. Enzymatic amplification of DNA loci was
carried out using a GeneAmp PCR System 9700 ther-
mal cycler (Applied Biosystems) in an emulation
mode of 1°C/s for 30 cycles.
The amplified samples were read on an ABI
PRISM 3130xl DNA Analyzer (Applied Biosystems).
The injection of samples was carried out at a voltage of
2.0 kV for 13 s. Processing of the results and identifica-
tion of alleles was performed using the GeneMapper
ID program (version 3.2). Typing of DNA prepara-
tions of samples nos. 67, 619, 1564, and 1566 was per-
formed in 6 parallels; samples no. 457 and 531—in 7 par-
allels; sample no. 1251—in 4 parallels; sample 656— in
5 parallels; sample number 1986 – in 9 parallels.
CordYs kit. Amplification of the Y chromosome
regions was carried out using the CordYs kit (Gordiz).
This kit contains the DYS 19, DYS 38 9I, DYS 38 9II,
DYS390, DYS391, DYS392, DYS393, DYS385a,
DYS385b, DYS438, DYS439, DYS437, DYS447,
DYS576, DYS449, DYS456, DYS448, DYS635 loci.
SynTaq DNA polymerase (Synthol) was additionally
added to the commercial reaction mixture in an
amount of 1 Unit for every 10 μL of the PCR mixture.
The Y-STR loci were PCR amplified using a Gene-
Amp PCR System 9700 thermal cycler (Applied Bio-
systems) in an emulation mode of 1°C/s (the heating
rate from 60 to 72°C was set as 0.3°C/1 s) for 30 cycles.
All samples were read on an ABI PRISM 3130xl
DNA analyzer (Applied Biosystems). The injection of
samples was carried out at a voltage of 3.0 kV for 8 s.
The identification of alleles was performed using the
GeneMapper ID program (version 3.2). Typing of
DNA preparations of s am ples nos. 531, 656, 1251, and
1986 was carried out in 3 parallels; samples nos. 67,
619, and 1566 in 4 parallels; sample no. 1564—in 6
parallels; sample no. 457—in 7 parallels.
Haplogroup identification. The haplogroup identifi-
cation of Y-STR haplotypes was performed using the
YHRD reference database [35, 36]. Haplotypes were
evaluated using the Haplogroup Predictor online pro-
gram [37–39] and the Y-DNA Haplogroup Predictor
online program NEVGEN [40].
SNP Genotyping Using SnaPshot
Confirmation of haplogroups detected using the
online Haplogroup Predictor tool [39] was by additional
genotyping using pairs of primers listed in Table 2.
To confirm the presence of one or another hap-
logroup in the studied bone remains predicted using
the online program “Haplogroup Predictor” [39],
additional SNP studies were carried out using the
selected primer pairs shown in Table 2.
PCR amplifications were performed using a Gene-
Amp PCR System 9700 thermal cycler (Applied Bio-
systems) at Ramp = max for 40 cycles using the fol-
lowing program: (1) preliminary incubation at 95°C
for 4 min; (2) denaturation step at 95°C for 15 s,
annealing stage of primers for 35 s at 60°C (for all but
a pair of primers F12906644/R12906717, for which
the annealing temperature was set to 56°C). The elon-
gation step was conducted at 72°C for 40 s; a subse-
quent incubation step at 72°C for 10 min. The ampli-
fied products were purified from excess deoxynucle-
otide triphosphates and primers using a CleanMag
DNA reagent kit on magnetic particles (Eurogen).
SNP genotyping was performed using the ABI
PRISM SNaPshot Multiplex Kit (Thermo Fisher Sci-
entific). The reaction mixture was prepared as follows
(Table 3).
Amplifications were performed using a GeneAmp
PCR System 9700 thermal cycler (Applied Biosys-
tems) in an emulation mode of 1°C/s for 25 cycles
according to the standard program: (1) preliminary
incubation at 95°C for 1 min; (2) a denaturation step
at 95°C for 10 s, a primer annealing step at 50°C for 5 s,
an elongation step at 60°C for 30 seconds.
Amplification products were purified from excess
fluorescently labeled dideoxynucleotide triphosphates
by incubation at 37°C for 80 min (followed by final
incubation at 80°C for 15 min) with the shrimp alka-
line phosphatase enzyme (Shrimp Alkaline Phospha-
tase, SAP) at the rate of 1 unit SAP per 10 μL of the
mixture. The amplified SNP loci were read on an ABI
PRISM 3130xl DNA analyzer (Applied Biosystems),
using LIZ120 size standards.
RESULTS
The genotyping results for the Y-STR and Y-SNP
loci in nine skeletons from Khazar burial mounds are
provided in Table 4.
As indicated there, three individuals had R1a
Y-chromosome s ( 531, 1251, 1986), two had C2 b
Y-chromosomes (656, 1564), and one each had G2a
(457), N1a (1566), Q (619) and R1b (67) Y-chromo-
somes. This diversity was noteworthy for the mixture
of West Eurasian (G2a, R1a, R1b) and East Asian
482
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
KORNIENKO et al.
(C2b, N1a, Q) lineages present in the burials. There-
fore, these individuals had significantly diverse pater-
nal ancestry.
In terms of the origins of these paternal lineages,
haplogroups R1a and R1b are common in Eurasia [42]
R1a achieves its highest frequency in eastern Europe
[43] and India [44] and whereas R1b is the most com-
mon haplogroup in Western Europe [45] achieving the
highest frequency on British Isles [46] and Basque
population [47], but also spread in the Eastern Europe
and West Asia at lower frequency. Haplogroup C2b is
mainly distributed in Eastern Eurasia [48], but also
Table 2. Determination of Y-haplogroups of Khazar skeletons using SNaPshot typing
bp—base pairs.
No. Tes te d
Y-g ap lo gr ou p SNP Used pair of primers Amplicon
size, bp
1R
M207
position on the Y chromosome—
13470103, substitution of A for G
F13 470 0 73 5'-GGG GCA AAT GTA AGT CAA GC-3'
R13 470 176 5'-TGA CTT CTT TTG CCA ATT AGG T-3' 104
2R1b
M343
position on the Y chromosome—
3019783, substitution of C for A
F3019 714 5'-CGT AGC CCG AGA GAA AAC TG-3'
R3019 831 5'-CCC AAC ACG TGC CTG GCA GC-3' 118
3R1a
M420
position on the Y chromosome—
21311315, repl acement of T by A
F21311266 5'-AAA TGG TGG AAG CAG ATT GG-3'
R21311338 5'-AGC ATC TTT TCA TTG GTT TC-3' 73
4Q
M242
position on the Y chromosome—
129 06671, sub stituti on of C for T
F12906644 5'-TTT GTG CAA AAA GGT GAC CA-3'
R129 0 6 717 5'-CGT TAA AAT AGA TTT TTT TCA A-3' 74
5N
M231
position on the Y chromosome—
13357844, replacement of G by A
F13 357 7 4 4 5'-CTG GAA AAT GTG GGC TCG T-3'
R13 35 7 871 5'-AAT TCT TTG ACG ATC TTT CC-3' 128
Table 3. Composition of the reaction mixture used for staging the SNaPshot reaction
Components Volume, μL
SNaPshot Multiplex Ready Reaction Mix 2.0
BigDye Terminator v1.1 & v3.1 5× Sequencing Buffer (Applied Biosystems™) 2.0
Tail-primer M207 (5 μM)
F 5'-GTA AGT CAA GCA AGA AAT TTA-3'
or
tail-primer M420 (5 μM)
F 5'-GCA AAC TTT TCA TTG CTG GCC TCC A-3'
or
tail-primer M343 (5 μM)
R 5'-CAG CAT AGC CAC CCC CAC ATA TCT CCA GGT GT-3'
or
tail-primer M231 (5 μM)
(T)38 CATTTACTGTTTCTACTGCTTTC
or
tail-primer M242 (5 μM)
(T)53 GTGCAAAAAGGTGACCAAGGTGCT
1.0
Deionized water 3.0
Purified amplicons 2.0
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
Y-CHROMOSOME HAPLOGROUP DIVERSITY IN KHAZAR BURIALS 483
Table 4. Y-haplotypes (DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439,
DYS635, DYS392, YGATA H4, DYS437, DYS438, DYS448, DYS447, DYS576, DYS449) skeletons of Khazarian time bur-
ied in burial mounds on the territory of the Rostov region
Bold and underlined marked loci related to the so-called “minimal haplotype” (Minimal “YHRD” Core Loci); “–”—means that it was
not possible to obtain stable typing results for this locus; “NA”—abbreviated by Null Allele; “*”—Y-haplogroup using SNaPshot
method has not been established; Outdated classification (there is no haplogroup C3 in the new tree) [41].
Locus
No. of skeleton
67 457 531 619 656 1251 1564 1566 1986
DYS 45 6 15 16 16 16 17 15 16 15 15
DYS 389I 14 12 13 13 13 13 13 14 ,15 13
DYS 390 19 23 24 23 24 25 – 23 25
DYS 389II 30 31 30 28 29 31 31 32
DYS 45 8 17 17 16 16 17 15 17 17 16
DYS 19 14 – 16 13 15 16 – 14 16
DYS 385a 13 13 11 13 12 10 12 11 11
DYS 385b 13 14 14 18 15 14 15 13 15
DYS 393 13 14 13 13 13 14 13 14 13
DYS 391 11 10 11 10 10 11 10 11 11
DYS 43 9 14 11 10 12 12 10 12 10 10
DYS 63 5 24 21 23 23 21 23 22 23
DYS 392 13 11 11 16 11 11 11 16 11
GATA H4 11 12 9 11 11 12 11 13
DYS 43 7 15 14 14 14 14 14 14 14 14
DYS 43 8 10 11 11 11 11 11 11 11 11
DYS 44 8 19 20 20 22 NA 20 19 19 20
DYS 44 7 23 23 24 28 30 24 30 26 24
DYS 57 6 16–18181819––18
DYS 44 9 33 31 32 27 29 33 28 32
YHRD Y
Haplogroup
Prediction
R1b G2a R1a Q C3 R1a C3 N R1a
Fitness score 17 38 87 39 61 54 48 57 65
Probability, % 78.5 67.8 100 100 100 100 99.8 100 100
NEVGEN Y
Haplogroup R1b G2a2 R1a Q C2b1a1b1 R1a C2b1a1b1 N1a1 R1a
Fitness score 58.4 34.3 56.4 18.7 43.1 40.2 31 43.7 40.2
Probability, % 99.1 16.5 100 3.6 100 100 99.8 87.4 100
SNaPshot
confirmation R1b * R1a Q * R1a * N R1a
appears throughout Asia, Eastern Siberia, as well as in
the Caucasus and the Middle East males, most likely
due to the spread of Turkic and Mongolic speaking
populations. N1a is common in northern Europe
(Finnish, Balts) as well as western Siberia (Yakuts,
Nganasans, Buryats, and Nenets), from where it likely
expanded [49]. Haplogroups G2a is found in Turkey
[50], the Caucasus region, and the Near East [51]. By
contrast, haplogroup Q is distributed across Central and
East Asia, from which it spread to the America [52].
When compared with the osteological assessments
of the Khazar burials, we did not observe full concor-
dance between the geographic source of Y-chromo-
some haplogroups and the estimated biological ances-
try for these individuals (Table 5).
Indeed, for most of these individuals, there were
seeming contradictions between the two data sets. We
will explore the implications of this non-concordance
in the remainder of this report.
484
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
KORNIENKO et al.
As noted above, through the analysis of the Y-STR
and Y-SNP data, we were able to generate paternal
haplotypes for each Khazar individual (Table 4).
These haplotypes were then compared to published
data to better understand their genetic affinities with
those in contemporary populations. We describe the
details of this comparative analysis below.
We noted a rare mutation in skeleton no. 1566, this
being a duplication of the DYS389I locus (i.e., the
simultaneous presence of alleles 14 and 15). The
mutation was confirmed by genotyping using both the
Yfiler (in three parallel experiments out of five) and
CordYs (in all parallel experiments) systems. In the
YHRD Y-haplotype database [35, 36], this duplication
has been only observed twice before (in Italy and China,
respectively), with the frequency of this duplication being
8.1 × 10–6 (95% CI: 1/1019039–1/34164).
In skeletons nos. 656 and 1564, a rare 30 allele size
was detected at the DYS447 locus. Although the cra-
niological study showed that these skeletons had
European types, this allele almost never occurs in
European populations [53]. Instead, it is observed at a
low frequency in Asian populations, such as Mongols
and Tajiks (where its frequency is 0.0188 and 0.007,
respectively) [54]. Using the algorithms of the online
resource “Haplogroup Predictor” [39], it was estimated
that the Y chromosomes of both skeletons (nos. 656 and
1564) belong to haplogroup C3 (obsolete classifica-
tion), which is mainly found among East Asians [55].
It is also worth noting that, despite the relatively
high yield of DNA from the bone fragments of skele-
ton no. 656, during multi-locus PCR using the Y-filer
and CordYs kits, it was not possible to obtain ampli-
cons of the DYS448 locus. This result probably
reflected a mutation(s) at the site(s) of where the spe-
cific primer annealed. According to the YHRD Y-hap-
lotype database, the Null allele of the DYS448 locus is
quite common, with 729 cases being recorded. This
frequency is 1–2 orders of magnitude higher than the
rest of the studied Y-STR loci.
Using the Haplogroup Predictor online resource
[39], we used data from the 20 Y-STR loci to predict
the presence of haplogroup R in four out of the nine
skeletons. Further studies of the M207, M420, and
M343 SNPs confirmed the results of the Haplogroup
Predictor that the Y-chromosome of the four studied
the skeletons belong to the haplogroup R. One of the
four, sample 67 belonged to R1b haplogroup, while
the remaining three skeletons, nos. 531, 1251 and
1986, belonged to haplogroups R1a.
As a result of the Y-STR typing of skeleton no. 67,
a rare allele 19 of the DYS390 locus was identified.
According to the YHRD database, the frequency of
this rare allele, relatively low at 1.09 × 10–3. This allele
is mainly found in Asian populations such as Kazakhs
(with a frequency of 0.0283), Uzbeks (with a fre-
quency of 0.0227), and Polynesians (with a frequency
of 0.0167) [35, 36]. In addition, the rare allele 14 was
found in skeleton no. 67 at the DYS439 locus. This
allele is mainly found in Southeast Asia and Polyne-
sians w i th fre q u enci e s 0.27 7 8 and 0 .1111, resp e c tive ly,
based on current data sets [35, 36].
According to the YHRD resource [35, 36], the
17-locus Y-filer haplotype of the R1b skeleton no. 67
was found in China, while the minimal 9-locus Y-hap-
lotype (DYS19, DYS389I, DYS389II, DYS390,
DYS391, DYS392, DYS393, DYS385a, DYS385b) is
distributed across Asia in China, and Kazakhstan,
Uzbekistan, Afghanistan (Table 5).
The 17-locus Y-filer haplotype of skeleton no. 531
belonging to R1a is found only in Afghanistan (Table 5).
Its minimal Y-haplotype is also the most common in
Afghanistan, where its frequency reaches 6.5%. By
contrast, the 17-locus Y-haplotypes for the other two
skeletons belonging to haplogroup R1a (nos. 1251 and
1986) were unique to the Y-HRD base. For skeleton
no. 1251, its minimal 9-locus haplotype is unique,
whereas that of skeleton no. 1986 appears at extremely
low frequency in a variety of populations (Indians,
Spaniards, and Chinese (0.049, 0.039, and 0.003%,
respectively).
A further comparison was made with the open
databases FamilyTreeDNA.com, namely with the
projects “R1b and Subclades Project for R1b” [56],
“R1b Basal Subclades” [57], “R-U152 and Subclades
Research Project” [58] for sample no. 67. For samples
nos. 531, 1251, 1986, a comparison was made with the
FamilyTreeDNA.com database “R1a1a and Sub-
clades Y-DNA Project” [59]. The comparison was
performed according to the minimum haplotype
(DYS389I, DYS390, DYS389II, DYS19, DYS385a,
DYS385b, DYS393, DYS391, DYS392). For sample
nos. 67, 22 matches were found in populations across
Eurasia; for no. 531 56 matches from mostly European
countries; and for sample nos. 1251 and 1986, only a
few matches in European countries were made.
DISCUSSION
In this s tudy, we analyzed Y-chromosome variation
in nine Khazar skeletons dating to the late 7th–early
9th centuries CE. Using both Y-STR and Y-SNP
genotyping, we determined haplogroups to which
these individuals belonged, and characterized the hap-
lotypes present in them. Through this work, we
observe the presence of both West Eurasian (G2a,
R1a, R1b) and East Asian (C2, N1a, Q) haplogroups
amongst these nine individuals. Upon comparison
with the anthropological types defined through crani-
ological analysis, we also observe that there are some
inconsistencies in the geographic origin of the Y-chro-
mosome haplogroups, and the biological ancestry
predicted from osteological examinations. These
results speak to the complex genetic ancestry of the
Khazar individuals being studied.
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
Y-CHROMOSOME HAPLOGROUP DIVERSITY IN KHAZAR BURIALS 485
Table 5. Identified matches in the database “YHRD” (April 20, 2020)
“*”—means that the DYS385 locus was not taken into account when calculating the frequencies of the minimum haplotype; “–”—indicates no data.
“YHRD” No. 67 No. 531 No. 1251 No. 1986
Yfiler-haplotype
Number
of matches
in the database
7/246821 3/246821 0/246821 0/246821
Country/
frequency
coincidences
China 7/103994 Afghanistan 3/743
Minimal
haplotype
Number
of matches
in the database
88/307169 255/307169 0/307169
43/307169* 14/307169
Country/
frequency
coincidences
Kazakhstan 15/741 Afghanistan 48/743 Lithuania* 3/634 India 3/6121
Uzbekistan 3/176 Estonia 3/186 Hungary* 3/1641 Spain 2/8369
Afghanistan 3/743 Pakistan 32/3136 Slovakia* 2/1201 China 3/106194
Russian Federation 7/3954 Latvia 2/197 Belgium* 2/1628
China 55/106194 Slovakia 7/1201 Switzerland* 2/1698
Norway 11/1574 India* 5/6121
Great Britain 16/4351 Russian Federation* 2/3954
Poland 19/7974 Poland* 3/7974
Russian Federation 10/3954
– I nd ia 23/ 6121
– Iran 6/2565
––China19/106194
486
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
KORNIENKO et al.
The comparison of these findings with data from
previous genetic studies of these same individuals
helps to illuminate this pattern of diversity. In a previ-
ous genome-wide analysis of the Khazar skeletons
[24], we showed that none of these samples had 100%
West Eurasian genetic ancestry. The percentage of
East As ian ancestry varied f rom 10% (no. 1251) to 75%
(no. 1566). These findings suggested that the Y-chro-
mosome data might show similar patterns of diversity.
Indeed, we found this to be the case. While skeleton
no. 619 had a Y-chromosome haplogroup (Q) consis-
tent with its predicted craniological type, no. 457
(G2a) and 1566 (N1a) seemingly did not. In addition,
the individuals with East Asian haplogroup C2b1a1b1
had European (no. 656) and mixed Eurasian
(no. 1564) craniological types.
This complex pattern of genetic affinities was also
observed in the autosomal data for these samples.
Skeleton no. 656 shows genetic similarities to Bashkirs
and Kirghiz, while no. 1564 is genetically similar to
the Lezgin [24], all populations being of mixed genetic
ancestry. In addition, sample no. 619 showed genetic
affinities with Near East populations, and no. 1566 to
East Asian populations.
In terms of their maternal lineages, samples
nos. 619 and 1564 had West Eurasian mtDNA hap-
logroups (H1a3 and H13c1, respectively), and samples
nos. 656 and 1566 had East Eurasian mtDNA hap-
logroups (C4a1 and D4b1a1a, respectively) [24].
This pattern was consistent for individuals having
Y-chromosomes belonging to haplogroup R (skeletons
nos. 67, 531, 1251, 1986). Of those belonging to hap-
logroup R1a, skeletons nos. 531 and 1251 have a Euro-
pean anthropological type, while skeleton no. 1986 is
classified as a mixed Eurasian type. By contrast, skel-
eton no. 67 belongs to R1b, the most common hap-
logroup in Europe, and exhibits a Asian craniological
type [24].
These Y-chromosome data are consistent with the
autosomal data for the same individuals. Skeleton
no. 67 has close genetic affinities with Kazakhs, Bury-
ats, and Han Chinese [24]. In addition, nos. 531 and
1251 show genetic affinities with Near East popula-
tions, while no. 1986 shows genetic similarities to East
Asian populations.
From a maternal lineage standpoint, samples
nos. 1251 and 531 have mtDNA haplogroups which
are common in Europe, the Caucasus, Turkey, and the
Near East (H5b and X2e respectively). By contrast,
Skeleton no. 1986 has a C4a1c mtDNA which is com-
monly seen in East Asia [24], and no. 67 with Y-chro-
mosome haplogroup R1b has mitochondrial hap-
logroup D4e5 typical for East Asia. Thus, regardless of
the portion of the genome being analyzed, the Khazar
samples showed mixed genetic ancestry [24].
To summarize, the ancient DNA analysis of the
Khazar burials presented in this and our previous
study reveals significant genetic diversity among them.
Our results are not fully consistent with the biological
ancestry predicted from anthropological studies or
their common ethnocultural attribution. This diversity
likely resulted from the ethnic consolidation that
occurred as a result of military and political confeder-
ations of originally diverse tribes during the formation
of the Khazar Khaganate. In fact, the combination of
biological diversity within ethnic-social groups has
been observed since the early Iron Age in eastern Eur-
asia (Siberia, Central, and Central Asia) and from the
first centuries of the Common Era in the Eastern
European steppes [60]. Mixed anthropological types
are also typical of modern peoples, as it can be seen
from recent large-scale genetic studies of modern
Tatars [61]. Thus, we conclude that the early medieval
Khazar nobility had mixed geographic ancestry
reflecting this millennium long process of ethnogene-
sis and population formation.
FUNDING
The study was financially supported by the grant of the
Government of the Russian Federation no. 075-15-2019-
1879 “From paleogenetics to cultural anthropology: a com-
prehensive interdisciplinary study of the traditions of the
peoples of transboundary regions: migration, intercultural
interaction and a world view.” Sample preparation of bio-
logical samples was performed as part of the implementa-
tion of the state task of the SSC RAS, no. gr. Project
01201363186.
COMPLIANCE WITH ETHICAL STANDARDS
Conf lict of interest. The authors declare no conflict of
interest.
Statement of compliance with standards of research involv-
ing humans as subjects. All procedures performed in studies
involving human participants were in accordance with the
ethical standards of the institutional and/or national
research committee and with the 1964 Helsinki declaration
and its later amendments or comparable ethical standards.
REFERENCES
1. Artamonov, M.I., History of the Khazars, Lenindrad:
Hermitage, 1962.
2. Pletneva, S.A., Khazars, Moscow: Nauka, 1976.
3. Novoseltsev, A.P., Khazar State and Its Role in the His-
tory of Eastern Europe and the Caucasus, Moscow: Nau-
ka, 1990.
4. Kalinina, T.M., Khazar Khaganate, Nomadic Empires of
Eurasia: Features of Historical Dynamics, Bazarov, B.V.
and Kradin, N.N., Eds., Moscow: Nauka, 2019,
pp. 214—232.
5. Shorokhov, V.A., Khazar Kaganate and its sphere of in-
fluence in the 9th century (according to “Anonymous
note” and “Book of Ways and Countries” by Ibn Khor-
dadbeh), Proceedings of the Faculty of History of St. Pe-
tersburg University, 2010, pp. 88—98.
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
Y-CHROMOSOME HAPLOGROUP DIVERSITY IN KHAZAR BURIALS 487
6. Ludwig, D., Struktur und Gesellschaft des Chazaren-Re-
iches im Licht der schriftlichen Quellen, Berlin, 1982,
pp. 127—156.
7. Flerov, V.S., Tsimlyansk complex of the Khazar time in
the Lower Don, Volga Archeol., 2015, vol. 1, no. 11,
pp. 4—40.
https://doi.org/10.24852/pa2015.1.11.4.39
8. Flerov, V.S., “Cities” and “Castles” of the Khazar Kaga-
nate: Archaeological Reality, Moscow: Gesharim, 2011.
9. Afanasyev, G.E., About the territory of the Khazar Ka-
ganate and the Khazar “domain” in the 9th century, in
Divnogorsk Collection, Voronezh, 2016, issue 6, pp. 41—
72.
10. Ochir-Goryaeva, M.A., Sitdikov, A.G., Kiyashko, Ya.A.,
and Naga, T., To the study of the monument of the ear-
ly Middle Ages Bashant II, Volga Archeol., 2016, vol. 4,
no. 18, pp. 23—36.
https://doi.org/10.24852/pa2016.4.18.23.36
11. Ochir-Goryaeva, M.A., Sitdikov, A.G., Kekeev, E.A.,
and Burataev, E.G., The first results of archaeological
excavations at the settlement of the early Middle Ages
Bashant-II, Bull. Kalmyk Sci. Cent. Russ. Acad. Sci.,
2017, no. 3 (3), pp. 12—55.
https://doi.org/10.22162/2587-6503-2017-3-3-12-55
12. Afanasyev, G.E. and Atavin, A.G., What is the Khazar
burial rite? (Problems of material, archaeological anal-
ysis and interpretation), in Khazars: Theses of the Sec-
ond International Colloquium, 2002, pp. 11—14.
13. Glebov, V.P. and Ivanov, A.A., Nomadic burial of the
Khazar period from the burial mound Talovy II Don,
Medieval Antiquities of the Don: Materials and Research
on the Archeology of the Don, Gugueva, Yu.K., Ed., Je-
rusalem: Gesharim, 2007, pp. 154—176.
14. Ivanov, A.A. and Kopylov, V.P., Khazar silver belt sets
from the burial mounds between the Don and Sal riv-
ers, Don Archeol., 2000, no. 1, pp. 81—90.
15. Ivanov, A.A., Early medieval sub-kurgan nomadic
burials of the second half of the 7th—first half of the
9th centuries: Lower Don and Volga—Don interfluve,
Cand. Sci. (Hist.) Dissertation, Volgograd: Volgograd
State University, 2000.
16. Ivanov, A.A., Kopylov, V.P., and Naumenko, S.A., Belt
sets from kurgans of the Khazar period between the
Don and Sal rivers, Don Archeol., 2000, no. 1, pp. 84—
85.
17. Kopylov, V.P. and Ivanov, A.A., Burial of a noble war-
rior of the Khazar period from the Salovsky burial
ground, Medieval Prescriptions of the Don: Digest of Arti-
cles, Moscow: Gesharim, 2007, pp. 119—153.
18. Naumenko, V.E., On the question of the formation of
the Khazar Kaganate, Khazar Almanac, Kharkiv, 2004,
vol. 2, pp. 64—70.
19. Naumenko, S.A., Report on research in the construc-
tion zone of the Tsimlyansk irrigation system in 1989,
Archive of the Archaeological Laboratory of the Russian
State University, 1990, F–12, d. 5.
20. Ginzburg, V.V., Anthropological data on the ethnogen-
esis of the Khazars, Soviet Ethnogr., 1946, no. 2,
pp. 81—86.
21. Balabanova, M.A., Features of the anthropological
composition of the burial complexes of the Khazar
time, Some Actual Problems of Modern Anthropology, St.
Petersburg: MAE RAN, 2006, pp. 59—61.
22. Balabanova, M.A., Anthropological structure of the
population of the Khazar time of the Eastern European
steppes, in Population of the South of Russia from Ancient
Times to the Present Day (Don Anthropological Read-
ings), Rostov-on-Don, 2013, pp. 76—79.
23. Batieva, E.F., Anthropology of the population of the
Lower Don region in the Khazar time, Don Archeol.,
2002, nos. 3—4, pp. 71—101.
24. Mikheyev, A.S., Qiu, L., Zarubin, A., et al., Diverse
genetic origins of medieval steppe nomad conquerors,
bioRxiv, 2019.
https://doi.org/10.1101/2019.12.15.876912
25. Savchenko, E.I., Report on the research of archaeolog-
ical sites in the construction zone of the Martynovsk ir-
rigation system in 1981, Archive of the Archaeological
Laboratory of the Russian State University, 1981, F–10,
d. 2/1.
26. Ilyukov, L.S., Report on the study of the burial mound
at Khutor Nonyi in Martynovsky district of the Rostov
region in 1982, Archive of the Archaeological Laboratory
of the Russian State University, 1983, F–10, d–1.
27. Naumenko, S.A., Report on research in the construc-
tion zone of the Tsimlyansk irrigation system in 1986,
Archive of the Archaeological Laboratory of the Russian
State University, 1987, F–12, d–2.
28. Parusimov, I.N., Excavation of burial mounds in the
Zimovnikovsky district: burial ground of Kuteinikov I.I.,
Proceedings of the Novocherkassk Archaeological Expedi-
tion, 1998, no. 3, pp. 15—16.
29 . Il yukov, L.S ., M aks im enko, V.E. , Klyu chn ik ov, V. V.,
and Gurkin, S.V., Investigation of the Lower Don Fre-
quent burial mounds in 2001, Historical and Archaeo-
logical Research in the City of Azov and the Lower Don in
2001, Azov, 2002, issue 18, pp. 162—163.
30. Glebov, V.P., Early medieval burial from the Talovy II
burial mound, Historical and Archaeological Research in
the City of Azov and the Lower Don in 2001, Azov, 2006,
vol. 21, pp. 86—89.
31. Alekseev, V.P. and Debets, G.F., Craniometry, in
Methods of Anthropological Research, Mjscow: Nauka,
1964.
32. Batieva, E.F., Anthropologists of the Khazar burial
from the Talovy II burial ground, Medieval Antiquities of
the Don, Materials and Research on the Archeology of the
Don, Moscow: Gesharim, 2007, issue II, pp. 177—181.
33. Kornienko, I.V., Faleeva, T.G., Makhotkin, M.A.,
et al., An innovative method for extracting ancient
DNA, Azak and the World Around It (Proc. Int. Sci.
Conf., Azov, October 14—18, 2019), 2019, pp. 268—
271.
34. Kornienko, I.V. and Kharlamov, S.G., Human DNA
Research Methods: Isolation of DNA and Its Quantitative
Assessment in the Aspect of Forensic Medical Research of
Material Evidence of Biological Origin: Teaching Aid,
Rostov-on-Don: SFU, 2012.
35. Willuweit, S. and Roewer, L., Y Chromosome Haplo-
type Reference Database (YHRD): update, Forensic
Sci. Int.: Genet., 2007, vol. 1, no. 2, pp. 83—87.
https://d oi.org/10.1016/j.fsig en.2007.01.017
488
RUSSIAN JOURNAL OF GENETICS Vol. 57 No. 4 2021
KORNIENKO et al.
36. Y Chromosome Haplotype Reference Database
(YHRD). https://yhrd.org. Accessed April 20, 2020.
37. Athey, T.W., Haplogroup prediction from Y-STR values
using an allele frequency approach, J. Genet. Geneal.,
2005, vol. 1, pp. 1—7.
38. Emmerova, B., Ehler, E., Comas, D., et al., Compari-
son of Y-chromosomal haplogroup predictors, Forensic
Sci. Int.: Genet. Suppl. Ser., 2017, vol. 6, pp. 145—147.
https://doi.org/10.1016/j.fsigss .2017.09.025
39. Online program Haplogroup Predictor.
http://www.hprg.com/hapest5/index.html. Accessed
April 20, 2020.
40. Online program Y-DNA Haplogroup Predictor—
NEVGEN. https://www.nevgen.org/ Accessed April 20,
2020.
41. International Society of Genetic Genealogy, Y-DNA
Haplogroup C and its Subclades, 2019—2020.
https://docs.google.com/spreadsheets/d/1XTMjVny-
bYFfj4mL1UwzDACTy9fZoJdCbENwdfvKWETQ/ed-
it#gid=928240711. Accessed April 20, 2020.
42. Underhill, P., Poznik, G., Rootsi, S., et al., The phylo-
genetic and geographic structure of Y-chromosome
haplogroup R1a, Eur. J. Hum. Genet., 2015, vol. 23,
pp. 124—131.
https://doi.org/10.1038/ejhg.2014.50
43. Luccote, G., The major Y-chromosome haplotype XI–
haplogroup R1a in Eurasia, Hered. Genet., 2015, vol. 4,
no. 2, p. 1000150.
https://doi.org/10.4172/2161-1041.1000150
44. Sharma, S., Rai, E., Sharma, P., et al., The Indian ori-
gin of paternal haplogroup R1a1* substantiates the au-
tochthonous origin of Brahmins and the caste system,
J. Hum. Genet., 2009, vol. 54, pp. 47—55.
https://doi.org/10.1038/jhg.2008.2
45. Adams, S.M., King, T.E., Bosch, E., and Jobling, M.A.,
The case of the unreliable SNP: recurrent back-muta-
tion of Y-chromosomal marker P25 through gene con-
version, Forensic Sci. Int., 2006, vol. 159, no. 1, pp. 14—
20.
https://doi.org/10.1016/j.forsciint.2005.06.003
46. Helgason, A., Sigurðardóttir, S., Nicholson, J., et al.,
Estimating scandinavian and gaelic ancestry in the
male settlers of Iceland, Am. J. Hum. Genet., 2000,
vol. 67, no. 3, pp. 697—717.
https://doi.org/10.1086/303046
47. Semino, O., Passarino, G., Oefner, P.J., et al., The ge-
netic legacy of paleolithic Homo sapiens sapiens in ex-
tant europeans: a Y chromosome perspective, Science,
2000, vol. 290, no. 5494, pp. 1155—1159.
https://doi.org/10.1126/science.290.5494.1155
48. Wu, Q., Cheng, H., Sun, N., et al., Phylogenetic anal-
ysis of the Y-chromosome haplogroup C2b-F1067, a
dominant paternal lineage in Eastern Eurasia, J. Hum.
Genet., 2020.
https://doi.org/10.1038/s10038-020-0775-1
49. Shi, H., Qi, X., Zhong, H., et al., Genetic evidence of
an East Asian origin and paleolithic northward migra-
tion of Y-chromosome haplogroup N, PLoS One, 2013,
vol. 8, no. 6, p. 66102.
https://doi.org/10.1371/journal.pone.0066102
50. Cinnioğlu, C., King, R., Kivisild, T., et al., Excavating
Y-chromosome haplotype strata in Anatolia, Hum.
Genet., 2004, vol. 114, no. 2, pp. 127—148.
https://doi.org/10.1007/s00439-003-1031-4
51. Rootsi, S., Myres, N.M., Lin, A.A., et al., Distinguish-
ing the co-ancestries of haplogroup G Y-chromosomes
in the populations of Europe and the Caucasus, Eur. J.
Hum. Genet., 2012, vol. 20, no 12, pp. 1275—1282.
https://doi.org/10.1038/ejhg.2012.86
52. Zegura, S.L., Karafet, T.M., Zhivotovsky, L.A., and
Hammer, M.F., High-resolution SNPs and microsatel-
lite haplotypes point to a single, recent entry of native
American Y chromosomes into the Americas, Mol. Biol.
Evol., 2004, vol. 21, no. 1, pp. 164—175.
https://doi.org/10.1093/molbev/msh009
53. Seman, A., Abu Bakar, Z., and Isa, M.N., First Y-short
tandem repeat categorical dataset for clustering appli-
cations, Dataset Pap. Biol., 2013, vol. 2013, article
364725, pp. 1—9.
https://doi.org/10.7167/2013/364725
54. Di Cristofaro, J., Pennarun, E., Mazières, S., et al., Af-
ghan Hindu Kush: where Eurasian sub-continent gene
flows converge, PLoS One, 2013, vol. 8, no. 10,
p. 76748.
https://doi.org/10.1371/journal.pone.0076748
55. Malyarchuk, B., Derenko, M., Denisova, G., et al.,
Phylogeography of the Y-chromosome haplogroup C
in northern Eurasia, Ann. Hum. Genet., 2010, vol. 74,
no. 6, pp. 539—546.
h tt p s :/ / d oi . or g / 10 .1111 /j .1 4 69 - 18 0 9 .2 01 0 .0 0 6 01. x
56. R1b and Subclades Project for R1b. https://www.fami-
lytreedna.com/public/r1b?iframe=yresults. Accessed
April 20, 2020.
57. R1b Basal Subclades. https://www.familytreed-
na.com/public/R1bBasalSubclades?iframe=yresults.
Accessed April 20, 2020.
58. R-U152 and Subclades Research Project.
https://www.familytreedna.com/public/r1b?iframe=
yresults. Accessed April 20, 2020.
59. R1a1a and Subclades Y-DNA Project.
https://www.familytreedna.com/public/R1a?iframe=
yresults. Accessed April 20, 2020.
60. Chikisheva, T.A., Dynamics of Anthropological Differen-
tiation of the Population of the South of Western Siberia in
the Neolithic—Early Iron Age, Novosibirsk: Institut
Arkheologii i Etnografii Sibirskogo Otdeleniya Rossiis-
koi Akademii Nauk, 2012.
61. Balanovskaya, E.V., Agdzhoyan, A.T., Zhabagin, M.K.,
et al., Tatars of Eurasia: the originality of the gene pools
of the Crimean, Volga and Siberian Tatars, Bull. Mos-
cow Univ., Ser. XXIII Anthropol., 2016, no. 2, pp. 75
85.
... Preparation of bone samples and phenol-organic DNA extraction from the obtained bone powder were carried out according to the protocol described earlier [7]. DNA isolation from samples PN-6 (left femur), PN-6 (right tibia), PN-48, and PN-36 was performed in two independent parallels. ...
Preprint
Full-text available
Over millennia, steppe nomadic tribes raided and sometimes overran settled Eurasian civilizations. Most polities formed by steppe nomads were ephemeral, making it difficult to ascertain their genetic roots or what present-day populations, if any, have descended from them. Exceptionally, the Khazar Khaganate controlled the trade artery between the Black and Caspian Seas in VIII-IX centuries, acting as one of the major conduits between East and West. However, the genetic identity of the ruling elite within the polyglot and polyethnic Khaganate has been a much-debated mystery; a controversial hypothesis posits that post-conversion to Judaism the Khazars gave rise to modern Ashkenazim. We analyzed whole-genome sequences of eight men and one woman buried within the distinctive kurgans of the Khazar upper (warrior) class. After comparing them with reference panels of present-day Eurasian and Iron Age populations, we found that the Khazar political organization relied on a polyethnic elite. It was predominantly descended from Central Asian tribes but incorporated genetic admixture from populations conquered by Khazars. Thus, the Khazar ruling class was likely relatively small and able to maintain a genetic identity distinct from their subjugated populations over the course of centuries. Yet, men of mixed ancestry could also rise into the warrior class, possibly providing troop numbers necessary to maintain control of their large territory. However, when the Khaganate collapsed it left few persistent genetic traces in Europe. Our data confirm the Turkic roots of the Khazars, but also highlight their ethnic diversity and some integration of conquered populations.
Article
Full-text available
R1a-M420 is one of the most widely spread Y-chromosome haplogroups; however, its substructure within Europe and Asia has remained poorly characterized. Using a panel of 16 244 male subjects from 126 populations sampled across Eurasia, we identified 2923 R1a-M420 Y-chromosomes and analyzed them to a highly granular phylogeographic resolution. Whole Y-chromosome sequence analysis of eight R1a and five R1b individuals suggests a divergence time of ∼25 000 (95% CI: 21 300-29 000) years ago and a coalescence time within R1a-M417 of ∼5800 (95% CI: 4800-6800) years. The spatial frequency distributions of R1a sub-haplogroups conclusively indicate two major groups, one found primarily in Europe and the other confined to Central and South Asia. Beyond the major European versus Asian dichotomy, we describe several younger sub-haplogroups. Based on spatial distributions and diversity patterns within the R1a-M420 clade, particularly rare basal branches detected primarily within Iran and eastern Turkey, we conclude that the initial episodes of haplogroup R1a diversification likely occurred in the vicinity of present-day Iran.European Journal of Human Genetics advance online publication, 26 March 2014; doi:10.1038/ejhg.2014.50.
Article
Full-text available
The Y-chromosome short tandem repeat (Y-STR) data are mainly collected for a performance benchmarking result in clustering methods. There are six Y-STR dataset items, divided into two categories: Y-STR surname and Y-haplogroup data presented here. The Y-STR data are categorical, unique, and different from the other categorical data. They are composed of a lot of similar and almost similar objects. This characteristic of the Y-STR data has caused certain problems of the existing clustering algorithms in clustering them.
Article
Full-text available
Despite being located at the crossroads of Asia, genetics of the Afghanistan populations have been largely overlooked. It is currently inhabited by five major ethnic populations: Pashtun, Tajik, Hazara, Uzbek and Turkmen. Here we present autosomal from a subset of our samples, mitochondrial and Y- chromosome data from over 500 Afghan samples among these 5 ethnic groups. This Afghan data was supplemented with the same Y-chromosome analyses of samples from Iran, Kyrgyzstan, Mongolia and updated Pakistani samples (HGDP-CEPH). The data presented here was integrated into existing knowledge of pan-Eurasian genetic diversity. The pattern of genetic variation, revealed by structure-like and Principal Component analyses and Analysis of Molecular Variance indicates that the people of Afghanistan are made up of a mosaic of components representing various geographic regions of Eurasian ancestry. The absence of a major Central Asian-specific component indicates that the Hindu Kush, like the gene pool of Central Asian populations in general, is a confluence of gene flows rather than a source of distinctly autochthonous populations that have arisen in situ: a conclusion that is reinforced by the phylogeography of both haploid loci.
Article
Full-text available
The Y-chromosome haplogroup N-M231 (Hg N) is distributed widely in eastern and central Asia, Siberia, as well as in eastern and northern Europe. Previous studies suggested a counterclockwise prehistoric migration of Hg N from eastern Asia to eastern and northern Europe. However, the root of this Y chromosome lineage and its detailed dispersal pattern across eastern Asia are still unclear. We analyzed haplogroup profiles and phylogeographic patterns of 1,570 Hg N individuals from 20,826 males in 359 populations across Eurasia. We first genotyped 6,371 males from 169 populations in China and Cambodia, and generated data of 360 Hg N individuals, and then combined published data on 1,210 Hg N individuals from Japanese, Southeast Asian, Siberian, European and Central Asian populations. The results showed that the sub-haplogroups of Hg N have a distinct geographical distribution. The highest Y-STR diversity of the ancestral Hg N sub-haplogroups was observed in the southern part of mainland East Asia, and further phylogeographic analyses supports an origin of Hg N in southern China. Combined with previous data, we propose that the early northward dispersal of Hg N started from southern China about 21 thousand years ago (kya), expanding into northern China 12-18 kya, and reaching further north to Siberia about 12-14 kya before a population expansion and westward migration into Central Asia and eastern/northern Europe around 8.0-10.0 kya. This northward migration of Hg N likewise coincides with retreating ice sheets after the Last Glacial Maximum (22-18 kya) in mainland East Asia.
Article
Human Y-chromosome haplogroup C2b-F1067 is one of the dominant paternal lineages of populations in Eastern Eurasia. In order to explore the origin, diversification, and expansion of this haplogroup, we generated 206 new Y-chromosome sequences from C2b-F1067 males and coanalyzed 220 Y-chromosome sequences of this haplogroup. BEAST software was used to reconstruct a revised phylogenetic tree of haplogroup C2b-F1067 with age estimates. The revised phylogeny of C2b-F1067 included 155 sublineages, 1986 non-private variants, and >6000 private variants. The age estimation suggested that the initial splitting of C2b-F1067 happened at about 32.8 thousand years ago (kya) and the major sublineages of this haplgroup experienced continuous expansion in the most recent 10,000 years. We identified numerous sublineages that were nearly specific for Korean, Mongolian, Chinese, and other ethnic minorities in China. In particular, we evaluated the candidate-specific lineage for the Dayan Khan family and the Confucius family, the descendants of the ruling family of the Chinese Shang dynasty. These findings suggest that ancient populations with varied C2b-F1067 sublineages played an important role during the formation of most modern populations in Eastern Eurasia, and thus eventually became the founding paternal lineages of these populations.
Article
We used Y-chromosome DNA typing data from 342 unrelated individuals from the Czech Republic to obtain the Y-STR haplotypes and haplogroup-defining single nucleotide polymorphisms (SNPs). The resulting Y-STR haplotypes were subsequently entered into 5 different Y-haplogroup predictors (Vadim Urasin, Nevgen, Hapest, Jim Cullen, and Felix Immanuel), and the results were compared. We also evaluated the influence of the number of STRs used (12 vs. 19 loci) on the accuracy of the Y-haplogroup predictions.