Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Effects of ODC on polyamine metabolism, hormone levels, cell proliferation and
apoptosis in goose ovarian granulosa cells
Chunyang Niu,*
,1
Sujuan Zhang,*
,1
Guilin Mo,*
,1
Yilong Jiang,*Liang Li,*Hengyong Xu,*
Chunchun Han,*Hua Zhao,
y
Yanhong Yan,*Shenqiang Hu,*Jiwei Hu,*Bo Kang,*and Dongmei Jiang*
,2
*
College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, P. R. China; and
y
Animal Nutrition Institute, Sichuan Agricultural University, Chengdu, P. R. China
ABSTRACT Ornithine decarboxylase (ODC) plays
an indispensable role in the process of polyamine biosyn-
thesis. Polyamines are a pivotal part of living cells and
have diverse roles in the regulation of cell proliferation
and apoptosis, aging and reproduction. However, to
date, there have been no reports about ODC regulating
follicular development in goose ovaries. Here, we con-
structed ODC siRNA and overexpression plasmids and
transfected them into goose primary granulosa cells
(GCs) to elucidate the effects of ODC interference and
overexpression on the polyamine metabolism, hormone
levels, cell apoptosis and proliferation of granulosa cells.
After interfering with ODC in GCs, the mRNA and pro-
tein levels of ODC and the content of putrescine were
greatly decreased (P<0.05). When ODC was overex-
pressed, ODC mRNA and protein levels and putrescine
content were greatly increased (P<0.05). The poly-
amine-metabolizing enzyme genes ornithine decarboxyl-
ase antizyme 1 (OAZ1) and spermidine / spermine-N1-
acetyltransferase (SSAT) were significantly increased,
and spermidine synthase (SPDS) was significantly
decreased when ODC was downregulated (P<0.05).
OAZ1, SPDS and SSAT were significantly increased
when ODC was upregulated (P<0.05). In addition,
after interference with ODC, progesterone (P4) levels in
the culture medium of GCs increased greatly (P<0.05),
while the overexpression of ODC caused the P4 level to
decrease significantly (P<0.05). After ODC downregu-
lation, granulosa cell activity was significantly reduced,
the apoptosis rate was significantly increased, and the
BCL-2 / BAX ratio was downregulated (P<0.05).
Under ODC overexpression, the activity of GCs was
notably increased, the apoptosis rate was significantly
reduced, and the BCL-2 / BAX protein ratio was upre-
gulated (P<0.05). Our study successfully induced ODC
interference and overexpression in goose ovarian GCs,
and ODC regulated mainly putrescine content in GCs
with a slight influence on spermidine and spermine.
Moreover, ODC participated in the adjustment of P4
levels in the culture medium of GCs, promoted granu-
losa cell proliferation and inhibited granulosa cell
apoptosis.
Key words: ornithine decarboxylase, polyamine, granulosa cells, proliferation, apoptosis
2021 Poultry Science 100:101226
https://doi.org/10.1016/j.psj.2021.101226
INTRODUCTION
The egg laying performance of poultry largely depends
on the development of the follicles. The granulosa cells
(GCs) in ovarian follicles participate in the regulation
of follicular development through the synthesis of hor-
mones. Polyamines mainly include putrescine, spermi-
dine and spermine, which are indispensable components
of living cells. They have diverse roles in the adjustment
of gene expression, RNA translation, cell proliferation
and apoptosis, as well as in the regulation of animal
gametogenesis, embryo implantation, development and
other reproductive functions (Kang et al., 2017a;
Sobe et al., 2017;Elmetwally et al., 2018;Lane et al.,
2018).
Ornithine decarboxylase (ODC) is a critical rate-lim-
iting enzyme in polyamine biosynthesis that can cata-
lyze the decarboxylation of ornithine to putrescine in
cells and plays a pivotal role in polyamine metabolism
(Pegg, 2006). Armstrong (1986) found that ODC activ-
ity in chicken ovarian granulosa layers increased with an
increase in follicles. Moreover, after blocking the synthe-
sis of ovarian ODC with the irreversible ODC inhibitor
a-difluoromethylornithine (DFMO), ovarian and
Ó2021 The Authors. Published by Elsevier Inc. on behalf of Poultry
Science Association Inc. This is an open access article under the CC
BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/
4.0/).
Received October 13, 2020.
Accepted April 14, 2021.
1
Chunyang Niu, Sujuan Zhang, and Guilin Mo contributed equally
to the work.
2
Corresponding author: jiangdm@sicau.edu.cn
1
follicular production and luteinization were inhibited.
Studies have found that ODC activity is regulated by
ornithine decarboxylase antizyme (OAZ), which regu-
lates the growth and development of animal follicles
(Ivanov et al., 2000). After overexpression of OAZ1in
goose GCs, the concentrations of spermidine and putres-
cine in cells decreased, the level of spermine increased,
and the expression of luteinizing hormone receptor
(LHR), follicle-stimulating hormone receptor (FSHR)
and estrogen receptor (ER) genes increased signifi-
cantly. Research has demonstrated that polyamine dele-
tion can inhibit the apoptosis of intestinal epithelial cells
in rats by reducing the activity of CASPASE 3 and 9
and the transfer of BAX to mitochondria, thereby reduc-
ing cytochrome c efflux (Yuan et al., 2002). It was found
that in many mammals (rats and pigs), ODC activity
briefly increases before ovulation (Liu et al., 2016).
Older mice showed decreased ovarian ODC and putres-
cine levels (Yong et al., 2015). Putrescine supplementa-
tion in drinking water before obtaining oocytes and
supplementing putrescine in oocyte maturation medium
in vitro can reduce oocyte aneuploidy in aged mice
(Koehler et al., 2006). It is noteworthy that supplemen-
tation of putrescine in ovulating mice can significantly
improve embryo quality, increase the number of blasto-
cyst cells, reduce early embryonic death and increase the
number of live births (Yong et al., 2015).
Inhibition of ODC activity not only sharply reduces
polyamine content but also affects cell proliferation and
apoptosis. Studies have found that ODC can directly act
on ER and androgen receptor (AR) to regulate human
breast cancer cell proliferation and apoptosis (Zhu et al.,
2012). Lee et al. (2011) showed that during the prolifera-
tion stage, the expression of ODC in C2C12 cells was
upregulated. After 48 and 72 h of DFMO treatment, the
expression of ODC in C2C12 cells decreased by 40 and
66%, respectively, and cell proliferation decreased. The
overexpression of the ODC gene promotes the prolifera-
tion of C2C12 cells, which indicated that ODC has an
important regulatory effect on cell proliferation.
However, there is currently no information available
on the influence of ODC on polyamine metabolism,
reproductive hormone receptors, cell apoptosis and pro-
liferation-related gene expression in poultry GCs. Focus-
ing on these points, this work used goose primary GCs
as the research object to clarify the influence of ODC on
polyamine metabolism, reproductive hormone concen-
tration, reproductive hormone receptor gene expression,
apoptosis and proliferation in GCs through the interfer-
ence and overexpression of the ODC gene.
MATERIALS AND METHODS
Animals and Ethics Statement
The regulations on the protection and use of Sichuan
white geese were approved by the Animal Ethics Commit-
tee of the College of Animal Science and Technology of
Sichuan Agricultural University. In this experiment, 40
Sichuan white geese weighing 3.5 §0.5 kg at the peak of
laying eggs (35−40 wks old) were selected randomly from
the poultry breeding farm of Sichuan Agricultural Univer-
sity and euthanized by cervical dislocation.
Cell Culture and Treatment
AccordingtothemethodsofKang et al. (2017b),hierar-
chical follicles (F1-F6) were rapidly collected from the ova-
ries of the geese, and primary granulosa cells were isolated.
GCs were cultured in DMEM/F12 (Thermo Fisher Scien-
tific, Shanghai, China) in a 37°C, 5% CO
2
incubator.
Construction of ODC Interference and
Overexpression Plasmids and Cell
Transfection
To interfere with ODC expression, three ODC siRNA
sequences (si-ODC-331, si-ODC-511, and si-ODC-894)
and a negative control (NC) were designed and synthe-
sized (Table 1). siRNAs were transfected when the gran-
ulosa cell density reached 70%. si-ODC-331, si-ODC-
511, si-ODC-894 and NC were diluted with Opti-MEM
(Thermo Fisher Scientific). Then, Lipofectamine 3000
(Thermo Fisher Scientific) was mixed with the plasmid
and added to the GCs. The cells were cultured in an
incubator at 37°C and 5% CO
2
for 24, 48, and 72 h.
The BglII and KpnI restriction endonucleases (New
England Biolabs) for the pEGFP-N1 plasmid (Sangon
Biotech, Shanghai, China) were a double enzyme, plastic
recycling pEGFP-N1 skeleton DNA sequence. The
primer sequences (F: 50-CGCAAATGGGCGG-
TAGGCGTG-30and R: 50-CGTCGCCGTCCAGCTC-
GACCAG-30) were verified through bidirectional
sequencing. All coding sequence (CDS) regions of ODC
were correctly inserted into the pEGFP-N1 vector, indi-
cating that the pEGFP-N1-ODC overexpression vector
was successfully constructed. The transfection complex
was prepared, and the compound was incubated at 25°C
for 15 min and transfected into GCs.
qRT-PCR Was Used to Detect the Expression
of Genes Associated With Polyamine
Metabolism, Cell Proliferation and Apoptosis
Total RNA was extracted from GCs using TRIzol
(Thermo Fisher Scientific). The cDNA templates were
obtained from total RNA samples using a reverse tran-
scription kit (Takara, Beijing, China). qRT-PCR
Table 1. List of four siRNA sequences.
Name Sequences (50
−30)
si-ODC-331 F: GCAAAUCCCUGCAAACAAATT
R: UUUGUUUGCAGGGAUUUGCTT
si-ODC-511 F: GGAGCUACACUUAAGACAATT
R: UUGUCUUAAGUGUAGCUCCTT
si-ODC-894 F: GGAGCAAACAGGUUCUGAUTT
R: AUCAGAACCUGUUUGCUCCTT
NC F: UUCUCCGAACGUGUCACGUTT
R: AGCUGACACGUUCGGAGAATT
2NIU ET AL.
detection was performed using a SYBR Green qPCR kit
(Takara). The reaction system was: 95°C for 5 min, 95°
C for 30 s, 55°C for 30 s, 72°C for 30 s, 39 cycles. The
primer sequences are shown in Table 2. Gapdh was used
as the internal standard, and 3 parallel replicates were
performed for each sample. The 2
44Ct
method was
used to calculate the Ct value based on the qRT-PCR.
Western Blotting Was Used to Detect ODC
Expression, Cell Proliferation and
Apoptosis-Related Proteins
GCs were cultured according to the above methods.
After washing with PBS (Solarbio, Beijing, China) pre-
cooled at 4°C, RIPA lysate (Beyotime, Shanghai, China)
containing protein inhibitor was added. The supernatant
was analyzed using a BCA detection kit (Beyotime). Pro-
teins were transferred to nitrocellulose membranes by 10%
SDS-PAGE (Beyotime). Then, the cells were sealed for 2 h
and incubated at 4°C for 13 h with primary anti-ODC (1:
1,000) (Abcam, Shanghai, China). The cell proliferation-
and apoptosis-related protein antibodies and dilution
ratios were as follows: anti-PARP (1: 1,000, Beyotime),
anti-b-actin (1: 2,000, TransGen Biotech, Beijing, China),
anti-Cyclin D1 (1: 1,000), anti-Bcl-2 (1: 1,000) and anti-
Bax (1: 1,000) (Abcam). The goat anti-rabbit IgG labeled
with 1: 2,000 diluted horseradish peroxidase was incubated
at room temperature for 1 h and then washed with TBST
(Beyotime). Finally, enhanced chemiluminescence reagent
(Beyotime) was used for development on a gel imaging sys-
tem instrument. Image Lab (Bio-Rad, Shanghai, China)
was used to analyze the optical density levels and to calcu-
late the relative protein content.
High-Performance Liquid Chromatography
Was Used to Detect Polyamines
The polyamine content in the goose GCs was deter-
mined by high-performance liquid chromatography
according to the methods of Kang et al. (2017b). The
Table 2. List of primer sequences used for qRT-PCR.
Genes Primer sequences (50
−30) Product length (bp) Annealing temperature (°C)
ODC F: TGTATCTGCTTGACATTGGTGGTG 146 60
R: CAGGAAGATACTATGTCGCATCAGC
OAZ1 F: ACTTCAGGAACCCTCGCATCAACT 141 65
R: GCTGCCCTCATCTTTCTAATACGG
OAZ2 F: AAGCCTCATGTTGTCCACTTC 142 63
R: GTGCTGATAACCCTTCTTTGC
SAMDC F: GCTTGACCCAGTAGTTATGGACCA 180 55
R: TGAATAGTCCAGTAAGTTCCATCCG
AZIN1 F: GCTCTTACTGCACATTGCCACA 180 58
R: TGAATGTACGTTTGCAGTTCCTTG
SPDS F: TCTGCTGCCAAGGTGAGTGC 111 55
R: TAGGGATGGTGCAATAGGCGTA
SPMS F: GTGCTGATCCTTGGAGGTGGT 110 58
R: TTACACCCGTCGATCACCATT
SSAT1 F: CACCCTTTCTACCACTGTCTG 173 58
R: CCAATGCCAAGTCCTCTGT
APAO F: GAGTTTGAGCAACCCTTCTGG 141 58
R: TGGCTGGAGGACCACAAA
SMO F: CTACCCACGGTGCTGTGCTTT 124 59
R: GAATCGGGAGTTGGTGGTGTT
LHR F: GTAACACTGGAATAAGGGAAT 191 54
R: GAAGGCTTGACTGTGGATA
ER F: ACCCAAACAGACCATTCAACGAA 187 61
R: CGCCAGACTAAGCCAATCATCAG
FSHR F: TCCTGTGCTAACCCTTTCCTCTA 207 59
R: AACCAGTGAATAAATAGTCCCATC
PR F: CCAGGATTTCGGAATTTAC 187 55
R: GACACAGTGAATAGAACGATG
AR F: AGGAGTTTGGGTGGCTTCAGA 201 55.7
R: GCTGGTAAAACCGCCTAGAGC
CCND1 F: TGTTTACGAGCCTGCCAAGAA 109 55
R: CTGCTTCGTCCTCTACAGTCTTTG
PCNA F: AGAAATGAATGAGCCAGTCCAGC 178 55
R: TTCAATCTTTGGAGCCAGGTAGT
SMAD1 F: AAGGGCTGCCGCATGTAATT 146 55
R: CCGCTTGTAGTGGTAAGGATTGA
BAX F: GAAGCATTTACAGTTGCCATTACAG 162 55
R: CCACAAGCAAGCAAAGAGCC
BCL-2 F: GATGCCTTCGTGGAGTTGTATG 98 60
R: GCTCCCACCAGAACCAAAC
CASPASE 3 F: CTGGTATTGAGGCAGACAGTGG 158 60
R: CAGCACCCTACACAGAGACTGAA
CASPASE 8 F: GGTGTCGCAGTTCAGGTA 127 57
R: CATTGTAGTTTCAGGGCTT
CASPASE 9 F: TTCCAGGCTCTGTCGGGTAA 150 64
R: GTCCAGCGTTTCCACATACCA
EFFECT OF ODC ON GRANULOSA CELLS 3
general steps were as follows. First, polyamine standard
curves were prepared. Goose GCs were ultrasonically
lysed, and 1 mL of 5% perchloric acid and 10 mL of 1,6-
hexanediamine (Sigma, Shanghai, China) standard
working solution were added. Then, the samples were
sonicated for 10 min and centrifuged, and the superna-
tant was collected. Then, the samples were extracted
again with 1 mL of 5% perchloric acid, the supernatant
was removed, an equal volume of 2.5 mol/L NaOH and
7mL of benzoyl chloride was added, and the samples
were derivatized at 40°C for 1 h. The samples were
adjusted to a neutral pH with 6 mol/L HCl, and a
HyperSep C18 extraction column (Thermo Fisher Scien-
tific) was used to extract and separate the derivative
products. The extraction column was washed with
15 mL of ultrapure water and 15 mL of 15% (v/v) chro-
matographic grade aqueous methanol solution to purify
the derivative products. Methanol was added to the
extraction column for elution. The methanol: ultrapure
water ratio was 62: 38 (v/v), and the column tempera-
ture of the Hypurity C18 chromatographic separation
column was 40°C. The results were compared with the
standard curve of polyamine.
Hormone (E2 and P4) Detection in the
Culture Medium
According to the instructions of the goose estradiol
(E2) ELISA kits (Qisong Biological Technology, Bei-
jing, China) and progesterone (P4) ELISA kits (Qisong
Biological Technology), the cell culture medium was
collected and centrifuged at 4,000 r/min for 15 min.
Then, horseradish peroxidase detection antibody was
added to the sample wells and standard product wells,
which were incubated at 37°C for 1 h, filled with wash-
ing buffer for 1 min and washed 5 times. Substrates A
and B were added to each well, and the OD value was
detected. The concentration of each sample was calcu-
lated according to the curve equation. The assay sensi-
tivity was as follows: the minimum detection level of E2
was 1.0 pg/mL, and the maximum detection level was
480 pg/mL. The minimum detection level of P4 was
0.1 ng/mL and the maximum detection level was
8 ng/mL. The inter- and intra-assay coefficients of vari-
ability ≤7%. It showed that the experiment had good
repeatability.
Analysis of Cell Proliferation in Transfected
Granulosa Cells by MTT Assay
GCs were cultured in 96-well plates (n = 6), and
the control and test groups were transfected as
described above. Forty-eight or twenty-four hours
after transfection of the interference and overexpres-
sion plasmids, 0.5 mg/mL MTT reagent (Beyotime)
was added, and the cells were incubated for 4 h
before discarding the DMEM. One hundred fifty mL/
well DMSO (Beyotime) was added. A microplate
readerwasusedtodetecttheODvalueat490nm,
and zero adjustment holes were set up (DMEM,
MTT and DMSO). Calculated cell activity = (OD
treatment −OD adjustment) / (OD control −OD
adjustment).
Flow Cytometry Was Used to Detect the
Apoptosis of Transfected GCs
According to the instructions of the Apoptosis Detec-
tion Kit (BD Biosciences, Shanghai, China), after the
GCs were transfected, the cell culture medium was
removed from the centrifuge tube. The cells were
digested with trypsin after washing with 4°C precooled
PBS (Solarbio). The cell culture medium collected
before was added to stop digestion. After centrifugation,
the cells were washed with precooled PBS once. The cells
were resuspended in 1 £binding buffer, and the suspen-
sion was filtered through a strainer to adjust the cell con-
centration to 1 £10
6
/mL. Annexin V-FITC and PI
staining solution was added to the cell suspension, mixed
with 1 £binding buffer, and analyzed with flow cytome-
try. Analysis was performed by using the flow cytometry
software CytExpert 2.0.
Statistical Analysis
The MEANS process in SPSS software (SPSS Inc.,
USA) was used for statistical analysis. ANOVA was
used to compare multiple groups, Duncan’s multiple
comparisons test was used to identify significant rela-
tionships. GraphPad Prism 6 was applied for graphing,
and the results were shown as the mean §SEM. P<
0.05 * represents a significant difference, and P<0.01
** represents an extremely significant difference.
RESULTS
Effects of ODC Interference on the Levels of
ODC mRNA and Protein in the Ovarian
Granulosa Cells of Geese
si-ODC-331, si-ODC-511 and si-ODC-894 were
transfected into GCs for 24, 48, and 72 h, respectively.
Theinterferenceefficiency of ODC was the highest
when transfected with si-ODC-894 plasmid for 48 h,
which was much lower than that of the Blank and NC
groups (P<0.01) (Figure 1A). Then, western blot
analysis was utilized to further verify the level of ODC
protein after the transfection of si-ODC-894 at differ-
ent times. Figure 1B shows that the protein expression
decreased significantly when ODC was interfered with
for 48 h (P<0.05), which was aligned with the results
acquired by qRT-PCR. Therefore, si-ODC-894 trans-
fected for 48 h was selected as the subsequent experi-
mental condition.
4NIU ET AL.
Effects of ODC Overexpression on the
Levels of ODC mRNA and Protein in Goose
Ovarian Granulosa Cells
As shown in Figure 2A, when the ODC overexpression
plasmid was transfected into GCs for 24, 48, and 72 h,
ODC expression was considerably upregulated by
19.9 times, 19.7 times, and 13.1 times, respectively (P<
0.01). Figure 2B shows that after 24 h of overexpression,
the protein level of ODC was significantly upregulated
(P<0.05), which was consistent with the results
obtained by qRT-PCR. Thus, the transfection of GCs
with the ODC overexpression plasmid for 24 h was
selected as the subsequent experimental condition.
Effects of ODC on Polyamine Contents and
Polyamine Metabolism-Related Gene
Expression in GCs
Upon ODC interference, the putrescine content in
GCs was significantly decreased (P<0.05) (Figure 3A).
When ODC was overexpressed, the putrescine content
in GCs was greatly increased (P<0.05) (Figure 3B).
Both the concentrations of spermidine and spermine
were not significantly different under ODC interference
or overexpression conditions (P>0.05).
Then, we studied the effect of ODC interference and
overexpression on the gene expression of polyamine-
metabolizing enzymes in GCs. The change in the expres-
sion of SPMS (spermine synthase) and SAMDC was not
significant after interference with ODC (P>0.05), while
OAZ1, OAZ2, APAO, and spermine oxidase (SMO)
gene expression was significantly upregulated (P<
0.05), antizyme inhibitor 1 (AZIN1) and SSAT expres-
sion was extremely significantly upregulated (P<0.01),
SPDS expression was remarkably decreased (P<0.05)
(Figure 3C). OAZ2, SPMS and APAO (acetyl-poly-
amine oxidase) expression was not significantly changed
when ODC was overexpressed in GCs (P>0.05), the
expression of OAZ1 and SMO was markedly increased
(P<0.05), SPDS, AZIN1 and SSAT gene level was
greatly significantly upregulated (P<0.01), while
SAMDC (s-adenosylmethionine decarboxylase) expres-
sion was greatly reduced (P<0.05) (Figure 3D).
Figure 1. Levels of ODC mRNA and protein in GCs after transfec-
tion with ODC siRNA. (A) Expression of ODC mRNA after transfec-
tion of three si-ODC plasmids at different times, (B) Expression of
ODC protein in GCs at different times. * P<0.05, ** P<0.01.
Figure 2. Expression levels of ODC mRNA and protein in GCs after transfection with the ODC plasmid. (A) Expression of ODC mRNA after
transfection of the overexpression plasmid at different times, (B) Expression of ODC protein in GCs. * P<0.05, ** P<0.01.
EFFECT OF ODC ON GRANULOSA CELLS 5
Effect of ODC on the Gene Expression of
Reproductive Hormone Receptors in GCs
and P4 and E2 Levels in Culture Medium
After interfering with ODC, the expression of ER and
FSHR genes in GCs was greatly decreased (P<0.05),
while AR gene was markedly increased (P<0.05), LHR
gene was extremely significantly downregulated (P<
0.01) (Figure 4A). The P4 level in the culture medium
was remarkably increased (P<0.05) (Figure 4C), and
the E2 content was tremendously decreased (P<0.01)
(Figure 4D). As shown in Figure 4B, when ODC was
overexpressed, the expression of the ER gene in GCs was
markedly downregulated (P<0.05). LHR, FSHR, AR,
and PR were not remarkably impacted (P>0.05). The
P4 level was significantly decreased (P<0.05)
(Figure 4E), while the E2 level did not markedly change
(P>0.05) (Figure 4F).
The Viability of GCs Was Analyzed After ODC
Interference and Overexpression
After ODC expression interference in goose ovarian
GCs, the number of decreased and dead GCs was
observed under the microscope and compared with that
of the NC group (Figure 5A). MTT results showed that
granulosa cell activity was remarkably reduced (P<
0.05) (Figure 5B). As shown in Figure 5C, after ODC
was overexpressed, the number of GCs was significantly
increased, and the cell morphology was fuller than that
of the NC group. MTT results indicated that the activ-
ity of GCs was greatly increased after ODC overexpres-
sion (P<0.01) (Figure 5D). Then, we explored the
effects of ODC on proliferation-related proteins.
Figure 5E and 5F show that the protein level of CCND1
decreased significantly when ODC was downregulated
(P<0.01), and the protein level of CCND1 was consid-
erably increased when ODC was upregulated (P<0.01).
Effect of ODC Interference and
Overexpression on the Apoptosis of GCs
qRT-PCR was applied to detect the expression of cell
apoptosis-related genes after ODC interference and
overexpression. As shown in Figure 6A, under ODC
expression interference, the relative expression of BAX
mRNA was greatly upregulated (P<0.05), the relative
expression of CASPASE 8 and CASPASE 9 mRNA was
markedly significantly upregulated (P<0.01). When
ODC was overexpressed (Figure 6B), the expression of
the proapoptotic gene BAX was remarkably reduced (P
<0.05), and that of BCL-2, CASPASE 3, CASPASE 8
and CASPASE 9 was not significantly changed (P>
0.05).
Western blotting was applied to assess the influence of
ODC interference and overexpression on the protein
Figure 3. Effect of ODC on polyamine content (A, B) and the expression of polyamine metabolism-related genes in GCs (C, D). (A, C) ODC
interference, (B, D) ODC overexpression. * P<0.05, ** P<0.01.
6NIU ET AL.
levels of apoptosis-related genes in GCs. BAX and BCL-
2 increased significantly after ODC interference (P<
0.05) (Figure 6C). BAX was markedly reduced after
ODC overexpression (P<0.05), whereas BCL-2 showed
no notable change (P>0.05) (Figure 6D).
Furthermore, flow cytometry was utilized to test the
influence of ODC interference and overexpression on the
apoptosis of GCs. The apoptosis rate of GCs was greatly
upregulated after interfering with ODC (P<0.05)
(Figure 6E), and the apoptosis rate of GCs was
Figure 4. Effect of ODC on the expression of reproductive hormone receptor genes (A, B) in GCs and on the levels of P4 (C, E) and E2 (D, F) in
culture medium. (A, C, D) ODC interference, (B, E, F) ODC overexpression. * P<0.05, ** P<0.01.
Figure 5. Effects of ODC on the morphology (A, C) and viability of goose GCs (B, D) and (E, F) cell proliferation-related genes. (A, B, E) ODC
interference, (C, D, F) ODC overexpression. * P<0.05, ** P<0.01.
EFFECT OF ODC ON GRANULOSA CELLS 7
significantly downregulated when ODC was overex-
pressed (P<0.05) (Figure 6F).
DISCUSSION
ODC is the pivotal rate-limiting enzyme for poly-
amine biosynthesis, and its activity can directly regulate
the content of polyamines in cells. Studies have shown
that changes in ODC expression and biological activity
directly affect the contents of polyamine, which plays a
crucial role in cell apoptosis, proliferation, and animal
reproduction (Arisan et al., 2012;Wei et al., 2013). In
this study, when GCs were transfected with the si-ODC-
894 plasmid for 48 h, the mRNA and protein expression
levels of ODC were remarkably reduced (P<0.05).
When the overexpressed ODC plasmid was transfected
for 24 h, the mRNA and protein expression levels of
ODC were considerably increased (P<0.05), indicating
that ODC interference and overexpression in GCs were
successfully achieved.
Studies have reported that after ODC overexpression,
the ODC activity in HEK293 cells increased by
100 times, and the content of putrescine increased by
10 times, but the concentrations of spermidine and sper-
mine were only slightly reduced (Wilson et al., 2005).
This experiment found that the content of putrescine in
GCs increased significantly after the overexpression of
ODC. In previous studies that transfected the ODC
overexpression vector into H9c2 cells, ODC activity was
significantly increased, and putrescine and spermidine
levels were also significantly increased (Govoni et al.,
2010). In this work, interfering with the expression of
ODC reduced the content of putrescine in GCs, while
the content of spermidine and spermine did not change
significantly. Furthermore, putrescine content was sig-
nificantly reduced after interfering with ODC expression
in MCF7 breast cancer cells (Gupta et al., 2016). This
experiment indicated that ODC expression changes
mainly affected the putrescine content in GCs and had a
small influence on the concentration of spermidine and
spermine.
Previous studies found that the level of OAZ1 mRNA
in the ovaries of laying geese was markedly higher than
that in the ovaries of prelaying geese. This result indi-
cated that the high expression of OAZ1 disrupted poly-
amine homeostasis by suppressing ODC activity and
inhibited follicular development (Bo et al., 2017). At
present, there is no direct evidence that ODC levels can
affect OAZ1 gene expression, but ODC and OAZ1 are
synergistically expressed in GCs, suggesting that
enhanced ODC expression may cause corresponding
changes in OAZ1 expression. Yue et al. (2008) showed
that the overexpression of ODC can promote the expres-
sion of OAZ1 in endometrial cells, which corresponded
with the results of this research. SSAT is regarded as the
rate-limiting enzyme of polyamine catabolism. It has
been confirmed in many cell lines that polyamine can
promote the expression of SSAT (Fogel et al., 1996).
This study found that putrescine content was reduced
and SPDS gene expression was inhibited after interfer-
ing with ODC.Zhu et al. (2012) interfered with ODC
gene expression in MCF7 and T47D cells and found that
ODC protein and mRNA levels were remarkably down-
regulated while the genes expression of SMO and SSAT
was upregulated, and the protein expression level of
SMO was increased. This finding was consistent with
the results of our experiment. After interfering with the
ODC gene in goose GCs, in addition to upregulating the
expression of the SMO and SSAT genes, the expression
of the APAO gene also increased significantly. In this
work, OAZ1 and OAZ2 expression increased greatly
after ODC expression interference, and the expression of
the SPMS and AZIN genes also increased significantly.
SAMDC was considered to be the most important poly-
amine synthetase after ODC (Thomas et al., 2003).
Studies have found that both ODC knockout and
Figure 6. Effect of ODC on the apoptosis of GCs. (A, B) The expression of cell apoptosis-related genes, (C, D) and proteins in GCs, and (E, F)
analysis of the cell apoptosis rate by flow cytometry. (A, C, E) ODC interference, (B, D, F) ODC overexpression. * P<0.05, ** P<0.01
8NIU ET AL.
SAMDC knockout are lethal in mouse embryos
(Pendeville et al., 2001;Nishimura et al., 2002). In this
experiment, the interference or overexpression of ODC
affected the gene expression of polyamine metabolism
enzyme in GCs. Accordingly, we speculated that the
protein and mRNA levels of ODC were significantly
changed, resulting in changes in the content of putres-
cine in cells and in the stimulation of GCs, which
affected the changes in the gene expression of polyamine
metabolism enzymes.
ODC activity in mammalian ovaries was reported to
transiently increase as oocytes mature in vivo, and
oocyte maturation and development are regulated by
GCs. In the early pregnancy of hamsters and rats, treat-
ment with progesterone receptor antagonists can result
in decreased ODC activity and eventually lead to mis-
carriage, which indicates that ODC activity in the ovary
is closely related to hormones (Galliani et al., 1986;
Jian et al., 2001). This study found that after interfering
with ODC, the E2 level was remarkably reduced, and
ER expression was greatly decreased. After the overex-
pression of the ODC gene, the E2 level in the medium
did not change significantly, and ER expression
decreased significantly. It is speculated that the expres-
sion of E2 and ER was affected not only by ODC but
also by the content of polyamines in GCs. However, the
detailed mechanism remains to be elucidated in the
future. Poultry ovaries cannot form a corpus luteum
after ovulation, poultry P4 is mainly produced by follic-
ular GCs (Yang et al., 2005), and poultry follicles also
have the ability to secrete P4 after ovulation
(Estienne et al., 2020). Studies have shown that low lev-
els of P4 can mediate an increase in low-frequency LH
pulses, prolonging the duration of the dominant follicles
and thus affecting the maturation and quality of oocytes
(Savio et al., 1993), while high levels of P4 can inhibit
the synthesis of luteinizing hormone and ultimately
cause atresia of the dominant follicles (Gu and
Zhao, 2015). This study showed that upon ODC inter-
ference, the level of P4 hormone in the culture medium
of granulosa cells was remarkably increased. Moreover,
studies have confirmed that PR genes play a critical role
in regulating the development and reproduction of ani-
mal reproductive systems (Fahl
en et al., 2018;
Singhal et al., 2018). Bastida et al. (2002) found that
after specifically using DFMO to inhibit ODC in the
ovary before ovulation in mice, the level of progesterone
in the ovary decreased, and then the level of progester-
one in the serum of interestrus decreased. The above
research showed that the ODC gene can regulate animal
reproductive function by mediating progesterone pro-
duction and its receptor gene expression.
Previous research found that ODC is an indispensable
factor in yeast, and the loss of the ODC gene in yeast
results in growth stagnation (Schwartz et al., 1995).
This experiment demonstrated that the expression of
BAX, CASPASE 8 and CASPASE 9 was considerably
increased under ODC interference, and cell activity was
significantly decreased, suggesting that ODC gene
expression interference may upregulate BAX,
CASPASE 8 and CASPASE 9 at the transcriptional
level and promote cell apoptosis. He et al. (2017) found
that interfering with ODC gene expression in esophageal
phosphorus cells reduced the levels of PCNA and
CCNB1, thereby inhibiting the proliferation of cells, sig-
nificantly increasing the level of activated CASPASE 3
protein, and promoting the apoptosis of esophageal
phosphorus cells. In HL-60 cell lines, the overexpression
of ODC can inhibit the apoptosis induced by toxic caro-
tene and maintain BCL-2 expression (Wei et al., 2010).
CCND1 is the core component of cell cycle regulation
and can promote the cell proliferation cycle. The results
of this experiment showed that CCND1 expression was
significantly decreased after interfering with ODC gene
expression, and the expression levels of CCND1 were sig-
nificantly increased after transfection with the ODC
overexpression vector, which indicated that the upregu-
lation of ODC promoted the differentiation and prolifer-
ation of GCs. When ODC was downregulated,
granulosa cell activity was significantly reduced, down-
regulating the BCL-2 / BAX protein ratio (P<0.05);
when ODC was overexpressed, the activity of GCs was
increased greatly, and the BCL-2 / BAX protein ratio
was upregulated (P<0.05). Overexpression of ODC can
block the apoptosis induced by dibenzoylmethane in
HL-60 cell lines, mainly by blocking the activation of
CASPASE 9, reducing BAX expression, and upregulat-
ing the BCL-2 / BAX ratio (Wu et al., 2011). Studies
have shown that the BAX protein cannot stimulate the
release of cytochrome C. However, the oligomers formed
by the transfer of BAX from the cytoplasm to the mito-
chondrial membrane form multimers with BCL-2 to
enhance mitochondrial permeability, contributing to the
release of cytochrome C and activating CASPASE 9.
The enzymolysis cascade of the Caspase protease family
is activated, which eventually leads to cell apoptosis.
Overexpression of ODC may affect the cell cycle, and
ODC activity increases in many cell types during the G1
phase (Kaczmarek et al., 1987;Fredlund and Oreds-
son, 2010). Inhibition of ODC activity by polyamine
inhibitors or analogs produces different effects at differ-
ent stages of the cell cycle (Pohjanpelto et al., 2010;
Laitinen et al., 2015). Upregulation of ODC in the skin
of transgenic mice can stimulate cell proliferation and
enhance the activity of CCNE / CDK2- and CCNA /
CDK2-associated kinases (Fredlund and Oreds-
son, 2010). Moreover, the flow cytometry results of this
work illustrated that the apoptosis rate of GCs was
markedly increased after interfering with ODC (P<
0.05), and when ODC was overexpressed, the apoptosis
rate was significantly reduced (P<0.05). The above
results suggested that ODC accelerated the proliferation
of goose ovarian GCs and suppressed cell apoptosis.
In conclusion, our study successfully achieved ODC
interference and overexpression in goose ovarian GCs,
and ODC mainly regulated the putrescine content in
GCs and had little influence on spermidine and sper-
mine. Furthermore, ODC participated in the adjust-
ment of P4 levels in GCs, promoted GC proliferation
and inhibited cell apoptosis.
EFFECT OF ODC ON GRANULOSA CELLS 9
ACKNOWLEDGMENTS
Funding was provided by the National Natural Sci-
ence Foundation of China (31872358 and 31702116) and
the Scientific Research Fund of Sichuan Provincial Edu-
cation Department (18ZB0469)
DISCLOSURES
The authors declare no financial or personal conflicts
of interest.
SUPPLEMENTARY MATERIALS
Supplementary material associated with this article
can be found in the online version at doi:10.1016/j.
psj.2021.101226.
REFERENCES
Arisan, E. D., P. Obakan, A. Coker, and P. Narcin. 2012. Inhibition of
ornithine decarboxylase alters the roscovitine-induced mitochon-
drial-mediated apoptosis in MCF-7 breast cancer cells. Mol. Med.
Rep. 5:1323–1329.
Armstrong, D. G. 1986. Changes in ornithine decarboxylase activity
in ovarian follicles of the laying hen (Gallus domesticus) during
the ovulatory cycle. J. Endocrinol. 110:211–216.
Bastida, C. M., F. Tejada, A. Cremades, and P. Rafael. 2002. The
preovulatory rise of ovarian ornithine decarboxylase is required for
progesterone secretion by the corpus luteum. Biochem. Bioph.
Res. Co. 293:106–111.
Bo, K., J. Dongmei, H. Hui, M. Rong, Y. Zhixin, and C. Ziyu. 2017.
Characterization of OAZ1 and its potential functions in goose fol-
licular development. Electron. J. Biotechn. 26:1–6.
Elmetwally, M. A., Y. Lenis, W. Tang, and W. B. Fuller. 2018. Effects
of catecholamines on secretion of interferon tau and expression of
genes for synthesis of polyamines and apoptosis by ovine trophec-
toderm. Biol. Reprod. 99:611–628.
Estienne, A., A. Brossaud, and M. Reverchon. 2020. Adipokines
expression and effects in oocyte maturation, fertilization and early
embryo development: lessons from mammals and birds. Int J. Mol.
Sci. 21:3581.
Fahl
en, M., H. Zhang, L. L€
ofgren, M. Britt, and S. E. Von. 2018.
Expression of progesterone and androgen receptors in the breast of
premenopausal women, considering menstrual phase. Anticancer.
Res. 38:1499.
Fogel, P. M., S. Vujcic, P. J. Brown, K. H. Mari, and
W. P. Carl. 1996. Effects of polyamines, polyamine analogs, and
inhibitors of protein synthesis on spermidine-spermine N1-acetyl-
transferase gene expression. Biochemistry. 35:14436–14444.
Fredlund, J. O., and S. M. Oredsson. 2010. Impairment of DNA repli-
cation within one cell cycle after seeding of cells in the presence of
a polyamine-biosynthesis inhibitor. Eur. J. Biochem. 237:539–544.
Galliani, G., F. Luzzani, G. Colombo, A. Conz, L. Mistrello, and
D. Barone. 1986. On the mode of action of a new contragestational
agent (DL 111-IT). Contraception. 33:263–283.
Govoni, M., F. Bonavita, L. M. Shantz, G. Carlo, and
G. Emanuele. 2010. Overexpression of ornithine decarboxylase
increases myogenic potential of H9c2 rat myoblasts. Amino Acids.
38:541–547.
Gu, J. M., and J. Z. Zhao. 2015. The effect of progesterone on the
development of endometrium, egg cells and embryos. Inter. J.
Reprod. Heal. /Famy. Plann. 34:239–242.
Gupta, E. D., M. Pachauri, P. C. Ghosh, and M. V. Rajam. 2016. Target-
ing polyamine biosynthetic pathway through RNAi causes the abro-
gation of MCF 7 breast cancer cell line. Tumor. Biol. 37:1159–1171.
He, W., E. Roh, K. Yao, D. L. Kang, and M. Xing. 2017. Targeting
ornithine decarboxylase (ODC) inhibits esophageal squamous cell
carcinoma progression. N. P. J. Precis. Oncol. 1:13.
Ivanov, I. P., A. Rohrwasser, D. A. Terreros, F. G. Raymond, and
F. A. John. 2000. Discovery of a spermatogenesis stage-specific
ornithine decarboxylase antizyme: antizyme 3. P. Natl. Acad. Sci.
USA. 97:4808–4813.
Jian, Z. S., J. Z. Hui, J. H. Qiao, M. W. Li, and Y. F. Rui. 2001.
Effects of DL111-IT or combined with RU486 on uterine poly-
amines biosynthesis in rats during early gestation. Contraception.
63:283–287.
Kaczmarek, L., B. Calabretta, S. Ferrari, and K. D. R. Jon. 1987.
Cell-cycle-dependent expression of human ornithine decarboxyl-
ase. J. Cell. Physiol. 132:545.
Kang, B., D. Jiang, R. Ma, H. Hui, X. Y. Zhi, and Y. C. Zi. 2017a.
OAZ1 knockdown enhances viability and inhibits ER and LHR
transcriptions of granulosa cells in geese. Plos One. 12:e0175016.
Kang, B., D. M. Jiang, H. He, M. Rong, Y. C. Zi, and
X. Y. Zhi. 2017b. Effect of Oaz1 overexpression on goose ovarian
granulosa cells. Amino Acids. 49:1–10.
Koehler, K. E., S. E. Schrump, J. P. Cherry, J. H. Terry, and
A. H. Patri4cia. 2006. Near-human aneuploidy levels in female
mice with homeologous chromosomes. Curr. Biol. 16:579–580.
Laitinen, J., K. Stenius, T. O. Eloranta, and H. Erkki. 2015. Poly-
amines may regulate S-phase progression but not the dynamic
changes of chromatin during the cell cycle. J. Cell. Biochem.
68:200–212.
Lane, D. J. R., D. H. Bae, A. R. Siafakas, S. R. Yohan, A. Lina, and
J. J. Patric. 2018. Coupling of the polyamine and iron metabolism
pathways in the regulation of proliferation: Mechanistic links to
alterations in key polyamine biosynthetic and catabolic enzymes.
BBA-Mol. Basis. Dis. 1864:2793–2813.
Lee, N. K., J. P. Skinner, J. D. Zajac, and E. M. Helen. 2011. Orni-
thine decarboxylase is upregulated by the androgen receptor in
skeletal muscle and regulates myoblast proliferation. Am. J. Phys-
iol. Endocrinol. Metab. 301:172–179.
Liu, X. J. 2016. Targeting oocyte maturation to improve fertility in
older women. Cell Tissue Res. 363:57–68.
Nishimura, K., F. Nakatsu, K. Kashiwagi, O. Hiroshi, T. Saito, and
I. Kazuei. 2002. Essential role of S-adenosylmethionine decarboxyl-
ase in mouse embryonic development. Genes Cells. 7:41–47.
Pegg, A. E. 2006. Regulation of ornithine decarboxylase. J. Biol.
Chem. 281:14529–14532.
Pendeville, H., N. Carpino, J. C. Marine, T. Yutaka, M. Marc, and
M. Joseph. 2001. The ornithine decarboxylase gene is essential for
cell survival during early murine development. Mol. Cell. Biol.
21:6549.
Pohjanpelto, P., S. Nordling, and S. Knuutila. 2010. Flow cytometric
analysis of the cell cycle in polyamine-depleted cells. Cytometry.
16:331–338.
Savio, J. D., W. W. Thatcher, G. R. Morris, and
M. R. Mattiacci. 1993. Effects of induction of low plasma proges-
terone concentrations with a progesterone-releasing intravaginal
device on follicular turnover and fertility in cattle. J. Reprod. Fer-
til. 98:77–84.
Schwartz, B., A. Hittelman, L. Daneshvar, and S. B. Hirak. 1995. A
new model for disruption of the ornithine decarboxylase gene,
SPE1, in Saccharomyces cerevisiae exhibits growth arrest and
genetic instability at the MAT locus. Biochem. J. 312:83.
Singhal, H., M. E. Greene, A. L. Zarnke, L. Muriel, and
A. A. Rose. 2018. Progesterone receptor isoforms, agonists and
antagonists differentially reprogram estrogen signaling. Oncotar-
get. 9:4282–4300.
Sobe, R. C., W. G. Bond, C. K. Wotanis, P. Z. Josiah,
A. B. Marybeth, and L. F. Nicolas. 2017. Spermine inhibits Vibrio
cholerae biofilm formation through the NspS-MbaA polyamine sig-
naling system. J. Biol. Chem. 292:17025–17036.
Thomas, T., and T. J. Thomas. 2003. Polyamine metabolism and can-
cer. J. Cell. Mol. Med. 7:113–126.
Wei, W., X. X. Chun, S. H. Guo, G. C. You, X. X. Jia, and
X. L. Xian. 2013. Downregulation of tumstatin expression by over-
expression of ornithinedecarboxylase. Oncol. Rep. 30:2042–2048.
Wei, C. H., C. H. Pei, F. L. Ya, and L. L. Chih. 2010. Overexpression
of ornithine decarboxylase suppresses thapsigargin-induced apo-
ptosis. Mol. Cells. 30:311–318.
Wilson, S. M., L. H. Iii, K. E. Pastorian, and V. B. Craig. 2005. A sta-
ble, inducible, dose-responsive ODC overexpression system in
human cell lines. BBA Gene Struct. Expr. 1732:103–110.
10 NIU ET AL.
Wu, C. L., Y. F. Liao, Y. C. Hung, L. K. Hsiu, and H. C. Hung. 2011.
Ornithine decarboxylase prevents dibenzoylmethane^
ainduced apo-
ptosis through repressing reactive oxygen species generation. J.
Biochem. Mol. Toxic. 25:312–319.
Yang, S. H., S. W. Xu, and J. L. Li. 2005. The effect of reproductive
hormones on the apoptosis of poultry follicle cells. Jilin Ani. Harv.
Veteri. 10:12–17.
Yong, T., L. Dandan, M. Guolong, M. W. Hong, and X. J. Liu. 2015.
Peri-ovulatory putrescine supplementation reduces embryo resorp-
tion in older mice. Hum. Reprod. 30:1867–1875.
Yuan,Q.,R.M.Ray,andL.R.Johnson.2002.Polyaminedeple-
tion prevents camptothecin-induced apoptosis by inhibiting the
release of cytochrome c. Am J Physiol. Cell Physiol. 282:1290–
1297.
Yue, C. Z., J. C. Yu, S. Y. Yong, L. L. Ji, W. S. Ren, and
H. M. Xing. 2008. Polyamines are essential in embryo implanta-
tion: expression and function of polyamine-related genes in mouse
uterus during peri-implantation period. Endocrinology. 149:2325–
2332.
Zhu, Q., L. Jin, R. A. Casero, E. D. Nancy, and H. Yi. 2012. Role of
ornithine decarboxylase in regulation of estrogen receptor alpha
expression and growth in human breast cancer cells. Breast. Can-
cer. Res. Tr. 136:57–66.
EFFECT OF ODC ON GRANULOSA CELLS 11
