Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
ISSN 2336-3193 Acta Mus. Siles. Sci. Natur., 69: 283-288, 2020
DOI: 10.2478/cszma-2020-0021 Published: online 31 January 2021, print January 2021
283
First rearing record and DNA sequence of Chromatomyia aizoon (Hering,
1932) (Diptera: Agromyzidae) associated with Saxifraga paniculata Miller
from the Czech Republic
Miloš Černý, Jiří Kocián & Jan Ševčík
First rearing record and DNA sequence of Chromatomyia aizoon (Hering, 1932) (Diptera:
Agromyzidae) associated with Saxifraga paniculata Miller from the Czech Republic. – Acta Mus. Siles.
Sci. Natur., 69: 283-288, 2020.
Abstract: A male of Chromatomyia aizoon (Hering, 1932) (Diptera: Agromyzidae) was reared from
a leaf mine at Saxifraga paniculata collected in Štramberk (Northern Moravia, Czech Republic). Partial
sequence of the mitochondrial cytochrome oxidase subunit I (COI barcode region, 658 bp) is also
provided.
Key words: Diptera, Agromyzidae, Chromatomyia aizoon, Czech Republic, biology, faunistics, DNA
barcoding
Introduction
Chromatomyia aizoon (Hering, 1932) is a rare species recorded so far only from Austria,
Czech Republic, Poland, and Switzerland (Martinez 2013). However, only the records from
Austria and Switzerland are based on specimens reared form its host plant Saxifraga paniculata.
For this reason the species has not been included in the Checklist of Diptera of the Czech
Republic and Slovakia (Černý & Vála 2009), pending a recent finding based on rearing.
The species-richness of the agromyzid fauna in the Czech Republic is increased to 495 species
in this paper.
Material and methods
A field survey of relict populations of the plant Saxifraga paniculata occurring on the limestone outcrops
on Zámecký vrch hill and in an old inactive limestone quarry called Dolní Kamenárka (both localities are located
in the town of Štramberk, Northern Moravia, Czech Republic) was held by the second author in order to check
the plants for the presence of Chromatomyia aizoon mines. This agromyzid species was reported from Kotouč hill
by Zavřel (1953) – our current survey was inspired by this literary record. Zámecký vrch hill was surveyed
on 31.viii.2020 and 9.ix.2020, Dolní Kamenárka quarry on 9.ix.2020. Kotouč hill was not surveyed since
the second author did not notice the host plants there during his earlier floristic inventory of the area (cf. Kocián
2020).
A male of Chromatomyia was reared from a single leaf of Saxifraga paniculata by the third author.
The specimen is preserved in 75 % ethanol and deposited in the private collection of the first author who carried
out a morphological examination of the specimen. The other leaves with mines of this agromyzid species have
been left at the locality in order to maintain and protect the local population of the species. The identification and
nomenclature used were based on Hering (1932), Griffiths (1972, 1974), Martinez (2013) and Spencer (1990).
Nomenclature of vascular plants follows Danihelka et al. (2012).
The method of DNA extraction and amplification used here is principally described by Ševčík et al. (2016).
PCR product was sequenced by Eurofins Genomics.
Abbreviations used in the text: det. = determined, distr. = district, leg. = legit (collected), m a.s.l. = meters
above sea level, PP = Natural Monument.
284
Results and Discussion
FAMILY: AGROMYZIDAE
Subfamily: Phytomyzinae
Chromatomyia aizoon (Hering, 1932) (Fig. 1a)
Phytomyza aizoon Hering, 1932: 162.
Material examined: CZECH REPUBLIC, Northern Moravia: Nový Jičín distr., Štramberk, PP Štramberk,
49°35'32.0"N, 18°06'53.8"E, 415 m a.s.l., leaf mine with puparium collected 31.viii.2020 by J. Kocián, 1 ♂ reared
10.ix.2020 by J. Ševčík, det. J. Kocián (host plant) and M. Černý (the adult fly).
Biology: Larva forms a mine on the upper side of the leaf of Saxifraga paniculata
(= S. aizoon Jacq.). The mine is initially narrow and inconspicuous but later becomes broader,
finally forming a large area covering almost the entire surface of the leaf (Figs 1b-c). Puparium
is whitish and 2.3 mm long (Fig. 1d), its anterior spiracles are knob-shaped with 9-10 bulbs,
posterior spiracles are small knob-shaped with 9-12 bulbs (Hering 1932, Griffiths 1972).
Puparium remains in mine, with its ventral surface adjacent to surface of leaf, and its anterior
spiracles projecting ventrally through epidermis.
A single plant of Saxifraga paniculata with agromyzid mines in leaves (Fig. 1b) was found
on the western slope of Zámecký vrch hill (Fig. 2b) within the Štramberk Natural Monument.
The habitat includes partly shaded limestone outcrops covered by semixerothermic vegetation
containing several relict, phytogeographically remarkable and rare species such as Saxifraga
paniculata, Scabiosa lucida subsp. calcicola, Libanotis pyrenaica, Allium senescens subsp.
montanum and Festuca pallens (Fig. 2a). The locality is a part of Štramberk karst, a small
limestone area well known for its biological richness. Limestone rocks, rock steppes and dry
grasslands are the most valuable habitats of this area providing ecological niches for many
endangered organisms. These habitats were best developed, both in quality and quantity, on
Kotouč hill. After their destruction there (see below) the best preserved ones remained on
Zámecký vrch hill.
The population of Saxifraga paniculata on Zámecký vrch hill consists of a few hundred
rosettes growing in several clusters dispersed on the western slope of the hill. Since the popu-
lation of the host plant is small and the mines were found only on a single plant, Chromatomyia
aizoon population is arguably small too. Although the insect species was not found on
the second surveyed site – in Dolní Kamenárka quarry – the population of the host plant is much
larger there and further survey could bring a positive result.
DNA barcode sequence: Partial sequence of the mitochondrial cytochrome oxidase
subunit I (COI) gene (barcode region, 658 bp) is provided below. GenBank accession number
is MW458947.
AACTTTATATTTTATTTTTGGAGCTTGAGCCGGAATAGTAGGAACTTCTTTAAGTATT
TTAATTCGAGCAGAATTAGGTCATCCTGGAGCCTTAATTGGGGATGATCAAATTTAT
AATGTAATTGTTACAGCTCATGCATTTATTATAATTTTCTTCATAGTTATACCAATTAT
AATTGGAGGATTTGGAAATTGACTAGTACCCTTAATACTAGGAGCCCCAGATATAGC
CTTTCCTCGTATAAATAATATAAGCTTTTGATTACTACCCCCAGCTTTAACCCTTTTA
CTAATAAGTAGTATAGTAGAAAACGGAGCTGGTACAGGGTGAACTGTATACCCCCC
TTTATCCTCAATTATTGCTCATGGAGGAGCTTCTGTCGATCTTGCAATTTTTTCTCTT
CACTTAGCTGGAATTTCATCTATTTTAGGGGCTGTAAATTTTATTACAACAATTATTA
ATATACGATCAACTGGAATTTCTTTTGATCGAATACCTTTATTTGTTTGATCAGTTTT
AATTACTGCAGTATTACTTTTACTATCCCTTCCTGTTTTAGCTGGGGCTATTACTATAC
TTTTAACAGATCGAAATTTTAATACTTCATTTTTTGATCCTGCTGGTGGAGGAGACC
CTATTTTATACCAACACTTATTT
285
Fig 1: Chromatomyia aizoon (Hering) and its host plant (a-d): a – Ch. aizoon, male, laterally (10.ix.2020);
b - Host plant Saxifraga paniculata with leaf mines (31.viii.2020); c – Leaf of Saxifraga paniculata with the mine
after the emergence of the adult (10.ix.2020); d – Leaf of Saxifraga paniculata with the mine and puparium
(10.ix.2020). Photos a, c, d by J. Ševčík, photo b by J. Kocián.
Comments
According to the Fauna Europaea Database, Chromatomyia aizoon is known only from
Austria, Czech Republic, Poland and Switzerland (Martinez 2013) and adult specimens were
reared only in Austria and Switzerland. Hering (1932) described the species based on adult
specimens reared from mines found on the host plant Saxifraga paniculata in Mauthen
(Carinthia, Austria) and Zernez (Canton Graubünder, Switzerland).
In the Czech Republic, Zavřel (1953) found the rare relict plant Saxifraga paniculata with
the mines of Phytomyza aizoon Hering, 1932 at the western slope of the Kotouč Hill on
12.ix.1952 (see Griffiths 1972) but he did not rear any adult specimens. However, the locality
does not exist anymore, due to extensive limestone quarrying at Kotouč hill during the 20th
century. The first adult male of Phytomyza aizoon reared from its host plant Saxifraga
paniculata is thus herewith recorded from a nearby locality at Zámecký vrch hill in Štramberk.
The new locality is about 1.2 km northeast of the former one. The new finding represents
the first definitive record of Chromatomyia aizoon (Hering, 1932) from the Czech Republic.
286
Fig 2: Habitat of Chromatomyia aizoon (Hering): a – vegetation on the site of Ch. aizoon occurrence
(31.viii.2020); b – part of the western slope of Zámecký vrch hill in Štramberk (26.x.2020). Photos by J. Kocián.
287
In Slovenia, Maček (1975, 1999) reported leaf mines of Phytomyza aizoon on Saxifraga
rotundifolia from Vintgar near Bled (October 1974) and Velika planina (Tiha dolina Valley, July
1974). Unfortunately these records were not supported by rearing of adults, so this species
cannot be considered as reliably recorded from Slovenia and also S. rotundifolia should not be
considered a confirmed host plant of Ch. aizoon. Beiger (1979, 1981) recorded a leaf mine on
Saxifraga paniculata from a locality near Krakow (4.ix.1961) but again without a confirmation
by the rearing of an adult. This indicates that Chromatomyia aizoon is undoubtedly more widely
distributed in suitable habitats in Europe and any well documented record of an adult male
reared from its host plant is valuable and worth publishing.
Ackn o w led g emen t s: We would like to thank Michael von Tschirnhaus (University of Bielefeld, Germany)
and Petr Kocián (Nový Jičín) for providing us with relevant literature, Nikola Burdíková (University of Ostrava)
for the extraction and amplification of DNA and David Gibbs (Weston-super-Mare, Great Britain) for the language
revision and other improvement of the manuscript. The study was partly supported by the Ministry of Culture
of the Czech Republic by institutional financing of long-term conceptual development of the research institution
(the Silesian Museum, MK000100595).
References
Bei g e r M. (1979): Studia nad owadami minującymi Tatrzańskiego Parku Narodowego. 10. Hymenoptera,
Lepidoptera i Diptera nowe dla fauny Polski. (Studies on mining insects of the Tatra National Park. 10.
Hymenoptera, Lepidoptera and Diptera new to the Polish fauna). – Polskie Pismo entomologiczne 49: 677-
681.
– (1981): Studia nad owadami minującymi Tatrzańskiego Parku Narodowego. 12. Część faunistyczno-
ekologiczna. (Studies on mining insects of the Tatry National Park. 12. Faunistical-ecological part.) – Prace
Komisji biologiczne. Poznańskie Towarzystwo Przyjaricół Nauk (= PTPN) 57: 3-68; Warszawa, Poznań.
Čern ý M. & Vála M. (2009): Agromyzidae Fallén, 1810. In: Jedl i čka L., K údel a M. & Stl o ukal o vá V.
(eds): Checklist of Diptera of the Czech Republic and Slovakia. Electronic version 2. <http://www.edvis.sk/
diptera2009> + CD-ROM: ISBN 978-80-969629-4-5
Dani h elka J., Chr t ek J. jun. & Kap l an Z. (2012): Checklist of vascular plants of the Czech Republic. – Preslia
84: 647–811.
Grif f i ths G.C.D. (1972): Studies on boreal Agromyzidae (Diptera). 1. Phytomyza miners on Saxifragaceae. –
Quaestiones entomologicae 8: 67-80.
– (1974): Studies on boreal Agromyzidae (Diptera). V. On the genus Chromatomyia Hardy, with revision of Capri-
foliaceae-mining species. – Quaestiones entomologicae 10: 35-69
Heri n g M. (1931): Minenstudien 11 [Teil I]. – Zeitschrift für wissenschaftliche Insektenbiologie (2. Folge) 26
(4/6): 93-108; Berlin-Frohnau & Leipzig.
– (1932): Minenstudien 11. (Schluß). – Zeitschrift für wissenschaftliche Insektenbiologie (2. Folge) 26 (7-10):
157-182; Berlin.
– (1957): Bestimmunstabellen der Blattminen von Europa: einschliesslich des Mittelmeerbeckens und der Kanaris-
chen Inseln. 1, 2: 1-1185; 3:1-221. Junk‘s Gravenhage.
Koci á n J. (2020): Floristická inventarizace NPP Šipka. /Floristic inventory of Šipka National Nature Monument./
– Ms. depon. in: Nature Conservation Agency of the Czech Republic, Praha.
Mače k J. (1975): Listni zavrtači Slovenije. V. – Zbornik Biotehniška fakulteta Ljubljana 25: 21-27.
– (1999): Hiponomoloska favna Slovenije = Hyponomologische Fauna Sloweniens. – Dela, slovenska Akademija
Znanosti in Umetnosti. [4] naravoslovne Vede 37: 1-385.
Mart i nez M. (2013): Fauna Europaea: Agromyzidae. In: Beuk P. & P a p e T. (2017) Fauna Europaea: Diptera,
Flies. Fauna Europaea version 2017.06, http://fauna-eu.org. Hosted by: Museum für Naturkunde in Berlin -
Leibniz Institute for Evolution and Biodiversity Science.
Spen c er K.A. (1990): Host Specialization in the World Agromyzidae (Diptera). – Series entomologica. Kluwer
Academic Publishers (Dordrecht, Boston, London) 45: i-xiii, 1-444.
Ševč í k J., Kasp ř ák D., Ma n t ič M., Fit z geral d S., Ševč í ková T., T óthov á A. & J asc h h of M. (2016):
Molecular phylogeny of the megadiverse insect infraorder Bibionomorpha sensu lato (Diptera). – PeerJ 4:
e2563.
Zavř e l H. (1953): Minující hmyz na Kotouči a v okolí Štramberka I. /Mining insects on Kotouč Mt. and in
the environs of Štramberk I./. – Přírodovědecký sborník Ostravského kraje 14: 416-422, 3 refs.
288
– (1956): Die Blattminen des Kotouč (Kotoutsch) und der Umgebung von Štramberk (Stramberg) II. –
Přírodovědecký sborník Ostravského kraje 17: 276-283, 6 refs.
Authorsʼ addresses: Miloš Čer n ý, CZ-763 63 Halenkovice 1, Czech Republic.
E-mail: cerny.milos@centrum.cz
Jiří Koc i á n, Revoluční 14, CZ-741 01 Nový Jičín, Czech Republic.
E-mail: jikocian@seznam.cz
Jan Ševč í k, Department of Biology and Ecology, University of Ostrava, Chittussiho 10,
CZ-710 00 Ostrava & Silesian Museum, Nádražní okruh 31, 746 01, Opava, Czech
Republic. E-mail: sevcikjan@email.cz
