ArticleLiterature Review

Collection and storage of human white blood cells for analysis of DNA damage and repair activity using the comet assay in molecular epidemiology studies

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

DNA damage and repair activity are often assessed in blood s#38les from humans in different types of molecular epidemiology studies. However, it is not always feasible to analyse the s#38les on the day of collection without any type of storage. For instance, certain studies use repeated s#38ling of cells from the same subject or s#38les from different subjects collected at different time-points, and it is desirable to analyse all these s#38les in the same comet assay experiment. In addition, flawless comet assay analyses on frozen s#38les opens up for the possibility of using this technique on biobank material. In this article we discuss the use of cryopreserved peripheral blood mononuclear cells (PBMCs), buffy coat (BC) and whole blood (WB) for analysis of DNA damage and repair using the comet assay. The published literature and the authors’ experiences indicate that various types of blood s#38les can be cryopreserved with only minor effect on the basal level of DNA damage. There is evidence to suggest that WB and PBMCs can be cryopreserved for several years without much effect on the level of DNA damage. However, care should be taken when cryopreserving WB and BCs. It is possible to use either fresh or frozen s#38les of blood cells, but results from fresh and frozen cells should not be used in the same dataset. The article outlines detailed protocols for the cryopreservation of PBMCs, BCs and WB s#38les.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... There are several methods that can be utilized to search for the molecular basis of genotoxic agent effects, including exposure to radiation (Møller et al., 2021). One of them is the alkaline comet test, that can be used to measure DNA damage microscopically and is an important tool in in vivo and in vitro studies on the population due to radiation mutagen exposure. ...
... One of them is the alkaline comet test, that can be used to measure DNA damage microscopically and is an important tool in in vivo and in vitro studies on the population due to radiation mutagen exposure. Several studies have used the comet technique to evaluate DNA damage in human (Møller et al., 2021;Kumar et al., 2015;Kumar et al., 2011), root cells of Allium cepa seeds (Saghirzadeh et al., 2008) or adult male albino rats (El-Marakby et al., 2021) exposed to high natural radiation. The assay was also used to measure the DNA damage in residents exposed to high concentrations of radon (Walczak et al., 2020); and DNA damage and its repair after a dose challenge (Dicu et al., 2022). ...
... The assay was also used to measure the DNA damage in residents exposed to high concentrations of radon (Walczak et al., 2020); and DNA damage and its repair after a dose challenge (Dicu et al., 2022). This technique is relatively simple, visual, and sensitive for detecting DNA instability, even in early damage, without the requirement for cell culture (Møller et al., 2021;Gonzalez and Plasencia, 2017;Gradzka and Iwanenko, 2005;Olive et al., 1990). While some molecular studies conducted in high background radiation areas (HBRA) have shown significantly increased frequencies of DNA damage Geetha and Sreedharan (2016), other investigations failed to find a significant difference. ...
Article
Full-text available
To evaluate the biological impacts of high background radiation exposures that are represented by spontaneous deoxyribonucleic acid (DNA) damage, an evaluation on lymphocyte cells from residents of Mamuju, West Sulawesi, Indonesia was tested. The mean annual dose received by individuals in this area is about 10.40 mSv. Of the 177 adult subjects studied, 102 were from high-level natural radiation areas of Mamuju and 75 subjects were from a nearby normal-level natural radiation area. Both areas are similar in living situations. DNA strand breaks and other parameters of study and control group were determined using a standardized comet assay. Our results showed that chronic low-level natural radiation had resulted in significantly higher (p<0.001) DNA damage based on the three parameters of the assay (tail length, tail DNA, and tail moment) compared to those of control. There was a positive correlation between the level of DNA damage and age, where people aged 40 years and older had a higher level of DNA damage than those under 40 year. The level of DNA damage was also found to be higher in females compared to that of males. It was concluded that chronic exposure to natural radiation in Mamuju had induced spontaneous DNA damage in human cells after long-term exposure which was dependent on age and sex.
... MDL of the assay increases with the increasing time of blood collection after exposure (due to DSB repair), which cannot be circumvented (28,45). After the collection of blood, the repair process can be slowed down by storing the sample in cold conditions (79,80). MDLs of the cytogenetic assays remain constant over the application time window. ...
Article
Full-text available
A rapid and reliable method for biodosimetry of populations exposed to ionizing radiation in the event of an incident or accident is crucial for initial triage and medical attention. DNA-double strand breaks (DSBs) are indicative of radiation exposure, and DSB-repair proteins (53BP1, γH2AX, ATM, etc.) are considered sensitive markers of DSB quantification. Phospho-53BP1 and γH2AX immunofluorescence technique serves as a sensitive, reliable, and reproducible tool for the detection and quantification of DSB-repair proteins, which can be used for biological dose estimations. In this study, dose-response curves were generated for 60Co-γ-rays induced phospho-53 Binding Protein 1 (phospho-53BP1) foci at 1, 2, 4, 8, 16, and 24 h, post-irradiation for a dose range of 0.05–4 Gy using fluorescence microscopy. Following ISO recommendations, minimum detection limits (MDLs) were estimated to be 16, 18, 25, 40, 50, and 75 mGy for dose-response curves generated at 1, 2, 4, 8, 16, and 24 h post-irradiation. Colocalization and correlation of phospho-53BP1 and γH2AX were also measured in irradiated peripheral blood lymphocytes (PBLs) to gain dual confirmation. Comparative evaluation of the established curve was made by γH2AX-immunofluorescence, dicentric chromosome assay (DCA), and reciprocal translocation (RT) assays by reconstructing the dose of 6 dose-blinded samples. Coefficients of respective in-house established dose-response curves were employed to reconstruct the blind doses. Estimated doses were within the variation of 4.124%. For lower doses (0.052 Gy), phospho-53BP1 and γH2AX assays gave closer estimates with the variation of −4.1 to + 9% in comparison to cytogenetic assays, where variations were −8.5 to 24%. For higher doses (3 and 4 Gy), both the cytogenetic and immunofluorescence (phospho-53BP1 and γH2AX), assays gave comparable close estimates, with −11.3 to + 14.3% and −10.3 to −13.7%, variations, respectively.
... The European Comet Assay Validation Group conducted a number of ring-trials with the aim of assessing the inter-laboratory variation procedures and results by the comet assay (62)(63)(64)(65)(66)(67)(68). Lately, the hCOMET project are conducting ringtrials to test potassium bromate as a positive assay control in cryopreserved samples (69,70). The comet assay has been thoroughly validated in studies that led up to the adoption of the technique for OECD guideline test no 489 (71)(72)(73). ...
Article
Full-text available
Large plastic litters degrade in the environment to micro- and nanoplastics, which may then enter the food chain and lead to human exposure by ingestion. The present study explored ways to obtain nanoplastic particles from real-life food containers. The first set of experiments gave rise to polypropylene nanoplastic suspensions with a hydrodynamic particle size range between 100 and 600 nm, whereas the same grinding process of polyethylene terephthalate (PET) produced suspensions of particles with a primary size between 100 and 300 nm. The exposure did not cause cytotoxicity measured by the lactate dehydrogenase (LDH) and water soluble tetrazolium 1 (WST-1) assays in Caco-2 and HepG2 cells. Nanoplastics of transparent PET food containers produced a modest concentration-dependent increase in DNA strand breaks, measured by the alkaline comet assay [net induction of 0.28 lesions/106 bp at the highest concentration (95% CI: 0.04; 0.51 lesions/106 base pair)]. The exposure to nanoplastics from transparent polypropylene food containers was also positively associated with DNA strand breaks [i.e., net induction of 0.10 lesions/106 base pair (95% CI: −0.04; 0.23 lesions/106 base pair)] at the highest concentration. Nanoplastics from grinding of black colored PET food containers demonstrated no effect on HepG2 and Caco-2 cells in terms of cytotoxicity, reactive oxygen species production or changes in cell cycle distribution. The net induction of DNA strand breaks was 0.43 lesions/106 bp (95% CI: 0.09; 0.78 lesions/106 bp) at the highest concentration of nanoplastics from black PET food containers. Collectively, the results indicate that exposure to nanoplastics from real-life consumer products can cause genotoxicity in cell cultures.
... Original EPIC samples are also of the buffy coat type, but during the reinvitations, PBMCs were stored as well. We and others have shown that frozen whole blood samples, buffy coat and PBMCs can in principle be used for comet assay analysis [21,22]. Here, we wanted to investigate whether long stored buffy coat samples or PBMCs from the EPIC-Heidelberg biobank are suitable for comet assay analysis, so as to assess the feasibility of using the comet assay in large-scale epidemiological cohorts with archived biosamples. ...
Article
The comet assay is widely used for quantification of genomic damage in humans. Peripheral blood derived mononuclear cells (PBMCs) are the most often used cell type for this purpose. Since the comet assay can be performed in an enhanced throughput format, it can be applied to large sample collections such as biobanks. The European Prospective Investigation into Cancer and Nutrition (EPIC) study is one of the largest existing prospective cohort studies, and the German Cancer Research Institute (DKFZ) in Heidelberg is a participating center with 25.000 frozen blood samples stored from around 25 years ago, enabling retrospective assessment of disease risk factors. However, experience with decades long frozen samples in the comet assay is so far missing. In Heidelberg, 800 study participants were re-invited twice between 2010 and 2012 to donate further blood samples. Here, we analyzed 299 Heidelberg-EPIC samples, compiled from frozen PBMC and buffy coat preparations selected from the different sampling time points. In addition, 47 frozen PBMC samples from morbidly obese individuals were included. For buffy coat samples, we observed a poor correlation between DNA damage in the same donors assessed at two sampling time points. Additionally, no correlation between DNA damage in buffy coat samples and PBMCs was found. For PBMCs, a good correlation was observed between samples of the same donors at the two time points. DNA damage was not affected by age and smoking status, but high BMI (>30; obesity) was associated with increased DNA damage in PBMCs. There was no indication for a threshold of a certain BMI for increased DNA damage. In conclusion, while 25 year-long stored buffy coat preparations may require adaptation of certain experimental parameters such as cell density and electrophoresis conditions, frozen PBMC biobank samples can be analyzed in the comet assay even after a decade of storage.
... Time between sampling and comet assay. Contrary to lymphocytes or white blood cells (Moller et al., 2021) no study has been done about the impact of the time between collection of colonic samples and the comet assay. Therefore, we recommend short-term storage. ...
Article
Full-text available
We recently characterized the association between DNA damage and immunoresponse in vivo in colonic mucosa of mice infected with a Salmonella Typhimurium strain expressing a genotoxin, known as typhoid toxin. In this protocol, we describe the specific steps for assessing DNA damage by the alkaline comet assay of colonic mucosal samples. The description of the comet assay protocol follows the international guidelines (Minimum Information for Reporting on the Comet Assay [Moller et al., 2020]). For complete details on the use and execution of this protocol, please refer to Martin et al. (2021).
... Single and double strand breaks, alkali label sites, and strand breaks associated with incomplete excision repair will facilitate the relaxation of DNA, indicating higher DNA damage. During the analysis, damaged cells appear as comets and the more the DNA is damaged the higher the intensity of tail is detected Collins et al. 2014;Gajski, Gerić, et al. 2020;Gajski, Langie, and Zhanataev 2020;Gerić et al. 2018;Møller et al. 2021Møller et al. , 2020Tice et al. 2000). TI reflects the percentage of DNA in the tail and it is also associated with increased risk of all-type cancer incidence and may predict the risk of death (Bonassi et al. 2021;Milić et al. 2021), while TL reflecting the comet tail's length and TM as a derivate of TL and TI have recently been discouraged from use. ...
Article
The health benefit of a vegetarian diet is still under debate as it may result in a higher intake of some beneficial micronutrients, while others may be reduced, thus influencing various metabolic pathways and health-related biomarkers. This scoping review discusses inflammatory, oxidative and DNA damage status in vegetarians and vegans compared to omnivores. Most of the reviewed studies indicated favorable effects of a vegetarian diet on oxidative status compared to omnivores but did not clearly associate particular dietary habits to genome damage. The evidence on the effect of vegetarian diet on the inflammatory and immunological biomarkers is poor, which could at least partly be explained by methodological constraints such as small sample size, short duration of vegetarianism and inconsistent definitions of the omnivorous diet. The only inflammatory biomarker that seems to be associated with the vegetarian diet was inflammatory mediator C-reactive protein, which in several studies showed lower values in vegetarians as compared to omnivores. There were very few studies on immunological markers and the results on the difference between vegetarians and omnivores were inconclusive. Although several biomarkers involved in oxidative stress and inflammation showed a beneficial association with the vegetarian diet, further research in well-defined and sufficiently sized cohorts is needed to provide more evidence.
... To determine whether this approach is valid for detecting different types of DNA damage, salivary leucocytes and PBL were exposed to genotoxic agents with different action mechanisms: MMS, Act-D, UV radiation and KBrO 3 . Since there is evidence to suggest that PBL can be cryopreserved for several years without much effect on the level of DNA damage (reviewed in Møller et al. 2021), frozen PBL were used in this study as the gold standard for comparison purposes. Figure 2 shows the results obtained in the standard comet assay for MMS treatments. ...
Article
Full-text available
Peripheral blood leucocytes (PBL) have been traditionally used to investigate DNA damage by the comet assay in population studies, but validating alternative non-invasive samples would expand the application of this assay in human biomonitoring. The objectives of this study were (i) to test the validity of salivary leucocytes as a proper biomatrix for the comet assay, (ii) to evaluate the ability of this approach to detect different types of primary and oxidative DNA damage, and (iii) to determine whether frozen salivary leucocytes are still suitable for displaying those types of DNA damage. Fresh and frozen leucocytes isolated from saliva samples (six healthy non-smoking volunteers), were exposed to four genotoxic agents inducing different types of DNA damage, both primary (methyl methanesulfonate, actinomycin-D, ultraviolet radiation) and oxidative (potassium bromate), and standard or enzyme-modified comet assay was conducted. Results were compared with those obtained from PBL. Cells exposed to the four genotoxic agents showed dose-dependent increases of primary and oxidative DNA damage, demonstrating the suitability of all these samples to detect genetic damage from different origin. When comparing baseline levels of DNA damage, just a slight significant increase in primary DNA damage was observed in frozen salivary leucocytes regarding the other biomatrices, but similar results were obtained regarding sensitivity to DNA damage induction by all agents tested. This study demonstrates that salivary leucocytes can be employed in comet assay as an alternative or complement to blood samples. Frozen salivary leucocytes were proved to be a very convenient sample in large biomonitoring studies.
Article
The comet assay is a simple technique for measurements of low levels of DNA damage and repair in single cells. However, there is variation in background levels of DNA damage in peripheral blood mononuclear cells (PBMCs). This variation has been documented by inter-laboratory ring-trials where identical samples have been analysed in different laboratories using the formamidopyrimidine DNA glycosylase (Fpg)-modified comet assay. The coefficient of variation of background levels of Fpg-sensitive sites was 128% in the first inter-laboratory validation trial called European Standards Committee on Oxidative DNA Damage. The variation was reduced to 44% by the end of the project. Subsequent ring-trials by the European Comet Assay Validation Group showed similar inter-laboratory variation in Fpg-sensitive sites in PBMCs (45%). The lowest inter-laboratory variation in Fpg-sensitive sites in PBMCs was 12% when using calibration to standardize comet assay descriptors. Introduction of standard comet assay procedures was surprisingly unsuccessful as certain laboratories experienced technical problems using unaccustomed assay conditions. This problem was alleviated by using flexible assay standard conditions rather than a standard protocol in a ring-trial by the hCOMET group. The approach reduced technical problems, but the inter-laboratory variation in Fpg-sensitive sites was not reduced. The ring-trials have not pinpointed specific assay steps as major determinants of the variation in DNA damage levels. It is likely that small differences in several steps cause inter-laboratory variation. Although this variation in reported DNA damage levels causes concern, ring-trials have also shown that the comet assay is a reliable tool in biomonitoring studies.
Article
Carbon nanotubes (CNTs) were the first nanomaterials to be evaluated by the International Agency for Research on Cancer (IARC). The categorization as possibly carcinogenic agent to humans was only applicable to multi-walled carbon nanotubes called MWCNT-7. Other types of CNTs were not classifiable because of missing data and it was not possible to pinpoint unique CNT characteristics that cause cancer. Importantly, the European Commission’s Joint Research Centre (JRC) has established a repository of industrially manufactured nanomaterials that encompasses at least four well-characterized MWCNTs called NM-400 to NM-403 (original JRC code). This review summarizes the genotoxic effects of these JRC materials and MWCNT-7. The review consists of 36 publications with results on cell culture experiments (22 publications), animal models (9 publications) or both (5 publications). As compared to the publications in the IARC monograph on CNTs, the current database represents a significant increase as there is only an overlap of 8 publications. However, the results come mainly from cell cultures and/or measurements of DNA strand breaks by the comet assay and the micronucleus assay (82 out of 97 outcomes). A meta-analysis of cell culture studies on DNA strand breaks showed a genotoxic response by MWCNT-7, less consistent effect by NM-400 and NM-402, and least consistent effect by NM-401 and NM-403. Results from other in vitro tests indicate strongest evidence of genotoxicity for MWCNT-7. There are too few observations from animal models and humans to make general conclusions about genotoxicity.
Article
Full-text available
The comet assay is an electrophoretic technique used to assess DNA damage, as a marker of genotoxicity and oxidative stress, in tissues and biological samples including peripheral blood mononuclear cells (PBMCs) and whole blood (WB). Although numerous studies are performed on stored samples, the impact of cryopreservation on artifactual formation of DNA damage is not widely considered. The present study aims to evaluate the impact of storage at different time-points on the levels of strand breaks (SBs) and formamidopyrimidine DNA glycosylase (Fpg)-sensitive sites in isolated PBMCs and WB. Samples were collected, aliquoted and stored at − 80 °C. DNA damage was analyzed on fresh samples, and subsequently on frozen samples every 2 months up to a year. Results have shown no changes in DNA damage in samples of PBMCs and WB stored for up to 4 months, while a significant increase in SBs and Fpg-sensitive sites was documented starting from 6-month up to 12-month storage of both the samples. In addition, fresh and frozen WB showed higher basal levels of DNA damage compared to PBMCs. In conclusion, WB samples show high levels of DNA damage compared to PBMCs. One-year of storage increased the levels of SBs and Fpg-sensitive sites especially in the WB samples. Based on these findings, the use of short storage times and PBMCs should be preferred because of low background level of DNA damage in the comet assay.
Article
Full-text available
Deficiencies in DNA damage response and repair (DDRR) can cause serious pathological outcomes; therefore, having an ability to determine individual DDRR would enhance specificities in health risk assessment and in determining individual’s response to cancer therapies. However, most methods for evaluating DDRR are not fully appropriate for population studies. The Challenge-Comet assay has gained acceptance for this purpose. The assay has traditionally used X-rays as challenge agent and isolated peripheral blood mononuclear cells (PBMC) as cell specimen. To enhance the usefulness of the assay, the objectives of this investigation were to use differently processed blood samples, to employ other challenge agents with different mechanisms of induction of DNA damage/repair, and to generate protocols for detecting different DDRR capacities. Fresh and frozen blood samples were challenged with bleomycin, methyl methanesulfonate (MMS) and ultraviolet light. Significant induction of damage after all treatments, and progressive and time-dependent DDRR were observed. No significant differences were obtained in the DDRR capacities of fresh or frozen whole blood samples as compared to PBMC, except that fresh blood samples showed higher MMS-induced DDRR capacity than PBMC. Results from this study show that the Challenge-Comet assay can be used as routine biomarker of DDRR capacity in human biomonitoring studies, and that whole blood is also a useful biomatrix for this assay. The collected data allow us to recommend different protocols for the Challenge-Comet assay which are useful for evaluating DDRR capacities in several key DNA repair pathways. Consequently, the usefulness of the Challenge-Comet assay can be greatly expanded.
Article
Full-text available
Background: Genetic material from large patient cohorts is increasingly central to translational genetic research. However, patient blood samples are a finite resource and their supply and storage are often dictated by clinical and not research protocols. Our experience supports difficulty in amplifying DNA from blood stored in herparin; a scenario that other researchers may have or will encounter. This technical note describes a number of simple steps that enable successful PCR amplification. Methods: DNA was extracted using the Illustra Nucleon Genomic DNA Extraction Kit. PCR amplification was attempted using a number of commercially available PCR mastermixes. Results: PCR DNA amplification failed using ReddyMix™ PCR Master Mix, Thermo-Start® (Thermo Scientific Inc. US) and ZymoTaq™ (Zymo research, US) PCR mastermixes, as demonstrated absence of products on gel electrophoresis. However, using the Invitrogen™ (Thermo Scientific Inc., US) Platinum® Taq DNA Polymerase, PCR products were identified on a 1% agarose gel for all samples. PCR products were cleaned with ExoSAP-IT® (Affymetrix Inc., US) and a sequencing reaction undertaken using a standard Big Dye protocol. Subsequent genotyping was successful for all samples for alleles at the CDH1 locus. Conclusion: From our experience a standard phenol/chloroform purification and using the Invitrogen™ Platinum® Taq has enabled the amplification of whole blood samples taken into lithium heparin and stored frozen for up to a month. This simple method may enable investigators to utilise blood taken in lithium heparin for DNA extraction and amplification.
Article
Full-text available
Cellular repair enzymes remove virtually all DNA damage before it is fixed; repair therefore plays a crucial role in preventing cancer. Repair studied at the level of transcription correlates poorly with enzyme activity, and so assays of phenotype are needed. In a biochemical approach, substrate nucleoids containing specific DNA lesions are incubated with cell extract; repair enzymes in the extract induce breaks at damage sites; and the breaks are measured with the comet assay. The nature of the substrate lesions defines the repair pathway to be studied. This in vitro DNA repair assay has been modified for use in animal tissues, specifically to study the effects of aging and nutritional intervention on repair. Recently, the assay was applied to different strains of Drosophila melanogaster proficient and deficient in DNA repair. Most applications of the repair assay have been in human biomonitoring. Individual DNA repair activity may be a marker of cancer susceptibility; alternatively, high repair activity may result from induction of repair enzymes by exposure to DNA-damaging agents. Studies to date have examined effects of environment, nutrition, lifestyle, and occupation, in addition to clinical investigations.
Article
Full-text available
The comet assay has developed over the past 30 years and today, a variety of different DNA lesions and DNA repair can be measured by different versions of the assay (Collins, 2004). In the final step of the method, an image resembling a comet with a head (the nuclear core) and a tail (consisting of mainly single stranded DNA that has migrated out from the cell nuclei) is analyzed. The magnitude of the comet's DNA-tail provides information about the level of DNA lesions in the cell. The results from comet assay analyses are reported using different descriptors, the most frequently used being percentage of DNA in the tail (%T), tail length and tail moment (the product of %T and tail length). These descriptors can be reported in different ways, i.e., as means, medians or as distribution patterns. To compile the information on the migration of thousands of comets into a single value that is meaningful to convey to other researchers, is difficult. The solution has been practical and controlled by those researchers with the longest experience with the comet assay. In this opinion paper, we revisit the search for a commonly accepted descriptor for DNA damage measured by the comet assay. We define the “best” comet assay descriptor as a measurement that best describes the migration of DNA in each comet in the agarose, fits the distribution of comets in the gel, and conveys the technical measurement of comets as a descriptor that other researchers can understand. It should be emphasized that we do not embark on a mission to promote only one comet assay descriptor.
Article
Full-text available
This study investigated the levels of DNA strand breaks and formamidopyrimidine DNA glycosylase (FPG) sensitive sites, as assessed by the comet assay, in peripheral blood mononuclear cells (PBMC) from healthy women from five different countries in Europe. The laboratory in each country (referred to as 'centre') collected and cryopreserved PBMC samples from three donors, using a standardised cell isolation protocol. The samples were analysed in 13 different laboratories for DNA damage, which is measured by the comet assay. The study aim was to assess variation in DNA damage in PBMC samples that were collected in the same way and processed using the same blood isolation procedure. The inter-laboratory variation was the prominent contributor to the overall variation. The inter-laboratory coefficient of variation decreased for both DNA strand breaks (from 68 to 26%) and FPG sensitive sites (from 57 to 12%) by standardisation of the primary comet assay endpoint with calibration curve samples. The level of DNA strand breaks in the samples from two of the centres (0.56-0.61 lesions/10(6) bp) was significantly higher compared with the other three centres (0.41-0.45 lesions/10(6) bp). In contrast, there was no difference between the levels of FPG sensitive sites in PBMC samples from healthy donors in the different centres (0.41-0.52 lesion/10(6) bp).
Article
Full-text available
Preservation of human blood cells for DNA damage analysis with the comet assay conventionally involves the isolation of mononuclear cells by centrifugation, suspension in freezing medium and slow freezing to -80 °C-a laborious process. A recent publication (Al-Salmani et al. Free Rad Biol Med 2011; 51: 719-725) describes a simple method in which small volumes of whole blood are frozen to -20 or -80 °C; on subsequent thawing, the comet assay is performed, with no indication of elevated DNA strand breakage resulting from the rapid freezing. However, leucocytes in whole blood (whether fresh or frozen) are abnormally resistant to damage by H2 O2 , and so a common test of antioxidant status (resistance to strand breakage by H2 O2 ) cannot be used. We have refined this method by separating the leucocytes from the thawed blood; we find that, after three washes, the cells respond normally to H2 O2 . In addition, we have measured specific endogenous base damage (oxidized purines) in the isolated leucocytes, using the enzyme formamidopyrimidine DNA glycosylase. In a study of blood samples from 10 subjects, H2 O2 sensitivity and endogenous damage-both reflecting the antioxidant status of the cells-correlated significantly. This modified approach to sample collection and storage is particularly applicable when the available volume of blood is limited and has great potential in biomonitoring and ecogenotoxicology studies where samples are obtained in the field or at sites remote from the testing laboratory. Copyright © 2013 John Wiley & Sons, Ltd.
Article
Full-text available
The comet analysis of DNA strand break levels in tissues and cells has become a common method of screening for genotoxicity. The large majority of published studies have used fresh tissues and cells processed immediately after collection. However, we have used frozen tissues and cells for more than 10 years, and we believe that freezing samples improve efficiency of the method. We compared DNA strand break levels measured in fresh and frozen bronchoalveolar cells, and lung and liver tissues from mice exposed to the known mutagen methyl methanesulphonate (0, 25, 75, 112.5mg/kg). We used a high-throughput comet protocol with fully automated scoring of DNA strand break levels. The overall results from fresh and frozen samples were in agreement [R 2 = 0.93 for %DNA in tail (%TDNA) and R 2 = 0.78 for tail length (TL)]. A slightly increased %TDNA was observed in lung and liver tissue from vehicle controls; and TL was slightly reduced in bronchoalveolar lavage cells from the high-dose group. In our comet protocol, a small block of tissue designated for comet analysis is frozen immediately at tissue collection and kept deep frozen until rapidly homogenised and embedded in agarose. To demonstrate the feasibility of long-term freezing of samples, we analysed the day-to-day variation of our internal historical negative and positive comet assay controls collected over a 10-year period (1128 observations, 11 batches of frozen untreated and H2O2-treated A549 lung epithelial cells). The H2O2 treatment explained most of the variation 57–77% and the day-to-day variation was only 2–12%. The presented protocol allows analysis of samples collected over longer time span, at different locations, with reduced variation by reducing number of electrophoreses and is suitable for both toxicological and epidemiological studies. The use of frozen tissues; however, requires great care during preparation before analysis, with handling as a major risk factor.
Article
Full-text available
DNA repair is a cellular defence mechanism responding to DNA damage caused in large part by oxidative stress. There is a controversy with regard to the effect of red blood cells on DNA damage and cellular response. To investigate the effect of red blood cells on H2O2-induced DNA damage and repair in human peripheral blood mononuclear cells. DNA breaks were induced in peripheral blood mononuclear cells by H2O2 in the absence or presence of red blood cells, red blood cells hemolysate or hemoglobin. DNA repair was measured by (3)H-thymidine uptake, % double-stranded DNA was measured by fluorometric assay of DNA unwinding. DNA damage was measured by the comet assay and by the detection of histone H2AX phosphorylation. Red blood cells and red blood cells hemolysate reduced DNA repair in a dose-dependent manner. Red blood cells hemolysate reduced % double-stranded DNA, DNA damage and phosphorylation of histone H2AX. Hemoglobin had the same effect as red blood cells hemolysate on % double-stranded DNA. Red blood cells, via red blood cells hemolysate and hemoglobin, reduced the effect of oxidative stress on peripheral blood mononuclear cell DNA damage and phosphorylation of histone H2AX. Consequently, recruitment of DNA repair proteins diminished with reduction of DNA repair. This suggests that anemia predisposes to increased oxidative stress induced DNA damage, while a higher hemoglobin level provides protection against oxidative-stress-induced DNA damage.
Article
Full-text available
Inter-individual susceptibility to mutagens/carcinogens can be assessed by either genotyping DNA repair genes in different pathways or phenotyping DNA repair capacity (DRC) at the molecular or cellular level. Due to the large number of known DNA repair genes, and the interactions between repair pathways, phenotyping is becoming the preferred approach to measure DRC, and reliable assays are therefore increasingly needed. The use of a cellular phenotype comet assay for the nucleotide excision repair (NER) pathway using benzo[a]pyrene diol epoxide (BPDE) has been described in previous papers, but no thorough evaluation of its applicability in large genotype-phenotype studies has been presented. Our aim was to evaluate the possibility of using cryopreserved instead of fresh peripheral blood mononuclear cells (PBMCs) to evaluate intra- and inter-assay variation, and inter-individual variation, for the aphidicolin (APC)-block NER comet assay. Moreover, we measured the variation for the designated internal standard (K562 erythroleukaemia cell line) and we evaluated the feasibility to use lymphoblastoid cell lines (LCLs) as surrogate of PBMCs. Our results showed a low intra-assay [coefficient of variation (CV) 19.9%] and inter-assay (CV 32.3%) variation, with a good inter-individual variation (122 subjects, mean ± standard deviation 7.38±4.99; range 0.66-26.14; CV 67.63%). A significant correlation between results derived from cryopreserved and fresh PBMCs from the same individuals was found (10 subjects, r = 0.62, P = 0.05). Results from LCLs and cryopreserved PBMCs from the same subjects showed an inverse significant correlation (10 subjects, r = -0.712, P = 0.02). K562 cells as internal standard showed low intra-assay variation. In the present study the APC-block NER comet assay on cryopreserved PBMCs seemed to be a reliable method to measure DRC variation in epidemiological studies; LCLs were not a good surrogate in this assay.
Article
This optimized protocol (including links to instruction videos) describes a comet-based in vitro DNA repair assay that is relatively simple, versatile, and inexpensive, enabling the detection of base and nucleotide excision repair activity. Protein extracts from samples are incubated with agarose-embedded substrate nucleoids (‘naked’ supercoiled DNA) containing specifically induced DNA lesions (e.g., resulting from oxidation, UVC radiation or benzo[a]pyrene-diol epoxide treatment). DNA incisions produced during the incubation reaction are quantified as strand breaks after electrophoresis, reflecting the extract’s incision activity. The method has been applied in cell culture model systems, human biomonitoring and clinical investigations, and animal studies, using isolated blood cells and various solid tissues. Once extracts and substrates are prepared, the assay can be completed within 2 d. This protocol describes a comet-based in vitro assay for detecting base and nucleotide excision repair activity for use in cell culture model systems, human biomonitoring and clinical investigations, and animal studies, using isolated blood cells and various solid tissues.
Article
The comet assay is a popular assay in biomonitoring studies. DNA strand breaks (or unspecific DNA lesions) are measured using the standard comet assay. Oxidative stress-generated DNA lesions can be measured by employing DNA repair enzymes to recognise oxidatively damaged DNA. Unfortunately, there has been a tendency to fail to report results from assay controls (or maybe even not to employ assay controls). We believe this might have been due to uncertainty as to what really constitutes a positive control. It should go without saying that a biomonitoring study cannot have a positive control group as it is unethical to expose healthy humans to DNA damaging (and thus potentially carcinogenic) agents. However, it is possible to include assay controls in the analysis (here meant as a cryopreserved sample of cells i.e. included in each experiment as a reference sample). In the present report we tested potassium bromate (KBrO3) as a positive comet assay control for the formamidopyrimidine DNA glycosylase (Fpg)-modified comet assay. Ten laboratories used the same procedure for treatment of monocytic THP-1 cells with KBrO3 (0.5, 1.5 and 4.5 mM for 1 h at 37°C) and subsequent cryopreservation. Results from one laboratory were excluded in the statistical analysis because of technical issues in the Fpg-modified comet assay. All other laboratories found a concentration-response relationship in cryopreserved samples (regression coefficients from 0.80 to 0.98), although with different slopes ranging from 1.25 to 11.9 Fpg-sensitive sites (%DNA in tail) per 1 mM KBrO3. Our results demonstrate that KBrO3 is a suitable positive comet assay control.
Article
This study proposes the application of the comet assay for the evaluation of DNA damage from frozen human whole blood samples that could be readily used in human biomonitoring and epidemiological studies. It was done on simply frozen whole blood samples collected from male volunteers (N = 60) aliquoted in small volumes and stored at -80 °C without the addition of cryopreservatives for a period of 5 years. To test the applicability of the alkaline comet assay for the evaluation of DNA damage in frozen whole blood, samples were quickly thawed at 37 °C and immediately embedded in an agarose matrix followed by an alkaline comet assay procedure. We concluded that the whole blood freezing and prolonged storage do not severely affect comet assay values, although background values were higher compared to our historical control data from the fresh whole blood. Even the influence of the variables tested, such as age, body mass index, smoking habit and alcohol consumption were in agreement with our previous data using fresh blood. The obtained results suggest that the comet assay could be applied to frozen blood samples, if properly stored, even for decades, which would certainly facilitate large-scale human biomonitoring and long-term epidemiological studies.
Article
The comet assay is a well-accepted biomonitoring tool to examine the effect of dietary, lifestyle, environmental and occupational exposure on levels of DNA damage in human cells. With such a wide range of determinants for DNA damage levels, it becomes challenging to deal with confounding and certain factors are inter-related (e.g. poor nutritional intake may correlate with smoking status). This review describes the effect of intrinsic (i.e. sex, age, tobacco smoking, occupational exposure and obesity) and extrinsic (season, environmental exposures, diet, physical activity and alcohol consumption) factors on the level of DNA damage measured by the standard or enzyme-modified comet assay. Although each factor influences at least one comet assay endpoint, the collective evidence does not indicate single factors have a large impact. Thus, controlling for confounding may be necessary in a biomonitoring study, but none of the factors is strong enough to be regarded a priori as a confounder. Controlling for confounding in the comet assay requires a case-by-case approach. Inter-laboratory variation in levels of DNA damage and to some extent also reproducibility in biomonitoring studies are issues that have haunted the users of the comet assay for years. Procedures to collect specimens, and their storage, are not standardized. Likewise, statistical issues related to both sample-size calculation (before sampling of specimens) and statistical analysis of the results vary between studies. This review gives guidance to statistical analysis of the typically complex exposure, co-variate, and effect relationships in human biomonitoring studies.
Article
The comet assay is widely used in studies on genotoxicity testing, human biomonitoring and clinical studies. The simple version of the assay detects a mixture of DNA strand breaks and alkali-labile sites; these lesions are typically described as DNA strand breaks to distinguish them from oxidatively damaged DNA that are measured with the enzyme-modified comet assay. This review assesses the association between high-prevalence diseases in high-income countries and DNA damage measured with the comet assay in humans. The majority of case-control studies have assessed genotoxicity in white blood cells. Patients with coronary artery disease, diabetes, kidney disease, chronic obstructive pulmonary disease and Alzheimer's disease have on average 2-fold higher levels of DNA strand breaks compared with healthy controls. Patients with coronary artery disease, diabetes, kidney disease and chronic obstructive pulmonary disease also have 2- to 3-fold higher levels of oxidatively damaged DNA in white blood cells than controls, although there is not a clear difference in DNA damage levels between the different diseases. Case-control studies have shown elevated levels of DNA strand breaks in patients with breast cancer, whereas there are only few studies on colorectal and lung cancers. At present, it is not possible to assess if these neoplastic diseases are associated with a different level of DNA damage compared with non-neoplastic diseases.
Article
The comet assay (single cell gel electrophoresis) is widely used as a biomonitoring tool to assess DNA damage - strand breaks, as well as oxidised bases; it can also be adapted to measure DNA repair. It is based on the ability of breaks in the DNA to relax supercoiling, allowing DNA loops to extend from the nuclear core (nucleoid) under an electric field to form a comet-like tail. Most commonly, it is applied to white blood cells. The range of detection is between a few hundred breaks per cell and a few thousand, encompassing levels of damage that can be repaired and tolerated by human cells. Its applications include monitoring various diseases, studying the influence of nutrition on DNA stability, and investigating effects of environmental and occupational mutagens. Here we address the issue of inter-laboratory variation in comet assay results. This variation is largely due to differences in methods. Imposing a standard protocol is not practical, but users should be aware of the crucial parameters that affect performance of the assay. These include the concentration of agarose in which the cells are embedded; the duration of cell lysis, and of enzyme incubation when oxidised bases are being measured; the duration of alkaline unwinding; the duration of electrophoresis and the voltage gradient applied; and the method used to score the comets. Including reference standards in each experiment allows experimental variability to be monitored - and if variation is not extreme, results can be normalised using reference standard values. Reference standards are also essential for inter-laboratory comparison. Finally, we offer recommendations which, we believe, will limit variability and increase the usefulness of this assay in molecular epidemiology.
Article
Frozen buffy coat fractions are often stored in human biomonitoring trials but their use for biomarker purposes has been limited. The purpose of the current study was to study whether frozen buffy coats can be used to monitor DNA damage levels. EDTA blood samples were provided from 9 healthy, non-smoking female volunteers, aged 26–48. Pre-existing DNA damage (strand breaks and oxidised purines) was measured with the comet assay in thawed resuspended buffy coat samples and washed leukocytes from these buffy coats, as well as resistance to DNA damage induced exogenously by H2O2 in the latter, and compared with damage measured in peripheral blood mononuclear cells isolated from fresh blood using percoll gradient centrifugation. Basal DNA damage levels (strand breaks) were significantly higher in the leukocytes isolated from frozen buffy coats in the untreated samples compared with peripheral blood mononuclear cells. However, the levels of strand breaks were still low (<4% tail DNA), indicating that little damage is caused by freezing or processing. Base oxidation was significantly higher in isolated buffy coat leukocytes than in peripheral blood mononuclear cells from fresh blood, but showed a good correlation (r = 0.67) between the two cell types. The correlation for strand breaks was stronger (r = 0.85). H2O2 induced DNA breaks in the cells both from fresh blood and buffy coats. The results indicate that buffy coat samples stored from cohort studies might be usefully analysed for DNA damage in retrospective epidemiological investigations. However, caution should be exercised when comparing the absolute levels of DNA damage in buffy coat leukocytes and peripheral blood mononuclear cells.
Article
Using alkaline comet assay, DNA damage tail length (TL) and tail intensity (TI) parameters were compared between fresh whole blood and 1-year frozen small volume whole blood in EDTA at -80 °C without cryo-preservation. The studied group consisted of 25 volunteers with different health conditions who served as their own controls for frozen blood results. Without the purification step after thawing, the results and the usefulness of this protocol for future/retrospective (including re-analysations of putative outliers) studies were analysed. Medical surveillance and blood sampling were done at Merkur University Hospital Zagreb. No significant differences between fresh and frozen blood samples in terms of the mean TL values (mean ± SD: 29.03 ± 12.26 vs. 25.36 ± 6.97, respectively) and the mean TI values (9.19 ± 10.37 vs. 10.17 ± 8.55, respectively), and highly damaged cell percentage were determined among 25 volunteers. Median TI frozen samples values of entire group were within the allowed 10–11% (8.24). At the individual levels, no correlation between fresh and frozen whole blood samples was observed in 11 volunteers who suffered from diabetes mellitus type 2. Strong correlation between fresh/frozen samples was seen for TL (r = 0.64, p < 0.015) and TI (r = 0.71, p < 0.005) in nondiabetic subgroup. Overall, the results demonstrated the usefulness of the 1-year frozen blood without induction of heavily damaged DNA. Due to the different DNA damage behaviour connected with different health conditions, future studies should involve more volunteers, oxidative DNA damage comet assay measurements, the inclusion of a washing step after thawing and inclusion of disease/antioxidant biomarkers.
Article
Assessment of DNA repair capacity (DRC) upon ex vivo challenge of peripheral blood mononuclear cells (PBMC) with oxidative damage inducing agents, as evaluated by the comet assay, is widely used as biomarker to assess the antioxidant status in human studies. Here, the alkaline comet assay was now optimized for easy and time saving detection of repair capacity upon oxidative stress-induced DNA damage using the DNA polymerase inhibitor aphidicolin (APC) to block repair of hydrogen peroxide (H 2 O 2 ) induced DNA damage. Addition of a DMSO-containing DNA damage stop solution was found suitable to replace washing steps for H 2 O 2 removal before APC block. Cell treatment with APC at 6 μM did not impact baseline DNA damage but could reliably block DNA repair after H 2 O 2 challenge in both fresh and cryopreserved samples thus omitting the use of a starting time point control. Under the conditions used, frozen cells, with or without an additional 4 h rest, showed the same repair capacity as their fresh counterpart. The intra assay coefficient of variation (CV) was 3.3%. To provide proof of principle, the modified assay was applied to cryopreserved PBMC from 19 participants of a short-term Brassica diet intervention study investigating potential health promoting effects of the food intervention. Then, a 33% increase in DRC (p ≤ 0.01) could be shown in samples after intervention (mean ± SD: 5.82 ± 1) as compared to baseline (mean ± SD: 4.38 ± 1.21). Individual samples from baseline and intervention showed an inter-individual CV of 27.65% (baseline) and 17.26% (intervention). Taken together this modified comet assay protocol allows the facilitated detection of DNA repair in fresh or cryopreserved human PBMC samples with a good sensitivity and reliability and could be useful in human studies addressing the antioxidant status and repair capacity of PBMC.
Article
The comet assay offers the opportunity to measure both DNA damage and repair. Various comet assay based methods are available to measure DNA repair activity, but some requirements should be met for their effective use in human biomonitoring studies. These conditions include i) robustness of the assay, ii) sources of inter- and intra-individual variability must be known, iii) DNA repair kinetics should be assessed to optimize sampling timing; and iv) DNA repair in accessible surrogate tissues should reflect repair activity in target tissues prone to carcinogenic effects. DNA repair phenotyping can be performed on frozen and fresh samples, and is a more direct measurement than genomic or transcriptomic approaches. There are mixed reports concerning the regulation of DNA repair by environmental and dietary factors. In general, exposure to genotoxic agents did not change base excision repair (BER) activity, whereas some studies reported that dietary interventions affected BER activity. On the other hand, in vitro and in vivo studies indicated that nucleotide excision repair (NER) can be altered by exposure to genotoxic agents, but studies on other life style related factors, such as diet, are rare. Thus, crucial questions concerning the factors regulating DNA repair and inter-individual variation remain unanswered. Intra-individual variation over a period of days to weeks seems limited, which is favourable for DNA repair phenotyping in biomonitoring studies. Despite this reported low intra-individual variation, timing of sampling remains an issue that needs further investigation. A correlation was reported between the repair activity in easily accessible peripheral blood mononuclear cells (PBMCs) and internal organs for both NER and BER. However, no correlation was found between tumour tissue and blood cells. In conclusion, although comet assay based approaches to measure BER/NER phenotypes are feasible and promising, more work is needed to further optimize their application in human biomonitoring and intervention studies.
Article
This study was designed within the frame of the COST Action hCOMET 15132 (Working Group 6), with the aim of comparing different peripheral blood cell preparations for their feasibility in human biomonitoring studies, using the comet assay for the evaluation of DNA damage. Basal levels of strand breaks/ALS and formamidopyrimidine DNA glycosylase (Fpg) - sites, and H2O2 (500 μM)-induced strand breaks, were measured in whole blood, peripheral blood mononuclear cells - lymphocytes and monocytes - and buffy coat; in fresh and 1, 4 and 12 weeks-frozen samples. The comparison among the fresh preparations showed that the basal levels of DNA damage were all very low and similar in the three samples. Frozen whole blood samples stored in cryostraws without cryoprotection showed similar basal levels of DNA damage as fresh samples, indicating that this preparation, often chosen for biobanks, resists efficiently freezing/thawing artifacts. However, long-term storage of frozen buffy coat samples in cryostraws and with no cryopreservative did not appear feasible. Storage up to 3 months of frozen cryoprotected peripheral blood mononuclear cells induced small increases in basal strand breaks and no other statistically significant modification. Altogether, this study suggests that whole blood could be the most suitable sample to be used to perform comet assay in human epidemiological biomonitoring for genotoxicity assessment in frozen samples, such as those stored in biobanks.
Chapter
Blood is a widely used biospecimen in the field of biobanking, secondary to the ease with which it is collected along with the wide variety of analytes obtained from it for analysis. It carries the potential to further the search for biomarkers in countless diseases; therefore, the standardization and optimization of blood collection procedures is of importance in assuring reproducibility of results. Here, we briefly review procedures for the procurement, storage, and use of blood and its fractions for biobanking purposes. Select commonly used methods for collecting blood with various vacutainer blood collection tubes are described, along with optimal storage conditions of various samples in short- and long-term situations.
Article
The comet assay is a commonly used method for in vitro and in vivo genotoxicity assessment. This versatile assay can be performed in a wide range of tissues and cell types. Although most of the studies use samples immediately processed after collection, frozen biological samples can also be used. The present study aimed to optimize a collection and freezing protocol to minimize the DNA damage associated with these procedures in human cell line samples for comet assay analysis. This study was conducted in glial A172 and lung alveolar epithelial A549 cells. Two cell detachment methods (mechanical vs enzymatic) and two cryoprotective media [FBS + 10% DMSO vs Cell Culture Media (CCM) + 10% DMSO] were tested, and DNA damage assessed at four time points following storage at −80 °C (one, two, four and eight weeks). In both cell lines, no differences in % tail intensity were detected between fresh and frozen cells up to eight weeks, irrespective of the harvesting method and freezing medium used. However, freshly isolated A172 cells exhibited a significant lower DNA damage when resuspended in CCM + 10% DMSO, while for A549 fresh cells the preferable harvesting method was the enzymatic one since it induced less DNA damage. Although both harvesting methods and cryoprotective media tested were found suitable, our data indicate that enzymatic harvesting and cryopreservation in CCM + 10% DMSO is a preferable method for DNA integrity preservation of human cell line samples for comet assay analysis. Our data also suggest that CCM is a preferable and cost-effective alternative to FBS in cryopreservation media. This optimized protocol allows the analysis of in vitro cell samples collected and frozen at different locations, with minimal interference on the basal DNA strand break levels in samples kept frozen up to eight weeks.
Chapter
Several reviews of the biophysical principles of cryobiology have been published recently and the interested reader is referred particularly to Mazur (1) for a detailed discussion or to Pegg (2) for an introductory account. In this chapter the science of cryopreservation will be approached in a more practical and applied way. We know that freezing living cells is normally lethal, a fact that is put to practical use in cryosurgery. But we also know that cooling slows the chemical processes both of life and of decay and this has lead to the idea that “suspended animation” might be achieved by cooling. Successful preservation will then depend on reducing the destructive action of ice but allowing the protective effect of low temperatures, such that any damaging effects are greatly outweighed by the protective effects. This is a complicated matter: many structures and processes are temperature-dependent and cooling has complex effects that combine to create conditions that are far removed from normal physiology. When cells are cooled much below 0°C, the effects are normally dominated by the freezing of water, which typically constitutes at least 80% of tissue mass. It was generally thought that the ice crystals were directly responsible for damage rather than the concentration of solutes in the progressively diminishing liquid phase as cooling proceeded.
Article
DNA damage measured by the comet assay is a well-established biomarker in studies on environmental and occupational exposures, dietary factors and clinical outcomes. Age and sex are typically regarded as confounding factors that are controlled by either selective inclusion criteria of subjects or adjustment in the statistical analysis. This review assesses the influence of age and sex on levels of DNA damage in leukocytes in study populations of healthy subjects. Analysis of unadjusted results in the studies indicates that the level of DNA strand breaks increases by 1% per year (95% CI: 0.9%–1.1%, linear regression analysis weighted for the number of subjects in the individual studies). The studies also show a slightly higher level of DNA strand breaks in men than women (8%, 95% CI: 0.4%–17%) in unadjusted analyses, which is not robust in studies with adjusted analyses. The attenuation of effect in adjusted analyses of DNA strand breaks in leukocytes indicates that the effect of age and sex may be driven by differences in lifestyle factors or other exposures. There do not appear to be differences related to age and sex on basal levels of oxidatively damaged DNA in leukocytes. In summary, the results indicate influences of both age and sex on DNA damage in the comet assay, which may be mediated by lifestyle factors or external exposures rather than direct effects of age and sex.
Article
Even if the comet assay has been widely used for decades, there is still a need for controlled studies and good mathematical models to assess the variability of the different versions of this assay and in particular to assess potential intra‐experimental variability of the high‐throughput comet assay. To address this point, we further validate a high‐throughput comet assay that uses hydrophilic polyester film (Gelbond®). Experiments were performed using human peripheral blood mononuclear cells (PBMC) either untreated or treated with different concentration of MMS (methyl methanesulfonate). A positive control for the Fpg (Formamidopyrimidine DNA glycosylase)‐modified comet assay (Ro 19‐8022 with light) was also included. To quantify the sources of variability of the assay, including intradeposit variability, instead of summarizing DNA damage on 50 cells from a deposit by the mean or median of their percentage DNA tail, we analyzed all logit‐transformed data with a linear mixed model. The main source of variation in our experimental data is between cells within the same deposit, suggesting genuine variability in the response of the cells rather than variation caused by technical treatment of cell samples. The second source of variation is the inter‐experimental variation (day‐to‐day experiment); the coefficient of this variation for the control was 13.6%. The variation between deposits in the same experiment is negligible. Moreover, there is no systematic bias because of the position of samples on the Gelbond® film nor the position of the films in the electrophoresis tank. This high‐throughput comet assay is thus reliable for various applications. Environ. Mol. Mutagen., 2018.
Article
Frailty has emerged as a reliable measure of the aging process. Since the early detection of frailty is crucial to prevent or even revert it, the use of biomarkers would allow an earlier and more objective identification of frail individuals. In order to improve the understanding of the biological features associated with frailty as well as to explore different biomarkers for its early identification, several genetic outcomes – mutagenicity, different types of genetic damage, and cellular repair capacity – were analysed in a population of older adults classified into frail, pre-frail and non-frail. Besides, influence of clinical parameters – nutritional status and cognitive status – was evaluated. No association of mutation rate or primary DNA damage with frailty was observed. However, DNA repair capacity showed a non-significant tendency to decrease with frailty, and persistent levels of phosphorylated H2AX, as indicative of DNA breakage, increased progressively with frailty severity. These results support the possible use of H2AX phosphorylation to provide information regarding frailty severity. Further investigation is necessary to determine the consistency of the current findings in different populations and larger sample sizes, to eventually standardize biomarkers to be used in clinics, and to fully understand the influence of cognitive impairment.
Article
During the last 30 years, the comet assay has become widely used for the measurement of DNA damage and repair in cells and tissues. A landmark achievement was reached in 2016 when the Organization for Economic Co-operation and Development adopted a comet assay guideline for in vivo testing of DNA strand breaks in animals. However, the comet assay has much more to offer than being an assay for testing DNA strand breaks in animal organs. The use of repair enzymes increases the range of DNA lesions that can be detected with the assay. It can also be modified to measure DNA repair activity. Still, despite the long-term use of the assay, there is a need for studies that assess the impact of variation in specific steps of the procedure. This is particularly important for the on-going efforts to decrease the variation between experiments and laboratories. The articles in this Special Issue of Mutagenesis cover important technical issues of the comet assay procedure, nanogenotoxicity and ionising radiation sensitivity on plant cells. The included biomonitoring studies have assessed seasonal variation and certain predictors for the basal level of DNA damage in white blood cells. Lastly, the comet assay has been used in studies on genotoxicity of environmental and occupational exposures in human biomonitoring studies and animal models. Overall, the articles in this Special Issue demonstrate the versatility of the comet assay and they hold promise that the assay is ready for the next 30 years.
Article
Obesity is associated with several detrimental health consequences, among them an increased risk for development of cancer, and an overall elevated mortality. Multiple factors like hyperinsulinemia, chronic microinflammation and oxidative stress may be involved. The comet assay has been proven to be very sensitive for detection of DNA damage and has been used to explore the relationship between overweight/obesity and DNA damage, but results are controversial. Very few investigations have been performed to correlate weight loss of obese individuals and possible reduction of DNA damage and these studies have not provided clear results. As currently, only surgical interventions (metabolic/bariatric surgery) enable substantial and sustained weight loss in the vast majority of morbidly obese patients, we analyzed whole blood samples of 56 subsequent patients prior, 6 and 12 months after bariatric surgery. No reduction of DNA damage was observed in comet assay analysis after 6 months despite efficient weight
Article
The comet assay is often applied in human biomonitoring. Most of the time the assay is performed with isolated peripheral blood mononuclear cells (PBMC). However, using whole blood instead of isolated cells reduces processing time, and only 20 µl is sufficient for analysis. In this study, a cryopreservation protocol for human whole blood for application in the comet assay was optimised by removing excess plasma before adding freezing medium. Cryopreservation of whole blood samples (n = 30) did not increase the detected level of strand breaks and formamidopyrimidine DNA glycosylase (FPG)-sensitive sites. Although there was no significant correlation with breaks measured in fresh whole blood, strand breaks detected in frozen whole blood were significantly correlated with breaks measured in frozen PBMC (Pearson correlation r = 0.54, P < 0.01). This correlation was however not observed for FPG-sensitive sites. Since we do not yet know the full extent to which cryopreservation might influence the blood cell population, care should be taken to ensure a similar cell type and storage conditions for all samples in one study.
Article
Since there are several predicting factors associated with the comet assay parameters, we have decided to assess the impact of seasonal variations on the comet assay results. A total of 162 volunteers were retrospectively studied, based on the date when blood donations were made. The groups (winter, spring, summer and autumn) were matched in terms of age, gender, smoking status, body mass index and medical diagnostic exposure in order to minimise the impact of other possible predictors. Means and medians of the comet assay parameters were higher when blood was sampled in the warmer period of the year, the values of parameters being the highest during summer. Correlation of meteorological data (air temperature, sun radiation and sun insolation) was observed when data were presented as the median per person. Using multivariate analysis, sampling season and exposure to medical radiation were proved to be the most influential predictors for the comet assay parameters. Taken together, seasonal variation is another variable that needs to be accounted for when conducting a cohort study. Further studies are needed in order to improve the statistical power of the results related to the impact of sun radiation, air temperature and sun insolation on the comet assay parameters.
Article
The formamidopyrimidine DNA glycosylase (Fpg) and human 8-oxoguanine DNA glycosylase (hOGG1)-modified comet assays have been widely used in human biomonitoring studies. The purpose of this article is to assess differences in reported levels of Fpg- and hOGG1-sensitive sites in leukocytes and suggest suitable assay controls for the measurement of oxidatively damaged DNA. An assessment of the literature showed a large variation in the reported levels of Fpg-sensitive sites (range 0.05-1.31 lesions/106 bp). The levels of Fpg-sensitive sites are lower in studies where Fpg has been obtained from commercial suppliers or unknown sources as compared to Fpg from one particular non-commercial source (χ2 = 7.14, P = 0.028). The levels of hOGG1-sensitive sites are lower (range: 0.04-0.18 lesions/106 bp in leukocytes) compared to the Fpg-sensitive sites. Surprisingly, few publications have reported the use of oxidising agents as assay controls, with the exception of hydrogen peroxide. This may be due to a lack of consensus about suitable controls for the Fpg- and hOGG1-modified comet assay. A major challenge is to find an oxidising agent that only oxidises nucleobases and does not generate DNA strand breaks because this reduces the dynamic range of Fpg- and hOGG1-sensitive sites in the comet assay. Based on a literature search we selected the photosensitiser Ro19-8022 plus light, KBrO3, 4-nitroquinoline-1-oxide, Na2Cr2O7 and ferric nitrilotriacetate as possible assay controls. A subsequent assessment of these compounds for generating cryopreserved assay controls in mononuclear blood cells showed that Ro19-8022 plus light, KBrO3 and 4-nitroquinoline-1-oxide provided suitable assay controls. We recommend these compounds as comet assay controls for oxidatively damaged DNA.
Article
The Comet assay is a reproducible and sensitive assay for the detection of DNA damage in eukaryotic cells and tissues. Incorporation of lesion specific, oxidative DNA damage repair enzymes (for example, Fpg, OGG1 and EndoIII) in the standard alkaline Comet assay procedure allows for the detection and measurement of oxidative DNA damage. The Comet assay using white blood cells (WBC) has proven useful in monitoring DNA damage from environmental agents in humans. However, it is often impractical to performance Comet assay immediately after blood sampling. Thus, storage of blood sample is required. In this study, we developed and tested a simple storage method for very small amount of whole blood for standard and Fpg-modified modified Comet assay. Whole blood was stored in RPMI 1640 media containing 10% FBS, 10% DMSO and 1 mM deferoxamine at a sample to media ratio of 1:50. Samples were stored at −20 °C and −80 °C for 1, 7, 14 and 28 days. Isolated lymphocytes from the same subjects were also stored under the same conditions for comparison. Direct DNA strand breakage and oxidative DNA damage in WBC and lymphocytes were analyzed using standard and Fpg-modified alkaline Comet assay and compared with freshly analyzed samples. No significant changes in either direct DNA strand breakage or oxidative DNA damage was seen in WBC and lymphocytes stored at −20 °C for 1 and 7 days compared to fresh samples. However, significant increases in both direct and oxidative DNA damage were seen in samples stored at −20 °C for 14 and 28 days. No changes in direct and oxidative DNA damage were observed in WBC and lymphocytes stored at −80 °C for up to 28 days. These results identified the proper storage conditions for storing whole blood or isolated lymphocytes to evaluate direct and oxidative DNA damage using standard and Fpg-modified alkaline Comet assay.
Article
Cryopreservation is the use of very low temperatures to preserve structurally intact living cells and tissues. Unprotected freezing is normally lethal and this chapter seeks to analyze some of the mechanisms involved and to show how cooling can be used to produce stable conditions that preserve life. The biological effects of cooling are dominated by the freezing of water, which results in the concentration of the solutes that are dissolved in the remaining liquid phase. Rival theories of freezing injury have envisaged either that ice crystals pierce or tease apart the cells, destroying them by direct mechanical action, or that damage is from secondary effects via changes in the composition of the liquid phase. Cryoprotectants, simply by increasing the total concentration of all solutes in the system, reduce the amount of ice formed at any given temperature; but to be biologically acceptable they must be able to penetrate into the cells and have low toxicity. Many compounds have such properties, including glycerol, dimethyl sulfoxide, ethanediol, and propanediol.
Article
Lymphocytes are routinely used in human biomonitoring to assess the potential toxic and cytoprotective effects of diet on both DNA damage and repair and, by implication, health. Logistically, samples may require to be cryopreserved and stored. How this affects cells used in human biomonitoring is often not considered. In this study we have evaluated the influence of cryopreservation on endogenous and induced DNA strand breakage, altered bases (oxidized purines, oxidized pyrimidines and misincorporated uracil), antioxidant capacity and DNA repair capability in human peripheral blood lymphocytes. Neither isolation nor freezing increased DNA strand breakage above endogenous levels found in freshly isolated human lymphocytes. Oxidized bases (both pyrimidines and purines) and misincorporated uracil, were similar for fresh and frozen lymphocytes. Fresh and frozen lymphocytes responded almost identically to hydrogen peroxide. Quercetin-mediated cytoprotection against hydrogen peroxide-induced strand breakage was maintained in cryopreserved lymphocytes after short-term (24 h) and longer term (2 months) storage compared with freshly isolated and treated cells. Hydrogen peroxide-induced DNA strand breakage was repaired in fresh lymphocytes. Cryopreserved lymphocytes were unable to repair oxidantinduced DNA strand breaks. Frozen human lymphocytes can therefore be successfully used for most aspects of DNA damage biomonitoring, but not for repair.
Article
Endogenous and oxidatively induced DNA damage, as evaluated by the comet assay, are widely used as biomarkers of oxidative stress in numerous dietary intervention studies. This analysis can be performed on fresh peripheral blood mononuclear cells (PBMCs) or on cryopreserved cells. However, information pertaining to the effects of cryopreservation on DNA damage is often missing, and this may be crucial in studies in which samples are analysed before and after intervention. The purpose of this study was to compare DNA damage in fresh versus cryopreserved PBMCs obtained from subjects following a 6-week intervention with wild blueberry drink or placebo drink. Fresh and 12-month-stored PBMCs were analysed for formamidopyrimidine-DNA glycosylase (FPG)-sensitive sites and H2O2-induced DNA damage. The levels of FPG-sensitive sites were significantly higher in the cryopreserved compared with the fresh cells (P < 0.001), while H2O2-induced DNA damage was significantly lower after storage (P < 0.001). Both the fresh and cryopreserved samples showed reductions in FPG-sensitive sites following the wild blueberry treatment (fresh PBMCs: from 12.50 +/- 5.61% to 9.62 +/- 3.52%, P = 0.039; cryopreserved PBMCs: from 22.7 +/- 6.1% to 19.1 +/- 7.0%, P = 0.012). In contrast, the decrease in H2O2-induced DNA damage observed in the cryopreserved cells masked the protective effect of the wild blueberry drink documented in the fresh samples (fresh PBMCs: from 44.73 +/- 7.46% to 36.34 +/- 9.27%, P < 0.001; cryopreserved PBMCs: from 25.8 +/- 4.6% to 23.9 +/- 4.6%, P = 0.414). In conclusion, our results suggest that FPG-sensitive sites, and more importantly, H2O2-induced DNA damage could be significantly modified following the long-term storage of samples obtained from individuals participating in a dietary intervention study. Because storage may affect the assessment of the protective role of diet against DNA damage as a marker of oxidative stress, further research is needed.
Article
Introduction: Maintenance of normal weight and higher levels of physical activity are associated with a reduced risk of several types of cancer. Because genomic instability is regarded as a hallmark of cancer development, one proposed mechanism is improvement of DNA repair function. We investigated links between dietary weight loss, exercise, and strand break rejoining in an ancillary study to a randomized-controlled trial. Methods: Overweight/obese postmenopausal women (n = 439) were randomized to the following: a) reduced calorie weight loss diet ("diet," n = 118), b) moderate- to vigorous-intensity aerobic exercise ("exercise," n = 117), c) a combination ("diet + exercise," n = 117), or d) control (n = 87). The reduced calorie diet had a 10% weight loss goal. The exercise intervention consisted of 45 min of moderate to vigorous aerobic activity 5 d·wk for 12 months. DNA repair capacity was measured in a subset of 226 women at baseline and 12 months from cryopreserved peripheral mononuclear cells using the comet assay. Anthropometric and body composition measures were performed at baseline and 12 months. Results: DNA repair capacity did not change significantly with any of the 12-month interventions compared with control; there were also no significant changes when stratified by changes in body composition or aerobic fitness (V˙O2max). At baseline, DNA repair capacity was positively associated with weight, body mass index, and fat mass (r = 0.20, P = 0.003; r = 0.19, P = 0.004; r = 0.13, P = 0.04, respectively) and inversely with lean body mass (r = -0.14, P = 0.04). Conclusion: In conclusion, DNA repair capacity in cryopreserved PBMCs (Comet Assay) did not change with dietary weight loss or exercise interventions in postmenopausal women within a period of 12 months. Other assays that capture different facets of DNA repair function may be needed.
Article
The comet assay measures DNA damage in individual cells (usually lymphocytes) and is widely used in biomonitoring studies. Lymphocytes are harvested and are usually cryopreserved for batch testing. We investigated cell loss during harvesting, cryopreservation, thawing, and washing of human peripheral lymphocytes and compared DNA damage, using the Fpg-assisted comet assay for oxidation-induced DNA lesions, in freshly harvested cells and cells that were thawed and tested after cryopreservation of 2-3 days and 4 weeks. Lymphocyte numbers were measured in fresh venous blood and after the steps of harvesting, cryopreservation, and washing. Results showed that >50% of lymphocytes in whole blood were harvested, but ∼60% were lost during washing. Loss during washing was not different (P>0.05) between fresh cells and cells thawed and washed after 2-3 days or 4 weeks cryopreservation. No change in DNA damage was seen after cryopreservation and thawing: mean (SD) % DNA in comet tail was 11.2 (1.53) in freshly harvested cells, 12.9 (1.39) in 2-3 days cryopreserved cells, and 12.9 (2.0) in cells tested after 4 weeks cryopreservation (P>0.05). Results indicate that there is no predominant loss of more highly damaged cells during cryopreservation and thawing and there is no induction of oxidation-induced DNA lesions in cryopreserved cells stored for up to 4 weeks.
Article
Well preserved frozen biospecimens are ideal for evaluating the genome, transcriptome, and proteome. While papers reviewing individual aspects of frozen biospecimens are available, we present a current overview of experimental data regarding procurement, storage, and quality assurance that can inform the handling of frozen biospecimens. Frozen biospecimen degradation can be influenced by factors independent of the collection methodology including tissue type, premortem agonal changes, and warm ischemia time during surgery. Rapid stabilization of tissues by snap freezing immediately can mitigate artifactually altered gene expression and, less appreciated, protein phosphorylation profiles. Collection protocols may be adjusted for specific tissue types as cellular ischemia tolerance varies widely. If data is not available for a particular tissue type, a practical goal is snap freezing within 20 minutes. Tolerance for freeze-thaw events is also tissue type dependent. Tissue storage at -80°C can preserve DNA and protein for years but RNA can show degradation at 5 years. For -80°C freezers, aliquots frozen in RNAlater or similar RNA stabilizing solutions is a consideration. It remains unresolved as to whether storage at -150°C provides significant advantages relative to -80°C. Histologic quality assurance of tissue biospecimens is typically performed at the time of surgery but should also be conducted on the aliquot to be distributed because of tissue heterogeneity. Biobanking protocols for blood and its components are highly dependent on intended use and multiple collection tube types may be needed. Additional quality assurance testing should be dictated by the anticipated downstream applications.
Article
The measurement of DNA-repair activity by extracts from cells or tissues by means of the single-cell gel electrophoresis (comet) assay has a high potential to become widely used in biomonitoring studies. We assessed the inter-laboratory variation in reported values of DNA-repair activity on substrate cells that had been incubated with Ro19-8022 plus light to generate oxidatively damaged DNA. Eight laboratories assessed the DNA-repair activity of three cell lines (i.e. one epithelial and two fibroblast cell lines), starting with cell pellets or with cell extracts provided by the coordinating laboratory. There was a large inter-laboratory variation, as evidenced by the range in the mean level of repair incisions between the laboratory with the lowest (0.002 incisions/10(6) bp) and highest (0.988 incisions/10(6) bp) incision activity. Nevertheless, six out of eight laboratories reported the same cell line as having the highest level of DNA-repair activity. The two laboratories that reported discordant results (with another cell line having the highest level of DNA-repair activity) were those that reported to have little experience with the modified comet assay to assess DNA repair. The laboratories were also less consistent in ordering the repair activity of the other two cell lines, probably because the DNA-repair activity by extracts from these cell lines were very similar (on average approximately 60-65% of the cell line with the highest repair capacity). A significant correlation was observed between the repair activity found in the provided and the self-made cell extracts (r=0.71, P<0.001), which indicates that the predominant source for inter-laboratory variation is derived from the incubation of the extract with substrate cells embedded in the gel. Overall, we conclude that the incubation step of cell extracts with the substrate cells can be identified as a major source of inter-laboratory variation in the modified comet assay for base-excision repair.
Article
A human leukemic cell line (THP-1) cultured from the blood of a boy with acute monocytic leukemia is described. This cell line had Fc and C3b receptors, but no surface or cytoplasmic immunoglobulins. HLA haplotypes of THP-1 were HLA-A2, -A9, -B5, -DRW1 and -DRW2. The monocytic nature of the cell line was characterized by: (1) the presence of α-naphthyl butyrate esterase activities which could be inhibited by NaF; (2) lysozyme production; (3) the phagocytosis of latex particles and sensitized sheep erythrocytes; and (4) the ability to restore T-lymphocyte response to Con A. The cells did not possess Epstein-Barr virus-associated nuclear antigen. These results indicate that THP-1 is a leukemic cell line with distinct monocytic markers. During culture, THP-1 maintained these monocytic characteristics for over 14 months.
Article
Polymerase chain reaction (PCR) has been used with increasing frequency to diagnose infectious and genetic diseases. In this study, the effects of heparin on PCR were investigated, because heparinized blood may sometimes be used in PCR studies. HLA-DQA1 gene amplification was used as a model. PCR was clearly interfered with when heparinized blood was used as a source of template DNA, and the degree of interference was affected by the following three factors; (1) type of Taq DNA polymerase; (2) leukocyte count in blood; and (3) concentration of heparin contained. When additional tests were conducted with additions of definite heparin concentrations to a PCR reaction mixture, specimens with large amounts of DNA tended to exhibit less interference by heparin. The addition of ≥ 0.1 to 0.0016 U of heparin per reaction mixture (50 μl) suppressed DNA amplification in a dose-dependent fashion. We therefore concluded that much care should be taken when heparinized blood is used as a PCR material. J. Clin. Lab. Anal. 13:133–140, 1999. © 1999 Wiley-Liss, Inc.
Article
We have conducted a population study to investigate whether current occupational exposure to mercury can cause genotoxicity and can affect DNA repair efficiency. Blood samples from 25 exposed workers and 50 matched controls were investigated for the expression of genotoxicity. The data indicate that mercury exposure did not cause any significant differences between the workers and controls in the baseline levels of DNA strand breaks (as measured by the alkaline version of the single cell gel electrophoresis [SCGE] assay) or sister chromatid exchanges (SCE). However, the exposure produced elevated average DNA tails length in the SCGE assay and frequency of chromosome aberrations. In the studies, isolated lymphocytes were exposed to 6 J/m2 UV-C light or 2 Gy dose of X-rays in a challenge assay and repair of the induced DNA damage was evaluated using the SCGE assay. Results from the UV-light challenge assay showed no difference between the workers and controls in the expression of DNA strand breaks after exposure followed by incubation in the absence or presence of the cellular mitogen (phytohemagglutinin, PHA). No difference in DNA strand breaks between the workers and controls was seen immediately after the X-ray challenge, either. However, significant differences were observed in cells that were incubated for 2 h with and without phytohemagglutinin. Data from the X-rays challenge assay were further used to calculate indices that indicate DNA repair efficiency. Results show that the repair efficiencies for the workers (69.7% and 83.9% in un-stimulated and stimulated lymphocytes, respectively) were significantly lower than that of matched controls (85.7% and 90.4%, respectively). In addition, the repair efficiency showed a consistent and significant decrease with the duration of occupational exposure to mercury (from 75.7% for <10 years employment, to 65.1% for 11–20 years and to 64.1% for 21–35 years) associated with increase of cytogenetic damage. Our study suggests that the occupational exposure to mercury did not cause a direct genotoxicity but caused significant deficiency in DNA repair. Our observations are consistent with previous studies using the standard chromosome aberration assay to show that exposure to hazardous environmental agents can cause deficiency in DNA repair. Therefore, these affected individuals may have exposure-related increase of health risk from continued exposure and in combination with exposure to other genotoxic agents.
Article
Alkaline single-cell gel electrophoresis (the `comet assay') was used to evaluate DNA damage in lymphocytes from 17 breast cancer patients before and 1–21 h after chemotherapy including cyclophosphamide (600–1800 mg/m2). In order to control for the experimental variability over time, freshly isolated lymphocytes from female mice given physiological saline or cyclophosphamide (150 mg/kg b.wt.) were included as `internal standards' in each individual electrophoresis run. There was an upward tendency of DNA damage in the mouse lymphocytes over the study period, but cyclophosphamide was constantly found to induce significant damage at all time points investigated (1–48 h). Although patients given up to 11 prior cycles of chemotherapy showed the same basal level of DNA damage as the patients coming to the clinic for their first treatment, the chemotherapy given at the time of the present blood sampling was associated with significant DNA damage in most samples. Considerable interindividual variations were observed both before and after the treatment. DNA single-strand breaks and alkali-labile sites in peripheral lymphocytes as evaluated by the comet assay seem to be useful molecular biomarkers for exposure to DNA damaging agents when monitoring ongoing exposures, but less impressive when monitoring accumulated exposures, at least in patients given high doses of cyclophosphamide and other antineoplastic agents.
Article
Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.
Article
Levels of oxidatively damaged cellular DNA and urinary excretion of damaged 2'-deoxyribonuclosides are widely measured in biomonitoring studies examining the role of oxidative stress induced by environmental exposures, lifestyle factors and development of disease. This has promoted efforts to harmonise measurements of oxidised guanine nucleobases by the variety of analytical approaches for DNA and urinary levels of damage, in multi-laboratory trials that are centred in Europe. The large inter-laboratory variation reported of values of oxidatively damaged DNA is reduced by harmonising assay protocols. Recent attention on optimal conditions for the comet assay may lead to better understanding of the most critical steps in procedure, which generate variation in DNA damage levels between laboratories. Measurements of urinary excretion of oxidatively generated 8-oxo-7,8-dihydro-2'-deoxyguanosine also show large differences between different methods, where chromatographic techniques generally show more reliable results than antibody-based methods. In this case, standardising calibrants is aimed at improving within technique agreement.