Therapeutic Delivery of Pip4k2c‐Modified mRNA Attenuates Cardiac Hypertrophy and Fibrosis in the Failing Heart

Abstract

Heart failure (HF) remains a major cause of morbidity and mortality worldwide. One of the risk factors for HF is cardiac hypertrophy (CH), which is frequently accompanied by cardiac fibrosis (CF). CH and CF are controlled by master regulators mTORC1 and TGF‐β, respectively. Type‐2‐phosphatidylinositol‐5‐phosphate‐4‐kinase‐gamma (Pip4k2c) is a known mTORC1 regulator. It is shown that Pip4k2c is significantly downregulated in the hearts of CH and HF patients as compared to non‐injured hearts. The role of Pip4k2c in the heart during development and disease is unknown. It is shown that deleting Pip4k2c does not affect normal embryonic cardiac development; however, three weeks after TAC, adult Pip4k2c−/− mice has higher rates of CH, CF, and sudden death than wild‐type mice. In a gain‐of‐function study using a TAC mouse model, Pip4k2c is transiently upregulated using a modified mRNA (modRNA) gene delivery platform, which significantly improve heart function, reverse CH and CF, and lead to increased survival. Mechanistically, it is shown that Pip4k2c inhibits TGFβ1 via its N‐terminal motif, Pip5k1α, phospho‐AKT 1/2/3, and phospho‐Smad3. In sum, loss‐and‐gain‐of‐function studies in a TAC mouse model are used to identify Pip4k2c as a potential therapeutic target for CF, CH, and HF, for which modRNA is a highly translatable gene therapy approach. Heart failure remains a major cause of morbidity and mortality worldwide. One of the risk factors for HF is cardiac hypertrophy (CH), which is frequently accompanied by cardiac fibrosis (CF). Here, gain‐ and loss‐of‐function studies are used to identify the therapeutic role of Pip4k2c in preventing CH and CF via inhibition of mTOR and TGFβ1 pathways, respectively.

Full text

RESEARCH ARTICLE
www.advancedscience.com
Therapeutic Delivery of Pip4k2c-Modified mRNA Attenuates
Cardiac Hypertrophy and Fibrosis in the Failing Heart
Ajit Magadum, Neha Singh, Ann Anu Kurian, Mohammad Tofael Kabir Sharkar,
Nishat Sultana, Elena Chepurko, Keerat Kaur, Magdalena M. ˙
Zak, Yoav Hadas,
Djamel Lebeche, Susmita Sahoo, Roger Hajjar, and Lior Zangi*
Heart failure (HF) remains a major cause of morbidity and mortality
worldwide. One of the risk factors for HF is cardiac hypertrophy (CH), which
is frequently accompanied by cardiac fibrosis (CF). CH and CF are controlled
by master regulators mTORC1 and TGF-𝜷, respectively.
Type-2-phosphatidylinositol-5-phosphate-4-kinase-gamma (Pip4k2c) is a
known mTORC1 regulator. It is shown that Pip4k2c is significantly
downregulated in the hearts of CH and HF patients as compared to
non-injured hearts. The role of Pip4k2c in the heart during development and
disease is unknown. It is shown that deleting Pip4k2c does not affect normal
embryonic cardiac development; however, three weeks after TAC, adult
Pip4k2c−/−mice has higher rates of CH, CF, and sudden death than wild-type
mice. In a gain-of-function study using a TAC mouse model, Pip4k2c is
transiently upregulated using a modified mRNA (modRNA) gene delivery
platform, which significantly improve heart function, reverse CH and CF, and
lead to increased survival. Mechanistically, it is shown that Pip4k2c inhibits
TGF𝜷1 via its N-terminal motif, Pip5k1𝜶, phospho-AKT 1/2/3, and
phospho-Smad3. In sum, loss-and-gain-of-function studies in a TAC mouse
model are used to identify Pip4k2c as a potential therapeutic target for CF, CH,
and HF, for which modRNA is a highly translatable gene therapy approach.
1. Introduction
HF is a major worldwide health problem and a huge socioeco-
nomic burden.[1] Pathological growth and hypertrophy (CH) de-
velop due to either sustained pressure overload in the injured
Dr.A.Magadum,Dr.N.Singh,A.A.Kurian,Dr.M.T.K.Sharkar,
Dr. N. Sultana, Dr. E. Chepurko, Dr. K. Kaur, Dr. M. M. ˙
Zak, Dr. Y. Hadas,
Prof. D. Lebeche, Prof. S. Sahoo, Prof. L. Zangi
Cardiovascular Research Center
Icahn School of Medicine at Mount Sinai
New York, NY , USA
E-mail: lior.zangi@mssm.edu
The ORCID identification number(s) for the author(s) of this article
can be found under https://doi.org/./advs.
©  The Authors. Advanced Science published by Wiley-VCH GmbH.
This is an open access article under the terms of the Creative Commons
Attribution License, which permits use, distribution and reproduction in
any medium, provided the original work is properly cited.
DOI: 10.1002/advs.202004661
heart or genetic mutation in the non-
injured heart, resulting in ventricular
chamber enlargement and contractile
dysfunction often accompanied by an in-
creased immune response, cardiac fibrosis
(CF), and scarring that subsequently con-
tribute to HF.[2,3] More common causes of
CF, which is a key risk factor for arrhyth-
mia and sudden death, are hypertension,
valve issues, and congenital heart disease.
Unraveling the mechanistic molecular
pathways that underlie pathological stress
and HF may lead to the development of
new therapeutic options for CH and CF in
HF.[4–9 ]
Pip4k2c is a Type 2 phosphatidylinositol-
5-phosphate 4-kinase (PI5P4K) that con-
verts phosphatidylinositol-5-phosphate
to Phosphatidylinositol 4,5-bisphosphate
in mammals. The mammalian gene
PI5P4K encodes three enzymes – PI5P4K𝛼,
PI5P4K𝛽, and PI5P4K𝛾– that play impor-
tant roles in development, homeostasis,
and disease.[10–12 ] Pip4k2c is expressed
primarily in the kidney, brain, heart, and
testes.[13–15 ] To date, Pip4k2c has been
studied for its regulatory roles in insulin resistance, via catalytic-
independent suppression of PIP5k synthesis,[16] and immune re-
sponse, via mTORC1-signaling inhibition in the kidney, testes,
muscle, or brain.[10,11,16 ] The N-terminal motif of Pip4k2c was
found to be crucial to mTOR inhibition.[16] Research produced
Dr.A.Magadum,Dr.N.Singh,A.A.Kurian,Dr.M.T.K.Sharkar,
Dr. N. Sultana, Dr. E. Chepurko, Dr. K. Kaur, Dr. M. M. ˙
Zak,Dr.Y.Hadas,
Prof. L. Zangi
Department of Genetics and Genomic Sciences
Icahn School of Medicine at Mount Sinai
New York, NY , USA
Dr.A.Magadum,Dr.N.Singh,A.A.Kurian,Dr.M.T.K.Sharkar,
Dr. N. Sultana, Dr. E. Chepurko, Dr. K. Kaur, Dr. M. M. ˙
Zak,Dr.Y.Hadas,
Prof. L. Zangi
Black Family Stem Cell Institute
Icahn School of Medicine at Mount Sinai
New York, NY , USA
Prof. R. Hajjar
Phospholamban Foundation
Amsterdam, The Netherlands
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (1 of 13)

www.advancedsciencenews.com www.advancedscience.com
Figure 1. PIPKC and Pipkc expression decreases in failing hearts of humans and mice, respectively. a) PIPKC mRNA expression in human non-
injured normal left ventricle (LV) (non-failing, NF, n=), cardiac hypertrophy (CH, n=), and heart failure (HF, n=). b. Western blot of PIPKC
expression in human LV samples with GAPDH as control (n= for NF, n= for CH, n= for HF). c) Quantitative analysis of b. d) Experimental
timeline to analyze Pipkc expression in sham-operated or TAC mouse model. e) mRNA expression of Pipkc in WT mouse heart samples compared
to those from TAC recipients,  days after injury (n=). f) Western blot evaluation of Pipkc protein in WT mouse heart samples compared to those
from TAC recipients  days after injury, with GAPDH as a control housekeeping gene. g) Quantitative analysis of Pipkc western blot from f (n=).
h) Pipkc mRNA expression in CM or non-CMs after Sham or  or  days post TAC injury (n=). One-way ANOVA, Tukey’s Multiple Comparison
Test were used in a,c; unpaired two-tailed t-test was used in e,g; and two-way ANOVA and Bonferroni post-hoc tests were used in h. ****, P<.,
***, P<., **, P<..
during the last decade has clarified that mTORC1 signaling is
important to promoting CH in response to chronic pressure
overload.[9,17–21 ] Moreover, TGF𝛽1 engenders CF via the down-
stream mediator Smad3, which activates the extracellular matrix
(ECM)-related genes.[22] What remains unclear, however, is 1) the
role of pip4k2c in the heart during development and disease, 2)
whether or not Pip4k2c affects TGF𝛽1 signaling in cardiovascu-
lar pathophysiology, and 3) the nature of the interplay between
Pip4k2c and mTORC1 in the context of cardiac disease. Here,
we use gain- and loss-of-function studies to explore the role of
Pip4k2c in preventing cardiac hypertrophy and fibrosis in the fail-
ing heart.
2. Results
2.1. Pip4k2c Expression Decreases during Human and Mouse
Heart Disease
CH is one of the leading causes of HF and is regulated by the
master regulator mTORC1. Since Pip4k2c negatively impacts the
immune system by suppressing mTORC1,[23] we hypothesized
that human PIP4K2C levels would be higher in heart tissue taken
from the left ventricular myocardium of a Non-Failing (NF) heart
than in samples taken from patients with CF or HF. To test our
hypothesis and to investigate the role of PIP4K2C in heart dis-
eases, we analyzed PIP4K2C mRNA or protein levels in the left
ventricle (LV) of hearts taken from patients with CH, HF, or NF
(Figure 1). We found that heart tissue from patients with CH and
HF had significantly lower PIP4K2C mRNA levels than tissue
from NF hearts (Figure 1a). In parallel, LV heart tissue taken
from patients with CH or HF contained notably less PIP4K2C
protein, as shown by western blot, than tissue from NF hearts
(Figure 1b,c).
To evaluate mouse Pip4k2c mRNA and protein expression in
CH, CF, and HF, we used a transverse aortic constriction (TAC)
mouse model (pressure overload). TAC was performed, and car-
diac tissue was collected 4, 7, and 21 days later (Figure 1d). We ob-
served, similar to the human results, significantly lower Pip4k2c
mRNA and protein levels short term post TAC injury (4 days),
as compared to sham-operated mice (Figure 1e–g). We also ob-
served Pip4k2c expression in both CM and non-CMs (including
cardiac fibroblasts, endothelial, and smooth muscle cells) iso-
lated from P8 mice (Figure S1a,b: Supporting Information). To
analyze the distribution of Pip4k2c expression in the two cell
types, we isolated CM and non-CM from both sham- and TAC-
operated mice long-term post TAC injury (7 or 21 days). We chose
longer time points as TAC leads to progressive cardiac disease.
We saw continuing reduction of Pip4k2c mRNA levels in both
CM and non-CM (Figure 1h) at different time points following
TAC. Taken together, our data suggest that all heart cell types ex-
press Pip4k2c, which is significantly lower in heart cells from pa-
tients with CH or HF and post-TAC mice.
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (2 of 13)

www.advancedsciencenews.com www.advancedscience.com
2.2. Loss of Pip4k2c Induced Cardiac Hypertrophy and Fibrosis
Post TAC in Mice
To study the role of Pip4k2c in cardiac development and dis-
eases, we used germline-deleted Pip4k2c−/−(KO-Pip4k2c) mice.
During mouse heart development, we saw no significant change
in mouse viability, growth, weight, heart weight, heart weight to
body weight ratio (HW/BW), or CM number in E18 KO-Pip4k2c
mice versus littermate control mice (WT) (Figure S2, Supporting
Information). In order to analyze the effect of Pip4k2c on cardiac
function, CH, and CF, we used a TAC mouse model in 8- to 12-
week-old KO-Pip4k2c or WT mice and compared them to sham-
operated KO-Pip4k2c or WT mice 21 days after the procedures
(Figure 2a). We show that KO-Pip4k2c mice have impaired car-
diac function, as indicated by reduced contractility (Figure 2b),
% ejection fraction (%EF, Figure 2c), % fractional shortening
(%FS, Figure 2d), LV Internal Diastolic Diameter (LVIDd, Fig-
ure 2e), and Internal Systolic Diameter (LVIDs, Figure 2f) com-
pared to WT or sham-operated controls. Moreover, hearts and
CM from KO-Pip4k2c animals that underwent TAC were signif-
icantly larger than those from their WT counterparts and sham-
operated controls; these differences can be seen in heart weight
to tibia length (HW/TL) ratios (Figure 2g), whole heart picture or
H&E staining (Figure 2h,i), and wheat germ agglutinin (WGA)
immunostaining and CM size evaluation (Figure 2j,k). This in-
creased CM size positively correlated with upregulated classic
markers of cardiac hypertrophy, such as atrial natriuretic pep-
tide (ANP) and brain natriuretic peptide (BNP) (Figure 2l,m) in
hearts of KO-Pip4k2c mice after TAC in comparison to WT TAC
or sham-operated mice. Importantly, Pip4k2c deletion did not
significantly change the expression of other Pip4k2s (Pip4k2a
and Pip4k2b) in the heart (Figure S3, Supporting Information).
To further evaluate CM size and structure, we isolated adult CM
from KO-Pip4k2c or WT hearts 21 days after TAC (Figure S4a,
Supporting Information). Our analysis demonstrated that CM
from KO-Pip4k2c mice are indeed larger and have higher hy-
pertrophy marker levels than WT CM, 21 days post TAC (Figure
S4b–d: Supporting Information); CM sarcomere structures did
not differ significantly (Figure S4e, Supporting Information). To
evaluate CF in the differently treated groups, we used Sirius red
/ Fast green staining and qPCR evaluation for fibrosis markers
and TGF𝛽1 (Figure 2n–q). We observed significantly elevated fi-
brosis (Figure 2n,o), TGF𝛽1, target gene expression (Figure 2p),
and matrix metalloproteases (MMP) (Figure 2q) in KO-Pip4k2c
hearts following TAC as compared to TAC-operated WT or sham-
operated controls. Due to this increased CH and CF, the KO-
Pip4k2c TAC mice had notably lower survival rates than the WT
TAC mice or sham-operated KO-Pip4k2c or WT mice (Figure 2r).
Importantly, FACS analysis of immune cell distribution in KO-
Pip4k2c or WT hearts 21 days post MI showed no significant dif-
ferences in immune cell infiltration into the heart (Figure S5,
Supporting Information).
2.3. Transiently Upregulating Pip4k2c in the Heart, Using
modRNA, Reverses CH and CF in a TAC Mouse Model
As Pip4k2c loss has detrimental effects in the heart post TAC,
we hypothesized that transiently upregulating Pip4k2c in a
TAC setting would benefit CH, CF, and overall heart function.
To test this, we used the novel modRNA delivery platform to
raise Pip4k2c (Figure 3a). As we have shown previously,[24–31]
modRNA can translate any open reading frame for 8–12 days in
both CM and non-CMs without eliciting an immune response
or compromising the host genome. Since modRNA has never
before been used for gene delivery in a TAC model, we first used
Cre recombinase (Cre) modRNA and R26mTmG mice to evalu-
ate modRNA biodistribution in the mouse heart following TAC
(Figure S6a, Supporting Information) and found that modRNA-
delivered Cre led to more than 40% LV transfection in a TAC
model (Figure S6b,c: Supporting Information). We also showed,
in vivo using western blot analysis (Figure 3b–e) and in vitro
using immunostaining (Figure S7a,b: Supporting Information),
that Pip4k2c modRNA can translate for at least 10 but not 21 days
in vivo in both CM and non-CM. Further, we demonstrated that a
single dose of Pip4k2c modRNA at the time of injury beneficially
affects cardiac function (Figure 3c), represented by increased
%EF (Figure 3d), %FS (Figure 3e), LVIDd, and LVIDs (Fig-
ure 3f,g) 21 days post TAC, as compared to mice treated with Luc
modRNA (control). Interestingly, neither diastolic nor systolic
left ventricular posterior wall diameter significantly changed
(Figure S8, Supporting Information), while both heart and CM
size were notably smaller in Pip4k2c modRNA-treated hearts
versus control, as can be seen in whole heart images (Figure 3h),
HW/TL (Figure 3i), WGA immunostaining, and CM size evalua-
tion (Figure 3j,k) 21 days after TAC. Additionally, decreased CM
size positively correlated with lower expression of CH markers
(ANP and BNP) in Pip4k2c modRNA-treated hearts than in
controls 21 days post TAC (Figure 3l). We also evaluated CF
following Pip4k2c modRNA delivery and found reduced fibrosis
area (Figure 3m,n), inhibited expression of TGF𝛽1 and its target
genes (Figure 3o), and fewer matrix MMP’s (Figure 3p) 21 days
after TAC in Pip4k2c modRNA-treated hearts as compared to
controls. Decreased CH and CF after TAC and Pip4k2c modRNA
treatment significantly raised mouse survival (Figure 3q). Taken
together, our data indicate that a single dose of Pip4k2c modRNA
in a mouse TAC model significantly reversed CH and CF 21 days
post injury, thereby improving cardiac function and survival.
2.4. Pip4k2c Regulates CH in CM through mTORC1 Signaling
To analyze the molecular pathways Pip4k2c induces to prevent
CH following TAC, we isolated protein from WT or KO-Pip4k2c
mice post sham or TAC injury (Figure 4a). As CH is highly regu-
lated via the mTOR1 pathway[17,21,32–34 ] and was previously shown
to be regulated by Pip4k2c in immune cells,[23] we used western
blot to evaluate phosphorylated and non-phosphorylated -p70s6k
(phosphorylated ribosomal protein S6 kinase beta-1 (S6K1)) pro-
tein, which is a known mTORC1 pathway marker. 21 days af-
ter TAC, phosphorylated p70s6k was significantly higher in KO-
Pip4k2c mice than WT and sham-operated WT or KO-Pip4k2c
mice (Figure 4b,c). This elevated phospho-p70s6 kinase response
is known to be pro-hypertrophic, suggesting that Pip4k2c nega-
tively regulates the mTORC1 pathway in the heart following TAC.
Next, we used rapamycin (a well-known mTORC1 chemical
inhibitor)[18,35 ] to further study the mTORC1 molecular pathway
in KO-Pip4k2c mice using the TAC model. We administrated
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (3 of 13)

www.advancedsciencenews.com www.advancedscience.com
Figure 2. Loss of Pipkc enhances formation of cardiac hypertrophy and fibrosis post TAC injury. a) Experimental timeline to evaluate cardiac function
and outcome in Pipkc−/−(KO-Pipkc) and Pipkc+/+littermate controls (WT) in a TAC mouse model. b) Representative echocardiography image
of left ventricle  days post sham or TAC injury in WT or KO-Pipkc. c–f) Echo evaluation of delta % left ventricular ejection fraction (c), fractioning
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (4 of 13)

www.advancedsciencenews.com www.advancedscience.com
rapamycin or vehicle every day from 2 days before the TAC pro-
cedure till day 7 (Figure 4d). This treatment partially reduced the
detrimental effect of KO-Pip4k2c, as compared to KO-Pip4k2c
mice treated with vehicle, 21 days post TAC. More specifically, ra-
pamycin treatment improved cardiac function, as demonstrated
by significantly increased %FS 21 days after TAC (Figure 4e,f)
and notably reduced LVIDd and LVIDs (Figure 4g,h) 14 and
21 days post TAC, compared to KO-Pip4k2c mice treated with ve-
hicle. Furthermore, rapamycin treatment leads to smaller heart
or lung weight to tibia length ratios (HW/TL or LW/TL, Figure 4i–
k). Using WGA immunostaining and CM measurements, we
determined that KO-Pip4k2c mice treated with rapamycin, ver-
sus vehicle, had significantly smaller CM 21 days after TAC in-
jury (Figure 4l,m). Finally, we observed that rapamycin treat-
ment distinctly reduced hallmark cardiac hypertrophy markers
21 days post TAC (Figure 4n). These data suggest that delivering
rapamycin to the KO-Pip4k2c heart beneficially reduces CH fol-
lowing TAC.
2.5. Pip4k2c Regulates CF in Cardiac Fibroblasts through TGF𝜷1
Signaling
In order to investigate how Pip4k2c curtails CF post TAC, we iso-
lated protein from WT or KO-Pip4k2c sham- or TAC-operated
mice (Figure 5a). As CF is highly regulated via the TGF𝛽1
pathway,[36–40] and because our loss- and gain-of-function stud-
ies (Figures 2 and 3) indicate Pip4k2c regulates TGF𝛽1, we used
western blot to evaluate TGF𝛽1 21 days after TAC. Our findings
show that TGF𝛽1 was significantly higher in KO-Pip4k2c mice
than WT post sham or TAC injury (Figure 5b,c), suggesting that
Pip4k2c negatively regulates the TGF𝛽1 pathway in the heart fol-
lowing TAC.
Next, we administered TbetaR1/ALK5 inhibitor (SB431542)
daily to further study the TGF𝛽1 molecular pathways in KO-
Pip4k2c mice undergoing TAC (Figure 5d). We showed that
SB4311542, like rapamycin, partially reduced the detrimental
effect of KO-Pip4k2c. More specifically, SB4311542 treatment
improved cardiac function, as demonstrated by significantly
increased %FS (Figure 5e,f) and notably diminished LVIDd
and LVIDs (Figure 5g,h) 21 days after TAC, as compared to
KO-Pip4k2c mice treated with DMSO vehicle. CF evaluation
following delivery of SB4311542 or vehicle revealed smaller heart
but not lung weight to tibia length ratios (HW/TL or LW/TL,
Figure 5i,j) accompanied by remarkably decreased fibrosis area
(12.5% to 4% fibrosis in the LV, Figure 5k,l) in KO-Pip4k2c mice
treated with SB4311542, compared to DMSO vehicle, 21 days
post TAC. These results suggest that SB4311542 delivery in
KO-Pip4k2c hearts after TAC can partially compensate for the
loss of Pip4k2c, which induces fibrosis through the TGF𝛽1
pathway. Our data suggest that Pip4k2c suppresses CH (via
mTORC1 in CM) and CF (via TGF𝛽1 in cardiac fibroblasts),
both of which can lead to HF. Using a TAC mouse model, we
demonstrated that Pip4k2c modRNA could therapeutically at-
tenuate detrimental effects and promote better cardiac function
and survival (Figure 5m).
2.6. N-Terminal Motif (VMLLPDD) on Pip4k2c is Directly
Responsible for its Suppression of the TGF𝜷1 Pathway
To map the molecular pathways Pip4k2c engenders to prevent
CF after TAC, we prepared mutant Pip4k2c modRNA in which
the N-terminal motif (VMLLPDD) was replaced with the mutant
motif EIFLPNN. This mutation was previously shown to abol-
ish Pip4k2c’s ability to inhibit the mTOR pathway.[16] We then
used the TAC mouse model to compare Pip4k2c and mutant
Pip4k2c modRNA (Figure 6a,b). Unlike Pip4k2c, mutant Pip4k2c
did not significantly change cardiac function (Figure 6c–f) or CH
(Figure 6g), in comparison to Luc control modRNA. In addition,
we isolated and sorted (for the fibroblastic marker CD90) car-
diac fibroblasts from WT or KO-Pip4k2c hearts 21 days post TAC
and treated them with DMSO (control), SB431542, Pip4k2c mod-
RNA, or mutant Pip4k2c modRNA. Next, we evaluated the fi-
broblasts’ expression of fibrosis markers, which are the direct tar-
gets of TGF𝛽1 (2 days after treatment, Figure 6i), total collagen
(3 days after treatment, Figure 6j), or proliferation (5 days after
treatment, Figure S9: Supporting Information). These analyses
showed that, similarly to SB431542, Pipk2c can inhibit TGF𝛽1
target genes, collagen production, and cardiac fibroblast prolif-
eration, while mutant Pip4k2c cannot, and behaves much like
KO-Pip4k2c cardiac fibroblasts. Recent publications have demon-
strated that the Pip4k2c N-terminus motif interacts with and sup-
presses Pip5k1𝛼, thereby hindering phospho-AKT in a prostate
cancer cell line.[16,41 ] Furthermore, inhibiting phosphorylated
phospho-AKT decreases Smad3 phosphorylation on site Ser208
(Smad3-Ser208); such phosphorylation is crucial for TGF𝛽1ex-
pression and pro-fibrotic activity.[42] We therefore wanted to eval-
uate if phospho-AKT and phospho-smad3 (208) play a role in in-
hibiting Pip4k2c on TGF𝛽1 in the heart. To accomplish this, we
collected KO-Pip4k2c cardiac fibroblasts 6 or 24 hours post trans-
fection with Luc or Pip4k2c modRNA, isolated and sorted the fi-
broblasts, and then evaluated them using western blot. Our data
show significantly elevated Pip4k2c that leads to remarkably re-
duced Pip5k1𝛼, phospho-AKT 1/2/3, and phospho-Smad3 (208)
after transfection with Pip4k2c modRNA as compared to control.
These findings indicate that Pip4k2c negatively regulates TGF𝛽1
via its N-terminal motif (VMLLPDD); reduces Pip5k1𝛼, phospho-
AKT 1/2/3, and phospho-Smad3 6 in cardiac fibroblasts; and
thereby lowers their proliferation and fibrotic activity (Figure 6l).
shorting (d), LVIDd (e), and LVIDd (f)  days post sham or TAC injury in WT or KO-Pipkc (n=). g) Heart weight to tibia length  days post sham
or TAC injury in WT or KO-Pipkc (n=). h,i) Representative images of whole heart (h) and H&E staining (i)  days post sham or TAC injury in WT
or KO-Pipkc. j) Representative images of wheat germ agglutinin (WGA) staining to evaluate CM size (cross-sectional area)  days post sham or TAC
injury in WT or KO-Pipkc. k) Quantitative analysis of j (n=). l,m) qPCR analysis of hypertrophic markers  days post sham or TAC injury in WT or
KO-Pipkc (n=). n) Representative images of Sirius red / fast green indicating fibrotic area  days post sham or TAC injury in WT or KO-Pipkc. o)
Quantitative analysis of n (n=). p,q) qPCR analysis of TGF𝛽 and its downstream target genes (p, n=) or dierent matrix metalloprotease (MMP)
genes (q, n=). r) Survival curve after TAC injury in WT or KO-Pipkc (n=). One-way ANOVA, Bonferroni post-hoc test for (C-F, J-L, and N&O).
Unpaired two-tailed t-test for p. Mantel-Cox log-rank test (Q). ***, P<., **, P<., *, P<., N.S., Not Significant. Scale bar =mm(b,h,I,
n),  m (j,n enlarge image).
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (5 of 13)

www.advancedsciencenews.com www.advancedscience.com
Figure 3. Pipkc modRNA elevates Pipkc levels, attenuating cardiac hypertrophy and fibrosis post TAC injury. a) Experimental timeline to evaluate
Pipkc modRNA expression and cardiac function in TAC mouse model. b) Western blot of Luc (control) or Pipkc modRNA expression in mouse hearts
 hours post TAC (n=) and quantitative analysis thereof (n=). c. Representative echocardiography image of left ventricle  days post TAC injury
and delivery of Luc or Pipkc modRNA. d–g) Echo evaluation of delta % left ventricular ejection fraction (d), fractioning shorting (e), LVIDd (f), and
LVIDs (g) before (day ), , or  days post TAC injury and delivery of Luc or Pipkc modRNA (n=). h) Representative images of whole heart  days
post TAC injury and delivery of Luc or Pipkc modRNA. i) Heart weight to tibia length  days post TAC injury and delivery of Luc or Pipkc modRNA
(n=). j) Representative images of WGA staining to evaluate CM size (cross-sectional area)  days post TAC injury and delivery of Luc or Pipkc
modRNA. k) Quantitative analysis of j (n=). l) qPCR analysis of hypertrophic markers  days post TAC injury and delivery of Luc or Pipkc modRNA
(n=). m) Representative images of Sirius red / fast green to evaluate fibrotic area  days post TAC injury and delivery of Luc or Pipkc modRNA. n)
Quantitative analysis of m (n=). o,p) qPCR analysis of TGF𝛽 and its downstream target genes (o, n=) or dierent matrix metalloprotease (MMP)
genes (p, n=). q) Survival curve of mice post TAC injury and delivery of Luc or Pipkc modRNA (n=). Unpaired two-tailed t-test for c, e–g, i, k,l,
n–p. Mantel-Cox log-rank test was used in q. ***, P<., **, P<., *, P<.. Scale bar = mm (c,h),  m (j),  m (m).
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (6 of 13)

www.advancedsciencenews.com www.advancedscience.com
Figure 4. Pipkc attenuates cardiac hypertrophy and fibrosis via mTORC and TGF𝛽, respectively. a) Experimental timeline to evaluate mTORC
pathway activation. b) Western blot analysis of phospho-psk and psk protein expression in WT or KO-Pipkc  days post sham or TAC injury.
c) Quantitative analysis of b (n=). d) Experimental timeline to evaluate the eect of vehicle or rapamycin small molecule on cardiac function, CH,
and CF. e) Representative echocardiography image of left ventricle  days post TAC injury and delivery of vehicle or rapamycin. f–h) Echo evaluation of
fractioning shorting (f), LVIDd (g), and LVIDd (h)  days post TAC injury and delivery of vehicle or rapamycin (n=). i) Representative images of whole
heart  days post TAC injury and delivery of vehicle or rapamycin. j,k) Heart weight (j) or lung weight (k) to tibia length  days post TAC injury and
delivery of vehicle or rapamycin (n=). l) Representative images of WGA staining to evaluate CM size (cross-sectional area)  days post TAC injury
and delivery of vehicle or rapamycin. m. Quantitative analysis of l (n=). n) qPCR analysis of ANP and BNP  days post TAC injury and delivery of
vehicle or rapamycin (n=). One-way ANOVA, Tukey’s Multiple Comparison Test were used in c. Two-way ANOVA, Bonferroni post-hoc test were used
in f–h. An unpaired two-tailed t-test was used for j,k, m,n, p. *, P<., N.S., Not Significant. Scale bar =mm(e,i),m(l).
Overall, our data demonstrate that Pip4k2c modRNA inhibits
the mTORC1 pathway in CMs and the TGF𝛽1 pathway in cardiac
fibroblasts post TAC, thereby reducing CH and CF, resulting in
better cardiac function and survival following TAC injury (Figure
S10, Supporting Information).
3. Discussion
There is a great need to identify new potential treatments for
CH and CF in order to prevent HF. Understanding the mecha-
nisms of action that induce CH and CF, and how to control those
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (7 of 13)

www.advancedsciencenews.com www.advancedscience.com
Figure 5. Pipkc attenuates cardiac fibrosis via the TGF𝛽 pathway. a) Experimental timeline to evaluate TGF𝛽pathway activation. b) Western blot
analysis of TGF𝛽protein expression in WT or KO-Pipkc  days post sham or TAC injury. c) Quantitative analysis of b (n=). d) Experimental timeline
to evaluate the eect of vehicle or SB small molecule on cardiac function and CF. e) Representative echocardiography image of left ventricle
 days post TAC injury and delivery of vehicle or SB. f–h) Echo evaluation of fractioning shorting (f), LVIDd (g), or LVIDd (h)  days post TAC
injury and delivery of vehicle or SB (n=). i) Heart weight to tibia length  days post TAC injury and delivery of vehicle or SB (n=).
j) Lung weight to tibia length  days post TAC injury and delivery of vehicle or SB (n=). k) Representative images of Sirius red / fast green
to evaluate fibrotic area  days post TAC injury and delivery of vehicle or SB. l) Quantitative analysis of k (n=). m) A proposed model for
regulating Pipkc modRNA in CH and CF by inhibiting mTORC and TGF𝛽 post TAC injury. One-way ANOVA, Tukey’s Multiple Comparison Test were
used in c. An unpaired two-tailed t-test was used for f-j, l, p. *, P<., N.S., Not Significant. Scale bar =mm(e),m(k).
mechanisms, may help uncover previously unknown therapeu-
tic targets that can be used to treat patients with CH and HF.
To date, the role of Pip4k2c in heart development and disease
has not been studied. Though Pip4k2c may not have a regulatory
role during cardiac development (Figure 2 and Figure S2: Sup-
porting Information), human PIP4K2C mRNA and protein lev-
els are significantly reduced in the LV of patients with CF and HF
(Figure 1). Using loss- and gain-of-function studies, we demon-
strate that mouse Pip4k2c affects CH and CF, thereby influenc-
ing cardiac function and survival in a TAC mouse model (Fig-
ures 2 and 3). From a mechanistic point of view, these results
confirm that Pip4k2c, via its N-terminal motif (VMLLPDD), in-
hibits mTORC1 in CMs. Further, our work is the first to show
that Pip4k2c, via its N-terminal motif, inhibits TGF𝛽1incar-
diac fibroblasts by suppressing Pip5k1𝛼, phospho-AKT 1/2/3,
and phospho-Smad3; prevents CH (of CM) and CF (in cardiac
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (8 of 13)

www.advancedsciencenews.com www.advancedscience.com
Figure 6. Pipkc suppresses the TGF𝛽 pathway via its N-terminal motif (VMLLPDD), which inhibits Pipk𝛼, phospho-AKT //, and phospho-
Smad. a) Experimental plan to evaluate the impact of mutant Pipkc (original N-terminal motif VMLLPDD replaced with EIFLPNN) on cardiac function
in the TAC mouse model. b) modRNA strategy for the three modRNA tested. c–f) Echo evaluation of delta % left ventricular ejection fraction (c),
fractioning shorting (d), LVIDd (e), and LVIDd (f)  days post TAC injury and delivery of Luc, Pipkc, or mutant Pipkc modRNA (Luc-, n=;
Pipkc- n=; mutant Pipkc modRNA- n=). g) Heart weight to tibia length  days post TAC injury and delivery of Luc or Pipkc modRNA
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (9 of 13)

www.advancedsciencenews.com www.advancedscience.com
fibroblasts); and improves TAC injury outcomes (Figures 4–6 and
Figure S9: Supporting Information).
PIP4Ks (including PIP4k2a, PIP4k2b, and PIP4k2c) play im-
portant roles in insulin production[16] and immune response.[23]
The loss of PIP4k2a or PIP4k2b limits the mTORC1 pathway,
which Pip4k2c induces.[16] Here we show that PIP4k2c, via its
N-terminal motif, limits TGF𝛽1, a master regulator gene with
respect to CF,[40] and its downstream target genes (Figures 2–
6). TGF𝛽1, which is pro-fibrotic, increases after cardiac ischemic
injury and can lead to CM cell death.[39,40 ] TGF𝛽1 signaling in-
volves activation via ligand-receptor recognition with TGF𝛽re-
ceptor type II and TGF𝛽receptor type I (TGF𝛽RIAKAasALK5)
recruitment. In the canonical TGF𝛽1 signaling pathways, Smads
2 and 3 are activated via ALK5 while Smads 1 and 5 are activated
via Smads 1 and 5. The two Smads pairs create a complex that
binds to Smad 4, which leads the complex into the nucleus to
promote expression of the TGF𝛽1, extracellular matrix, matrix
metalloproteases, and myofibroblast-related genes.[39,40,43–45 ] Sev-
eral strategies to inhibit TGF𝛽1 signaling have been tested, with
limited success.[36,37,46,47 ] Therefore, identifying new targets that
can control TGF𝛽1 signaling may have important therapeutic po-
tential in heart disease. It is not clear if PIP4k2a and PIP4k2b
suppress mTORC1 or TGF𝛽1 in the mouse TAC model. The
fact that it can simultaneously suppress two fundamental path-
ways, mTORC1 in CM and TGF𝛽1 in cardiac fibroblasts, posits
PIP4k2c as a key target for regulating CH and CF in HF patients.
As the TGF𝛽1 and, in some cases, mTORC1 pathways are crucial
to other fibrotic diseases, such as pulmonary fibrosis and chronic
renal fibrosis, it will be vital to evaluate the effect of PIP4k2c in
these settings. Further, we show that immune cell composition in
KO-Pip4k2c mice is similar to that in WT mice 21 days post TAC
(Figure S5, Supporting Information). Together with our Pip4k2c
modRNA data, this strongly suggests that Pip4k2c impacts car-
diac cells directly and not via suppressing the immune system.
Our current project also shows that the small-molecule drugs
rapamycin and SB4311542 partially overcome Pip4k2c loss in the
heart following TAC injury (Figures 4 and 5). As rapamycin and
SB4311542 are well-known inhibitors of mTORC1 and TGF𝛽1,
respectively, and have been widely used in the clinic, it would
be intriguing to determine whether or not they can be replaced
with Pip4k2c modRNA. The longer pharmacokinetics of Pip4k2c
modRNA allow it to be administered in a single dose, without
known toxicity, and its activity localizes only in the target tissue
(i.e., the heart), whereas small-molecule drugs need daily admin-
istration, have some toxicity (e.g., rapamycin has known toxicity
in the pancreas[48]), and are active in all tissues and organs within
a treated individual.
Our study transfected modRNA in vitro using RNAiMAX,
while in vivo we used naked modRNA transfected with sucrose-
citrate buffer. In vitro, naked modRNA transfection was not
successful, as the modRNA floated over the cells (data not
shown). In vivo, as we have shown previously,[24] naked mod-
RNA translates 20 times higher than capsulated modRNA using
commercially available nanoparticles. Furthermore, in moderna
and AstraZeneca Phase 2a human clinical trials in Finland
(AZD8601), patients with ischemic heart disease receive VEGFA
modRNA delivered naked in citrate-sucrose buffer.[49] The mech-
anism of action that allows naked modRNA to enter the cell, as
both modRNA and the cell membrane are negatively charged, is
not yet clear. Additionally, modRNA was recently shown to be a
safe, effective Spike protein gene delivery system for vaccination
against SARS-CoV-2 to prevent COVID-19[50,51] in humans. Both
companies (e.g., moderna and Pfizer-BioNTech) producing these
vaccines chose to capsulate Spike modRNA in nanoparticles to
insure consistent delivery. While capsulated modRNA can lead
to lower translation, it also protects against RNase cleavage in
the blood. In our published cardiac studies[52,24,26–28,53–55 ] and
our current work, we use a dissecting microscope to perform in-
tramyocardial injections, allowing us to avoid injecting the naked
modRNA into blood vessels, which can lead to it’s cleavage.
Overall, modRNA is a transient, safe, controlled, dose-
dependent gene delivery method that has thus far been used
to upregulate a gene of interest (VEGF-A,[27,56 ] IGF1,[28] mu-
tant hFSTL1,[26] aYAP,[57] AC,[29] or Pkm2[30])inI/RorMImod-
els in order to promote cardiovascular effects, induce epicar-
dial fat, or support CM proliferation. Here, in a TAC model, we
show that modRNA has high biodistribution, as over 40% of the
LV is transfected (Figure S6, Supporting Information), and that
Pip4k2c modRNA pharmacokinetics show expression for more
than 10 days (Figure S7, Supporting Information). Indeed, a sin-
gle dose of Pip4k2c modRNA engenders cardioprotection and re-
duces CH and CF in a TAC mouse model, with translational ca-
pacity. It is not yet clear if a single dose is sufficient for long-
lasting effects in mice or larger animals. As intramyocardially
injected Pip4k2c modRNA upregulates Pip4k2c protein for 10–
12 days (Figure S7C–E, Supporting Information), we should seek
new, minimally invasive routes to deliver modRNA into the in-
jured heart.
Because the modRNA gene delivery platform is currently be-
ing evaluated for cardiac use in a clinical setting, we aim to apply
Pip4k2c modRNA in a large animal model to pave the way toward
human clinical studies.
4. Experimental Section
Mice:All animal procedures were performed under protocols ap-
proved by the Icahn School of Medicine at Mount Sinai Institutional Ani-
mal Care and Use Committee (IACUC). Male and female CBL/J or CFW
mice were used. Dierent modRNAs ( g per heart) were injected di-
rectly into the myocardium during open chest surgery.  to  animals
were used for each experiment. The Pipkc−/−mice were purchased from
(Luc-, n=; Pipkc- n=; mutant Pipkc modRNA- n=). h) Experimental plan to evaluate Pipkc’s eect on fibrosis marker expression in
cardiac fibroblasts isolated and sorted (for the fibroblastic marker CD) from WT or KO-Pipkc hearts  days post TAC injury and treated with DMSO
(control), TbetaR/ALK inhibitor (SB), Pipkc, or mutant Pipkc modRNA i) qPCR analysis of fibrosis markers placed downstream of TGF𝛽
following dierent treatments (n=). j) Estimation of total collagen in cells  days after dierent treatments (n=). k) Western blot analysis for
isolated KO-Pipkc cardiac fibroblasts for Pipkc modRNA’s eects on the expression of Pipk𝛼, phospho-AKT //, and phospho-Smad. l) A
proposed model for the molecular pathway regulated by Pipkc’s N-terminal motif on TGF-𝛽 in cardiac fibroblasts. One-way ANOVA, Tukey’s Multiple
Comparison Test were used in (c–g) and (i,j). An unpaired two-tailed t-test was used for k. ****, P<., ***, P<., **, P<.. *, P<.
N.S., Not Significant.
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (10 of 13)

www.advancedsciencenews.com www.advancedscience.com
Jackson Laboratories (Pipkctmb(KOMP)Wtsi). For long-term survival, - to
-week-old CBL/J or Pipkc−/−mice were treated without or with
Luc or Pipkc modRNAs (n=) post TAC and allowed to recover for
the specified time in the animal facility. Deaths were monitored and doc-
umented. Tissues were harvested from CBL/J or Pipkc−/−mice on
E for analysis. Mouse husbandry was carried out according to the pro-
tocol approved by the IACUC. Oligonucleotide sequences for genotyping
the above mouse lines: Pipkc -F- CACACCTCCCCCTGAACCTGAAAC,
Pipkc -R- AGCCGCTGGGGCCAGATGAT.
Human Left Ventricle (LV) Samples:Human heart tissue specimens
were obtained from the National Disease Research Interchange through
the Human Tissues and Organs for Research Resource program. HF heart
samples were obtained from patients with end-stage heart failure under-
going heart transplantation. Normal or CH heart samples were procured
from donors who died in accidents and who had either CH or hearts un-
suitable for transplantation for non-cardiac reasons (i.e., healthy). Normal
and CH conditions were defined by cardiac pathology. The control samples
were obtained from donors with uninjured normal hearts: ) Caucasian,
Male,  years old, died on //; ) Caucasian, Male,  years old,
died on //; ) Caucasian, Female,  years old, died on //;
) Caucasian, Male,  years old, died on //; ) Hispanic, Female,
 years old, died on //. Samples of CH hearts, defined by car-
diac pathology using known criteria,[, ] were obtained from: ) Afro-
American, Male,  years old, died on //; ) Caucasian, Female,
 years old, died on //; ) Caucasian, Male,  years old, died
on //; ) Afro-American, Male,  years old, died on //;
) Caucasian, Female,  years old, died on //. Samples of HF
hearts were obtained from patients with either ischemic heart disease:
) Caucasian, Female,  years old, died on //; ) Caucasian,
Male,  years old, died on //; ) Caucasian, Male,  years old,
died on //; ) Afro-American, Female,  years old, died on
//; or dilated cardiomyopathy: ) Caucasian, Male,  years old,
died on //.
ModRNA Synthesis:ModRNAs were transcribed in vitro from plasmid
templates (see Table S (Supporting Information) for a complete list of
open reading frame sequences used to make the modRNA for this study)
using a customized ribonucleotide blend of anti-reverse cap analog;
 ´-O-Me-mG (’)ppp(’)G ( ×−, TriLink Biotechnologies);
guanosine triphosphate (. ×−, Life Technology); adenosine
triphosphate (. ×−, Life Technology); cytidine triphosphate (. ×
−, Life Technology); and N-Methylpseudouridine-’-Triphosphate
(. ×−, TriLink Biotechnologies) as described previously in the
recent protocol paper.[] The mRNA was purified using the Megaclear kit
(Life Technology) and treated with antarctic phosphatase (New England
Biolabs), followed by re-purification using the Megaclear kit. The mRNA
was quantitated by Nanodrop (Thermo Scientific), precipitated with
ethanol and ammonium acetate, and resuspended in  ×−
TrisHCl,  ×−EDTA.
ModRNA Transfection:In vivo modRNA transfection was performed
as described in the recent method paper,[] using sucrose citrate
buer containing  L of sucrose in nuclease-free water (. g
mL−), with  L of citrate (.  pH =; Sigma) mixed with  L of
dierent modRNA concentrations in saline, to a total volume of  L. The
transfection mixture was directly injected (three individual injections,
 L each) into the myocardium. For in vitro transfection, RNAiMAX
transfection reagent was used (Life Technologies) according to the manu-
facturer’s instructions.
For additional methods please see the Supporting Information.
Supporting Information
Supporting Information is available from the Wiley Online Library or from
the author.
Acknowledgements
The authors acknowledge Irsa Munir, Talha Mehmood, and Kemar Brown
for their help with this manuscript. Sources of Funding: This work was
funded by a cardiology start-up grant awarded to the Zangi laboratory and
also by NIH/NHLBI grants R HL- and RO HL. L.Z.
and A.M. are Inventors of a Provisional Patent that covers the results in
this manuscript.
Conflict of Interest
The authors declare no conflict of interest.
Data Availability Statement
All modified mRNA (modRNA) vectors containing any genes of interest
described in this paper will be made available to other investigators. My
institution and I will adhere to the NIH Grants Policy on Sharing of Unique
Research Resources. Specifically, material transfers will be made with no
more restrictive terms than in the Simple Letter Agreement or the UBMTA
and without reach-through requirements. Should any intellectual property
arise which requires a patent, we would ensure that the technology re-
mains widely available to the research community in accordance with the
NIH Principles and Guidelines.
Keywords
fibrosis, gene therapy, heart failure, hypertrophy
Received: December , 
Revised: January , 
Published online: March , 
[] A. S. Go, D. Mozaarian, V. L. Roger, E. J. Benjamin, J. D. Berry, M.
J. Blaha, S. Dai, E. S. Ford, C. S. Fox, S. Franco, H. J. Fullerton, C.
Gillespie, S. M. Hailpern, J. A. Heit, V. J. Howard, M. D. Human, S.
E. Judd, B. M. Kissela, S. J. Kittner, D. T. Lackland, J. H. Lichtman,
L. D. Lisabeth, R. H. Mackey, D. J. Magid, G. M. Marcus, A. Marelli,
D.B.Matchar,D.K.McGuire,E.R.Mohlerrd,C.S.Moy,M.E.
Mussolino, R. W. Neumar, G. Nichol, D. K. Pandey, N. P. Paynter, M.
J. Reeves, P. D. Sorlie, J. Stein, A. Towfighi, T. N. Turan, S. S. Virani,
N. D. Wong, D. Woo, M. B. Turner, C. American Heart Association
Statistics, and S. Stroke Statistics, Circulation 2014,129,.
[] R. G. Weintraub, C. Semsarian, P. Macdonald, Lancet 2017,390, .
[] H. Dargie, Heart 2005,91, ii.
[] D. I. Lee, G. Zhu, T. Sasaki, G. S. Cho, N. Hamdani, R. Holewinski,
S. H. Jo, T. Danner, M. Zhang, P. P. Rainer, D. Bedja, J. A. Kirk, M. J.
Ranek, W. R. Dostmann, C. Kwon, K. B. Margulies, J. E. Van Eyk, W. J.
Paulus, E. Takimoto, D. A. Kass, Nature 2015,519, .
[] P. Han, W. Li, C. H. Lin, J. Yang, C. Shang, S. T. Nuernberg, K. K. Jin,
W. Xu, C. Y. Lin, C. J. Lin, Y. Xiong, H. Chien, B. Zhou, E. Ashley, D.
Bernstein, P. S. Chen, H. V. Chen, T. Quertermous, C. P. Chang, Nature
2014,514, .
[] J. Viereck, R. Kumarswamy, A. Foinquinos, K. Xiao, P. Avramopou-
los, M. Kunz, M. Dittrich, T. Maetzig, K. Zimmer, J. Remke, A. Just,
J. Fendrich, K. Scherf, E. Bolesani, A. Schambach, F. Weidemann, R.
Zweigerdt, L. J. de Windt, S. Engelhardt, T. Dandekar, S. Batkai, T.
Thum, Sci. Transl. Med. 2016,8, ra.
[] M. C. Scimia, C. Hurtado, S. Ray, S. Metzler, K. Wei, J. Wang, C. E.
Woods, N. H. Purcell, D. Catalucci, T. Akasaka, O. F. Bueno, G. P.
Vlasuk, P. Kaliman, R. Bodmer, L. H. Smith, E. Ashley, M. Mercola, J.
H. Brown, P. Ruiz-Lozano, Nature 2012,488, .
[] A. Nakai, O. Yamaguchi, T. Takeda, Y. Higuchi, S. Hikoso, M. Taniike,
S. Omiya, I. Mizote, Y. Matsumura, M. Asahi, K. Nishida, M. Hori, N.
Mizushima, K. Otsu, Nat. Med. 2007,13, .
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (11 of 13)

www.advancedsciencenews.com www.advancedscience.com
[] J. Heineke, M. Auger-Messier, R. N. Correll, J. Xu, M. J. Benard, W.
Yuan, H. Drexler, L. V. Parise, J. D. Molkentin, Nat. Med. 2010,16,
.
[] A. Gupta, S. Toscano, D. Trivedi, D. R. Jones, S. Mathre, J. H. Clarke,
N. Divecha, P. Raghu, Proc. Natl. Acad. Sci. USA 2013,110, .
[] A. M. Mackey, D. A. Sarkes, I. Bettencourt, J. M. Asara, L. E. Rameh,
Sci. Signaling 2014,7, ra.
[] S. Mathre, K. B. Reddy, V. Ramya, H. Krishnan, A. Ghosh, P. Raghu,
Biosci. Rep. 2019,39, BSR.
[] J. H. Clarke, P. C. Emson, R. F. Irvine, J. Comp. Neurol. 2009,517, .
[] I. Al-Ramahi, S. S. P. Giridharan, Y. C. Chen, S. Patnaik, N. Safren, J.
Hasegawa, M. de Haro, A. K. Wagner Gee, S. A. Titus, H. Jeong, J.
Clarke, D. Krainc, W. Zheng, R. F. Irvine, S. Barmada, M. Ferrer, N.
Southall, L. S. Weisman, J. Botas, J. J. Marugan, elife 2017,6, .
[] J.H.Clarke,P.C.Emson,R.F.Irvine,Am. J. Physiol. Renal. Physiol.
2008,295, F.
[]D.G.Wang,M.N.Paddock,M.R.Lundquist,J.Y.Sun,O.
Mashadova, S. Amadiume, T. W. Bumpus, C. Hodakoski, B. D. Hop-
kins, M. Fine, A. Hill, T. J. Yang, J. M. Baskin, L. E. Dow, L. C. Cantley,
Cell Rep. 2019,27, .
[] R. A. Saxton, D. M. Sabatini, Cell 2017,169, .
[] T. Shioi, J. R. McMullen, O. Tarnavski, K. Converso, M. C. Sherwood,
W. J. Manning, S. Izumo, Circulation 2003,107, .
[] M. Volkers, H. Toko, S. Doroudgar, S. Din, P. Quijada, A. Y. Joyo, L.
Ornelas, E. Joyo, D. J. Thuerauf, M. H. Konstandin, N. Gude, C. C.
Glembotski, M. A. Sussman, Proc. Natl. Acad. Sci. USA 2013,110,
.
[] L. Benard, J. G. Oh, M. Cacheux, A. Lee, M. Nonnenmacher, D. S.
Matasic, E. Kohlbrenner, C. Kho, C. Pavoine, R. J. Hajjar, J. S. Hulot,
Circulation 2016,133, .
[] M. J. Ranek, K. M. Kokkonen-Simon, A. Chen, B. L. Dunkerly-Eyring,
M. P. Vera, C. U. Oeing, C. H. Patel, T. Nakamura, G. Zhu, D. Bedja,
M. Sasaki, R. J. Holewinski, J. E. Van Eyk, J. D. Powell, D. I. Lee, D. A.
Kass, Nature 2019,566, .
[] Zeng, Q. Wang, X. Yang, Y. Ren, S. Jiao, Q. Zhu, D. Guo, K. Xia, Y.
Wan g, C . Li, W. Wan g, Phytomedicine 2019,62, .
[] H. Shim, C. Wu, S. Ramsamooj, K. N. Bosch, Z. Chen, B. M. Emerling,
J. Yun, H. Liu, R. Choo-Wing, Z. Yang, G. M. Wulf, V. K. Kuchroo, L.
C. Cantley, Proc. Natl. Acad. Sci. USA 2016,113, .
[] N. Sultana, A. Magadum, Y. Hadas, J. Kondrat, N. Singh, E. Youssef,
D. Calderon, E. Chepurko, N. Dubois, R. J. Hajjar, L. Zangi, Mol. Ther.
2017,25, .
[] Y. Hadas, N. Sultana, E. Youssef, M. T. K. Sharkar, K. Kaur, E. Chep-
urko, L. Zangi, Mol. Ther. –Methods Clin. Dev. 2019,14, .
[] A. Magadum, N. Singh, A. A. Kurian, M. T. K. Sharkar, E. Chepurko,
L. Zangi, Mol. Ther. –Nucleic Acids 2018,13, .
[] L. Zangi, K. O. Lui, A. von Gise, Q. Ma, W. Ebina, L. M. Ptaszek, D.
Spater, H. Xu, M. Tabebordbar, R. Gorbatov, B. Sena, M. Nahrendorf,
D. M. Briscoe, R. A. Li, A. J. Wagers, D. J. Rossi, W. T. Pu, K. R. Chien,
Nat. Biotechnol. 2013,31, .
[] L. Zangi, M. S. Oliveira, L. Y. Ye, Q. Ma, N. Sultana, Y. Hadas, E. Chep-
urko, D. Spater, B. Zhou, W. L. Chew, W. Ebina, M. Abrial, Q. D. Wang,
W. T. Pu, K. R. Chien, Circulation 2017,135, .
[] Y. Hadas, A. S. Vincek, E. Youssef, M. M. Zak, E. Chepurko, N. Sul-
tana,M.T.K.Sharkar,N.Guo,R.Komargodski,A.A.Kurian,K.Kaur,
A. Magadum, A. Fargnoli, M. G. Katz, N. Hossain, E. Kenigsberg, N.
C. Dubois, E. Schadt, R. Hajjar, E. Eliyahu, L. Zangi, Circulation 2020,
141, .
[] A. Magadum, N. Singh, A. A. Kurian, I. Munir, T. Mehmood, K. Brown,
M. T. K. Sharkar, E. Chepurko, Y. Sassi, J. G. Oh, P. Lee, C. X. C. Santos,
A. Gaziel-Sovran, G. Zhang, C. L. Cai, C. Kho, M. Mayr, A. M. Shah,
R. J. Hajjar, L. Zangi, Circulation 2020,141, .
[] N. Sultana, Y. Hadas, M. T. K. Sharkar, K. Kaur, A. Magadum, A.
A. Kurian, N. Hossain, B. Alburquerque, S. Ahmed, E. Chepurko, L.
Zangi, Mol. Ther. –Methods Clin. Dev. 2020,17, .
[] S. Sciarretta, M. Forte, G. Frati, J. Sadoshima, Circ. Res. 2018,122,
.
[] X. Wang, Y. Deng, G. Zhang, C. Li, G. Ding, H. I. May, D. H. Tran, X.
Luo, D. S. Jiang, D. L. Li, X. Wei, L. Xu, A. Ferdous, T. G. Gillette, P. E.
Scherer, X. Jiang, Z. V. Wang, Circulation 2019,140, .
[] D. Zhang, R. Contu, M. V. Latronico, J. Zhang, R. Rizzi, D. Catalucci,
S. Miyamoto, K. Huang, M. Ceci, Y. Gu, N. D. Dalton, K. L. Peterson,
K. L. Guan, J. H. Brown, J. Chen, N. Sonenberg, G. Condorelli, J. Clin.
Invest. 2010,120, .
[] D. Y. Ko, J. M. Shin, J. Y. Um, B. Kang, I. H. Park, H. M. Lee, Am. J.
Rhinol. Allergy 2016,30, .
[] M. J. Anderton, H. R. Mellor, A. Bell, C. Sadler, M. Pass, S. Powell, S.
J. Steele, R. R. Roberts, A. Heier, Toxi c o l. Pa t h ol. 2011,39,.
[] K. V. Engebretsen, K. Skardal, S. Bjornstad, H. S. Marstein, B. Skrbic,
I. Sjaastad, G. Christensen, J. L. Bjornstad, T. Tonnessen, J. Mol. Cell.
Cardiol. 2014,76, .
[] N. G. Frangogiannis, Mol. Aspects Med. 2019,65, .
[] R. Khan, R. Sheppard, Immunology 2006,118, .
[] G. Liu, C. Ma, H. Yang, P. Y. Zhang, Exp. Ther. Med. 2017,13, .
[] M. Sarwar, A. S. Syed Khaja, M. Aleskandarany, R. Karlsson, M. Altho-
biti, N. Odum, N. P. Mongan, N. Dizeyi, H. Johnson, A. R. Green, I.
O. Ellis, E. A. Rakha, J. L. Persson, Oncogene 2019,38, .
[] F. Huang, Q. Shi, Y. Li, L. Xu, C. Xu, F. Chen, H. Wang, H. Liao, Z.
Chang, F. Liu, X. H. Zhang, X. H. Feng, J. J. Han, S. Luo, Y. G. Chen,
Cancer Res. 2018,78, .
[] A. C. Chung, H. Zhang, Y. Z. Kong, J. J. Tan, X. R. Huang, J. B. Kopp,
H. Y. Lan, J. Am. Soc. Nephrol. 2010,21, .
[] D. M. Dolivo, S. A. Larson, T. Dominko, Cytokine Growth Factor Rev.
2017,38, .
[] I. Kashiwagi, R. Morita, T. Schichita, K. Komai, K. Saeki, M. Mat-
sumoto, K. Takeda, M. Nomura, A. Hayashi, T. Kanai, A. Yoshimura,
Immunity 2015,43, .
[] S. M. Tan, Y. Zhang, K. A. Connelly, R. E. Gilbert, D. J. Kelly, Am. J.
Physiol.: Heart Circ. Physiol. 2010,298, H.
[] L. H. Wei, X. R. Huang, Y. Zhang, Y. Q. Li, H. Y. Chen, B. P. Yan, C. M.
Yu, H . Y. La n, Cardiovasc. Res. 2013,99, .
[] A. D. Barlow, M. L. Nicholson, T. P. Herbert, Diabetes 2013,62,
.
[] V. Anttila, A. Saraste, J. Knuuti, P. Jaakkola, M. Hedman, S. Svedlund,
M. Lagerstrom-Fermer, M. Kjaer, A. Jeppsson, L. M. Gan, Mol. Ther.
–Methods Clin. Dev. 2020,18, .
[] L. A. Jackson, E. J. Anderson, N. G. Rouphael, P. C. Roberts, M.
Makhene, R. N. Coler, M. P. McCullough, J. D. Chappell, M. R. Deni-
son, L. J. Stevens, A. J. Pruijssers, A. McDermott, B. Flach, N. A.
Doria-Rose, K. S. Corbett, K. M. Morabito, S. O’Dell, S. D. Schmidt, P.
A. Swanson nd, M. Padilla, J. R. Mascola, K. M. Neuzil, H. Bennett,
W. Sun, E. Peters, M. Makowski, J. Albert, K. Cross, W. Buchanan, R.
Pikaart-Tautges, J. E. Ledgerwood, B. S. Graham, J. H. Beigel, R. N. A.
S. G. m, N. Engl. J. Med. 2020,383, .
[] M. J. Mulligan, K. E. Lyke, N. Kitchin, J. Absalon, A. Gurtman, S. Lock-
hart, K. Neuzil, V. Raabe, R. Bailey, K. A. Swanson, P. Li, K. Koury, W.
Kalina, D. Cooper, C. Fontes-Garfias, P. Y. Shi, O. Tureci, K. R. Tomp-
kins,E.E.Walsh,R.Frenck,A.R.Falsey,P.R.Dormitzer,W.C.Gruber,
U. Sahin, K. U. Jansen, Nature 2020,586, .
[] J. Kondrat, N. Sultana, L. Zangi, Methods Mol. Biol. 2017,1521, .
[] V. A. Hadas, E. Youssef, M. M. ˙
Zak, E. Chepurko, N. Sultana, M. T. K.
Sharkar, N. Guo, R. Komargodski, K. Kaur, A. Fargnoli, M. G. Katz, N.
Hossain, E. Kenigsberg, N. C. Dubois, E. Schadt, R. Hajjar, E. Eliyahu,
L. Zangi, Circulation 2020,141, .
[] S. N. Magadum A, A. A. Kurian, I. Munir, T. Mehmood, K. Brown, M.
T. K. Sharkar, E. Chepurko, Y. Sassi, J. G. Oh, P. Lee, C. X. Santos, A.
Gaziel-Sovran, G. Zhang, C. Cai, C. Kho, M. Mayr, A. M. Shah, R. J.
Hajjar, L. Zangi, Circulation 2020,141, .
[] A. Magadum, A. A. Kurian, E. Chepurko, Y. Sassi, R. J. Hajjar, L. Zangi,
Circulation 2020,142, .
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (12 of 13)

www.advancedsciencenews.com www.advancedscience.com
[] L. Carlsson, J. C. Clarke, C. Yen, F. Gregoire, T. Albery, M. Billger, A.
C. Egnell, L. M. Gan, K. Jennbacken, E. Johansson, G. Linhardt, S.
Martinsson, M. W. Sadiq, N. Witman, Q. D. Wang, C. H. Chen, Y.
P.Wang,S.Lin,B.Ticho,P.C.H.Hsieh,K.R.Chien,R.Fritsche-
Danielson, Mol. Ther. –Methods Clin. Dev. 2018,9, .
[] J. Chen, Q. Ma, J. S. King, Y. Sun, B. Xu, X. Zhang, S. Zohrabian, H.
Guo, W. Cai, G. Li, I. Bruno, J. P. Cooke, C. Wang, M. Kontaridis, D. Z.
Wang,H.Luo,W.T.Pu,Z.Lin,Life Sci. Alliance 2020,3, .
[] Circulation 2020,142, e.
[] A. J. Marian, E. Braunwald, Circ. Res. 2017,121, .
Adv. Sci. 2021,8,  ©  The Authors. Advanced Science published by Wiley-VCH GmbH
2004661 (13 of 13)