Content uploaded by Mitchell Palmer
Author content
All content in this area was uploaded by Mitchell Palmer on May 10, 2021
Content may be subject to copyright.
Content uploaded by Mitchell Palmer
Author content
All content in this area was uploaded by Mitchell Palmer on Mar 15, 2021
Content may be subject to copyright.
Susceptibility of White-Tailed Deer (Odocoileus virginianus)to
SARS-CoV-2
Mitchell V. Palmer,
a
Mathias Martins,
b
Shollie Falkenberg,
c
Alexandra Buckley,
d
Leonardo C. Caserta,
b
Patrick K. Mitchell,
b
Eric D. Cassmann,
d
Alicia Rollins,
b
Nancy C. Zylich,
b
Randall W. Renshaw,
b
Cassandra Guarino,
b
Bettina Wagner,
b
Kelly Lager,
d
Diego G. Diel
b
a
Infectious Bacterial Diseases Research Unit, National Animal Disease Center, USDA, Agricultural Research Service, Ames, Iowa, USA
b
Department of Population Medicine and Diagnostic Sciences, Animal Health Diagnostic Center, College of Veterinary Medicine, Cornell University, Ithaca, New York, USA
c
Ruminant Disease and Immunology Research Unit, National Animal Disease Center, USDA, Agricultural Research Service, Ames, Iowa, USA
d
Virus and Prion Research Unit, National Animal Disease Center, USDA, Agricultural Research, Ames, Iowa, USA
Mitchell V. Palmer and Mathias Martins contributed equally to this work. Author order was determined based on the institution where the animal studies were conducted and in
order of increasing seniority.
ABSTRACT The origin of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-
2), the virus causing the global coronavirus disease 2019 (COVID-19) pandemic, remains
a mystery. Current evidence suggests a likely spillover into humans from an animal res-
ervoir. Understanding the host range and identifying animal species that are susceptible
to SARS-CoV-2 infection may help to elucidate the origin of the virus and the mecha-
nisms underlying cross-species transmission to humans. Here, we demonstrated that
white-tailed deer (Odocoileus virginianus), an animal species in which the angiotensin-
converting enzyme 2 (ACE2)—the SARS-CoV-2 receptor—shares a high degree of simi-
larity to that of humans, are highly susceptible to infection. Intranasal inoculation of
deer fawns with SARS-CoV-2 resulted in established subclinical viral infection and shed-
ding of infectious virus in nasal secretions. Notably, infected animals transmitted the vi-
rus to noninoculated contact deer. Viral RNA was detected in multiple tissues 21 days
postinoculation (p.i.). All inoculated and indirect contact animals seroconverted and
developed neutralizing antibodies as early as day 7 p.i. The work provides important
insights into the animal host range of SARS-CoV-2 and identifies white-tailed deer as a
wild animal species susceptible to the virus.
IMPORTANCE Given the presumed zoonotic origin of SARS-CoV-2, the human-animal-envi-
ronment interface of the COVID-19 pandemic is an area of great scientific and public and
animal health interest. Identification of animal species that are susceptible to infection by
SARS-CoV-2 may help to elucidate the potential origin of the virus, identify potential reser-
voirs or intermediate hosts, and define the mechanisms underlying cross-species transmis-
sion to humans. Additionally, it may also provide information and help to prevent potential
reverse zoonosis that could lead to the establishment of new wildlife hosts. Our data
shows that upon intranasal inoculation, white-tailed deer became subclinically infected and
shed infectious SARS-CoV-2 in nasal secretions and feces. Importantly, indirect contact ani-
mals were infected and shed infectious virus, indicating efficient SARS-CoV-2 transmission
from inoculated animals. These findings support the inclusion of wild cervid species in
investigations conducted to assess potential reservoirs or sources of SARS-CoV-2 infection.
KEYWORDS ACE2, SARS-CoV-2, cervids, deer, host species, pathogenesis, host range
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a novel coronavirus,
within the genus Betacoronavirus (subgenus Sarbecovirus)ofthefamilyCoronaviridae,
that causes coronavirus disease 2019 (COVID-19) in humans (1). COVID-19 was first
Citation Palmer MV, Martins M, Falkenberg S,
Buckley A, Caserta LC, Mitchell PK, Cassmann
ED, Rollins A, Zylich NC, Renshaw RW, Guarino
C, Wagner B, Lager K, Diel DG. 2021.
Susceptibility of white-tailed deer (Odocoileus
virginianus) to SARS-CoV-2. J Virol 95:e00083-
21. https://doi.org/10.1128/JVI.00083-21.
Editor Tom Gallagher, Loyola University
Chicago
This is a work of the U.S. Government and is
not subject to copyright protection in the
United States. Foreign copyrights may apply.
Address correspondence to Mitchell V. Palmer,
mitchell.palmer@usda.gov, and Diego G. Diel,
dgdiel@cornell.edu.
Received 20 January 2021
Accepted 2 March 2021
Accepted manuscript posted online
10 March 2021
Published 10 May 2021
June 2021 Volume 95 Issue 11 e00083-21 Journal of Virology jvi.asm.org 1
PATHOGENESIS AND IMMUNITY
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
reported in Wuhan, Hubei Province, China, in December 2019 (2). The early clusters of the
disease in humans had an epidemiological link to the Huanan Seafood Wholesale market in
Wuhan, where several live wild animal species were sold (2–4).Genomesequenceanalysisof
SARS-CoV-2 revealed a high degree of similarity to coronaviruses circulating in bats (3, 5, 6),
with current evidence pointing to horseshoe bats as the most likely source of the ancestral vi-
rus that crossed the species barrier to cause the global COVID-19 pandemic in humans (7, 8).
Other pathogenic zoonotic coronaviruses, including severe acute respiratory syndrome
coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV), are
also believed to have originated in bat reservoirs. However, there is no evidence of direct
bat-to-human transmission, and current data indicate that human infections with SARS-CoV
and MERS-CoV resulted from interactions with intermediate animal hosts, such as palm civet
cats (Paguma larvata) and dromedary camels (Camelus dromedaries), respectively (9–11). The
epidemiological link of the first reported human cases of COVID-19 with the Huanan animal
market in Wuhan suggests that SARS-CoV-2 may have spilled over into humans from an ani-
mal host (3–5, 11–13). Early studies proposed that pangolins (Manis sp.) may have served as
an intermediate host for SARS-CoV-2, as they are a natural reservoir for SARS-CoV-2-like coro-
naviruses (14). However, phylogenetic analyses and amino acid sequence analysis of the S
gene of SARS-CoV-2 did not support the hypothesis of the virus arising directly from the
closely related pangolin betacoronaviruses (15). A better understanding of the host range
and species susceptibility of SARS-CoV-2 is critical to elucidate the origin of the virus and to
identify potential animal reservoirs and routes of transmission to humans.
The tropism and host range of coronaviruses is largely determined by the spike (S) gly-
coprotein, which binds to host cell receptors, triggering fusion and virus entry into suscep-
tible cells (16). The SARS-CoV-2 S protein binds host cells through the angiotensin-convert-
ing enzyme 2 (ACE2) protein receptor (17). Comparison of the human ACE2 protein to that
of over 400 vertebrate species demonstrated that the ACE2 protein of several animal spe-
cies presents a high degree of amino acid conservation to the human protein (18). Further
analysis of the ACE2/S binding motif and predictions of the SARS-CoV-2 S binding propen-
sity led to the identification of several animal species with an ACE2 protein with a high
binding probability to the SARS-CoV-2 S protein (18). Not surprisingly, the majority of spe-
cies with the highest S/ACE2 binding propensity are nonhuman primates (18). Notably,
the ACE2/S protein binding motif of three species of deer, including Père David’sdeer
(Elaphurus davidianus), reindeer (Rangifer tarandus), and white-tailed deer (Odocoileus vir-
ginianus), share a high homology with the human ACE2 (18). These observations suggest a
putative broad host range for SARS-CoV-2; however, the susceptibility of most of these ani-
mal species to SARS-CoV-2 infection remains unknown.
Natural SARS-CoV-2 infections have been reported in dogs, cats, mink, tigers, and lions
in Hong Kong, Netherlands, China, and the United States (19–22). The increased interest in
the virus-host range and in understanding the array of susceptible animal species, and the
need to develop reliable animal models for SARS-CoV-2 infection, led to several experi-
mental inoculations in domestic and wild animal species. Experimentally infected nonhu-
man primates, ferrets, minks, cats, dogs, raccoon dogs, golden Syrian hamsters, and deer
mice have displayed mild to moderate clinical disease upon SARS-CoV-2 infection (23–28),
whereas experimental inoculation of swine, cattle, poultry, and fruit bats have shown that
these species are either not susceptible to SARS-CoV-2 or that inoculation on these studies
did not result in productive infection and sustained viral replication (23, 29–31). Here, we
assessed the susceptibility of white-tailed deer to SARS-CoV-2. Viral infection, clinical out-
comes, shedding patterns, and tissue distribution were evaluated. Additionally, transmis-
sion of SARS-CoV-2 to indirect contact animals was also investigated.
RESULTS
Susceptibility of deer cells to SARS-CoV-2 infection and replication. The suscep-
tibility of deer cells to SARS-CoV-2 infection and replication was assessed in vitro. Deer
lung (DL) cells were inoculated with SARS-CoV-2 isolate TGR/NY/20 (22), and the ability
of SARS-CoV-2 to infect these cells was compared to Vero-E6 and Vero-E6/TMPRRS2
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 2
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
cells. Virus infection and replication were assessed by immunofluorescence (IFA) stain-
ing using a SARS-CoV-2 N-specific monoclonal antibody. As shown in Fig. 1A, SARS-
CoV-2 N expression was detected in DL cells at 24 h postinoculation (hpi), indicating
that these cells are susceptible to SARS-CoV-2 infection. Importantly, staining for ACE2
confirmed expression of the SARS-CoV-2 receptor in DL cells (Fig. 1A).
FIG 1 Susceptibility and replication properties of the SARS-CoV-2 in deer cells in vitro. (A) Deer lung (DL), Vero
E6, and Vero E6/TMPRSS2 cells were inoculated with SARS-CoV-2 at a multiplicity of infection (MOI) of 1. At
24 h postinoculation (hpi), cells were fixed and subjected to an immunofluorescence assay using a monoclonal
antibody (MAb) anti-ACE2 (green) and with a MAb anti-SARS-CoV-2-nucleoprotein (N) (red). Nuclear
counterstain was performed with DAPI (blue); 40 magnification. (B) To assess the kinetics of replication of
SARS-CoV-2, DL, Vero E6, and Vero E6/TMPRSS2 cells were inoculated with SARS-CoV-2 isolate TGR/NY/20 (MOI
of 0.1 and 1) and harvested at various time points postinoculation (12, 24, 36, 48, and 72 hpi; time zero shown
in the graphs represent the back titration of input virus). Virus titers were determined on each time point using
endpoint dilutions and the Spearman and Karber's method and expressed as log
10
TCID50 ml21. Results
represent the average of three independent experiments.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 3
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
The replication kinetics of SARS-CoV-2 was investigated in DL cells. For comparison,
we included Vero-E6 and Vero-E6/TMPRSS2 cells, which are known to support efficient
SARS-CoV-2 replication (32, 33). All cells were inoculated with SARS-CoV-2 at multiplic-
ities of infection (MOI) of 0.1 and 1, and cells plus supernatant were harvested at 12,
24, 36, 48, and 72 hpi. Consistent with previous studies showing efficient replication of
SARS-CoV-2 in Vero-E6 and Vero-E6/TMPRSS2 cells (32, 33), SARS-CoV-2 replicated well
in these cells, reaching peak titers (;10
6
to 10
7
50% tissue culture infectious dose per
milliliter ½TCID50 ml21) within 12 to 24 hpi (Fig. 1B). Interestingly, while SARS-CoV-2
also replicated to high titers in DL cells (;10
6
to 10
7
TCID50 ml21), replication kinetics
was delayed with peak viral titers being reached by 72 hpi (Fig. 1B). These results show
that DL cells are susceptible to SARS-CoV-2 infection and support productive virus rep-
lication in vitro.
Infection and transmission of SARS-CoV-2 in white-tailed deer. Given that
white-tailed deer have been recently identified as one of the species with an ACE2 pro-
tein with a high binding probability to the SARS-CoV-2 S protein (18), we investigated
the susceptibility of white-tailed deer fawns to SARS-CoV-2 infection. Six-week-old
fawns (n= 4) were inoculated intranasally with 5 ml (2.5 ml per nostril) of a virus sus-
pension containing 10
6.3
TCID50 ml21of SARS-CoV-2 TGR/NY/20, an animal SARS-CoV-
2 (D614G) strain that is identical to human viral strains (22). To assess the potential
transmission of SARS-CoV-2 between white-tailed deer, two fawns (n= 2) were main-
tained as noninoculated contacts in the same biosafety level 3 (agriculture) (BSL-3Ag)
room. The inoculated and indirect contact animals were kept in separate pens divided
by a plexiglass barrier to prevent direct nose-to-nose contact between inoculated and
contact animals (Fig. 2A). Following inoculation, animals were monitored daily for clini-
cal signs and body temperature. No clinical signs of overt respiratory distress were
observed in any of the inoculated or contact animals during the 21-day experimental
period. Interestingly, a slight and transient increase in body temperature was noted in
3/4 (no. 2001, 2042, and 2043) inoculated fawns between days 1 to 3 postinoculation
(p.i.) (Fig. 2B). One fawn (no. 2001) died on day 8 p.i. of unrelated intestinal perforation
and peritonitis. The body temperature in both indirect contact animals (no. 2006 and
2044) remained within physiological ranges throughout the experimental period (Fig.
2B). Postmortem examination of fawns at 8 days p.i. (animal no. 2001) or 21 days p.i.
(animal no. 2042, 2043, 2045, 2006, and 2044) revealed no gross lesions. Microscopic
changes observed were not associated with the presence of the virus, as no viral RNA
(genomic and subgenomic RNA) was detected by PCR or in situ hybridization (ISH)
(data not shown).
Replication of SARS-CoV-2 in the upper respiratory and gastrointestinal tracts and
the dynamics and patterns of virus shedding and viremia were assessed in inoculated
and indirect contact fawns. Nasal secretions and feces were collected by nasal and rec-
tal swabs on days 0, 1, 2, 3, 4, 5, 6, 7, 10, 12, 14, and 21 p.i.; serum and buffy coat col-
lected on days 0, 7, 14, and 21 p.i. were subjected to nucleic acid extraction and tested
for the presence of SARS-CoV-2 RNA (genomic and subgenomic RNA) by real-time
reverse transcriptase PCR (rRT-PCR). While viremia was not detected in serum and buffy
coat samples, viral RNA was detected between days 2 and 21 p.i. in nasal secretions
from inoculated animals (Fig. 3A), with higher viral RNA loads being detected between
days 2 and 7 p.i. and decreasing thereafter through day 21 p.i. (Fig. 3A). Notably, high
levels of viral RNA were also detected in nasal secretions from indirect contact animals
throughout the experimental period (Fig. 3B). Viral RNA was detected in fecal samples
in all inoculated and indirect contact animals (Fig. 3A and B); however, intermittent
and short-duration fecal shedding was observed, with most animals (4/5) only transi-
ently shedding detectable SARS-CoV-2 in feces through days 6 to 7 p.i. (Fig. 3A and B).
Notably, infectious SARS-CoV-2 was detected in nasal secretions of all inoculated and
indirect contact animals between days 2 and 5 p.i. (Fig. 4A). Indirect contact animals shed
infectious SARS-CoV-2 in nasal secretions through day 7 p.i. Viral titers shed in nasal secre-
tions ranged from 2.0- to 4.8-log
10
TCID50 ml21(Fig. 4A). Infectious SARS-CoV-2 shedding
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 4
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
in feces was detected in inoculated animals on day 1 p.i. (Fig. 4B). Sequencing of SARS-
CoV-2 from select nasal secretions from inoculated and indirect contact animals confirmed
the identity of the virus, matching the sequence of the inoculated virus. Together, these
results indicate that SARS-CoV-2 productively infected and replicated in the upper respira-
tory tract of white-tailed deer. In addition, the virus was efficiently transmitted to indirect
contact animals.
Viral load and tissue distribution. Viral RNA load and tissue distribution of SARS-
CoV-2 were assessed on day 8 p.i. (animal no. 2001, which died of an unrelated cause
[intestinal perforation]) and day 21 p.i. (animal no. 2042, 2043, 2045, 2006, and 2044).
Tissues were collected and processed for rRT-PCR, virus isolation, and ISH. On day 8 p.i.
(fawn 2001), SARS-CoV-2 RNA was detected in nasal turbinates, palatine tonsil, spleen,
ileocecal junction, and in submandibular, medial retropharyngeal, tracheobronchial,
and mediastinal lymph nodes (Fig. 5). Among the tissues collected on day 21 p.i. from
the remaining inoculated and indirect contact fawns, SARS-CoV-2 RNA was consistently
detected in nasal turbinates, palatine tonsil, and retropharyngeal lymph node (Fig. 5).
FIG 2 Infection and transmission of SARS-CoV-2 in white-tailed deer. (A) Room setup of animal
experiment. Fawns were kept in a room of a biosafety level 3 (agriculture) (BSL-3Ag) facility. Four
fawns were inoculated intranasally with a virus suspension containing 5 10
6.3
TCID
50
of SARS-CoV-2
isolate TGR/NY/20, and two fawns were maintained as noninoculated room contact animals. All fawns
were maintained in a 3.7-m by 3.7-m room and inoculated, and room contact animals were kept in
two pens separated by a plexiglass barrier approximately 0.9 m (;3 ft) in height to prevent direct
nose-to-nose contact. Airflow in the room was maintained at 10 to 11 air exchanges per hour and
was directional from the contact pen toward the inoculated pen. (B) Fawns were microchipped
subcutaneously for identification and monitored daily for clinical signs and body temperature starting
on day 1 before inoculation or contact day (day 21). Body temperatures are expressed in degrees
Celsius.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 5
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
This subset of tissues presented higher viral RNA loads on both days 8 and 21 p.i. than
the other tissues tested (Fig. 5).
The presence of SARS-CoV-2 RNA was confirmed by ISH in the palatine tonsils and
medial retropharyngeal lymph nodes of all inoculated and indirect contact fawns.
Labeling of viral RNA was intense and limited to central regions of lymphoid follicles
(Fig. 6A and B). Viral RNA was also noted in tracheobronchial and/or mediastinal lymph
nodes of 5/6 deer but was less intense than that seen in tonsils and was limited to the
medulla of the lymph node (Fig. 6C). Only the nasal turbinates of fawn 2001, collected
on day 8 p.i., exhibited viral RNA labeling. Within the nasal lumen, there was strong
labeling of aggregates of mucus and cell debris (Fig. 6D). No viral RNA was detected in
sections of lung, kidney, brain, intestine, or mesenteric lymph nodes. Tissues were also
analyzed using the negative sense-specific RNA probe (V-nCoV2019-S-sense probe) to
detect virus replication. While intense labeling was noted with the probe detecting
genomic and subgenomic positive-sense viral RNA (Fig. 6E), no labeling was observed
with the negative sense-specific probe in any of the tissues (Fig. 6F), suggesting lack of
virus replication. These findings are consistent with lack of virus isolation from rRT-
PCR-positive tissues. The ability of the negative sense-specific probe to bind actively
replicating virus was confirmed in Vero cells infected with SARS-CoV-2 isolate TGR/NY/
20 (data not shown).
Antibody responses in white-tailed deer following SARS-CoV-2 infection. The
serological responses to SARS-CoV-2 were assessed using a Luminex and a virus neu-
tralization (VN) assay. Serum samples collected on days 0, 7, 14, and 21 p.i. were used
to assess nucleocapsid (N) and S receptor binding domain (RBD)-specific or neutraliz-
ing antibody (NA) levels following SARS-CoV-2 infection. All inoculated and indirect
contact animals seroconverted to SARS-CoV-2, with antibodies against S-RBD and NA
being detected as early as day 7 p.i. (Fig. 7A and B, respectively) and increasing there-
after on days 14 and 21 p.i. Overall, titers of antibodies against the N protein were
FIG 3 Viral RNA in nasal secretion and feces. (A) Dynamics of virus shedding was assessed in nasal secretions (line)
and feces (bars) of four inoculated fawns (no. 2001, 2042, 2043, and 2045). Nasal and rectal swabs collected on days 0
to 7, 10, 12, 14, and 21 postinoculation (p.i.) were tested for the presence of SARS-CoV-2 RNA by real-time reverse
transcriptase PCR (rRT-PCR). (B) Dynamics of virus shedding of contact fawns (no. 2006 and 2044). Nasal and rectal
swabs collected on the same time points as the inoculated animals were subjected to nucleic acid extraction and
tested for the presence of SARS-CoV-2 RNA by rRT-PCR.
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 6
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
lower and appeared at later time points (days 14 to 21) (Fig. 7A). Geometric mean titers
(GMT) of NA ranged from 37 to 107, 85 to 214, and 85 to 256 on days 7, 14, and 21,
respectively (Fig. 7C). These results confirm infection of all inoculated fawns and further
confirm transmission to indirect contact animals.
DISCUSSION
Here, we demonstrated that white-tailed deer are susceptible to SARS-CoV-2 infec-
tion. Infection of deer cells in vitro resulted in productive virus replication. Most impor-
tantly, intranasal inoculation of white-tailed deer fawns led to subclinical infection and
productive virus replication in the upper respiratory tract with shedding of infectious
virus in nasal secretions of infected animals.
One of the most remarkable characteristics of SARS-CoV-2 is its highly efficient
transmissibility (34, 35). Consistent with this, rapid SARS-CoV-2 transmission was observed
in several experimentally infected animal species (27, 28, 31, 36–41). Similarly, results here
show efficient SARS-CoV-2 transmission between white-tailed deer. Indirect contact fawns
became infected and supported productive SARS-CoV-2 replication, as evidenced by virus
shedding in nasal secretions and seroconversion. Evidence to date indicates that transmis-
sion of SARS-CoV-2 occurs mainly through direct, indirect, or close contact with infected
individuals through secretions such as respiratory, salivary, and/or fecal droplets (42).
Under experimental conditions, transmission via direct contact has been demonstrated in
ferrets, minks, raccoon dogs, hamsters, cats, and deer mice (23, 28, 31, 36, 38, 39, 41), while
FIG 5 Tissue distribution of SARS-CoV-2 RNA. Tissues were collected and processed for rRT-PCR on
day 8 postinoculation (p.i.) for animal no. 2001 (which died of an unrelated cause) and 21 p.i. of the
remaining animals (animal no. 2042, 2043, 2045, 2006, and 2044).
FIG 4 Shedding of infectious SARS-CoV-2 by inoculated and contact fawns. (A) Infectious virus was
assessed by virus isolation in nasal secretions in rRT-PCR-positive samples. (B) Infectious SARS-CoV-2
shedding in feces in rRT-PCR-positive samples. Virus titers were determined using endpoint dilutions
and the Spearman and Karber's method and expressed as log
10
TCID50 ml21.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 7
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
indirect/aerosol transmission was observed in ferrets and hamsters (36, 38). The experi-
mental setup in the present study prevented direct contact between animals, suggesting
that transmission of SARS-CoV-2 from inoculated to room indirect contact fawns most
likely occurred via aerosols or droplets generated by inoculated animals. Importantly, in a
follow-up study conducted to assess the transmission dynamics of SARS-CoV-2 in white-
tailed deer, we have confirmed the rapid transmission of the virus from inoculated to con-
tact animals. Contact animals became positive within ;24 to 48 h, when inoculated ani-
mals were placed in contact with naive animals on day 3 postinoculation (M. Martins et al.,
unpublished data). These findings are consistent with the present study and with the
transmission dynamics of the virus in other animal species (23, 28, 31, 36, 38, 39, 41).
Despite the potential for severe illness and mortality due to SARS-CoV-2 infection in
humans (43, 44), asymptomatic and mild cases represent approximately 80% of human
COVID-19 cases, while severe and critical disease outcomes account for approximately
15 and 5% of the cases, respectively (45). Notably, experimental infections in several
animal species, including nonhuman primates (26), cats (19, 23, 46), ferrets (23, 31, 37,
47), minks (27), deer mice (39), and raccoon dogs (28), have mostly resulted in subclini-
cal infections or only mild respiratory distress. Consistent with these observations,
white-tailed deer fawns inoculated here did not present overt clinical disease following
FIG 6 Tissues from white-tailed deer fawn inoculated intranasally with SARS-CoV-2 and examined 21 days later.
(A) Note intense labeling of viral RNA in the centers of lymphoid follicles located subjacent to tonsillar
epithelium (upper left). (B and C) Note labeling for SARS-CoV-2 RNA within the medial retropharyngeal lymph
node follicle (B) and mediastinal lymph node medulla (C). (D) Nasal turbinate lumen contains aggregate of
mucus, cells, and debris with intense labeling for SARS-CoV-2 RNA. (E and F) Adjacent microscopic sections
demonstrate intense labeling of lymphoid follicles with probe for SARS-CoV-2 RNA (E) but no labeling using
the anti-genomic sense probe (F). ISH-RNAscope.
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 8
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
SARS-CoV-2 infection. Only a transient and modest increase in body temperature was
observed in 3 of 4 inoculated animals between days 1 to 3 p.i. It is important to note
that most severe and critical cases of COVID-19 in humans have been associated with
underlying clinical conditions (e.g., heart and pulmonary disease, cancer, and diabetes,
among others), which may complicate full recapitulation of the clinical manifestations
of the human disease in animal species. Differences in expression and/or tissue distri-
bution of the SARS-CoV-2 receptor (ACE2), cellular proteases (transmembrane serine
protease 2, TMPRRS2, cathepsins), or other cofactor(s) that might be required for effi-
cient virus infection and replication in target tissues may help to explain the diverse
clinical outcomes of infection in humans and animals.
While no viremia was detected in infected animals, active virus shedding was
observed in nasal secretions of both inoculated and indirect contact animals. The pat-
terns and dynamics of SARS-CoV-2 shedding observed in fawns here are consistent
with what has been described for other susceptible animal species (23, 28, 31, 36, 39,
41, 46). Most importantly, the duration and magnitude of virus shedding observed in
deer corroborate observations in humans in which prolonged viral RNA has been
FIG 7 Antibody responses in white-tailed deer following SARS-CoV-2 infection. (A) Luminex assay to
assess IgG anti-SARS-CoV-2 nucleocapsid (N) in serum samples collected on days 0, 7, 14, and 21
postinoculation (p.i.) (fawn no. 2001, 2042, 2043, and 2045), or contact (fawn no. 2006 and 2044). (B)
Luminex assay to assess IgG anti-SARS-CoV-2-S-receptor binding domain (RBD) specificity at the same
time point and fawns as above. (C) Virus neutralization (VN) assay. Neutralizing antibody (NA) titers
were expressed as the reciprocal of the highest dilution of serum that completely inhibited SARS-
CoV-2 infection/replication in serum at the same time point and fawns as above. Results represent
the geometric mean titers (GMT) of three independent experiments.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 9
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
detected by rRT-PCR (21 to 35 days), with virus infectivity being usually limited to the
first 7 to 10 days of infection (48, 49). This could be partially explained by the activity of
effector host immune responses elicited against the virus, especially of neutralizing
antibodies, which were detected as early as day 7 p.i. in all fawns here, paralleling
decreased virus infectivity in nasal secretions.
Viral RNA load and tissue distribution were assessed on day 8 p.i. (animal no. 2001)
following acute infection and on day 21 p.i. after termination of the experiment
(remaining fawns). High viral RNA loads were detected in nasal turbinates, palatine ton-
sils, and medial retropharyngeal lymph nodes, suggesting that these tissues may
potentially serve as sites of SARS-CoV-2 replication in white-tailed deer. Since no infec-
tious virus was recovered from any of the tissues sampled on days 8 or 21 p.i., addi-
tional studies involving serial tissue collection over time are needed to determine spe-
cific sites of virus replication. Interestingly, no viral RNA was detected in the lung
tissues from inoculated or indirect contact fawns, suggesting that these tissues may
not be targeted by SARS-CoV-2 following infection of white-tailed deer. The possibility
that the virus may have been cleared from these sites by the time of tissue collection,
however, cannot be excluded.
Microscopic changes were observed in the lungs of 2 of 4 inoculated fawns and the
1 indirect contact fawn examined 21 days p.i. These changes were characterized by
congestion, lymphohistiocytic interstitial pneumonia, hyaline membranes, and intra-al-
veolar fibrin (Fig. 8), all of which are characteristic of the acute phase of diffuse alveolar
damage, the predominant finding in the lungs of patients affected with COVID-19 (50,
51). Mild to moderate pulmonary changes have been described in other species follow-
ing experimental SARS-CoV-2 infection, including domestic cats (40), rhesus macaques
(25, 52, 53), hACE2 mice (54, 55), ferrets (36), and minks (27). It is also notable that no
SARS-CoV-2 viral RNA was associated with lesions in white-tailed deer, which could be
a result of earlier viral clearance from these sites due to potent immunological
responses following SARS-CoV-2 infection.
Given the susceptibility of white-tailed deer to SARS-CoV-2 and the fact that corona-
viruses may adapt to host species through mutations that may enhance binding affin-
ity of the S protein to the ACE2 receptor, it will be interesting to assess potential evolu-
tion of SARS-CoV-2 in this species in the future. Studies to investigate evolution as the
virus is transmitted between animals (multiple rounds of transmission) are warranted.
The best example of SARS-CoV-2 adaptation to a new species comes from mink, a spe-
cies that is naturally susceptible to the virus and in which variant SARS-CoV-2 strains
have been identified and shown to be transmitted back to humans (56). It is important
to note, however, that the mink ACE2 protein is less conserved with the human protein
than the white-tailed deer receptor (18). Whether these differences result in different
evolutionary rates and differential adaptation of the virus remains to be demonstrated.
In summary, our study shows that white-tailed deer are susceptible to SARS-CoV-2
infection and can transmit the virus to indirect contact animals. These results con-
firmed in silico predictions describing a high propensity of interaction between SARS-
CoV-2 S protein and the cervid ACE2 receptor. Our findings indicate that deer and
other cervids should be considered in investigations conducted to identify the origin
and potential intermediate host species that may have served as the link host reservoir
to humans.
MATERIALS AND METHODS
Cells and virus. Vero cells (ATCC CCL-81), Vero E6 (ATCC CRL-1586), and Vero E6/TMPRSS2 (JCRB Cell
Bank; JCRB1819) were cultured in Dulbecco’s modified eagle medium (DMEM), while deer lung (DL;
ATCC CRL6195) cells were cultured in minimum essential medium (MEM). Both DMEM and MEM were
supplemented with 10% fetal bovine serum (FBS), L-glutamine (2 mM), penicillin (100 U·ml
21
), strepto-
mycin (100
m
g·ml
21
), and gentamicin (50
m
g·ml
21
). The cell cultures were maintained at 37°C with 5%
CO
2
. The SARS-CoV-2 isolate TGR/NY/20 obtained from a Malayan tiger naturally infected with SARS-
CoV-2 and presenting with respiratory disease compatible with SARS-CoV-2 infection (22) was propa-
gated in Vero CCL-81 cells. Low-passage virus stocks (passage 4) were prepared, cleared by centrifuga-
tion (1,966 gfor 10 min), and stored at 280°C. The endpoint titer was determined by limiting dilution
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 10
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
following the Spearman and Karber method. A viral suspension containing 10
6.3
50% tissue culture infec-
tious dose per milliliter (TCID50 ml21) was used for all in vitro experiments and fawn inoculations.
Cell susceptibility and growth curves. The susceptibility and kinetics of replication of the SARS-
CoV-2 in DL cells was assessed in vitro and compared to virus replication in Vero E6 and Vero E6/
TMPRSS2. For this, DL, Vero E6, and Vero E6/TMPRSS2 cells were inoculated with SARS-CoV-2 isolate
TGR/NY/20 at a multiplicity of infection (MOI) of 1 and adsorbed for 1 h at 37°C with 5% CO
2.
After
adsorption, cells were washed 3 times with MEM, and the cells were incubated for 24 h at 37°C with 5%
CO
2
. At 24 h postinoculation, cells were fixed with 3.7% formaldehyde for 30 min at room temperature,
permeabilized with 0.2% Triton X-100 (in phosphate-buffered saline [PBS]), and subjected to an immu-
nofluorescence assay (IFA) using a monoclonal antibody (MAb) anti-ACE2 (Sigma-Aldrich), then incu-
bated with a goat anti-rabbit IgG (Alexa Fluor 488) and using a MAb anti-SARS-CoV-2 nucleoprotein (N)
(clone B6G11) produced and characterized in D. G. Diel’s laboratory, and then incubated with a goat
anti-mouse IgG secondary antibody (Alexa Fluor 594). Nuclear counterstain was performed with 49,6-dia-
midino-2-phenylindole (DAPI) and visualized under a fluorescence microscope. To assess the kinetics of
replication of SARS-CoV-2 isolate TGR/NY/20, Vero E6, Vero E6/TMPRSS2, and DL cells were cultured in
12-well plates, inoculated with SARS-Cov-2 isolate TGR/NY/20 (MOI of 0.1 and 1) and adsorbed for 1 h at
37°C with 5% CO
2.
After adsorption, the inoculum was removed, and cells were washed 3 times with
FIG 8 Histological examination of lung from white-tailed deer fawns intranasally inoculated with
SARS-CoV-2. (A) Note the well-demarcated focus of congestion. Alveolar septal capillaries are
engorged with blood surrounded by normal appearing alveolar septa. HE. (B) Multiple alveolar septa
are lined by bands of eosinophilic hyalinized proteinaceous material (arrows) consistent with hyaline
membranes. Multiple alveoli contain flocculent to fibrillar eosinophilic material consistent with fibrin.
HE. (C) Expanded alveolus contains a large collection of fibrin, inflammatory cells, and cell debris
(arrow). HE. (D) Alveolar septa are expanded by an inflammatory infiltrate (interstitial pneumonia)
composed primarily of lymphocytes (arrows) and macrophages (E). HE. (F) Within a field of congested
alveolar septa are irregular regions characterized by hypocellular septa containing few erythrocytes.
Septal stroma is fibrillar and lightly eosinophilic. Multiple alveoli within these regions contain
flocculent strands of fibrin. HE. (G) There is type II pneumocyte hyperplasia and an increase in
alveolar macrophages (arrows). HE. (H) Lumens of cortical tubules in the kidney are filled with
necrotic cellular debris. Renal tubules are variably lined by attenuated epithelium, occasionally have
hypereosinophilic cytoplasm and pyknotic nuclei (degeneration and necrosis), and overall exhibit
increased cytoplasmic basophilia (regeneration). Tubules are separated by interstitial edema and a
cellular infiltrate composed of lymphocytes, plasma cells, and fewer macrophages. HE. Tissue sections
were examined on day 21 postinoculation.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 11
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
MEM. Inoculated cell cultures were maintained at 37°C with 5% CO
2
and harvested at various time points
postinoculation (12, 24, 36, 48, and 72 hpi). Cell monolayers and supernatants were collected and kept
at 280°C until further processing. The input virus amount was confirmed by back titration of the inocu-
lum virus (time zero). Virus titers were determined on each time point using endpoint dilutions and the
Spearman and Karber's method and expressed as TCID50 ml21.
Animals, inoculation, and sampling. All animals were handled in accordance with the Animal
Welfare Act Amendments (7 U.S. Code §2131 to §2156), and all study procedures were reviewed and
approved by the Institutional Animal Care and Use Committee at the National Animal Disease Center
(NADC; IACUC approval number ARS-2020-861). White-tailed deer fawns (n= 6) were obtained from a
breeding herd maintained at the National Animal Disease Center in Ames, Iowa. Within 24 h of birth,
fawns were removed from the pasture, moved to indoor housing, and bottle-fed. Hand-raising fawns
has been found to greatly decrease stress when animals are moved to containment housing (57). At
approximately 4 weeks of age, fawns were moved to the biosafety level 3 (agriculture) (BSL-3Ag) facility
at NADC and were microchipped (subcutaneously [s.c.]) for identification and body temperature moni-
toring. Fawns were fed white-tailed deer milk replacer, and hay was also available.
After a 2-week acclimation period, four fawns were inoculated intranasally with 5 ml (2.5 ml per nos-
tril) of a virus suspension containing 10
6.3
TCID50 ml21of SARS-CoV-2, isolated from respiratory secre-
tions from a tiger at the Bronx Zoo (TGR/NY/20) (22). Two fawns were maintained as noninoculated indi-
rect contact animals to evaluate potential transmission of SARS-CoV-2 from inoculated to indirect
contact animals. All fawns were maintained in a 3.7-m by 3.7-m room and inoculated, and indirect con-
tact animals were kept in two pens separated by a plexiglass barrier approximately 0.9 m (;3-feet) in
height to prevent direct nose-to-nose contact (Fig. 2A). Airflow in the room was maintained at 10 to 11
air exchanges per hour at a standard exchange rate for BSL-3Ag housing of large animals. Body tempera-
tures were recorded daily; nasal swabs (NS) and rectal swabs (RS) were collected on days 0, 1, 2, 3, 4, 5, 6,
7, 10, 12, 14, and 21 postinoculation (p.i.). Upon collection, swabs were placed individually in sterile tubes
containing 2 ml of vi ral transport media (MEM with 1,000 U·ml
21
of penicillin, 1,000
m
g·ml
21
of streptomycin,
and 2.5
m
g·ml
21
of amphotericin B) and stored at 280°C until analysis. Blood was collected through jugular
venipuncture in EDTA and serum separator tubes on days 0, 7, 14, and 21 p.i. The tubes were centrifuged for
25 min at 1,20 0 g, and buffy coat (BC) was collected from EDTA tubes and stored at 280°C. Serum from
the serum separator tubes was aliquoted and stored at 280°C until analysis.
Fawns were humanely euthanized on day 21 p.i. Following necropsy, multiple specimens, including
tracheal wash (TW), lung lavage (LL), and several tissues (nasal turbinates, palatine tonsil, thymus, tra-
chea, lung, bronchi, kidney, liver, spleen, ileum, ileocecal junction, spiral colon, cerebellum, cerebrum, ol-
factory bulbs, and medial retropharyngeal, mandibular, tracheobronchial, mediastinal and mesenteric
lymph nodes) were collected. Samples were processed for rRT-PCR and virus isolation (VI) and were indi-
vidually bagged, placed on dry ice, and transferred to a 280°C freezer until testing. Additionally, tissue
samples were collected and processed for standard microscopic examination and in situ hybridization
(ISH). For this, tissue fragments of approximately #0.5 cm in width were fixed by immersion in 10% neu-
tral-buffered formalin ($20 volumes fixative to 1 volume tissue) for approximately 24 h and then trans-
ferred to 70% ethanol, followed by standard paraffin embedding techniques. Slides for standard micro-
scopic examination were stained with hematoxylin and eosin (HE).
Nucleic acid extraction and rRT-PCR. Nucleic acid was extracted from nasal secretions, feces, BC,
serum tracheal wash, and lung lavage, and all the tissue samples were collected at necropsy. Before
extraction, 0.5 g of tissues were minced with a sterile scalpel and resuspended in 5 ml DMEM (10% wt/vol) and
homogenized using a stomacher (Stomacher 80 Biomaster; one speed cycle of 60 s). Homogenized tissue sam-
ples were cleared by centrifugation (1,966 gfor 10 min), and 200
m
l of the homogenate supernatant was used
for RNA extraction using the MagMax Core extraction kit (Thermo Fisher, Waltham, MA, USA) and the automated
KingFisher Flex nucleic acid extractor (Thermo Fisher) following the manufacturer’srecommendations.Thereal-
time reverse transcriptase PCR (rRT-PCR) was performed using the EZ-SARS-CoV-2 real-time RT-PCR assay
(Tetracore Inc., Rockville, MD), which detects both genomic and subgenomic viral RNA for increased diagnostic
sensitivity. An internal inhibition control was included in all reactions. Positive and negative amplification controls
were run side by side with test samples. All RNA extractions and rRT-PCR were performed at the Cornell Animal
Health Diagnostic Center (AHDC).
Virus isolation and titration. Nasal and rectal swabs collected on days 0, 1, 2, 3, 4, 5, 6, 7, 10, 12, 14,
and 21, and tissues collected during the necropsy that tested positive for SARS-CoV-2 by rRT-PCR were subjected
to virus isolation under biosafety level 3 conditions at Cornell University. Twenty-four-well plates were seeded
with ;75,000 Vero E6/TMPRSS2 cells per well 24 h prior to sample inoculation. Cells were rinsed with PBS
(Corning) and inoculated with 150
m
lofeachsampleandinoculumadsorbedfor1hat37°Cwith5%CO
2
.Mock-
inoculated cells were used as negative controls. After adsorption, replacement cell culture medium supple-
mented as described above was added, and cells were incubated at 37°C with 5% CO
2
and monitored daily for
cytopathic effect (CPE) for 3 days. SARS-CoV-2 infection in CPE-positive cultures was confirmed with an immuno-
fluorescence assay (IFA) as described above. Cell cultures with no CPE were frozen, thawed, and subjected to two
additional blind passages/inoculations in Vero E6/TMPRSS2 cell cultures. At the end of the third passage, the cell
cultures were subjected to IFA as above. Positive samples were subjected to endpoint titrations by limiting dilu-
tion using the Vero E6/TMPRSS2 cells, and virus titers were determined in the original swab sample using the
Spearman and Karber’s method and expressed as TCID50 ml21.
ISH. Paraffin-embedded tissues were sectioned at 5
m
m and subjected to ISH using the RNAscope
ZZ probe technology (Advanced Cell Diagnostics, Newark, CA). In situ hybridization was performed to
assess tissue distribution of SARS-CoV-2 nucleic acid in palatine tonsil; medial retropharyngeal, tracheobronchial,
mediastinal, and mesenteric lymph nodes; nasal turbinate; brain; lung; and kidney, using the RNAscope 2.5 HD
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 12
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
reagents-Red kit (Advanced Cell Diagnostics) as previously described (58). Proprietary ZZ probes targeting SARS-
CoV-2 RNA (V-nCoV2019-S probe; reference no. 8485561) or anti-sense RNA (V-nCoV2019-S-sense; reference no.
845701) designed and manufactured by Advance Cell Diagnostics were used for detection of viral RNA. The V-
nCoV2019-S probe detects the subgenomic RNA encoding the S gene, while the V-nCoV2019-S-sense detects
negative-sense genomic RNA intermediates of virus replication. A positive-control probe targeted the Bos taurus-
specific cyclophilin B (PPIB; catalog no. 3194510) or ubiquitin (UBC; catalog no. 464851) housekeeping genes,
whileaprobetargetingdapBofBacillus subtilis (catalog no. 312038) was used as a negative control. Slides were
counterstained with hematoxylin and examined by light microscopy using a Nikon Eclipse Ci microscope. Digital
images were captured using a Nikon DS-Ri2 camera.
Serological analysis. Antibody responses to SARS-CoV-2 were assessed by a Luminex assay, and virus neu-
tralization assays were developed in-house. For the Luminex assay, SARS-CoV-2 antigens were expressed as inter-
leukin 4 (IL-4) fusion proteins in mammalian cells as previously described (59). SARS-CoV-2 RNA (strain Hu-WA-1)
was derived from Vero cells infected with the virus, and cDNA was synthesized using the SuperScript III reverse
transcriptase (Life Technologies) and oligo(dT) and six hexamer random primers. The cDNA was used to amplify
the receptor binding domain (RBD; amino acids 319 to 529) of the spike protein and the whole nucleocapsid pro-
tein (NP; amino acids 1 to 419) by PCR. The primer sequences for RBD were AAGGATCCAAGAGTCCAACCAACAG
AATCTATTGTT (forward) and AAAGGTACCTTACTTTTTAGGTCCACAAACAGTTGCT (reverse). N primers were AAGG
ATCCAATGTCTGATAATGGACCCCAAAATC (forward) and AAAGGTACCTTAGGCCTGAGTTGAGTCAGCACTG
(reverse). The restriction sites for expression cloning are underlined. Both PCR products were cloned into
the multiple cloning site of the mammalian expression vector pcDNA3.1 (Thermo Fisher Scientific, Waltham, MA,
USA) downstream of the equine IL-4 sequence as described previously (59). Nucleotide sequences of RBD and N
were verified by Sanger sequencing and identical to respective sequences of the Hu-WA-1 strain (GenBank acces-
sion number NC_045512).
CHO-K1 cells were transiently transfected with the recombinant plasmid constructs. Expression and
secretion of the recombinant SARS-CoV-2 antigen fusion proteins by CHO transfectants were confirmed
using the IL-4 tag by flow cytometric analysis and enzyme-linked immunosorbent assay (ELISA) as previ-
ously described (59). After 24 to 30 h of incubation, the supernatants were harvested for fluorescent
bead-based multiplex assays.
Fluorescent beads were coupled with the anti-equine IL-4 antibody, clone 25 (RRID AB_2737308) as
previously described (60). The RBD/IL-4 and N/IL-4 fusion proteins were bound by incubating the anti-IL-
4-coupled beads with the fusion protein supernatant solution for 30 min at room temperature, followed
by a wash. The assay was performed with a few modifications from previously described procedures (60, 61).
Briefly, beads were incubated with deer serum samples diluted 1:100. The assay was detected using a biotinyl-
ated mouse anti-goat IgG (H1L) (RRID AB_2339061; Jackson ImmunoResearch Laboratories, West Grove, PA)
cross-reactive with deer immunoglobulin. Afterwards, streptavidin-phycoerythrin (Invitrogen, Carlsbad, CA) was
added as a final detection step. All incubation steps were for 30 min at room temperature, and the assay was
washed after each incubation step. The assay was measured in a Luminex 200 instrument (Luminex Corp.,
Austin, TX). Assay results were expressed as median fluorescence intensity (MFI).
Neutralizing antibody responses to SARS-CoV-2 were assessed by a virus neutralization (VN) assay performed
under BSL-3 conditions at the Cornell AHDC. Twofold serial dilutions (1:8 to 1:4,096) of serum samples were incu-
bated with 100 to 200 TCID
50
of SARS-CoV-2 isolate TGR/NY/20 for 1 h at 37°C. Following incubation of serum
and virus, 50
m
l of a cell suspension of Vero cells was added to each well of a 96-well plate and incubated for
48 h at 37°C with 5% CO
2
. The cells were fixed and permeabilized as described above and subjected to IFA using
a rabbit polyclonal antibody (pAb) specific for the SARS-CoV-2 nucleoprotein (N) (produced in D. G. Diel’slabora-
tory) followed by incubation with a goat anti-rabbit IgG (DyLight 594 conjugate, ImmunoReagents, Inc.).
Unbound antibodies were washed from cell cultures by rinsing the cells in PBS, and virus infectivity was assessed
under a fluorescence microscope. Neutralizing antibody titers were expressed as the reciprocal of the highest
dilution of serum that completely inhibited SARS-CoV-2 infection/replication after three independent VN assays
were performed. Fetal bovine serum (FBS) and convalescent human serum (kindly provided by Elizabeth
Plocharczyk, Cayuga Medical Center [CMC], under CMC’s Institutional Review Board; protocol number 0420EP)
were used as negative and positive controls, respectively.
ACKNOWLEDGMENTS
We thank clinical veterinarian, Rebecca Cox, and animal caretakers, Tiffany Williams,
Kolby Stallman, Derek Vermeer, and Robin Zeisneiss, for excellent animal care and
Patricia Federico for excellent technical assistance.
Antibody reagents to SARS-CoV-2 and the virus neutralization assay used to assess
serological responses were developed with support from the Cornell Feline Health Center.
Mention of tradenames or commercial products is solely for the purpose of
providing specific information and does not imply recommendation or endorsement by
the U.S. Department of Agriculture.
REFERENCES
1. Gorbalenya AE, Baker SC, Baric RS, de Groot RJ, Drosten C, Gulyaeva AA,
HaagmansBL,LauberC,LeontovichAM,NeumanBW,PenzarD,PerlmanS,
Poon LLM, Samborskiy DV, Sidorov IA, Sola I, Ziebuhr J. 2020. The species
severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV
and naming it SARS-CoV-2. Nat Microbiol Nature Res 5:536–544. https://doi
.org/10.1038/s41564-020-0695-z.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 13
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
2. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, Zhao X, Huang B, Shi W, Lu
R, Niu P, Zhan F, Ma X, Wang D, Xu W, Wu G, Gao GF, Tan W, China Novel
Coronavirus Investigating and Research Team. 2020. A novel coronavirus
from patients with pneumonia in China, 2019. N Engl J Med 382:727–733.
https://doi.org/10.1056/NEJMoa2001017.
3. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, Si HR, Zhu Y, Li B,
Huang CL, Chen HD, Chen J, Luo Y, Guo H, Jiang RD, Liu MQ, Chen Y, Shen
XR, Wang X, Zheng XS, Zhao K, Chen QJ, Deng F, Liu LL, Yan B, Zhan FX,
Wang YY, Xiao GF, Shi ZL. 2020. A pneumonia outbreak associated with a
new coronavirus of probable bat origin. Nature 579:270–273. https://doi
.org/10.1038/s41586-020-2012-7.
4. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, Hu Y, Tao ZW, Tian JH,
Pei YY, Yuan ML, Zhang YL, Dai FH, Liu Y, Wang QM, Zheng JJ, Xu L,
Holmes EC, Zhang YZ. 2020. A new coronavirus associated with human
respiratory disease in China. Nature 579:265–269. https://doi.org/10
.1038/s41586-020-2008-3.
5. Andersen KG, Rambaut A, Lipkin WI, Holmes EC, Garry RF. 2020. The proxi-
mal origin of SARS-CoV-2. Nat Med 26:450–454. https://doi.org/10.1038/
s41591-020-0820-9.
6.LatinneA,HuB,OlivalKJ,ZhuG,ZhangL,LiH,ChmuraAA,FieldHE,
Zambrana-Torrelio C, Epstein JH, Li B, Zhang W, Wang LF, Shi ZL, Daszak P.
2020. Origin and cross-species transmission of bat coronaviruses in China. Nat
Commun 11:4235. https://doi.org/10.1038/s41467-020-17687-3.
7. Murakami S, Kitamura T, Suzuki J, Sato R, Aoi T, Fujii M, Matsugo H, Kamiki
H, Ishida H, Takenaka-Uema A, Shimojima M, Horimoto T. 2020. Detection
and characterization of bat sarbecovirus phylogenetically related to
SARS-CoV-2, Japan. Emerg Infect Dis 26:3025–3029. https://doi.org/10
.3201/eid2612.203386.
8. Lau SKP, Luk HKH, Wong ACP, Li KSM, Zhu L, He Z, Fung J, Chan TTY, Fung
KSC, Woo PCY. 2020. Possible bat origin of severe acute respiratory syn-
drome coronavirus 2. Emerg Infect Dis 26:1542–1547. https://doi.org/10
.3201/eid2607.200092.
9. Chu DKW, Poon LLM, Gomaa MM, Shehata MM, Perera RAPM, Zeid DA, El
Rifay AS, Siu LY, Guan Y, Webby RJ, Ali MA, Peiris M, Kayali G. 2014. MERS coro-
naviruses in dromedary camels, Egypt. Emerg Infect Dis 20:1049–1053. https://
doi.org/10.3201/eid2006.140299.
10. Alagaili AN, Briese T, Mishra N, Kapoor V, Sameroff SC, Burbelo PD, de Wit
E, Munster VJ, Hensley LE, Zalmout IS, Kapoor A, Epstein JH, Karesh WB,
Daszak P, Mohammed OB, Lipkin WI. 2014. Middle East respiratory syn-
drome coronavirus infection in dromedary camels in Saudi Arabia. mBio
5:e00884-14. https://doi.org/10.1128/mBio.00884-14.
11. Childs JE, Mackenzie JS, Richt JA. 2007. Current topics in microbiology and im-
munology. The biology, circumstances and consequences of cross-species
transmission. Springer-Verlag, Berlin, Heidelberg, Germany.
12. Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, Wang W, Song H, Huang B, Zhu N,
Bi Y, Ma X, Zhan F, Wang L, Hu T, Zhou H, Hu Z, Zhou W, Zhao L, Chen J,
Meng Y, Wang J, Lin Y, Yuan J, Xie Z, Ma J, Liu WJ, Wang D, Xu W, Holmes
EC, Gao GF, Wu G, Chen W, Shi W, Tan W. 2020. Genomic characterisation
and epidemiology of 2019 novel coronavirus: implications for virus ori-
gins and receptor binding. Lancet 395:565–574. https://doi.org/10.1016/
S0140-6736(20)30251-8.
13. Paraskevis D, Kostaki EG, Magiorkinis G, Panayiotakopoulos G, Sourvinos
G, Tsiodras S. 2020. Full-genome evolutionary analysis of the novel co-
rona virus (2019-nCoV) rejects the hypothesis of emergence as a result of
a recent recombination event. Infect Genet Evol 79:104212. https://doi
.org/10.1016/j.meegid.2020.104212.
14. Lam TTY, Jia N, Zhang YW, Shum MHH, Jiang JF, Zhu HC, Tong YG, Shi YX,
Ni XB, Liao YS, Li WJ, Jiang BG, Wei W, Yuan TT, Zheng K, Cui XM, Li J, Pei
GQ, Qiang X, Cheung WYM, Li LF, Sun FF, Qin S, Huang JC, Leung GM,
Holmes EC, Hu YL, Guan Y, Cao WC. 2020. Identifying SARS-CoV-2-related
coronaviruses in Malayan pangolins. Nature 583:282–285. https://doi.org/
10.1038/s41586-020-2169-0.
15. Liu P, Jiang J-Z, Wan X-F, Hua Y, Li L, Zhou J, Wang X, Hou F, Chen J,
Zou J, Chen J. 2020. Are pangolins the intermediate host of the 2019
novel coronavirus (SARS-CoV-2)? PLoS Pathog 16:e1008421. https://
doi.org/10.1371/journal.ppat.1008421.
16. Letko M, Marzi A, Munster V. 2020. Functional assessment of cell entry and re-
ceptor usage for SARS-CoV-2 and other lineage B betacoronaviruses. Nat
Microbiol 5:562–569. https://doi.org/10.1038/s41564-020-0688-y.
17. Wan Y, Shang J, Graham R, Baric RS, Li F. 2020. Receptor recognition by
the novel coronavirus from Wuhan: an analysis based on decade-long
structural studies of SARS coronavirus. J Virol 94:1–9. https://doi.org/10
.1128/JVI.00127-20.
18. Damas J, Hughes GM, Keough KC, Painter CA, Persky NS, Corbo M, Hiller
M, Koepfli KP, Pfenning AR, Zhao H, Genereux DP, Swofford R, Pollard KS,
Ryder OA, Nweeia MT, Lindblad-Toh K, Teeling EC, Karlsson EK, Lewin HA.
2020. Broad host range of SARS-CoV-2 predicted by comparative and
structural analysis of ACE2 in vertebrates. Proc Natl Acad Sci U S A
117:22311–22322. https://doi.org/10.1073/pnas.2010146117.
19. Sit THC, Brackman CJ, Ip SM, Tam KWS, Law PYT, To EMW, Yu VYT, Sims
LD, Tsang DNC, Chu DKW, Perera RAPM, Poon LLM, Peiris M. 2020. Infec-
tion of dogs with SARS-CoV-2. Nature 586:776–778. https://doi.org/10
.1038/s41586-020-2334-5.
20. Oreshkova N, Molenaar RJ, Vreman S, Harders F, Oude MBB, Van Der Honing
RWH, Gerhards N, Tolsma P, Bouwstra R, Sikkema RS, Tacken MGJ, De RM,
Weesendorp E, Engelsma MY, Bruschke CJM, Smit LAM, Koopmans M, Van Der
Poel WHM, Stegeman A. 2020. SARS-CoV-2 infection in farmed minks, the
Netherlands, April and May 2020. Eurosurveillance 25:2001005. https://doi
.org/10.2807/1560-7917.ES.2020.25.23.2001005.
21. Rockx B, Kuiken T, Herfst S, Bestebroer T, Lamers MM, Munnink BBO, De
Meulder D, Van Amerongen G, Van Den Brand J, Okba NMA, Schipper D,
Van Run P, Leijten L, Sikkema R, Verschoor E, Verstrepen B, Bogers W,
Langermans J, Langermans J, Drosten C, Van Vlissingen MF, Fouchier R,
De Swart R, Koopmans M, Haagmans BL. 2020. Comparative pathogenesis
of COVID-19, MERS, and SARS in a nonhuman primate model. Science
368:1012–1015. https://doi.org/10.1126/science.abb7314.
22. McAloose D, Laverack M, Wang L, Killian ML, Caserta LC, Yuan F, Mitchell
PK, Queen K, Mauldin MR, Cronk BD, Bartlett SL, Sykes JM, Zec S, Stokol T,
Ingerman K, Delaney MA, Fredrickson R, Ivan
ci
c M, Jenkins-Moore M,
Mozingo K, Franzen K, Bergeson NH, Goodman L, Wang H, Fang Y,
Olmstead C, McCann C, Thomas P, Goodrich E, Elvinger F, Smith DC, Tong
S, Slavinski S, Calle PP, Terio K, Torchetti MK, Diel DG. 2020. From people
to Panthera: natural SARS-CoV-2 infection in tigers and lions at the Bronx
Zoo. mBio 11:e02220-20. https://doi.org/10.1128/mBio.02220-20.
23. Shi J, Wen Z, Zhong G, Yang H, Wang C, Huang B, Liu R, He X, Shuai L, Sun
Z, Zhao Y, Liu P, Liang L, Cui P, Wang J, Zhang X, Guan Y, Tan W, Wu G,
Chen H, Bu Z. 2020. Susceptibility of ferrets, cats, dogs, and other domes-
ticated animals to SARS-coronavirus 2. Science 368:1016–1020. https://
doi.org/10.1126/science.abb7015.
24. Chandrashekar A, Liu J, Martino AJ, McMahan K, Mercad NB, Peter L,
Tostanosk LH, Yu J, Maliga Z, Nekorchuk M, Busman-Sahay K, Terry M,
Wriji LM, Ducat S, Martine DR, Atyeo C, Fischinger S, Burk JS, Slei MD,
Pessaint L, Van Ry A, Greenhouse J, Taylor T, Blade K, Cook A, Finneyfrock
B, Brown R, Teow E, Velasco J, Zahn R, Wegmann F, Abbink P, Bondzi EA,
Dagotto G, Gebr MS, He X, Jacob-Dolan C, Kordana N, Li Z, Lifto MA,
Mahrokhia SH, Maxfiel LF, Nityanandam R, Nkolol JP, Schmid AG, Mille
AD, Bari RS, Alter G, Sorge PK, Este JD, Andersen H, Lewi MG, Barou DH.
2020. SARS-CoV-2 infection protects against rechallenge in rhesus maca-
ques. Science 369:812–817. https://doi.org/10.1126/science.abc4776.
25. Munster VJ, Feldmann F, Williamson BN, van Doremalen N, Pérez-Pérez L,
Schulz J, Meade-White K, Okumura A, Callison J, Brumbaugh B, Avanzato
VA, Rosenke R, Hanley PW, Saturday G, Scott D, Fischer ER, de Wit E. 2020.
Respiratory disease in rhesus macaques inoculated with SARS-CoV-2. Na-
ture 585:268–272. https://doi.org/10.1038/s41586-020-2324-7.
26. Hartman AL, Nambulli S, McMillen CM, White AG, Tilston-Lunel NL, Albe
JR, Cottle E, Dunn MD, Frye LJ, Gilliland TH, Olsen EL, O'Malley KJ, Schwarz
MM, Tomko JA, Walker RC, Xia M, Hartman MS, Klein E, Scanga CA, Flynn
JL, Klimstra WB, McElroy AK, Reed DS, Duprex WP. 2020. SARS-CoV-2
infection of African green monkeys results in mild respiratory disease dis-
cernible by PET/CT imaging and shedding of infectious virus from both
respiratory and gastrointestinal tracts. PLoS Pathog 16:e1008903. https://
doi.org/10.1371/journal.ppat.1008903.
27. Zhang Z, Wang L, Liu W, Yan Z, Zhu Y, Zhou S, Guan S. 2020. Replication,
pathogenicity, and transmission of SARS-CoV-2 in minks. Natl Sci Rev
https://doi.org/10.1093/nsr/nwaa291.
28. FreulingCM,BreithauptA,MüllerT,SehlJ,Balkema-BuschmannA,Rissmann
M, Klein A, Wylezich C, Höper D, Wernike K, Aebischer A, Hoffmann D,
Friedrichs V, Dorhoi A, Groschup MH, Beer M, Mettenleiter TC. 2020. Suscepti-
bility of raccoon dogs for experimental SARS-CoV-2 infection. Emerg Infect Dis
26:2982–2985. https://doi.org/10.3201/eid2612.203733.
29. Meekins DA, Morozov I, Trujillo JD, Gaudreault NN, Bold D, Carossino M,
Artiaga BL, Indran SV, Kwon T, Balaraman V, Madden DW, Feldmann H,
Henningson J, Ma W, Balasuriya UBR, Richt JA. 2020. Susceptibility of
swine cells and domestic pigs to SARS-CoV-2. Emerg Microbes Infect
9:2278–2288. https://doi.org/10.1080/22221751.2020.1831405.
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 14
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
30. Ulrich L, Wernike K, Hoffmann D, Mettenleiter TC, Beer M. 2020. Experimental
infection of cattle with SARS-CoV-2. Emerg Infect Dis 26:2979–2981. https://
doi.org/10.3201/eid2612.203799.
31. Schlottau K, Rissmann M, Graaf A, Schön J, Sehl J, Wylezich C, Höper D,
Mettenleiter TC, Balkema-Buschmann A, Harder T, Grund C, Hoffmann D,
Breithaupt A, Beer M. 2020. SARS-CoV-2 in fruit bats, ferrets, pigs, and chickens:
an experimental transmission study. Lancet Microbe 1:e218–e225. https://doi
.org/10.1016/S2666-5247(20)30089-6.
32. Matsuyama S, Nao N, Shirato K, Kawase M, Saito S, Takayama I, Nagata N,
Sekizuka T, Katoh H, Kato F, Sakata M, Tahara M, Kutsuna S, Ohmagari N,
Kuroda M, Suzuki T, Kageyama T, Takeda M. 2020. Enhanced isolation of
SARS-CoV-2 by TMPRSS2-expressing cells. Proc Natl Acad Sci U S A
117:7001–7003. https://doi.org/10.1073/pnas.2002589117.
33. Harcourt J, Tamin A, Lu X, Kamili S, Sakthivel SK, Murray J, Queen K, Tao Y,
Paden CR, Zhang J, Li Y, Uehara A, Wang H, Goldsmith C, Bullock HA,
Wang L, Whitaker B, Lynch B, Gautam R, Schindewolf C, Lokugamage KG,
Scharton D, Plante JA, Mirchandani D, Widen SG, Narayanan K, Makino S,
Ksiazek TG, Plante KS, Weaver SC, Lindstrom S, Tong S, Menachery VD,
Thornburg NJ. 2020. Severe acute respiratory syndrome coronavirus 2
from patient with 2019 novel coronavirus disease, United States. Emerg
Infect Dis 26:1266–1273. https://doi.org/10.3201/eid2606.200516.
34. Korber B, Fischer WM, Gnanakaran S, Yoon H, Theiler J, Abfalterer W,
Hengartner N, Giorgi EE, Bhattacharya T, Foley B, Hastie KM, Parker MD,
Partridge DG, Evans CM, Freeman TM, de Silva TI, Angyal A, Brown RL,
Carrilero L, Green LR, Groves DC, Johnson KJ, Keeley AJ, Lindsey BB,
Parsons PJ, Raza M, Rowland-Jones S, Smith N, Tucker RM, Wang D, Wyles
MD, McDanal C, Perez LG, Tang H, Moon-Walker A, Whelan SP, LaBranche
CC, Saphire EO, Montefiori DC. 2020. Tracking changes in SARS-CoV-2
spike: evidence that D614G increases infectivity of the COVID-19 virus.
Cell 182:812–827.e19. https://doi.org/10.1016/j.cell.2020.06.043.
35. Arons MM, Hatfield KM, Reddy SC, Kimball A, James A, Jacobs JR, Taylor J,
Spicer K, Bardossy AC, Oakley LP, Tanwar S, Dyal JW, Harney J, Chisty Z,
Bell JM, Methner M, Paul P, Carlson CM, McLaughlin HP, Thornburg N,
Tong S, Tamin A, Tao Y, Uehara A, Harcourt J, Clark S, Brostrom-Smith C,
Page LC, Kay M, Lewis J, Montgomery P, Stone ND, Clark TA, Honein MA,
Duchin JS, Jernigan JA. 2020. Presymptomatic SARS-CoV-2 infections and
transmission in a skilled nursing facility. N Engl J Med 382:2081–2090.
https://doi.org/10.1056/NEJMoa2008457.
36. Kim YI, Kim SG, Kim SM, Kim EH, Park SJ, Yu KM, Chang JH, Kim EJ, Lee S,
Casel MAB, Um J, Song MS, Jeong HW, Lai VD, Kim Y, Chin BS, Park JS,
Chung KH, Foo SS, Poo H, Mo IP, Lee OJ, Webby RJ, Jung JU, Choi YK.
2020. Infection and rapid transmission of SARS-CoV-2 in ferrets. Cell Host
Microbe 27:704–709.e2. https://doi.org/10.1016/j.chom.2020.03.023.
37. Richard M, Kok A, de Meulder D, Bestebroer TM, Lamers MM, Okba NMA,
Fentener van Vlissingen M, Rockx B, Haagmans BL, Koopmans MPG, Fouchier
RAM, Herfst S. 2020. SARS-CoV-2 is transmitted via contact and via the air
between ferrets. Nat Commun 11:3496. https://doi.org/10.1038/s41467-020
-17367-2.
38. Sia SF, Yan LM, Chin AWH, Fung K, Choy KT, Wong AYL, Kaewpreedee P,
Perera RAPM, Poon LLM, Nicholls JM, Peiris M, Yen HL. 2020. Pathogenesis
and transmission of SARS-CoV-2 in golden hamsters. Nature 583:834–838.
https://doi.org/10.1038/s41586-020-2342-5.
39. Fagre A, Lewis J, Eckley M, Zhan S, Rocha SM, Sexton NR, Burke B, Geiss B,
P
eersenO,KadingR,RovnakJ,EbelGD,TjalkensRB,AboellailT,SchountzT.
2020. SARS-CoV-2 infection, neuropathogenesis and transmission among
deer mice: implications for reverse zoonosis to New World rodents. BioRxiv
https://doi.org/https://doi.org/10.1101/2020.08.07.241810.
40. Bosco-Lauth AM, Hartwig AE, Porter SM, Gordy PW, Nehring M, Byas AD,
VandeWoude S, Ragan IK, Maison RM, Bowen RA. 2020. Experimental
infection of domestic dogs and cats with SARS-CoV-2: pathogenesis,
transmission, and response to reexposure in cats. Proc Natl Acad Sci U S A
117:26382–26388. https://doi.org/10.1073/pnas.2013102117.
41. Halfmann PJ, Hatta M, Chiba S, Maemura T, Fan S, Takeda M, Kinoshita N,
Hattori S, Sakai-Tagawa Y, Iwatsuki-Horimoto K, Imai M, Kawaoka Y. 2020.
Transmission of SARS-VoV-2 in domestic cats. N Engl J Med 383:592–594.
https://doi.org/10.1056/NEJMc2013400.
42. Honein MA, Christie A, Rose DA, Brooks JT, Meaney-Delman D, Cohn A,
Sauber-Schatz EK, Walker A, McDonald LC, Liburd LC, Hall JE, Fry AM, Hall
AJ, Gupta N, Kuhnert WL, Yoon PW, Gundlapalli AV, Beach MJ, Walke HT,
CDC COVID-19 Response Team. 2020. Summary of guidance for public
health strategies to address high levels of community transmission of
SARS-CoV-2 and related deaths, December 2020. MMWR Morb Mortal
Wkly Rep 69:1860–1867. https://doi.org/10.15585/mmwr.mm6949e2.
43. Bialek S, Boundy E, Bowen V, Chow N, Cohn A, Dowling N, Ellington S, Gierke
R, Hall A, MacNeil J, Patel P, Peacock G, Pilishvili T, Razzaghi H, Reed N, Ritchey
M, Sauber-Schatz E. 2020. Severe outcomes among patients with coronavirus
disease 2019 (COVID-19) —United States, February 12–March 16, 2020.
MMWR Morb Mortal Wkly Rep 69:343–346. https://doi.org/10.15585/mmwr
.mm6912e2.
44. Nachtigall I, Lenga P, Jó
z
wiakK,ThürmannP,Meier-HellmannA,KuhlenR,
Brederlau J, Bauer T, Tebbenjohanns J, Schwegmann K, Hauptmann M,
Dengler J. 2020. Clinical course and factors associated with outcomes among
1904 patients hospitalized with COVID-19 in Germany: an observational study.
Clin Microbiol Infect 26:1663–1669. https://doi.org/10.1016/j.cmi.2020.08.011.
45. Wu Z, McGoogan JM. 2020. Characteristics of and important lessons from
the coronavirus disease 2019 (COVID-19) outbreak in China. JAMA
323:1239. https://doi.org/10.1001/jama.2020.2648.
46. Gaudreault NN, Trujillo JD, Carossino M, Meekins DA, Morozov I, Madden DW,
Indran SV, Bold D, Balaraman V, Kwon T, Artiaga BL, Cool K, García-Sastre A,
Ma W, Wilson WC, Henningson J, Balasuriya UBR, Richt JA. 2020. SARS-CoV-2
infection, disease and transmission in domestic cats. Emerg Microbes Infect
9:2322–2332. https://doi.org/10.1080/22221751.2020.1833687.
47. Oude Munnink BB, Sikkema RS, Nieuwenhuijse DF, Molenaar RJ, Munger
E, Molenkamp R, van der Spek A, Tolsma P, Rietveld A, Brouwer M,
Bouwmeester-Vincken N, Harders F, Hakze-van der Honing R, Wegdam-
Blans MCA, Bouwstra RJ, GeurtsvanKessel C, van der Eijk AA, Velkers FC,
Smit LAM, Stegeman A, van der Poel WHM, Koopmans MPG. 2021. Trans-
mission of SARS-CoV-2 on mink farms between humans and mink and
back to humans. Science 371:172–177. https://doi.org/10.1126/science
.abe5901.
48. Widders A, Broom A, Broom J. 2020. SARS-CoV-2: the viral shedding vs infectiv-
ity dilemma. Infect Dis Health 25:210–215. https://doi.org/10.1016/j.idh.2020
.05.002.
49. Perera RAPM, Tso E, Tsang OTY, Tsang DNC, Fung K, Leung YWY, Chin AWH,
Chu DKW, Cheng SMS, Poon LLM, Chuang VWM, Peiris M. 2020. SARS-CoV-2
virus culture and subgenomic RNA for respiratory specimens from patients
with mild coronavirus disease. Emerg Infect Dis 26:2701–2704. https://doi.org/
10.3201/eid2611.203219.
50. Suess C, Hausmann R. 2020. Gross and histopathological pulmonary find-
ings in a COVID-19 associated death during self-isolation. Int J Legal Med
134:1285–1290. https://doi.org/10.1007/s00414-020-02319-8.
51. Arrossi AV, Farver C. 2020. The pulmonary pathology of COVID-19. Cleve
Clin J Med https://doi.org/10.3949/ccjm.87a.ccc063.
52. Yu P, Qi F, Xu Y, Li F, Liu P, Liu J, Bao L, Deng W, Gao H, Xiang Z, Xiao C, Lv
Q, Gong S, Liu J, Song Z, Qu Y, Xue J, Wei Q, Liu M, Wang G, Wang S, Yu H,
Liu X, Huang B, Wang W, Zhao L, Wang H, Ye F, Zhou W, Zhen W, Han J,
Wu G, Jin Q, Wang J, Tan W, Qin C. 2020. Age-related rhesus macaque
models of COVID-19. Anim Model Exp Med 3:93–97. https://doi.org/10
.1002/ame2.12108.
53. Rockx B, Feldmann F, Brining D, Gardner D, LaCasse R, Kercher L, Long D,
Rosenke R, Virtaneva K, Sturdevant DE, Porcella SF, Mattoon J, Parnell M,
Baric RS, Feldmann H. 2011. Comparative pathogenesis of three human
and zoonotic SARS-CoV strains in cynomolgus macaques. PLoS One 6:
e18558. https://doi.org/10.1371/journal.pone.0018558.
54. Sun SH, Chen Q, Gu HJ, Yang G, Wang YX, Huang XY, Liu SS, Zhang NN, Li XF,
XiongR,GuoY,DengYQ,HuangWJ,LiuQ,LiuQM,ShenYL,ZhouY,YangX,
Zhao TY, Fan CF, Zhou YS, Qin CF, Wang YC. 2020. A mouse model of SARS-
CoV-2 infection and pathogenesis. Cell Host Microbe 28:124–133.e4. https://
doi.org/10.1016/j.chom.2020.05.020.
55. Bao L, Deng W, Huang B, Gao H, Liu J, Ren L, Wei Q, Yu P, Xu Y, Qi F, Qu Y, Li
F, Lv Q, Wang W, Xue J, Gong S, Liu M, Wang G, Wang S, Song Z, Zhao L, Liu
P,ZhaoL,YeF,WangH,ZhouW,ZhuN,ZhenW,YuH,ZhangX,GuoL,
Chen L, Wang C, Wang Y, Wang X, Xiao Y, Sun Q, Liu H, Zhu F, Ma C, Yan L,
Yang M, Han J, Xu W, Tan W, Peng X, Jin Q, Wu G, Qin C. 2020. The pathoge-
nicity of SARS-CoV-2 in hACE2 transgenic mice. Nature 58 3:830–833. https://
doi.org/10.1038/s41586-020-2312-y.
56. Hammer AS, Quaade ML, Rasmussen TB, Fonager J, Rasmussen M, Mundbjerg
K, Lohse L, Strandbygaard B, Jørgensen CS, Alfaro-Núñez A, Rosenstierne MW,
Boklund A, Halasa T, Fomsgaard A, Belsham GJ, Bøtner A. 2021. SARS-CoV-2
transmission between mink (Neovison vison) and humans, Denmark. Emerg
Infect Dis 27:547–551. https://doi.org/10.3201/eid2702.203794.
57. Palmer MV, Cox RJ, Waters WR, Thacker TC, Whipple DL. 2017. Using
white-tailed deer (Odocoileus virginianus) in infectious disease research.
J Am Assoc Lab Anim Sci 56:350–360.
58. Palmer MV, Wiarda J, Kanipe C, Thacker TC. 2019. Early pulmonary lesions in
cattle infected via aerosolized Mycobacterium bovis. Vet Pathol 56:544–554.
https://doi.org/10.1177/0300985819833454.
Infection of White-Tailed Deer with SARS-CoV-2 Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 15
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
59. Wagner B, Hillegas JM, Babasyan S. 2012. Monoclonal antibodies to
equine CD23 identify the low-affinity receptor for IgE on subpopulations
of IgM 1and IgG1 1B-cells in horses. Vet Immunol Immunopathol
146:125–134. https://doi.org/10.1016/j.vetimm.2012.02.007.
60. Wimer CL, Schnabel CL, Perkins G, Babasyan S, Freer H, Stout AE, Rollins
A, Osterrieder N, Goodman LB, Glaser A, Wagner B. 2018. The deletion of
the ORF1 and ORF71 genes reduces virulence of the neuropathogenic
EHV-1 strain Ab4 without compromising host immunity in horses. PLoS
One 13:e0206679. https://doi.org/10.1371/journal.pone.0206679.
61. Wagner B, Freer H, Rollins A, Erb HN. 2011. A fluorescent bead-
based multiplex assay for the simultaneous detection of antibodies
to B. burgdorferi outer surface proteins in canine serum. Vet Immunol
Immunopathol 140:190–198. https://doi.org/10.1016/j.vetimm.2010
.12.003.
Palmer et al. Journal of Virology
June 2021 Volume 95 Issue 11 e00083-21 jvi.asm.org 16
on May 10, 2021 at DigiTop -- USDA's Digital Desktop Libraryhttp://jvi.asm.org/Downloaded from
