Synopsis of the Evippinae (Araneae, Lycosidae) of Israel, with description of a new species

Abstract

Evippinae (Araneae, Lycosidae) is a subfamily of old-world lycosids, comprising six genera and 67 species, most of them typically found in xeric habitats. Although Israel is located between the two distribution-centers of the subfamily, Africa and central Asia, only two species of the genus Evippa Simon, 1882, namely E. arenaria (Audouin, 1826) and E. praelongipes (O. Pickard-Cambridge, 1871), and a doubtful record of Xerolycosa nemoralis (Westring, 1861) were reported previously. Here we describe a new species: Evippa amitaii sp. nov., and re-describe and report a new record for Israel of E. onager (Simon, 1895 sensu Šternbergs 1979). Additionally, the genus Evippomma Roewer, 1959 is recorded for the first time from the Middle East, with a description of the previously unknown female of Evippomma simoni Alderweireldt, 1992. We discuss the possible vicariance of Evippa arenaria and E. praelongipes. We suggest that the dispersal of E. arenaria along the coastal plain is blocked by the Yarqon river valley. We suggest competition with a similar species (Pardosa subsordidatula (Strand, 1915)) as a factor affecting the seasonal activity of E. arenaria. Additionally, we present a partial molecular phylogeny of Evippinae, to clarify the placement of E. onager, a species with an unusual morphology.

Full text

87
European Journal of Taxonomy 733: 87–124 ISSN 2118-9773
https://doi.org/10.5852/ejt.2021.733.1225 www.europeanjournaloftaxonomy.eu
2021 · Armiach Steinpress I. et al.
This work is licensed under a Creative Commons Attribution License (CC BY 4.0).
Research article
urn:lsid:zoobank.org:pub:22EF594A-81C2-4C8B-AF9A-0DC86C3B5BA3
Synopsis of the Evippinae (Araneae, Lycosidae) of Israel,
with description of a new species
Igor ARMIACH STEINPRESS 1,*, Mark ALDERWEIRELDT 2,
Mira COHEN 3, Ariel CHIPMAN 4 & Efrat GAVISH-REGEV 5
1,4,5 The National Natural History Collections, The Hebrew University
of Jerusalem, Edmond J. Safra Campus, Givat Ram, Jerusalem, 9190401, Israel.
1, 3, 4 The Department of Ecology, Evolution and Behavior, The Hebrew University
of Jerusalem, Edmond J. Safra Campus, Givat Ram, Jerusalem, 9190401, Israel.
2 University Ghent, Terrestrial Ecology Unit, K.L. Ledeganckstraat 35, 9000 Gent, Belgium.
* Corresponding author: bomtombadil@gmail.com
2 Email: malderweireldt@hotmail.com
3 Email: mira.cohen@mail.huji.ac.il
4 Email: ariel.chipman@mail.huji.ac.il
5 Email: efrat.gavish-regev@mail.huji.ac.il
1 https://orcid.org/0000-0002-0794-0906
4 https://orcid.org/0000-0001-6696-840X
5 https://orcid.org/0000-0002-7359-1492
1 urn:lsid:zoobank.org:author:380129F9-96AC-4F19-A30E-3FB65AA39076
2 urn:lsid:zoobank.org:author:CE20F264-3E66-4481-86A9-06ACCD1941AE
3 urn:lsid:zoobank.org:author:0FE66053-001F-44F1-A0EC-36DDAF791AE2
4 urn:lsid:zoobank.org:author:C7A32B57-33D0-4A35-BB05-62C919137F53
5 urn:lsid:zoobank.org:author:FC073F19-2202-4C89-8B43-CEA4CC5E2D50
Abstract. Evippinae (Araneae, Lycosidae) is a subfamily of old-world lycosids, comprising six genera
and 67 species, most of them typically found in xeric habitats. Although Israel is located between the
two distribution-centers of the subfamily, Africa and central Asia, only two species of the genus Evippa
Simon, 1882, namely E. arenaria (Audouin, 1826) and E. praelongipes (O. Pickard-Cambridge, 1871),
and a doubtful record of Xerolycosa nemoralis (Westring, 1861) were reported previously. Here we
describe a new species: Evippa amitaii sp. nov., and re-describe and report a new record for Israel of
E. onager (Simon, 1895 sensu Šternbergs 1979). Additionally, the genus Evippomma Roewer, 1959 is

of Evippomma simoni Alderweireldt, 1992. We discuss the possible vicariance of Evippa arenaria
and E. praelongipes. We suggest that the dispersal of E. arenaria along the coastal plain is blocked
by the Yarqon river valley. We suggest competition with a similar species (Pardosa subsordidatula
     E. arenaria. Additionally, we present a
partial molecular phylogeny of Evippinae, to clarify the placement of E. onager, a species with an
unusual morphology.

European Journal of Taxonomy 733: 87–124 (2021)
88
Keywords. Evippa, Evippomma, vicariance, xeric habitat.
Armiach Steinpress I., Alderweireldt M., Cohen M., Chipman A. & Gavish-Regev E. 2021. Synopsis of the
Evippinae (Araneae, Lycosidae) of Israel, with description of a new species. European Journal of Taxonomy 733:
87–124. https://doi.org/10.5852/ejt.2021.733.1225
Introduction
Lycosidae Sundevall, 1833 is a family of medium-sized to large entelegyne spiders, easily recognized
by a combination of characters: three-row eye-arrangement, the lack of a Retrolateral Tibial Apophysis
(RTA) (in males) and carrying the egg sac attached to the spinnerets and hatchlings on the body (in

described species (World Spider Catalog 2020). Lycosids inhabit most terrestrial habitats, from the Arctic
Circle to the tropics and from rainforests to deserts (Bowden & Buddle 2012; Dippenaar-Schoeman &
Jocqué 1997; Silva 1996). With some exceptions, lycosids are ground-dwelling, active hunters, either
vagrant or burrowing (Dippenaar-Schoeman & Jocqué 1997). The family Lycosidae was traditionally

1986). However, recent studies using new techniques are challenging this division (Jiman & Daxiang
1996; Murphy et al. 2006; Piacentini 2019). A recent phylogeny suggested nine subfamilies, supported
by molecular analysis: Allocosinae, Artoriinae, Hippasinae, Lycosinae, Sosippinae, Tricassinae,
Venoniinae, Zoicinae and Evippinae (Piacentini 2019).
The subfamily Evippinae comprises 67 species in six genera (Roewer 1959; World Spider Catalog 2020;
Zyuzin 1985), with all six represented in Africa. Little is known about the life histories of most Evippinae
species. While three genera (Proevippa Purcell, 1903; Pseudevippa Simon, 1910; Zenonina Simon,
1898) are endemic to sub-Saharan Africa, the other three genera (Evippa Simon, 1882; Evippomma
Roewer, 1959; Xerolycosa Dahl, 1908) are distributed across the dry parts of tropical, sub-tropical,
temperate and continental regions of the old world (Xerolycosa alone can be found in boreal climates
(Lyubechanskii 2012)). Evippinae was elevated by Zyuzin (1985) to a subfamily level from the tribe

this group: the embolus enters the tegular apophysis (referred to as median apophysis, in Alderweireldt
1991; Alderweireldt 1992; Alderweireldt & Jocqué 2017), forming a single structural complex with it.

patella IV + tibia IV. However, many somatic characters used by Roewer are given very little value
in modern taxonomy (e.g., Alderweireldt & Jocqué 1992). Apart from this character, Evippinae was
described by Roewer as similar to the Pardosinae, although today Evippinae is considered more closely
related to the Venoniinae, based on molecular data (Murphy et al. 2006; Piacentini 2019). According to
Zonstein & Marusik (2013), three species of Evippinae have been reported from Israel to date: Evippa
arenaria (Audouin, 1826); E. praelongipes (O. Pickard-Cambridge, 1871) and Xerolycosa nemoralis
(Westring, 1861). Of these, the report of X. nemoralis by Bodenheimer (1937) is considered doubtful
(Zonstein & Marusik 2013).
Evippa Simon, 1882, with 38 species, is the most species-rich genus in the subfamily (World
Spider Catalog 2020). Evippa is highly derived, distinguished easily from other Evippinae by three
synapomorphies: elongated tarsal claws, pseudoarticulation of the tarsus and a transverse depression in
the carapace, posterior to the ocular area (Alderweireldt 1991). It is found mostly in arid climates, from
East Africa to the deserts of Mongolia and China (World Spider Catalog 2020).
Evippomma Roewer, 1959 comprises seven species, distinguished from other Evippinae by two
synapomorphies: short leaf-shaped setae covering the body like scales; 4–5 pairs of ventral spines on

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
89
tibia I (plus an apical pair) (Alderweireldt 1992). It is found mostly in arid climates in Africa (World
Spider Catalog 2020).
Here we studied historical material deposited in collections and collected fresh material, to revise the
species of Evippinae in Israel and examine their distributions and seasonal activity.
Material and methods
This synopsis is based on material deposited at the Israel National Arachnid Collection, the National
Natural History Collections (NNHC), at the Hebrew University of Jerusalem (HUJ). The samples were

(Šternbergs 1979; Alderweireldt 1991, 1992; Marusik, et al. 2003).
Morphological analysis and distribution maps
Measurements are in mm. Epigynes were detached and temporarily cleared with clove oil. Specimens
were examined and measured using a Nikon SMZ25 stereo microscope. Digital microscope images
were taken using NIS-elements imaging system with a Nikon DS Fi2 digital camera mounted on a Nikon
SMZ25 stereo microscope. Habitus images were taken with a Nikon D7100. Images were edited and
drawings generated using GIMP ver. 2.6.10. The distribution map was generated with Inkscape ver. 0.48.
Transliterated names of the localities in Israel and Palestine follow the 'Israel Touring Map'(1:250 000)
and 'List of Settlements', published by the Israel Survey, Ministry of Labor. Coordinates are given in
decimal degrees (DD). Coordinates estimated from Google maps by the locality name are in square
brackets, coordinates taken in situ with a GPS are without brackets.
Anatomical abbreviations used in text and gures
A = atrium
ALE = anterior lateral eyes
AME = anterior median eyes
C = conductor
CY = cymbium
E = embolus
Fe = femur
Mt = metatarsus
Pa = patella
PME = posterior median eyes
RTA = retrolateral tibial apophysis
S = septum
SA = spermatheca
SD = sperm duct
SP = subapical process
ST = subtegulum
T = tegulum
TA = tegular apophysis
TAT = tegular apophysis tip
TER = terminal apophysis (as used by Barrientos et al. 2015)
Ti = tibia
Tr = tarsus

European Journal of Taxonomy 733: 87–124 (2021)
90
Molecular analysis
    , using the
BioVision Insect Genomic DNA Kit (Catalog #: K1412), following the protocol provided with the
product (except that the samples were incubated in proteinase K overnight, rather than 30 minutes).
      
bidirectionally with Sanger sequencing. We retrieved a ~650 bp long fragment of cytochrome c oxidase
I (COI) and a ~600 bp long fragment of NADH dehydrogenase subunit 1 (NADH). All sequences are
deposited in GenBank (see Table 1). To these we added the corresponding COI and NADH fragments
from six lycosid species retrieved from GenBank (see Table 1). These two markers were selected for
their proven utility in lycosid phylogeny (Piacentini & Ramírez 2019). The sequences were edited and
aligned using MEGA 10 (Kumar et al. 2018). We constructed a maximum likelihood phylogenetic
tree, with MEGA 10 (Kumar et al. 2018), using the Tamura-Nei substitution model. Nodal support was
estimated by running 10 000 non-parametric bootstrap replicates.
Results
Class Arachnida Cuvier, 1812
Order Araneae Clerck, 1757
Family Lycosidae Sundevall,1833
Subfamily Evippinae Zyuzin, 1985
Diagnosis

single structural complex with it” (Zyuzin 1985: 48). Roewer recognized this distinguishing feature
for Evippinae (at the time, tribe Evippeae): Metatarsus IV shorter than patella IV + tibia IV (Roewer
1959). Roewer's character is invalid for Evippa amitaii sp. nov. deviates from these
proportions.
Description

appearance, but distinct in genital structure (Figs 6–13). Anterior eye row narrower than second eye
row (PME). Tibia I with 2–6 pairs of ventral spines (apart from apical pair). Spinnerets not elongated.
Body densely covered with short (often specialized) setae (Alderweireldt 1992) (Figs 1, 14). Sexual
dimorphism usually weak (Figs 4–5) (but see section about Evippomma (Figs 1–2, 4–5)). Zyuzin (1985)
described the Evippinae as having an embolus encased in a sheath of transparent tissue (Figs 6–8);
     
inserted into tegular apophysis, forming single structure. Epigyne atria very shallow, pale, conspicuous;
septum with narrow base, often covered with setae; spermathecae usually large and conspicuous
(Figs 10–11, 13). Coloration variable; carapace often with median band (Figs 1–3). Certain genera
(Evippa, Zenonina) have a derived habitus, clearly discernible from other lycosid genera (Roewer 1959;
Alderweireldt 1991, 1992; Marusik Kovblyuk & Koponen 2011).
Natural history
Most species inhabit deserts, steppes and savannas, but species of open patches in and along forests
(Xerolycosa spp.) are known. Zyuzin (1985) described Xerolycosa as found in dry conifer forests,
steppes and arable land, while Evippa    
representative of Lycosidae. They are largely presumed vagrant (Alderweireldt & Jocqué 2017),
although burrow construction behavior is known from species of Xerolycosa (Marusik et al. 2011) and
Evippomma (Bayer et al. 2017). Both diurnal and nocturnal activity has been observed (Zyuzin 1985;

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
91
Table 1. Specimens used for molecular phylogeny.
Species Specimen ID gene GenBank
accession source
Alopecosa albofasciata
(Brullé, 1832) P6A 7039 COI MH763780.1 Just et al. 2019
Evippa sp. NIBGE SPD-00947 COI MK154832.1 Ashfaq et al. 2019
Evippa arenaria
(Audouin, 1826) HUJ INV-Ar 20313 COI MT560596 This study
Evippa arenaria
(Audouin, 1826) HUJ INV-Ar 20313 NADH MT559069 This study
Evippa arenaria
(Audouin, 1826) HUJ INV-Ar 20319 COI MT560597 This study
Evippa arenaria
(Audouin, 1826) HUJ INV-Ar 20319 NADH MT559070 This study
Evippa onager
Simon, 1895 sensu Šternbergs HUJ INV-Ar 20314 COI MT560593 This study
Evippa onager
Simon, 1895 sensu ŠternbergsHUJ INV-Ar 20314 NADH MT559068 This study
Evippa onager
Simon, 1895 sensu Šternbergs HUJ INV-Ar 20315 COI MT560592 This study
Evippa onager
Simon, 1895 sensu Šternbergs HUJ INV-Ar 20315 NADH MT559067 This study
Evippa praelongipes
(O. Pickard-Cambridge, 1871) HUJ INV-Ar 16562 COI MT560599 This study
Evippa praelongipes
(O. Pickard-Cambridge, 1871) HUJ INV-Ar 16562 NADH MT559072 This study
Evippa praelongipes
(O. Pickard-Cambridge, 1871) HUJ INV-Ar 20317 COI MT560598 This study
Evippa praelongipes
(O. Pickard-Cambridge, 1871) HUJ INV-Ar 20317 NADH MT559071 This study
Evippomma sp. CAS 9029020 COI – Luis Piacentini, pers.
com.
Evippomma sp. CAS 9029020 NADH MK524650 Piacentini & Ramirez
2019
Evippomma simoni
Alderweireldt, 1992 HUJ INV-Ar 16579 COI MT560594 This study
Lycosa sp. HUJ INV-Ar 20318 COI MT560595 This study
Pirata piraticus (Clerck, 1757) BIOUG06991-A10 COI KM839375.1 Blagoev et al. 2016
Pirata piraticus (Clerck, 1757) MACN-Ar 35321 NADH MK524663.1 Piacentini & Ramirez
2019
Xerolycosa miniata
(C.L. Koch, 1834)
ZFMK-
DNA-100425649 COI KY270253.1 Astrin et al. 2016*
Xerolycosa nemoralis
(Westring, 1861)
ZFMK-
TIS-2534437 COI KY270273.1 Astrin et al. 2016*
Xerolycosa nemoralis
(Westring, 1861) NADH DQ019710.1 Murphy et al. 2006
* Direct submission to Gen Bank by Astrin J., Hoefer H., Spelda J., Holstein J., Bayer S., Hendrich L.,
Huber B.A., Kielhorn K.-H., Krammer H.-J., Lemke M., Monje J.C., Moriniere J., Rulik B., Petersen M.,
Janssen H. and Muster C.

European Journal of Taxonomy 733: 87–124 (2021)
92
Fig. 1. Evippomma simoni   (HUJ INV-Ar 16579), Mamshit, Apr. 2018.
A. Lateral view. B. Frontal view. C. Dorsal view. D. Cephalic region in dorsal view, right side. Leaf-
shaped setae discernible. Photos by I. Armiach Steinpress.
Table 2. Primers used for molecular phylogeny.
Name Sequence Gene Direction Source
LepF1 ATTCAACCAATCATAAAGATATTGG COI F Hebert et al. 2004
LCO1490 GGTCAACAAATCATAAAGATATTGG COI R Folmer et al. 1994
LepR1 TAAACTTCTGGATGTCCAAAAAATCA COI R Hebert et al. 2004
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA COI F Folmer et al. 1994
TL-1-N-12718 TGCATTAGAATTAGAATCTA NADH F Piacentini & Ramirez 2019
M510 ATACTAATTCKGATTCKCCTTC NADH R Piacentini & Ramirez 2019

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
93
I. Armiach Steinpress, pers. obs.). As in all lycosids, the female carries the egg sac attached to her
spinnerets and carries the young on her body for some time after hatching (I. Armiach Steinpress, pers.
obs.).
Distribution
The subfamily is restricted to the Old World where it is widely distributed, except in the polar region,
wet tropics and wet subtropics. Xerolycosa is found across the Palearctic, from Europe to Japan (with
a doubtful species from Zanzibar). Proevippa, Pseudevippa and Zenonina are restricted to sub-Saharan
Africa. Evippomma        
Evippa is found across arid and semiarid climates throughout Africa and Eurasia, from Tanzania to
Siberia (World Spider Catalog 2020).
Relationships
Molecular studies that included Xerolycosa tend to place it in a rather basally branching position in
Lycosidae, away from the Lycosinae (Park et al. 2007; Zehethofer & Sturmbauer 1998). Murphy et al.
(2006) have placed Xerolycosa as a sister taxon of the venoniin genera Aulonia (C.L. Koch, 1847) and
Hygrolycosa (Dahl, 1908) (Venoniinae was not recovered in the study). A recent molecular phylogeny
Fig. 2. Evippomma simoni   
16 June 2020. A. Lateral view. B. Frontal view. C. Dorsal view. D
I. Armiach Steinpress; photo D by S. Aharon.

European Journal of Taxonomy 733: 87–124 (2021)
94
Evippinae: Proevippa, Xerolycosa, and Evippomma,
and recovered Evippinae as monophyletic (Piacentini 2019).
Composition
Evippinae consists of 67 species in six genera: 38 species in Evippa Simon, 1882; seven species in
Evippomma Roewer, 1959; eleven species in Proevippa Purcell, 1903; one species in Pseudevippa
Simon, 1910; four species in Xerolycosa Dahl, 1908; and six species in Zenonina Simon, 1898.
Key to the genera of Evippinae (based on: Roewer 1959; Alderweireldt 1991, 1992; Marusik et al.
2011). Spines are counted in pairs, as in Alderweireldt 1991.
1. Abdomen triangular, widest distally. Spinnerets ventral, not seen in dorsal view .............................
........................................................................................................................Zenonina Simon, 1898
– Abdomen oval, widest in the middle. Spinnerets distal, seen in dorsal view ................................... 2
  ...................... Evippomma Roewer, 1959
  ............................................................ 3
Fig. 3.    A. Evippa arenaria (Audouin, 1826) (   ), dorsal
view. B. E. praelongipes (O. Pickard-Cambridge, 1871) (Nahal Ashalim, 13 Apr. 2018), dorsal view.
C. E. onager Simon, 1895 sensu Šternbergs 1979 (
13 Mar. 2018), dorsal view. D. E. onager (
2018), frontal view. Photos by I. Armiach Steinpress.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
95
Fig. 4.   A. Evippa amitaii sp. nov. (HUJ INV-Ar 16051). B. E. arenaria (Audouin,
1826) (HUJ INV-Ar 16508). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar 20316).
D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16041). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16049). Scale bars = 10 mm. Photos by A. Uzan.

European Journal of Taxonomy 733: 87–124 (2021)
96
3. Tibia I with 4–5 ventral spines, apart from distal pair ........................................................................
................................................................................................................ Xerolycosa Sundevall, 1833
– Tibia I with more than 5 ventral spines, apart from distal pair ......................................................... 4
4. Tibia I with 3–4 pairs of ventral spines (apart from distal pair) ....................................................... 5
– Tibia I with 5–6 pairs of ventral spines (apart from distal pair) ........................ Evippa Simon, 1882
5. Metatarsus I with 2 pairs of ventral spines (apart from distal pair) .......... Pseudevippa Simon, 1910
– Metatarsus I with 3 pairs of ventral spines (apart from distal pair) ............. Proevippa Purcell, 1903
Fig. 5.   A. Evippa amitaii sp. nov. (HUJ INV-Ar 16048). B. E. arenaria (Audouin,
1826) (HUJ INV-Ar 16507). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar 16510).
D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16044). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16544). Scale bars = 10 mm. Photos by A. Uzan.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
97
Fig. 6.  A. Evippa amitaii sp. nov. (HUJ INV-Ar 16051). B. E. arenaria
(Audouin, 1826) (HUJ INV-Ar 16508). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar
16510). D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16531). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16538). Scale bars = 0.5 mm. Photos by I. Armiach Steinpress.

European Journal of Taxonomy 733: 87–124 (2021)
98
Fig. 7. A. Evippa amitaii sp. nov. (HUJ INV-Ar 16051). B. E. arenaria
(Audouin, 1826) (HUJ INV-Ar 16508). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar
16510). D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16531). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16538). Scale bars = 0.5 mm. Photos by I. Armiach Steinpress.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
99
Fig. 8.A. Evippa amitaii sp. nov. (HUJ INV-Ar 16051). B. E. arenaria
(Audouin, 1826) (HUJ INV-Ar 16508). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar
16510). D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16531). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16538). Scale bars = 0.5 mm. Photos by I. Armiach Steinpress.

European Journal of Taxonomy 733: 87–124 (2021)
100
Evippa Simon, 1882
Figs 3–13
Evippa Simon, 1882: 367.
Type species
Evippa arenaria (Audouin, 1826)
Diagnosis
Evippa is distinguished easily from all other lycosids by a combination of characters: elongated tarsal
claws, 5–6 pairs of ventral spines on tibia I (apart from apical pair), transverse depression in carapace
posterior to ocular area (Fig. 3) (Alderweireldt 1991).
Description
Small- to medium-sized lycosids. Cephalic region elevated, separated from thoracic region by transverse
depression. Ocular area almost as wide as cephalic region, adorned with long, forward-pointing setae.
Clypeus vertical. Anterior row of eyes procurved, narrower than PME. AME larger than ALE. Labium
wider than long. Most species with long, slender legs (see E. onager; Fig. 3). Claws usually long,
toothed near base. Tarsi of many species with pseudoarticulation. Tibia I with 5–6 pairs of spines (apart
from apical pair). Coloration cryptic, usually mottled yellow or brown (Fig. 3). Carapace usually with
pale median band. Body covered with short setae throughout (Fig. 14A) (Alderweireldt 1992). Male
and female of similar appearance. Embolus large; base in meso-apical position (Figs 6–9, 12). Epigyne
usually with well-developed, pale atria (Figs 10, 13). Spermathecae large, sperm ducts twisted (Figs 11,
13) (Tikader & Malhotra 1980; Alderweireldt 1991).
Fig. 9. Evippa amitaii sp. nov.,   16051), bulb of left palp, proximal view. Photo by
I. Armiach Steinpress. Scale bar = 0.3 mm.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
101
Natural history
Evippa species inhabit deserts, steppes and savannas, often on sandy, clay or salt-covered plains
(Barrientos et al. 2015; Ponomarev & Tsvetkov 2004) (Fig. 15), although mountain-dwelling species are
known (Tikader & Malhotra 1980). All species are presumed vagrant (Alderweireldt & Jocqué 2017).
Diurnal activity has been observed (I. Armiach Steinpress, pers. obs.) but most activity is crepuscular
and nocturnal (Alderweireldt & Jocqué 2017). Adults in warm climates are observed active during most
of the year (Barrientos et al. 2015).
Distribution
The species of Evippa are distributed in arid and semiarid environments across Eurasia and Africa. Eight
species are reported from Africa, four species are reported from Europe, and 34 are reported from Asia
(13 from Central Asia, nine from India, nine from the Middle East, seven from China and one from
Siberia) (World Spider Catalog 2020). In Israel four species are found.
Relationships
The genus appears to be closely related to Pseudevippa Simon, 1910, from which it is distinguished by
the number of ventral spines on tibia I (Alderweireldt 1991).
Key to the genus Evippa in Israel
  ............. Evippa onager Simon, 1895 sensu Šternbergs 1979
  ............................................................................................ 2
Fig. 10. , genitalia, ventral view. A. Evippa amitaii sp. nov. (HUJ INV-Ar 16053). B. E. arenaria
(Audouin, 1826) (HUJ INV-Ar 16058). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar
20314). D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16521). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16543). Scale bars = 0.5 mm. Photos by I. Armiach Steinpress.

European Journal of Taxonomy 733: 87–124 (2021)
102
2. Females ............................................................................................................................................. 3
– Males ................................................................................................................................................. 5
Females
3. Epigynal septum greatly constricted proximally. Epigynal atria curved proximally towards each
other (Fig. 10B) ............................................................................Evippa arenaria (Audouin, 1826)
– Epigynal septum not constricted proximally. Epigynal atria approximately parallel (Figs 10A, D,
13) ..................................................................................................................................................... 4
4. Epigynal septum with smooth edges, widening only towards ends (Fig. 10D) .................................
..........................................................................Evippa praelongipes (O. Pickard-Cambridge, 1871)
– Epigynal septum edge with small tooth or terrace (Figs 10A, 13A, C) .........Evippa amitaii sp. nov.
Males
5. Terminal apophysis (process between tegular apophysis and cymbium, as used by Barrientos et al.
2015) at least at 40° angle to tegular apophysis (Figs 7A, 8A, 12) ............... Evippa amitaii sp. nov.
– Terminal apophysis approximately parallel to tegular apophysis (Figs 7B–D, 8B–D) .................... 6
 
8D) ................................................................... Evippa praelongipes (O. Pickard-Cambridge, 1871)
               
(Fig. 6B) ........................................................................................Evippa arenaria (Audouin, 1826)
Fig. 11. , genitalia, dorsal view. A. Evippa amitaii sp. nov. (HUJ INV-Ar 16053). B. E. arenaria
(Audouin, 1826) (HUJ INV-Ar 16058). C. E. onager Simon, 1895 sensu Šternbergs 1979 (HUJ INV-Ar
20314). D. E. praelongipes (O. Pickard-Cambridge, 1871) (HUJ INV-Ar 16521). E. Evippomma simoni
Alderweireldt, 1992 (HUJ INV-Ar 16543). Scale bars = 0.5 mm. Photos by I. Armiach Steinpress.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
103
Fig. 12. Evippa amitaii           A. Ventral view.
B. Retrolateral view. C. Proximal view. D. Prolateral view. Scale bars = 0.5 mm. Drawings by I. Armiach
Steinpress.

European Journal of Taxonomy 733: 87–124 (2021)
104
Evippa amitaii sp. nov.
urn:lsid:zoobank.org:act:CB6C5814-B74C-4FEC-AD41-27D18232D3FC
Figs 4A, 5A, 6A, 7A, 8A, 9, 10A,11A, 12, 13A, 13C
Diagnosis
Recognized by a combination of genital characters (compare with Evippa aequalis Alderweireldt, 1991).

E. aequalis,
by the terminal apophysis (process between tegular apophysis and cymbium) being at least at 40° angle
to tegular apophysis and oriented ventrad (in the others the tip of the tegular apophysis is oriented distad)
(Figs 6A, 7A, 8A, 12). Epigyne: Atrium borders indistinct. Septum wide, longer than atrium, narrowing
Fig. 13. , genitalia, drawings. A. Evippa amitaii sp. nov. (HUJ INV-Ar 16053), ventral view.
B. Evippomma simoni Alderweireldt, 1992 (HUJ INV-Ar 16543), ventral view. C. Evippa amitaii
sp. nov. (HUJ INV-Ar 16053), dorsal view. D. Evippomma simoni Alderweireldt, 1992 (HUJ INV-Ar
16543), dorsal view. Scale bars = 0.5 mm. Drawings by I. Armiach Steinpress.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
105
slightly anteriorly and mesally, creating a small protrusion (Figs 10A, 13A). Spermathecae club-shaped,
long, reaching over frontal edge of atria (Figs 11A, 13C). In contrast, the similar E. praelongipes lacks
the protrusion in the septum (Fig. 10D). The similar E. aequalis has a protrusion in the septum, but has
short spermathecae, not reaching the frontal edge of the atria (Alderweireldt 1991).
Etymology
Named after Pinchas Amitai, an Israeli entomologist, writer and educator, who coined the Hebrew name
for Evippa: 
Material examined
Holotype
ISRAEL – Dead Sea Area •
INV-Ar 16051.
Paratype
ISRAEL – Dead Sea Area •
pitfall; HUJ INV-Ar 16048.
Other material
ISRAEL – Dead Sea Area     30.94° N, 35.37° E; 3–27 Aug. 2014; pitfall;

31.01° N, 35.35° E; 21 Apr. 1954; A. Shulov leg.; HUJ INV-Ar 16053.
Description
Male
   AME diameter: 0.15; PME diameter: 0.36; carapace length: 2.37;
carapace width: 2.2; abdomen length: 2.34; leg I (Fe, Pa, Ti, Mt, Tr): 3.16, 1.21, 2.92, 3.07, 1.48; leg II:
2.95, 1.2, 2.8, 3.07, 1.54; leg III: 2.98, 1.05, 2.87, 3.67, 1.55; leg IV: 3.0, 1.04, 2.88, 3.77, 1.71.
Fig. 14. Cephalic region (right side, dorsal view), showing covering setae. A. Evippa praelongipes
  B. Evippomma simoni Alderweireldt, 1992, leaf-
shaped setae. Scale bars = 0.5 mm. Photos by I. Armiach Steinpress.

European Journal of Taxonomy 733: 87–124 (2021)
106
   n = 2). AME diameter: 0.15–0.16; PME diameter: 0.36–0.39; carapace length:
2.37–2.61; carapace width: 2.2–2.25; abdomen length: 2.1–2.34; legs I, III, IV of male HUJ INV-Ar
16047 are missing. Leg II (Fe, Pa, Ti, Mt, Tr): 2.99, 1.07, 2.9, 3.9, 1.6.
 Transverse depression posterior to ocular area.
 3 promarginal, 2 retromarginal.
 Carapace yellow, lateral bands faint, brown-grey; margins spotted. Clypeus yellow to brown.
Chelicerae yellow, darker retrolaterally. Legs yellow. Femora III–IV with grey dorsal bands. Palps
yellow. Sternum yellow. Abdomen dorsum yellow, with dark spots on margins, cardiac mark dark.
Abdomen venter yellow to dark yellow, sometimes with longitudinal lines. Spinnerets yellow to orange
(Fig. 4A).
 Palpal organs strongly sclerotized. Part of sperm duct visible through tegulum as sinuous

9, 12), best examined in distal view (Figs 9, 12C). Terminal apophysis long, sharp, slightly curved,
oriented distad.
Fig. 15. Typical habitats of Evippinae in Israel. A. Nahal Ashalim, Dead Sea area, stream bed in hyperarid
climate. B. Mamshit, central Negev, sandy loess plain in arid climate. C.
southern Negev, stream bed with cracked soil in hyperarid climate. D. Palmahim, Coastal Plain, dunes
in Mediterranean climate. Photos by I. Armiach Steinpress.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
107
 Pseudoarticulation of tarsi present. Metatarsus I ventral spination: 3 pairs + apical triplet; tibia I
ventral spination: 6 pairs + single weak retrolateral spine + apical pair.
Female
 AME diameter: 0.15; PME diameter: 0.37; carapace length: 3.18;
carapace width: 2.46; abdomen length: 2.85; leg I (Fe, Pa, Ti, Mt, Tr): 2.6, 1.2, 2.8, 2.77, 1.4; leg II: 2.9,
1.0, 2.85, 2.69, 1.38; leg III: 3.0, 1.2, 2.7, 3.2, 1.5; leg IV: 4.2, 1.2, 3.98, 5.27, 2.0
n = 3). AME diameter: 0.15–0.19; PME diameter: 0.35–0.46; carapace length:
3.14–3. 2; carapace width: 2.46–2.8; abdomen length: 2.85–4.37; leg I (Fe, Pa, Ti, Mt, Tr): 2.6–3.1, 1.2,
2.8–3.09, 2.77–2.8, 1.4–1.5; leg II: 2.9–3.19, 1.0–1.18, 2.85–2.9, 2.69–2.79, 1.35–1.38; leg III: 3.0–3.7,
1.2–1.25, 2.7–2.88, 3.2–3.5, 1.5–1.8; leg IV: 4.2–4.6, 1.2–1.37, 3.98–4.1, 5.6–5.27, 2.0.
 Carapace yellow, lateral bands distinct, orange to brown, sometimes radiated. Clypeus yellow to
brown. Chelicerae orange. Legs yellow. Legs I–II with faint grey spots. Femora III–IV with three dorsal
bands. Palps yellow, darker towards tip, femora with dark stain. Sternum yellow. Abdomen dorsum
yellow, with four brown, unfused chevrons (sometimes indistinct); dark cardiac mark. Abdomen venter
whitish. Spinnerets whitish yellow with brown setae (Fig. 5A).
 Transverse depression posterior to ocular area.
 3 promarginal, 2 retromarginal.
 Epigyne as wide as long, septum approximately straight, mildly widening on proximal half,
atria indistinct laterally. Spermathecae club-shaped, slightly longer than atria (Figs 10A, 11A, 13C).
 Pseudoarticulation of tarsi present. Metatarsus I ventral spination: 3 pairs + apical triplet; tibia I
ventral spination: 6 pairs + apical pair.
Natural history
No live specimens observed. Adults collected in April, August and September (Table 3), from salt pans
and oases (Fig. 16).
Distribution
Israel,
Remarks
The species closely resembles the African species Evippa aequalis Alderweireldt, 1991. The Dead Sea
area is known to be a refugium for tropical species (Yom-Tov & Tchernov 1988), mainly of African
origin. We suggest that populations of E. amitaii sp. nov., or a closely related species, exist in suitable

5.27 mm) is slightly
longer than its patella and tibia IV (1.2 + 3.98 = 5.18 mm).

European Journal of Taxonomy 733: 87–124 (2021)
108
Fig. 16. Recorded distribution of Evippinae in Israel and Palestine: - Evippa amitaii sp. nov., - Evippa
arenaria (Audouin, 1826), - E. onager Simon, 1895 sensu Šternbergs 1979, - E. praelongipes
(O. Pickard-Cambridge, 1871), - Evippomma simoni Alderweireldt, 1992. Dune areas marked by
grainy background. Isohyets marking average annual precipitation.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
109
Evippa arenaria (Audouin, 1826)
Figs 3A, 4B, 5B, 6B, 7B, 8B, 10B, 11B
Lycosa arenaria Audouin.
Lycosa festiva Pavesi, 1880: 369 .
Lycosa arenaria – 
Evippa arenaria – Simon 1885: 12 (North Africa);  (North Africa). —
Reimoser 1919: 158 (North Africa, Syria). — Caporiacco 1933: 337 (Lybia); 1936: 91 (Lybia). —
Bodenheimer 1937: 242 (Israel, Palestine). — Roewer 1955: 154 (North Africa, Syria). — Bonnet
1956: 1866.        
Egypt).
non Evippa arenaria.
non Evippa arenaria).
Diagnosis
Recognized by a combination of genital characters. Male palp: Tegular apophysis parallel to cymbium,
tip sharp, distally oriented. Subapical process blunt, located near base of TA. Terminal apophysis between
tegular apophysis and cymbium (Figs 6B, 7B, 8B). Epigyne: atria distinct, kidney shaped; septum wide,
constricted proximally (Figs 10B, 11B). It is the only Evippinae in Israel to have kidney-shaped atria.
Material examined
ISRAEL – Coastal Plain •        
  20 Jul. 2017; I. Armiach Steinpress
leg.; HUJ INV-Ar 16509 • 

  

       
    
  31.7259° N, 34.6064° E; 6 Jul. 2017; B. Shacham leg.;
     
   
Ar 20313. – Negev


         
      
   
      
eggs; same locality as for preceding; 5 Feb. 1970; faunistics course leg.; sands; HUJ INV-Ar 16073 •





 



European Journal of Taxonomy 733: 87–124 (2021)
110









Sekher; 31.091° N, 34.8121° E; 18 Apr. 2015; B. Shacham leg.; Subadult; sands; HUJ INV-Ar 16063 •

;
; 24 Mar. 2018; B. Shacham leg.; sands; HUJ INV-Ar 16552 • ;








                 


preceding; 23 Jul. 2015; I. Armiach Steinpress leg.; HUJ INV-Ar 16045 to 16046.
PALESTINE – Gaza strip
INV-Ar 16074.
Natural history
Adults of Evippa arenaria were collected from February through October, and egg-sacs are recorded
from February to September (Table 3). Both nocturnal and diurnal activity were observed. Evippa
arenaria is the most mesophilic species of the four Evippa species found in Israel. It is found in sand
and loess substrate throughout the semi-arid and arid parts of the Negev (Figs 15B, 16). It is also found
in the Mediterranean climate zone, along the coastal dune strip (Figs 15D, 16). In the northern edge of
its distribution in Israel and Palestine, E. arenaria is a strict psammophile, found only on exposed sand,
but in the Negev desert it appears to be more generalist in its edaphic preferences, and is even found on
somewhat rocky hillsides.
Distribution
Algeria, Tunisia, Lybia, Chad and Egypt (Alderweireldt 1991); Israel, Palestine; the report from Syria
(Reimoser, 1919) is doubtful.
Records

Ramon, Mamshit, Mishor Yamin, Nahal Ashan, Nahal Sekher (Sands), Sede Boqer, Sede Zin, Yeroham,

Palestine: Gaza (Jabalyia) (Fig. 16).

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
111
Remarks
Despite extensive sampling in the Negev in all seasons, no adult E. arenaria were collected from
November to January. This may be due to seasonal changes in activity (see Discussion).
Evippa onager Simon, 1895 sensu Šternbergs 1979
Figs 3C–D, 4C, 5C, 6C, 7C, 8C, 10C, 11C
Evippa onager Simon, 1895: 341 .
Evippa caucasica Zamani et al.
et al. 2017)
Evippa ? onager          et al. 2003: 50)  
Turkmenistan).
Evippa ? onager sensu Šternbergs 1979 – Marusik et al..
Diagnosis
.
Prosoma of preserved specimens dark brown (other Evippinae in Israel are yellow after preservation).
Male palp: tegular apophysis parallel to cymbium, with single, small, subapical process oriented ventrad
(Figs 6C, 7C, 8C). It is the only Evippa in Israel with a subapical process directed ventrad at 90° to the
tegular apophysis. In the similar Evippa caucasica Marusik, Guseinov & Koponen, 2003, the base of the
subapical process reaches the tip of the tegular apophysis, whereas in E. onager, the tip and the process
are distinct. Epigyne: atria distinct, widest in middle. Septum narrow, slightly constricted in middle,
broadened distally (Figs 10C, 11C).
Material examined
ISRAEL – Dead Sea Area
Ar 16510. – Negev


Description
Male
 (n = 2, specimen HUJ INV-Ar 20316 (the smaller of the two) was raised in the laboratory
and might not be representative of sizes found in wild populations). AME diameter: 0.24–0.2; PME
diameter: 0.51–0.4; carapace length: 3.97–3.58; carapace width: 2.94–2.67; abdomen length: 2.81–3.4;
leg I (Fe, Pa, Ti, Mt, Tr): 2.99–2.74 (rest missing in specimen HUJ INV-Ar 16510), 1.26, 2.38, 2.3, 1.27;
leg II: 2.91–2.44, 1.27–1.17, 3.04–2.3, 2.91–2.4 (rest missing in specimen HUJ INV-Ar 16510), 1.19;
leg III: 2.29–2.6, 1.38–1.22, 2.59–2.22, 3.51–2.86, 1.51–1.34; leg IV: 3.83–3.34, 1.64–1.37, 3.43–2.9,
5.13–4.13, 1.99–1.61.
 Carapace brown, darker on margins and in ocular area, sparsely radiated. Clypeus center
dark, margins white. Chelicerae dark yellow, striated brown. Legs yellow, dorsum with wide brown
annulations. Palps yellow, tarsus darkest. Sternum brown to black. Abdomen dorsum brown to black
with white setae. Abdomen venter black to brown, with sparse white setae. Spinnerets yellow (Fig. 4C).
Live specimens dark yellow; legs with faint annulations.
 Transverse depression posterior to ocular area.
 2 promarginal, 2 retromarginal.

European Journal of Taxonomy 733: 87–124 (2021)
112

makes two sinoid curves. Tegular apophysis large, somewhat transparent, oriented distad, with subapical
process oriented ventrad. Subapical process sharp, distinct from sharp tip of tegular apophysis (Figs 6C,
7C, 8C).
 Pseudoarticulation of tarsi not evident, but tarsi curved. Metatarsus I ventral spination: 3 pairs +
apical triplet; tibia I ventral spination: 5 pairs + apical pair.
Female
AME diameter: 0.2; PME diameter: 0.56; carapace length: 3.88; carapace width: 2.8;
abdomen length: 4.44; leg I (Fe, Pa, Ti, Mt, Tr): 2.54, 1.37, 2.35, 1.94, 1.03; leg II: 2.55, 1.36, 2.26, 1.96,
0.96; leg III: 2.58, 1.31, 2.22, 2.39, 1.1; leg IV: 3.31, 1.47, 2.93, 3.9, 1.41.
 Carapace blackish, with some orange setae and orange fringe of setae. Clypeus blackish.
Chelicerae reddish brown. Legs yellow, dorsum annulated grey. Palps yellow. Sternum black. Abdomen
dorsum dark brown. Abdomen venter grey, spotted yellow. Spinnerets yellow (Fig. 4C). Live specimens
yellow, legs mildly annulated (Figs 3C–D).
Transverse depression posterior to ocular area.
3 promarginal, 2 retromarginal.
 Epigyne septum wider posteriorly, margins with small tooth or terrace in middle. Atria
distinct (Fig. 10C), width variable (compare Šternbergs 1979). Spermathecae round, unbent, distinct
from sperm ducts (Fig. 11C).
 No clear pseudoarticulation on tarsi. Metatarsus I ventral spination: 3 pairs + apical triplet; tibia I
ventral spination: 6 pairs + apical pair.
Natural history
Outside Israel inhabits steppes. In Israel inhabits hyperarid deserts. Specimens were found at night, on

male collected in February, juveniles collected in July (Table 3). The short legs, not typical of Evippinae,
may be an adaptation for a somewhat fossorial lifestyle.
Distribution
Turkmenistan (Šternbergs 1979), Iran (Zamani et al. 2016), Israel.
Records

Remarks
The female of Evippa onager was originally described from China by Simon (1895), and redescribed
from both sexes by Šternbergs (1979) from Turkmenistan. It is very unlikely that these later specimens
et al.
specimen, we avoided describing a new species and instead have chosen to treat the species as Evippa
onager sensu Šternbergs, following Marusik et al. (2003).

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
113
               
localities, and the only one not in a steppe habitat. Nevertheless, cool steppe habitats are found in Israel
and it would be helpfull to search them for E. onager.
See Phylogenetic relationships of Evippinae based on COI and NADH for a partial molecular phylogeny
and a discussion of the placement of E. onager.
Evippa praelongipes (O. Pickard-Cambridge, 1871)
Figs 3B, 4D, 5D, 6D, 7D, 8D, 10D, 11D, 14A
Lycosa praelongipes.
Pardosa praelongipes – Schmidt 1895: 476 Evippa onager).
Evippa praelongipes – Simon 1890: 112, 123 (Yemen); 1897: 290. — Roewer 1955 (North
Africa, Transcaspia, India, Arabia, Sinai, Tripoli
. — 
). — Alderweireldt
& Jocqué 2017: 10 (Saudi Arabia, Yemen).
non Evippa praelongipes .
Diagnosis
Recognized by a combination of genital characters. Male palp: tegular apophysis parallel to cymbium,
with small, prolaterally oriented subapical process. Short terminal apophysis positioned ventrad to
tegular apophysis (Figs 6D, 7D, 8D). Epigyne: straight atria with indistinct retrolateral margins. Septum
with smooth margins, without protrusions (compare with similar E. amitaii sp. nov. palp, with a small
protrusion) (Fig. 10D, 11D) It is the only Evippa in Israel to have a septum without protrusions.
Material examined
ISRAEL – Dead Sea Area
Steinpress leg.; HUJ INV-Ar 16554 • ; same collection data as for preceding; HUJ INV-Ar
16555 • ; same collection data as for preceding; HUJ INV-Ar 16556 to 16558 • 
31.067° N, 35.335° E; 12 Apr. 2018; I. Armiach Steinpress leg.; HUJ INV-Ar 16559–16560 • 
; 21 Apr. 1954; A. Shulov leg.; HUJ INV-Ar 16518. – ’Arava Valley


same collection data as for preceding; 11 Sep. 2017; I. Armiach Steinpress leg.; HUJ INV-Ar 16534

same collection data as for preceding; 18 Aug. 2016; A. Weinstein leg.; HUJ INV-Ar 16519 to 16520,



INV-Ar 16533 • 



HUJ INV-Ar 16529. – Negev
leg.; HUJ INV-Ar 16560 •      
13 Mar. 2018; E. Gavish-Regev leg.; HUJ INV-Ar 16562 • 
;

European Journal of Taxonomy 733: 87–124 (2021)
114

leg.; HUJ INV-Ar 16564 to 16565 • 




 
2019; I. Armiach Steinpress leg.; HUJ INV-Ar 20317.
EGYPT – Sinai

                  
S. Reichenstein leg.; HUJ INV-Ar 16514, 16516.
Natural history
Inhabits hyper-arid deserts. Adults were collected January through April, June through September and in
November (Table 3). Egg-sacs were observed in April and September. We suggest that E. praelongipes
is active and reproducing throughout the year. Specimens were collected at night, mostly in dry stream
beds, under and near shrubs (Fig. 15A).
Distribution
Lybia to Saudi Arabia (Bonnet 1956; Alderweireldt & Jocqué 2017), Israel. Reports from Turkmenistan

Records

Negev (Makhtesh Ramon, Shizzafon). Egypt: Sinai (Mt. Catherine, Wadi Nequra).
Evippomma Roewer, 1959
Figs 1–2, 4E, 5E, 6E, 7E, 8E, 10E, 11E, 13B, D, 14B
Evippomma Roewer, 1959: 187; type species: Evippomma squamulatum (Simon, 1898).
Diagnosis
This is the only known genus of Lycosidae in which the body (mainly, the cephalothorax) is densely
covered in scale-like, leaf-shaped setae (Figs 1D, 14B).
Description
Small- to medium-sized wolf spiders. Tibia I with 4–5 pairs of ventral spines (apart from apical pair).

shine (Figs 1–2). Coloration of preserved specimens is brown or yellow. Cephalic region elevated.
Ocular area with long macrosetae. Genitalia relatively uniform across genus. Embolus large but not
conspicuous. Embolic base in meso-apical position. Tegular apophysis hook-shaped (Figs 6E, 7E, 8E).
Median septum of epigyne widened posteriorly. Atria narrow (Figs 10E, 13B). Spermathecae large and
sperm ducts twisted (Figs 11E, 13D). Anterior row of eyes procurved, narrower than PME. ALE smaller
than AME.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
115
Natural history
The species inhabit deserts, grasslands and savannas. Evippomma rechenbergi is known to construct
silk-lined burrows in sand (Bayer, Foelix & Alderweireldt 2017), as we recorded for E. simoni as well
(Fig. 2D).
Distribution
Found across Africa, with a new record from Israel (but see the section on Composition).
Relationships
Evippomma is traditionally considered to be related to Evippa (Alderweireldt 1992). Our molecular
phylogeny supports this placement (see Phylogenetic relationships of Evippinae based on COI and
NADH).
Composition
Seven species are included: Evippomma albomarginatum Alderweireldt, 1992; E. evippiforme
(Caporiacco, 1935); E. evippinum (Simon, 1897); E. plumipes (Lessert, 1936); E. rechenbergi Bayer
et al., 2017; E. simoni Alderweireldt, 1992; and E. squamulatum (Simon, 1898). Two representatives
of the genus (E. evippiforme and E. evippinum) that were described from India are not considered here
as belonging to Evippomma, as they have three pairs of ventral spines on tibia I (Caporiacco 1935),
whereas Evippomma             Moreover,
E. evippiforme appears to have genitalia uncharacteristic of the other known Evippomma species.
Evippomma simoni Alderweireldt, 1992
Figs 1–2, 4E, 5E, 6E, 7E, 8E, 10E, 11E, 13B, D, 14B
Evippomma simoni
Diagnosis
Recognized by a combination of genital characters. Male palp: tegular apophysis small, translucent,
oriented distad, parallel to plane of bulb, laterally barb-shaped (Figs 6E, 7E, 8E). Tegulum presents
single sinus shape curve of sperm duct (in Evippa: two) (Fig. 6E). Epigyne: rounded or hat-shaped,
wider than long, septum wide. Atria narrow, shallow, greatly constricted distally (in Evippa: width
approximately equal throughout), similar to epigyne of E. squamulatum, but proximal portion of atrium
wide (in E. squamulatum proximal portion of atrium slit-shaped) (Figs 10E, 13B, D). It is the only
.
Material examined
ISRAEL – Dead Sea Area 
INV-Ar 16537. – Negev
HUJ INV-Ar 16544 • same collection data as for preceding; 11 Apr. 1991; Y. Lubin leg.; HUJ
same collection data as for preceding; 27 May 1992; Y. Lubin
same collection data as for preceding; 25 Jun. 1992; Y. Lubin
same collection data as for preceding; 30 Apr. 1993;
same collection data as for preceding; 30 Apr.

same collection data as for preceding; 26 Feb. 2013; I. Renan
leg.; HUJ INV-Ar 16576 • 1 juv.; same collection data as for preceding; 14 Mar. 2013; I. Renan leg.;
HUJ INV-Ar 16545 • 1.002° N, 34.754° E; 16 Jun. 2020; S. Aharon leg.; HUJ


European Journal of Taxonomy 733: 87–124 (2021)
116


INV-Ar 16543 • 
Description
Male
 (n = 12). AME diameter: 0.13–0.2; PME diameter: 0.27–0.4; carapace length: 2.8–3.99;
carapace width: 2.1–2.8; abdomen length: 2.7–4.17; leg I (Fe, Pa, Ti, Mt, Tr): 2.77–4.7, 0.98–1.6, 2.39–
5.96, 2.8–4.86, 1.7–2.3; leg II: 3.38–4.46, 1.2–1.57, 2.8–3.7, 3.57–4.5, 1.7–2.2; leg III: 3.2–4.3, 1.08–
1.5, 2.27–2.9, 3.5–4.5, 1.78–2.25; leg IV: 3.8–5.26, 1.3–1.68, 3.9–5.1, 4.6–6.0, 2.14–2.58.
 Carapace yellow to orange and brown, lighter around fovea and in patches behind PME; lateral
bands brown to grey, radiated, fused posteriorly; ocular area black; cephalic and thoracic regions
separated by sharp, black V-shaped line; perimeter with spots of white setae. Clypeus black near AME,
light laterally, with white setae on margin. Chelicerae proximally yellow to orange with grey or brown
reticulation connecting to oblique brown band in middle, retrolateral margin white. Legs yellow, proximal
part of femur and coxa usually grey. Palps yellow to brownish (femur and tarsus darker). Sternum grey
to brown, margin black, sometimes with light radiation. Abdomen dorsum yellow to whitish, sometimes
with white spots. Cardiac mark yellow to brown, outlined with black spots, surrounded by posteriorly
extending broken light band, outlined with dark spots, not reaching spinnerets. Abdominal venter
margins yellow to whitish, center irregularly bordered, grey to black with yellow spots. Book lungs
white. Spinnerets yellow (Fig. 4E).
 Ocular area elevated. Fovea area slightly elevated.
 3 promarginal, 2 retromarginal.
 Palpal organs weakly sclerotized. Tegulum keel-shaped. Part of sperm duct visible through
tegulum bent at 90°. Tegular apophysis small, translucent, oriented distad, with subapical process
oriented ventrad; slightly elevated over tegulum (Figs 6E, 7E, 8E).
 Tarsus without pseudoarticulation, but in some specimens tarsi bent. Metatarsus I ventral spination:
2 pairs of long spines (pair I not reaching pair II) + short apical triplet; tibia I ventral spination: 5 pairs
(all long except 5th pair) + short apical pair. Distance between pairs 2–3 greatest.
Female
 (n = 6). AME diameter: 0.1–0.19; PME diameter: 0.33–0.42; carapace length: 3.28–4;
carapace width: 2.3–3.07; abdomen length: 3.57–5.1; leg I (Fe, Pa, Ti, Mt, Tr): 2.95–3.6, 1.24–1.56, 2.5–
3.09, 1.84–2.31, 1.22–1.5; leg II: 2.64–3.18, 1.22–1.3, 2.15–2.47, 1.69–2.2, 1.1–1.3; leg III: 2.46–3.14,
1.1–1.26, 1.5–2.9, 1.9–3.1, 1.37–1.6; leg IV: 2.99–3.86, 1.28–1.58, 2.79–3.8, 2.69–3.25, 1.48–1.78.
 Carapace yellow to brownish-orange, covered with white setae, lighter around fovea and in
patches behind PME; lateral bands grey, radiated, fused posteriorly; cephalic and thoracic regions
separated by sharp, black V-shaped line. Clypeus yellow to brown, covered with leaf-like setae, with dark
lateral bar. Chelicerae orange, with leaf-like setae on proximal half, sometimes with grey reticulation
and oblique grey band. Legs yellow, usually, greyish on proximal side of segment, sometimes with grey
line on dorsal side. Palps yellow, with some grey on femur and tarsus. Sternum brown. Abdomen dorsum
yellow to whitish. Cardiac mark grey, usually with two lines of gray spots, connecting above spinnerets.
Abdomen venter yellow, grey or white, darker on center. Book lungs white. Spinnerets yellow (Fig. 5E).

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
117
 
resemble a juvenile Lycosa rather than an Evippa.
 3 promarginal, 2 retromarginal.
 Epigyne wider than long, septum wide, atria distinct, shallow, narrow, widening proximally.
Spermathecae longer than atria, bent retrolaterally, shaped like a crookneck squash (Figs 10E, 11E, 13B,
D).
 No pseudoarticulation of the tarsus. Metatarsus I ventral spination: 2 long pairs (pair I reaching
base of pair II); tibia I ventral spination: 5 pairs (long, except 5th) + short apical pair.
Natural history
Adult Evippomma simoni were collected April through June, August and September (Table 3) and may
have a yearly cycle similar to what was suggested for E. arenaria, with a period of lowered activity in
the colder months of the year (see Discussion). A female with eggs (HUJ INV-Ar 20422) was collected
in June. The species mostly inhabits sandy desert habitats (Fig. 15B). An anecdotal report raises the
possibility that the species also exists along the coastal dune strip, similar to Evippa arenaria (Y. Salaviz,
pers. com.). Specimen HUJ INV-Ar 20421 was found by S. Aharon in a silk-lined burrow (Fig. 2),
similar to what has been reported for E. rechenbergi (Bayer et al. 2017).
Distribution
Sudan (Alderweireldt 1992), Israel.
Israel: Negev Mamshit), Dead Sea area (Near Sedom)
(Fig. 16).
Remarks
Evippomma
on the dubious report of the species from India (Roewer 1955)). If there is a continuous distribution with
the type locality at the northern Sudanese border, this species is to be present in the sandy desert of
northern Sinai and in eastern Egypt. It may be distributed in other hot desert environments in the region,
such as the sandy deserts of Jordan.
Most of the specimens were collected in dune areas, but a specimen from the Sedom area, with a clay-
rich substrate, suggests that this species is not an obligate psammophile.
Phylogenetic relationships of Evippinae based on COI and NADH
The ML tree topology recovered the genus Evippa 
Evippinae was only moderately supported in our tree (Fig. 17; BS = 63%), yet the topology in our tree
accords with the tree topology for Lycosidae in Piacentini & Ramírez 2019 and with the composition of
Evippinae sensu Alderweireldt 1991.
Discussion
Habitat use and distribution
The Evippinae are among the most desert-adapted lycosids, often being the only representatives of
Lycosidae in desert habitats. Even though mesophilic Evippinae are known (Xerolycosa, Proevippa),
the Evippinae of Israel are largely excluded from mesic habitats. The only exception to this rule is
E. arenaria. It is found along the southern and central coastal dunes of Israel. The southernmost record is
from the coastal dunes of Gaza, where the dunes come in contact with the Negev desert. The northernmost


European Journal of Taxonomy 733: 87–124 (2021)
118
the northern edge of a large area of dunes, where the coastal sands are interrupted by the alluvial plain
of the Yarqon river system. Two major dune areas exist on the Israeli coast north of this point (Qesarya
sands and Zevulun valley sands). Visual searches by the authors were performed in both areas. A 2015
  E. arenaria (A. Avisar, pers. com.). North of

is known to be a northern limit for several desert-dwelling species. Examples of this biogeographic
limit can be found among mammals (Meriones sacramenti Thomas, 1922; Jaculus jaculus Linnaeus,
1758); reptiles (Trapelus savignii (A.M.C. Duméril & Bibron, 1837); Varanus griseus (Daudin, 1803);
Mesalina olivieri (Audouin, 1829)) (Yom-Tov & Tchernov 1988) and insects (Adesmia dilatata (Klug,
1830), Cataglyphis sabulosa J. Kugler, 1981) (Alon 1991). The accepted hypothesis is that these species
have colonized the dunes from the area of the present-day Negev desert, during the Holocene, with
subsequent range expansion and their spread was impeded by physical barriers, such as rivers. Evippa
arenaria may have followed the same route of expansion, and if so, the Yarqon may be the northernmost
distribution edge of E. arenaria in the Levantine coastal region.
Fig. 17. Maximum likelihood cladogram, showing the topology of Evippinae, with Lycosa sp., Alopecosa
albofasciata (Brullé, 1832) and Pirata piraticus (Clerck, 1757) as outgroups. Bootstrap supports


ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
119
              



it is to be expected that the distributions and activity patterns of the local Evippinae species are not
uniform.
Evippa arenaria is the best sampled species in our study, with 62 specimens, collected at 23 localities
(Fig. 16). It is found on loess and sandy substrates, in semi-arid steppes and arid deserts in the range
of 80–300 mm average annual rainfall (Fig. 15B). It is also found in coastal dunes, in higher rainfall
areas (Fig. 15D). Throughout most of its range, E. arenaria co-occurs with other lycosids (Alopecosa
spp., Hogna spp., Pardosa spp., Lycosa spp.), including a partial overlap with the range of Evippomma
simoni. It is usually less abundant than Pardosa subsordidatula. Of the 23 localities at which E. arenaria
was collected, it co-occurs with another Evippa species (E. praelongipes) only in one, at the southern
edge of its distribution (Fig. 16). The second most sampled species, E. praelongipes, is largely restricted
to the hyper-arid region (<80mm average annual rainfall), mostly in stream beds (Fig. 15A). It is the
most common, and often only, lycosid species in its habitat (I. Armiach Steinpress., pers. obs.), rarely
co-occurring with E. onager, Lycosa sp., Hogna ferox and Evippomma simoni, as well as E. amitaii and
the aforementioned E. arenaria. It is not yet known whether the apparent vicariance between E. arenaria
and E. praelongipes is mainly due to habitat requirements, species interactions or other variables.
In our study area, the Dead Sea area (Fig.15A) is the richest in Evippinae species (E. amitaii, E. onager,
E. praelongipes and Evippomma simoni) (Fig. 16). The biogeographic mechanism underlying this trend
   
E. praelongipes
    Evippa onager was found in
other localities on and under cracked mud crusts. Evippa amitaii is possibly endemic to the Dead Sea
region, and may be restricted to a habitat discontinuous with the surrounding desert, such as salt pans
or hot oases. The habitat preferences of Evippomma simoni are unknown. Further collecting and in-situ
observations need to be done to clarify these questions.
Activity patterns
No Evippa arenaria or Evippomma simoni were collected during the winter months. The lack of adult
     
of lowered activity. A study of arachnids in the northern Negev, that was conducted between 1990 and
1993, using pitfall traps (Lubin, unpublished data) found Evippa arenaria from April through October,
and Evippomma simoni in April through September. This area is rich in other lycosid species, including
the very common Pardosa subsordidatula (Strand, 1915), which is similar in size to Evippa arenaria
and co-occurs throughout its range. In the same study P. subsordidatula was collected in November
through April, complementing the activity period of Evippa arenaria and Evippomma simoni. These
data are congruent with collection dates of other specimens deposited in The Arachnid National Natural
History Collection (HUJ).
These activity patterns contrast with those of E. praelongipes, which is evidently active all year round
  Evippa arenaria, Evippomma simoni and E. praelongipes
is that E. praelongipes is the dominant lycosid species in its habitat. Therefore, we postulate that a
contributing factor to the activity patterns of E. arenaria and Evippomma simoni may be temporal
habitat partitioning with a winter-active species, possibly P. subsordidatula. Further research is to be
done to address this suggestion.

European Journal of Taxonomy 733: 87–124 (2021)
120
Molecular phylogeny
Evippa onager is an unusually short-legged species (Figs 4C, 5C), unlike most Evippa species, and unlike
the type species, E. arenaria. This feature is shared with at least two other species: E. kirchshoferae
Roewer, 1959 (Barrientos et al. 2015) and E. caucasica Guseinov & Koponen, 2003. The three species
also share similarity in their male genital morphology: a subapical, ventrad oriented process on the TA.
Evippa onager and E. kirchshoferae are also known to have preferences for cracked soil (Barrientos et al.
2015). We hypothesized that these species may belong to a separate genus, as was already suggested
for E. kirchshoferae by Alderweireldt (1991). To test this hypothesis and examine the relatedness
of E. onager   
of E. kirchshoferae and E. caucasica for molecular analysis. Nevertheless, we created a molecular
phylogeny of the Evippinae available to us, including E. onager. The resulting cladogram (Fig. 17)
does not support the placement of E. onager in a separate genus, but does not reject it altogether. It does
imply, though, that E. onager is more closely related to Evippa arenaria (the type species of Evippa)
than it is to Evippomma or Xerolycosa. This species may belong to a separate species-group within
Evippa, along with other short-legged species, possibly conforming to the eltonica group suggested by
Marusik et al. (2003). To test both hypotheses more material is needed.
           
           Evippa arenaria, E. onager,
E. praelongipes and Evippomma simoni), four species co-occurring in the southern Dead Sea area
(Evippa amitaii sp. nov., E. onager, E. praelongipes and Evippomma simoni) and one species occurring
E. praelongipes). In addition, one species (E. arenaria) is found along
the mesic, but edaphically suitable coastal dunes. These distribution patterns may manifest either

or a combination of both. Which ecological and/or evolutionary mechanisms are responsible for these
distribution patterns is beyond the scope of this study, yet the distributions and relationships we present

been scarce, even within the boundaries of Israel and Palestine. The southern Negev and northern rift

Neighboring countries (Jordan, Lebanon, Syria and to a lesser extent, Egypt) have very little to no data
concerning the diversity and distribution of Evippinae. We hope that in the future local researchers in
the other Levantine countries will complete our knowledge about the Evippinae species of the region,
their biogeography and life history.
Month 1 2 3 4 5 6 7 8 9 10 11 12
Evippa amitaii sp. nov.   
Evippa arenaria
(Audouin, 1826)         
Evippa onager Simon,
1895 sensu Šternbergs  
Evippa praelongipes
(O. Pickard-
Cambridge, 1871)
        
Evippomma simoni
Alderweireldt, 1992     
Table 3. Documented activity of adult Evippinae in Israel (by month). Females with egg-sacs marked


ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
121
Acknowledgements
We would like to thank all the people that provided us with specimens. Among others, Shlomi Aharon,
Pinchas Amitai, Aviv Avisar, Yael Lubin, Tal Mei-Dan, Ittai Renan, Yakov Salaviz, Boaz Shacham,
Benny Shalmon and Amir Weinstein. Special thanks to Assaf Uzan for making the habitus photographs
E. simoni; to Luis Piacentini, for sharing DNA sequences and
advice on sequencing; to Miquel Arnedo, Ivan Magalhaes and Prashant Sharma for useful discussions;
and to Prof. Dany Cohen for endowing IAS with a student-stipend.
References
Alderweireldt M. 1991. A revision of the African representatives of the wolf spider genus Evippa Simon,
1882 (Araneae, Lycosidae) with notes on allied species and genera. Journal of Natural History 25 (2):
359–381. https://doi.org/10.1080/00222939100770261
Alderweireldt M. 1992. A taxonomic revision of the African wolf spider genus Evippomma Roewer,
1959 (Araneae, Lycosidae). Journal of African Zoology 106: 153–167
Alderweireldt M. & Jocqué R. 1992. A review of the nebulosa-group of Pardosa Koch 1847 in Africa, a
complex with some highly variable species (Araneae Lycosidae). Tropical Zoology 5: 73–113.
https://doi.org/10.1080/03946975.1992.10539183
Alderweireldt M. & Jocqué R. 2017. Order Araneae, family Lycosidae. Arthropod Fauna of the UAE
6: 3–20.
Alon A. 1991. Plants and Animals of the Land of Israel, Volume 3. Ministry of Defense Publishing,
Israel, Tel-Aviv.
Ashfaq M., Blagoev G., Tahir H.M., Khan A.M., Mukhtar M.K., Akhtar S., Butt A., Mansoor S. &
Hebert P.D. 2019. Assembling a DNA barcode reference library for the spiders (Arachnida: Araneae) of
Pakistan. PloS One 14 (5): e0217086. https://doi.org/10.1371/journal.pone.0217086
Barrientos J.A., Miñano J. & Mestre L. 2015. Primera cita de Evippa Simon, 1882 para Europa occidental
y descripción del macho de Evippa kirchshoferae Roewer, 1959 (Araneae: Lycosidae). Revista Ibérica
de Aracnología 27: 3–12.
Bayer S., Foelix R. & Alderweireldt M. 2017. An unusual new wolf spider species from the Erg Chebbi
Desert in Morocco (Araneae: Lycosidae: Evippinae). The Journal of Arachnology 45 (3): 344–355.
https://doi.org/10.1636/JoA-S-16-094.1
Blagoev G.A., Dewaard J.R., Ratnasingham S., Dewaard S.L., Lu L., Robertson J., Telfer A.C. &
Hebert P.D. 2016. Untangling taxonomy: a DNA barcode reference library for Canadian spiders.
Molecular Ecology Resources 16 (1): 325–341. https://doi.org/10.1111/1755-0998.12444
Bodenheimer F.S. 1937. Prodromus faunae Palestinae. Mémoires présentés à l’Institut d’Égypte 33:
1–286.
Bonnet P. 1956. Bibliographia araneorum. Analyse méthodique de toute la littérature aranéologique
jusqu'en 1939. Tome II. Systématique des araignées (Étude par ordre alphabétique) (2me partie: C–F):
919–1926. Douladoure Toulouse.
Bowden J.J. & Buddle C.M. 2012. Life history of tundra-dwelling wolf spiders (Araneae: Lycosidae)
from the Yukon Territory, Canada. Canadian Journal of Zoology 90 (6): 714–721.
https://doi.org/10.1139/Z2012-038
Caporiacco L. di 1933. Araneidi. In       
Annali del Museo Civico di Storia Naturale di Genova 56: 311–340.

European Journal of Taxonomy 733: 87–124 (2021)
122
Caporiacco L. di 1935. Escursione del Prof. Nello Beccari in Anatolia. Aracnidi. Monitore Zoologico
Italiano 46: 283–289.
Denis J. 1966. Les araignées du Fezzân. Bulletin de la Société d’Histoire naturelle d’Afrique du Nord
55: 103–144.
Dippenaar-Schoeman A.S. & Jocqué R. 1997. African Spiders: an Identication Manual. Arc-Plant
Protection Research Institute, Biosystematics Division, National Collection of Arachnida.
Dondale C.D. 1986. The subfamilies of wolf spiders (Araneae: Lycosidae). In: Actas X Congreso
Internacional de Aracnologıa, Jaca, Espana 1: 327–332.
                
mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine
Biology and Biotechnology 3 (5): 294–299.
Jiman H. & Daxiang S. 1996. The phylogenetic relationship of Chinese wolf spiders. Zhuxing Xuebao
5 (1): 3–20.

An example from Central European Alopecosa wolf spiders (Araneae: Lycosidae). Zoological Journal
of the Linnean Society 185 (4): 1039–1056. https://doi.org/10.1093/zoolinnean/zly060
Kasparek M. 2004. The Mediterranean Coast of Lebanon: Habitat for Endangered Fauna and Flora.
Result of a coastal survey for the Ministry of Environment, Beirut.
Kumar S., Stecher G., Li M., Knyaz C. & Tamura K. 2018. MEGA X: Molecular Evolutionary Genetics
Analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549
https://doi.org/10.1093/molbev/msy096
Marusik Y.M. & Guseinov E. F. 2003. Spiders (Arachnida: Aranei) of Azerbaijan. 1. New family and
genus records. Arthropoda Selecta 12: 29–46.
Marusik Y.M., Guseinov E. & Koponen S. 2003. Spiders (Arachnida: Aranei) of Azerbaijan. 2. Critical
survey of wolf spiders (Lycosidae) found in the country with description of three new species and brief
review of Palaearctic Evippa Simon, 1885. Arthropoda Selecta 12 (1): 47–65.
Marusik Y.M., Kovblyuk M.M. & Koponen S. 2011. A survey of the East Palaearctic Lycosidae
(Araneae). 9. Genus Xerolycosa Dahl, 1908 (Evippinae). ZooKeys 119: 11–27.
https://doi.org/10.3897/zookeys.119.1706
Murphy N.P., Framenau V.W., Donnellan S.C., Harvey M.S., Park Y.C. & Austin A.D. 2006. Phylogenetic
reconstruction of the wolf spiders (Araneae: Lycosidae) using sequences from the 12S rRNA, 28S rRNA,
and NADH1      
behavior. Molecular Phylogenetics and Evolution 38 (3): 583–602.
https://doi.org/10.1016/j.ympev.2005.09.004
Lyubechanskii I.I. 2012. Spider community structure in the natural and disturbed habitats of the West
Siberian northern taiga: comparison with Carabidae community. Russian Entomological Journal 21 (2):
147–155.
Park Y.C., Yoo J.S., Schwarz M.P., Murphy N. & Kim J.P. 2007. Molecular phylogeny of East Asian
wolf spiders (Araneae: Lycosidae) inferred from mitochondrial 12S ribosomal DNA. Annals of the
Entomological Society of America 100 (1): 1–8.

Pavesi P. 1880. Studi sugli aracnidi africani. I. Aracnidi di Tunisia. Annali del Museo Civico di Storia
Naturale di Genova 15: 283–388.

ARMIACH STEINPRESS I. et al., Synopsis of the Evippinae (Araneae, Lycosidae) of Israel
123
Piacentini L.N. & Ramírez M.J. 2019. Hunting the wolf: A molecular phylogeny of the wolf spiders
(Araneae, Lycosidae). Molecular Phylogenetics and Evolution 136: 227–240.
https://doi.org/10.1016/j.ympev.2019.04.004
Pickard-Cambridge O. 1871. Notes on a collection of Arachnida made by J.K. Lord, Esq., in the
peninsula of Sinai and on the African borders of the Red Sea. Proceedings of the Zoological Society of
London 38: 818–823.
Ponomarev A.V. & Tsvetkov A.S. 2004. The generalized data on spiders (Aranei) of the Nature Research
Trudy Gosudarstvennogo Zapovednika “Rostovskii” 3: 84–104.
Reimoser E. 1919. Katalog der echten Spinnen (Araneae) des Paläarktischen Gebietes. Abhandlungen
der Zoologisch-Botanischen Gesellschaft in Wien 10 (2): 1–280.
Roewer C.F. 1955. Katalog der Araneae von 1758 bis 1940, bzw. 1954. Volume 2: 1–1751. Bruxelles.
Roewer C.F. 1959. Araneae Lycosaeformia II (Lycosidae). Exploration du Parc National de l’Upemba,
Mission G.F. de Witte 55: 1–518.
Schmidt P. 1895. Beitrag zur Kenntnis der Laufspinnen (Araneae Citigradae Thor.) Russlands.
Zoologische Jahrbücher, Abtheilung für Systematik, Geographie und Biologie der Thiere 8 (4): 439–484.
Silva D. 1996. Species composition and community structure of Peruvian rainforest spiders: a case study
from a seasonally inundated forest along the Samiria River. Revue Suisse de Zoologie, vol hors série:
597–610. Available from https://www.biodiversitylibrary.org/page/43628730
Simon E. 1890. Etudes arachnologiques. 22e
Annales de la Société entomologique de France (6) 10: 77–124.
Simon E. 1895. Arachnides recueillis par M. G. Potanine en Chinie et en Mongolie (1876–1879). Bulletin
de l’Académie impériale des Sciences de St.-Pétersbourg (5) 2: 331–345.
Simon E. 1897. Arachides recueillis par M. M. Maindron à Kurrachee et à Matheran (près Bombay) en
1896. Bulletin du Muséum national d’histoire naturelle Paris 3: 289–297.
Simon E. 1898. Histoire naturelle des araignées. Second Edition, Volume 2: 193–380. Roret, Paris.
https://doi.org/10.5962/bhl.title.51973
       sicEvippa (Aranei, Lycosidae)
in Turkmenistan. Izvestiya Akademii Nauk Turkmenskoi SSR Seriya Biologicheskikh Nauk (Biol. Nauk)
1979 (5): 65–67.
Tikader B.K. & Malhotra M.S. 1980. Lycosidae (Wolf-spiders). Fauna India (Araneae) 1: 248–447.
World Spider Catalog 2020. World Spider Catalog. Version 21.0. Natural History Museum Bern.
Available from http://wsc.nmbe.chhttps://doi.org/10.24436/2
Yom-Tov Y. & Tchernov E. 1988. The Zoogeography of Israel. The Distribution and Abundance at a
Zoogeographical Crossroad. Dr. W. Junk Publishers Volume 1: 1–682. Roret, Paris.
Zamani A., Mirshamsi O., Rashidi P., Marusik Y.M., Moradmand M. & Bolzern A. 2016. New data on
the spider fauna of Iran (Arachnida: Aranei), part III. Arthropoda Selecta 25 (1): 99–114.
https://doi.org/10.15298/arthsel.25.1.10
Zamani A., Mirshamsi O., Dolejš P., Marusik Y.M., Esyunin S.L., Hula V. & Ponel P. 2017. New data on
the spider fauna of Iran (Arachnida: Araneae), part IV. Acta Arachnologica 66 (2): 55–71.
https://doi.org/10.2476/asjaa.66.55

European Journal of Taxonomy 733: 87–124 (2021)
124
Zehethofer K. & Sturmbauer C. 1998. Phylogenetic relationships of Central European wolf spiders
(Araneae: Lycosidae) inferred from 12S ribosomal DNA sequences. Molecular Phylogenetics and
Evolution 10 (3): 391–398. https://doi.org/10.1006/mpev.1998.0536
Zonstein S. & Marusik Y.M. 2013. Checklist of the spiders (Araneae) of Israel. Zootaxa 3671 (1):
1–127. https://doi.org/10.11646/zootaxa.3671.1.1
Zyuzin A.A. 1985. Generic and subfamilial criteria in the systematics of the spider family Lycosidae
(Aranei), with the description of a new genus and two new subfamilies. Trudy Zoologicheskogo Instituta
AN SSSR 139: 40–51.
Manuscript received: 4 June 2020
Manuscript accepted: 20 October 2020
Published on: 4 February 2021
Topic editor: Rudy CAM Jocqué
Desk editor: Jeroen Venderickx
Printed versions of all papers are also deposited in the libraries of the institutes that are members of
the EJT          
Belgium; Royal Museum for Central Africa, Tervuren, Belgium; Royal Belgian Institute of Natural
Sciences, Brussels, Belgium; Natural History Museum of Denmark, Copenhagen, Denmark; Naturalis
Biodiversity Center, Leiden, the Netherlands; Museo Nacional de Ciencias Naturales-CSIC, Madrid,
Spain; Real Jardín Botánico de Madrid CSIC, Spain; Zoological Research Museum Alexander Koenig,
Bonn, Germany; National Museum, Prague, Czech Republic.