Co-existence of LasI, RhI, and Pseudomonas Quinolone Signal Quorumsensing Genes in Clinical Pseudomonas aeruginosa Isolates

Abstract

Pseudomonas aeruginosa can regulate different group actives and physiological processes through the quorum sensing mechanism. The aims of this research were to detect the presence of quorum sensing genes in 50 clinical P. aeruginosa isolates, which represent by (lasI, lasR, rhlI, and rhlR) and Pseudomonas quinolone signal (PQS) (PgsA, PgsB, PgsC, PgsD, PgsE, and MvfR) genes by Polymerase chain reaction (PCR) technique and interaction between the two systems. Isolates were subjected to test their susceptibility to 12 antimicrobial drugs, 64% of isolates showed resistance to ceftazidime, followed by carbencillin (56%), while only 8% were resistant to imipenem. In addition, all of the bacterial isolates were distributed within three multidrug-resistant (MDR) patterns, viz., A, B, and C. The highest rate of MDR was showed with MDR pattern C, in which bacterial isolates showed resistance to resist (9→11) antimicrobial drugs. Results revealed that P. aeruginosa isolates have different gene patterns, viz., A to E. According to quorum sensing genes production, pattern A found to express all the genes in LasI, RhI, and PQS system, while pattern B has a defective for the production of lasR, rhlR genes, while the same isolates have the PQS system all present. Significantly, there is a positive relationship between las and rhl system and regulation of antibiotics resistance, in which the bacterial isolates that have las and rhl genes showed high resistance to common antimicrobial agents under study. These findings suggest that PQS can function as an intercellular signal in P. aeruginosa that is not restricted only to alkyl homoserine lactones (AHL).

Full text

ABSTRACT
Pseudomonas aeruginosa can regulate dierent group actives and physiological processes through the quorum sensing
mechanism. The aims of this research were to detect the presence of quorum sensing genes in 50 clinical P. aeruginosa
isolates, which represent by (lasI, lasR, rhlI, and rhlR) and Pseudomonas quinolone signal (PQS) (PgsA, PgsB, PgsC, PgsD,
PgsE, and MvfR) genes by Polymerase chain reaction (PCR) technique and interaction between the two systems. Isolates were
subjected to test their susceptibility to 12 antimicrobial drugs, 64% of isolates showed resistance to ceftazidime, followed
by carbencillin (56%), while only 8% were resistant to imipenem. In addition, all of the bacterial isolates were distributed
within three multidrug-resistant (MDR) patterns, viz., A, B, and C. The highest rate of MDR was showed with MDR pattern
C, in which bacterial isolates showed resistance to resist (9→11) antimicrobial drugs. Results revealed that P. aeruginosa
isolates have dierent gene patterns, viz., A to E. According to quorum sensing genes production, pattern A found to express
all the genes in LasI, RhI, and PQS system, while pattern B has a defective for the production of lasR, rhlR genes, while the
same isolates have the PQS system all present. Signicantly, there is a positive relationship between las and rhl system and
regulation of antibiotics resistance, in which the bacterial isolates that have las and rhl genes showed high resistance to common
antimicrobial agents under study. These ndings suggest that PQS can function as an intercellular signal in P. aeruginosa that
is not restricted only to alkyl homoserine lactones (AHL).
Keywords: Multidrug-resistant (MDR), Pseudomonas aeruginosa, Pseudomonas quinolone signal (PQS), Quorum sensing.
International Journal of Drug Delivery Technology (2020); DOI: 10.25258/ijddt.10.3.5
How to cite this article: Faisal AJ, Ali MR, Said LA. Co-existence of LasI, RhI, and Pseudomonas Quinolone Signal Quorum-
sensing Genes in Clinical Pseudomonas aeruginosa Isolates. International Journal of Drug Delivery Technology. 2020;10(3):337-343.
Source of support: Nil.
Conict of interest: None
Co-existence of LasI, RhI, and Pseudomonas Quinolone Signal Quorum-
sensing Genes in Clinical Pseudomonas aeruginosa Isolates
Anwer Jaber Faisal1,2*, Munim Radwan Ali1, Layla Abdulhamid Said1
1Department of Biology, College of Science, Mustansiriyah University, Baghdad, Iraq
2Medical Laboratory Techniques Department, Al-Farabi University College, Baghdad, Iraq
Received: 24th June, 2020; Revised: 25th July, 2020; Accepted: 24th August, 2020; Available Online: 25th September, 2020
INTRODUCTION
P. aeruginosa is considered one of the most gram-negative
opportunistic pathogens causing a broad range of infections in
healthcare settings and community.1 P. aeruginosa, it stands out
as a threatening and unique microorganism, as it has the ability
to cause invasive disease, and to evade the immune defenses
causing infections hard to be treated. Infections caused by
P. aeruginosa are almost impossible to treat.2 P. aeruginosa
is one of the most problematic drug-resistant bacterium in
the world today. Scientists are now facing growing clones of
pan drug-resistant P. aeruginosa, which is responsible for
moving humans to the post-antibiotic era of diseases caused
by drug-resistant bacteria.3 Multiple research reported the
epidemic outbreaks caused by XDR/ MDR strains within the
environment of the hospital. Concerning data have provided
evidence of the existence of MDR and XDR global clones
distributed in many hospitals all around the world that have been
denominated high-risk clones.4 P. aeruginosa is responsible
RESEARCH ARTICLE
for regulating dierent group activities and physiological
processes through the quorum sensing mechanism. In the
quorum sensing mechanism, bacterial cells produce, then,
detect and respond to the diusible small signal molecule.5
Three different chemotypes of Autoinducers (AIs) have
been recognized in P. aeruginosa: AHL used by las and rhl
systems, alkyl quinolones (AQs) used by the PQS system, and
2-(2-hydroxyphenyl) thiazole-4-carbaldehyde used by the IQS
system.6 In the las system, N-3-oxododecanoyl-homoserine
lactone, 3OC12-HSL is produced by the enzyme, which is
encoded by the lasI gene. When P. aeruginosa bacteria reaches
to threshold density, 3OC12-HSL will bind to LasR, which
acts as a transcriptional activator; LasR, in turn, dimerizes
and binds to target promoters to control gene expression of
many virulence genes, while in rhl system, rhlI gene function
is encoding the enzyme that is responsible for the production
of N-butyryl-homoserine lactone C4-HSL, which binds to
RhlR, which acts as a transcriptional regulator to control the
*Author for Correspondence: bio_1987@yahoo.com

Interaction between Quorum Sensing Genes in Pseudomonas aeruginosa
IJDDT, Volume 10 Issue 3 July 2020 – September 2020 Page 338
activity of target promoters.7 The rhl system is responsible
for controlling the las system at the transcriptional and post-
transcriptional levels.8
PQS is a quinolone-based Quorum sensing (QS) system
that acts through 2-heptyl-3-hydroxy-4-quinolone. PQS
connects the LysR-type transcriptional regulator PqsR to
stimulate many virulence genes.9 PQS are believed to create
a global regulatory network and are responsible for regulating
the expression of up to 12% of the genome of P. aeruginosa.10,11
The objective of this research was to detect the presence
quorum sensing genes in P. aeruginosa, which is represented
by lasI, lasR, rhlI, and rhlR, and PQS (pqsA, PgsB, PgsC,
PgsD, PgsE, and MvfR) genes, by using PCR technique and
interaction between them, after testing their MDR resistant
patterns against dierent antimicrobial drugs.
MATERIALS AND METHODS
Isolation and Identication
267 clinical samples, including burns, wounds, ears swabs, and
sputum, were collected from Al-Yarmouk Teaching Hospital, Al
Jawadar Hospital, and Medical City, Burn Center in Baghdad,
Iraq. Samples were collected between December 2017 to
April 2018. 50 P. aeruginosa isolates were obtained during
this study. VITEK 2 compact system GN cards were carried
out to conrm the diagnosis of Pseudomonas isolates to
species level, according to manufacturer’s instructions
(Biomerieux, Fra nce). Molecular conrmation of the isolates
as P. aeruginosa was performed by using 16S rDNA, which is a
housekeeping gene used for the identication of P. aeruginosa
at the molecular level. Tables 1 and 2 show 16S rDNA primer
annealing temperature, sequences, and the expected size of
amplicon for PCR assay.
Antimicrobial Susceptibility Test
The antimicrobial susceptibility test was done by disk diusion
test on Mueller-Hinton agar, using a different antibiotic
disk; results, then interpreted as susceptible, intermediate,
or resistant to the particular antibiotic, and was obtained as
recommended in the Clinical and Laboratory Standard Institute
(CLSI), 2016.12
The antimicrobials drugs tested were ceftazidime 30 μg,
cefepime 30 μg, ciprofloxacin 5 μg, levofloxacin 5 μg,
tobramycin 10 μ g, amikaci n 30 μ g , gentam icin 10 μ g, piperacillin/
carbencillin 100 μg, imipenem 10 μg, azetreonam 30 μg, and
colistin sulfate 5 μg (MAST group, UK).
DNA Extraction and Detection of Quorum Sensing Genes
by a Conventional Polymerase Chain Reaction
The nucleic acid extraction of the P. aeruginosa isolates
was performed using a commercial DNA extraction kit
(G-spin DNA extraction kit), according to the manufacturer’s
instr uction (Intron Biotechnology). Determination of DNA
quality and quantity is done by using nanodrop at 260/280 nm
Table 1: Sequence of primers and molecular size of PCR product
Primer target
Primers sequence
5′→3′ Product bp References
16S rDNA F5’- AGAGTTTGATCCTGGCTCAG-3’ 1250
base pair 14
16S rDNA R5’- gGTTACCTTGTTACGACTT-3’
lasR-F5’- TGCCGATTTTCTGGGAACC-3’ 401
base pair
15
lasR-R5’- CCGCCGAATATTTCCCATATG -3’
lasI-F5’- TCGACGAGATGGAAATCGATG-3’ 402
base pair
lasI-R5’- gCTCGATGCCGATCTTCAG -3’
rhlI-F5’- CGAATTGCTCTCTGAATCGCT -3’ 182
base pair
rhlI-R5’- gGCTCATGGCGACGATGTA -3’
rhlR-F5’- TCGATTACTACGCCTATGGCG -3’ 208
base pair
rhlR-R5’- TTCCAGAGCATCCGGCTCT -3’
pgsA-F5’- CCTGCAATACACCTCGGGTT-3’ 898
base pair
This study
pgsA-R5’- CAGCAGGATCTGGTTTGTCGT-3’
pgsB-F5’- TGGCCGACACCCTTTATCACV-3’ 407
base pair
pgsB-R5’- TCGCGGTTCTCGATCAGATG -3”
pgsC-F5’- ACCGTCTGGATGAACTGCTG-3’ 289
base pair
pgsC-R5’- AGGTGAAGTCGAGCAGGTTG-3’
pgsD-F5’- TCCATCCCGTACACCCTGAT-3’ 442
base pair
pgsD-R5’- AGCAGGTCGAAGTAGTTGCC-3’
pgsE-F5’- gGATGCCGAATTGGTTTGGG-3’ 317
base pair
pgsE-R5’- CTCCATGTCGTCGAACACCA-3’
mvfR -F 5’- gTTTCGACGAATGCTCGGTTG-3’ 302
base pair
mvfR -R 5’- gACAAGGTGCTCTTCGTGGA-3’

Interaction between Quorum Sensing Genes in Pseudomonas aeruginosa
IJDDT, Volume 10 Issue 3 July 2020 – September 2020 Page 339
and gel electrophoresis.13 PCR protocol was used to detect the
presence of quorum sensing genes (las1, lasR, rhlI, rhlR, pgsA,
PgsB, PgsC, PgsD, PgsE, and mvfR).
Preparation of Primers
las1, lasR, rhlI, rhlR, pgsA, PgsB, PgsC, PgsD, PgsE, and
mvfR genes were investigated by Integrated DNA Technologies,
Inc. (IDT, USA). The lyophilized primers were dissolved in
DdH2O to gi ve a nal concentr at io n of 10 0 pmol/μL, as a stock
solution. The stock was kept at -20°C to prepare 10 pmol/μL
concentration, as work primer suspended. 10 μL of the stock
solution and 90 μL of the DdH2O water was added to get the
nal volume (100 μL).
Primers Selection
The primers used in PCR amplication included, 16S rDNA,
Las1, LasR, RhlI, RhlR, pgsA, PgsB, PgsC, PgsD, PgsE, and
mvfR, as illustrated in Table 1.
RESULTS
Isolation and Identication of P. aeruginosa
50 P. aeruginosa isolates were obtained in this study. The
P. aeruginosa isolates were recovered from 28 (56%) male
patients and 22 (44%) female patients. These clinical isolates
were obtained from burn 24 (48%), wound 12 (24%), sputum
7 (14%), ear 3 (6%), urinary tract infection (UTI) (4%),
vaginal 1 (2%), and blood 1 (2%). As shown in Figure 1.
P. aeruginosa isolates were identied biochemically by
using VITEK 2 compact system GN cards (BioMerieux,
France). According to the 46 biochemical reactions included
in cards, all the isolates were identied successfully with an
identication probability of 93–99%.
Antibiotic Susceptibility Patterns
The results of antimicrobial susceptibility test rates of the
50 P. aeruginosa isolates obtained in our study revealed that
P. aeruginosa was (64%) resistant to ceftazidime, followed
by carbenicillin (56%), ciprooxacin (44%), levooxacin/
tobramycin (38%), aztreonam (26%), and to a lesser extent
to cefepime (22%), piperacillin (16%), gentamicin/amikacin
(12%), colistin (10%), and imipenem (8%). Resistance rates
of P. aeruginosa isolated are shown in Fig ure 2.
P. aeruginosa isolates were differentiated into three
dierent MDR patterns, viz., A, B, and C. Pattern C showed
the highest rate of MDR, when bacterial isolates show resistant
9→11 antibiotics, while pattern A isolates showed the lowest
MDR, when the isolates were able to resist 1→4 antibiotics
only, as shown in Table 3.
Molecular Analysis
The DNA of 50 P. aeruginosa isolates were successfully
extracted with g-spin DNA extraction kit. Purity and
concentration were conrmed with nanodrop, and the intact
DNA bands were conrmed through gel electrophoresis.
Identication by using 16S rDNA Gene Analysis
Genotypic identication, depending on 16S rDNA, conrms
the diagnosis of the fty isolates under study, which showed
Table 2: Thermal cycling conditions of Las1, LasR, rhlI, rhlR, pgsA, PgsB, PgsC, PgsD, PgsE, and mvfR genes used for PCR
Gene Initial denaturation No. of cycles Denaturation Primer annealing Primer extension Final extension
16s RNA 94ºC/3 min
35 amplication
cycles
94°C/45 sec 62°C/45 sec 72°C/1 min 72°C/7 min
Lasl
95ºC/5 min 95ºC/30 sec 59ºC/1 min 72ºC/80 sec 72ºC/10 min
LasR
rhlI
rhlR 95ºC/5 min 95ºC/30 sec 54ºC/1 min 72ºC/80 sec 72ºC/10 min
pgsA 95ºC/5 min 95ºC/45 sec 60ºC/45 sec 72ºC/45 sec 72ºC/7 min
PgsB 95ºC/3 min 95ºC/45 sec 58ºC/45 sec 72ºC/45 sec 72ºC/7 min
PgsC
PgsD 95ºC/3 min 95ºC/45 sec 60ºC/45 sec 72ºC/45 sec 72ºC/7 min
PgsE
mvfR 95ºC/3 min 95ºC/45 sec 57ºC/45 sec 72ºC/45 sec 72ᵒC/7 min
Figure 1: Distribution of P. aeruginosa isolates according to clinical
sources (N = 50)
Figure 2: Antibiotic resistance of P. aeruginosa isolates
Table 3: Patterns of resistance of P. aeruginosa
Patterns Number of antibiotic resistance Isolates number
A 1–4 34/50 (68%)
B 5–8 11/50 (22%)
C 9–11 5/50 (10%)

Interaction between Quorum Sensing Genes in Pseudomonas aeruginosa
IJDDT, Volume 10 Issue 3 July 2020 – September 2020 Page 340
The detection of lasI/lasR and rhlI/rhlR genes showed that
all of the 50 isolates under study were positive for one or
more QS genes. By PCR technology, result showed that 47/50
(94%) of the isolates were positive for lasR, 49/50 (98%) of
the isolates were positive for lasI, 50/50 (100%) were positive
for rhlI, 42/50 (84%) of the isolates were positive for rhlR, as
illustrated in Figure 4.
Twe n ty P.aeruginosa isolates were selected for the
detection the present of the third quorum sensing system
PQS, which is represented by pgsA, PgsB ,PgsC, PgsD, PgsE,
and mvfR genes, and the result showed that 12/20 (60%) were
positive for pqsA, 20/20 (100%) were positive for pqsB, 19/20
(95%) were positive for pqsC, 15/20 (75%) were positive
for pqsD, 18/20 (90%) were positive for pqsE, and nally
16/20 (80%) were positive for the receptor mvfR, as shown in
Figu res 5 to 7.
DISCUSSION
As shown in Figure 1, the majority 24/50 (48%) of P. aeruginosa
isolates were obtained from burns infections. This indicates
that P. aeruginosa is widely found in hospital environments,
such as, distribution systems and air. These observations
agree with other authors who mentioned that P. aeruginosa
is present in about 33% of burn wounds and 59% of extensive
burns. Huebinger RM et al.16 and Sallman RS et al.17 noticed
that P. aeruginosa was obtained from 41.26% burn infection,
followed by 28.57% wound swabs. In this study, it was noticed
that the lowest percentage of isolation was from vaginal
swab 1/50 (2%), followed by blood samples 1/50 (2%). Even
when the isolation percentage is low, it can still cause a high
mortality rate in these sites comparing with other gram-
negative bacteria.18
Molecular identication based on 16S rDNA amplication
protocol for P. aeruginosa, including PCR assays and DNA
amplication by using standard forward and reverse 16S
universal primers. The taxonomic gold standard for the
determination of the phylogenies of bacterial species and the
identication of bacteria, is by using 16S rDNA, which is a
housekeeping gene.19 Our observation showed the utility of
16S rDNA PCR amplication. This reveals the high specicity
of the primers used in the study and the accuracy of the PCR
machine.
The susceptibility pattern test of P. aeruginosa bacteria
under study suggests the idea that they might harbor dierent
antibiotics resistant mechanisms against ceftazidime, followed
by carbencillin antibiotics, which show a high resistant rate
64 and 56%, respectively, Figure 2, Results are in agreement
with Othman N et al.,20 who reported the resistant rate of
ceftazidime was 69.2%, and Ronat JB et al.,21 who fou nd
out that the resistant rate for carbencillin was 54%. Only
ve P. aeruginosa isolates in this study belong to MDR
pattern C, as shown in Table 3. Dierent genetic events, like
the acquisition of dierent mutations or horizontal transfer
of genes responsible for antibiotic resistance, are responsible
for the development of MDR by P. aeruginosa isolates.22 It
is worth mentioning that in this study, 90% P. aeruginosa
Figure 6: Gel electrophoresis of pqsB gene amplicons (407 bp) and
pqsD gene amplicons (442 bp) of P. aeruginosa isolates; M: 100 bp
ladder; gel electrophoresis was performed using 1% agarose gel, and the
run lasted for 50 min/ 100V
Figure 5: Gel electrophoresis of pqsA gene amplicons (898 bp) of
P. aeruginosa isolates; M: 100 bp ladder; gel electrophoresis was
performed using 1% agarose gel, and the run lasted for 50 min
Figure 4: Gel electrophoresis for quorum sensing genes of
P. aeruginosa isolates; A: for lasR gene amplicons (401 bp); B:
for lasI (402 bp); C: for rhlI (182 bp); D: for rhIR (208 bp); M:
100 bp ladder; gel electrophoresis was performed using 1% agarose gel,
and the run lasted for 50 min/ 100 V
Figure 3: PCR product, band size is 1,250 bp; Product was
electrophoresed on 2% agarose at 5 volt/cm2; 1x TBE buer for 1:30 hr;
N: DNA ladder (100)
expected amplicons size 1,250 bp (Figure 3).
Detection of QS Genes by Conventional PCR Techniques

Interaction between Quorum Sensing Genes in Pseudomonas aeruginosa
IJDDT, Volume 10 Issue 3 July 2020 – September 2020 Page 341
isolates were susceptible to the imipenem, as shown in
Figure 2. Al-Charrakh AH et al.23 observed similar data,
while Hussein ZK et al.24 and Amini A et al.25 reported that
P. aeruginosa had an intermediate resistance (35 and 39.3%,
respectively) to imipenem.
PCR analysis of P. aeruginosa under study for the presence
of QS genes, indicates that they can have dierent patterns.
According to quorum sensing genes production, gene pattern
A includes the P. aeruginosa isolates 2, 3, 4, 5, 6, 9, 12, and 16,
were all positive for las and rhl systems, as shown in Table 4.
Previous study showed that las and rhl system is the rst
QS system discovered in P. aeruginosa, which is controlled
via the AHL,19 by comparing these result with the antibiotic
susceptibility patterns, Table 3. It is worth mentioning that
the P. aeruginosa isolates number 2, 3, 4, 5, 6, 9, 12, and
16, which were positive for las and rhl system, showed high
resistant to 5 to 10 of the antimicrobial agent under study.
This is in agreement with a result of previous researchers
who observed a relationship between las and rhl system, and
regulation of antibiotics resistance via eux pump genes.26
Another study showed that clinical P. aeruginosa isolates
were decient in QS genes, and were generally less susceptible
to antibiotics.27 As shown in Table 4, gene pattern A, the
PQS biosynthetic genes pqsABCDE are all present, specially
MvfR gene, which is considered a master regulator of PQS
biosynthesis genes.28 There is a relationship between lasR/3-
oxo-C12- and PQS biosynthesis; lasR considered as positive
regulator of PQS biosynthesis,29 and that is the main reason
why all the pqsABCDE were turned on, MvfR will positively
regulate the transcription of the pqsABCDE and phnAB operons
directly.29
Our result also showed that gene patter n B, which
include the isolate number 13, 14, and 18, Table 4, has a
defect for the production of lasR, rhlR genes, which are
considered as transcription regulators of quorum system that
when companied with their specic autoinducers, activate
transcription of dierent virulence factors.30 This defect can
be caused by mutation or other reason that cause the genes
to be silent, while the same isolates have the PQS system,
which includes pqsABCDE MvfR genes, Table 4. It can be
concluded that P. aeruginosa isolates nd their way for the
second quorum system, viz., PQS, to express their virulence
factor. As previously concluded by Diggle SP et al.,31 k nown
that the regulation of PQS biosynthesis by LasR (3-oxo-C12-
AHL) occurs through transcriptional regulation of MvFR
that is responsible for converting HHQ to PQS,32 but under
certain growth situation, there can be a considerable LasR
independent biosynthesis of PQS genes.31 Another evidence
that isolates 13, 14, and 18 have the PQS fully functional is
thei r high resistance to uoroquinolones family (ciprooxacin
and levooxacin), as shown in Figure 2; this nding is in
agreement with Heeb S et al.33 In spite of the decient in lasR,
rhlR isolates 13, 14, and 18, they still have the ability to resist
to some antibiotics in addition to their biolm formation and
pigment production abilities. All these virulence factors under
the control of las, rhl systems, our explanation that a lasR, rhlR
decient strain may lead to cause infection by the presence of
multiple P. aeruginosa bacteria in infection site. The patient
could be infected by both QS decient and procient strains
of P. aeruginosa. QS decient strains could prot from the
extracellular enzymes produced by QS procient, and this can
lead to a QS decient strain to take part in infection.34 In the
same manner, Ali MR et al.35 indicates the low or moderate
resistance to antibiotics focused in isolates with high genetic
content.
Our result also revealed that isolates number 7, 10, and
11 with i n gene pattern C, and isolates number 17 and 19
within gene pattern D, were positive for production las and
rhl sy stems , Ta ble 4, but has a defect for the production of
MvfR gene. Even some of the PQS genes were turned on,
Table 4: Distribution of quorum sensing genes among P. aeruginosa isolates
Gene patterns Quorum sensing gene detected by PCR Isolates number
AlasI, lasR/ rhlI, rhlR/ MvfR, pqsA, pqsB, pqsC, pqsD, pqsE 2, 3, 4, 5, 6, 9, 12, 16
BrhlI/MvfR, pqsA, pqsB, pqsC, pqsD, pqsE 13, 14, 18
ClasI, lasR/ rhlI, rhlR/ pqsB, pqsE 7, 10, 11
DlasI, lasR/ rhlI, rhlR/ pqsB, pqsC 17, 19
ElasI, lasR/ rhlI, rhlR/ MvfR, pqsB, pqsC, pqsD, pqsE 1, 8, 15, 20
Figure 7: Gel electrophoresis of pqsC gene amplicons (298 bp), pqsE gene amplicons (317 bp), and mvfr gene amplicons (302 bp) of P. aeruginosa
isolates; M: 100 bp ladder; gel electrophoresis was performed using 1% agarose gel, and the run lasted for 50 min/ 100V

Interaction between Quorum Sensing Genes in Pseudomonas aeruginosa
IJDDT, Volume 10 Issue 3 July 2020 – September 2020 Page 342
knowing that these isolates still require MvfR gene as a
transcriptional regulator for PQS biosynthesis.32,36 While
pattern E isolates number 1, 8, 15, and 20 have only defective
in pqsA gene production, pqsA is an anthranilate coenzyme
A, has an important role in PQS biosynthesis.37
CONCLUSION
It was concluded that the quorum-sensing systems in
P. aeruginosa play a main role in the pathogenesis of infections.
It is also concluded that P. aeruginosa isolates, which have all
the QS genes, tend to be highly susceptible to antimicrobials
agents. Our study revealed that the regulation PQS system was
mediated by the las and rhl system. These ndings suggest
PQS can act as an intercellular signal in P. aeruginosa that is
not restricted only to AHL. This can be an important tool for
further future studying of quinolone signaling in more specic
in P. aeruginosa bacteria.
ACKNOWLEDGMENT
The authors would like to thank Al-Mustansiryiah University,
College of Science, Biology Department, Baghdad, Iraq, for
their support.
REFERENCES
1. Gaynes R, and Edwards J.R (2016). National Nosocomial
Infections Surveillance System. Overview of nosocomial
infections caused by gram-negative bacilli. Clin Infect Dis.
41:848–54.
2. Pier g, Band RR (2005) Pseudomonas aeruginosa. I n:
Mandell, g.L., Bennett J.E and DolinR, Eds., Mandell, Douglas
and Bennett’s Principles and Practice of Infectious Disease, 6th
Edition, Churchill Livingstone, New York, 2587-2615.
3. Perry J, Waglechner N, and Wright g (2016).The Prehistory of
Antibiotic Resistance. Cold Spring Harb Perspect Med; 6(6):11
4. Oliver A, Mulet X, López C, and Juan C (2015).The increasing
threat of Pseudomonas aeruginosa high-risk clones. Dr ug Resist
Update; 21,22:41–59
5. Ali M.R, and khudhair A.M (2019). Occurrence of quor um
sensing genes among cytotoxic and invasive MDR
Pseudomonas aeruginosa. Asian Jr. of Microbiol. Biotech. Env,
21(3): 67-72 .
6. Wagner S, Sommer R, Hinsberger S, Lu C, Hartmann R. W;
Empting M, Titz A. J (2016). Novel Strategies for the Treatment
of Pseudomonas aeruginosa Infections. Med. Chem, 59 (13):
5929–5969.
7. De Kievit T. R, and Iglewski B. H (2000). Bacterial quorum
sensing in pathogenic relationships. Infect Immun, 68, 4839–
48 49.
8. Lati A, Foglino M, Tanaka K, Williams P and Lazdunski
A (2010). A hierarchical quorum-sensing cascade in
Pseudomonas aeruginosa links the transcriptional activators
LasR and RhIR (VsmR) to expression of the stationary-phase
sigma factor RpoS. mol Microbio, 21(6): 113 7–1146.
9. Lee J, and Zhang L (2015).The hierarchy quorum-sensing
network in Pseudomonas aeruginosa. Protein Cell, 26–41.
10. Wagner V. E, Bushnell D, Passador L, Brooks A. I, and Iglewski
B. H (2003). Microarray analysis of Pseudomonas aeruginosa
quorum-sensing regulons: effects of growth phase and
environment. J. Bacterial, 185(7):2080–2095.
11. Déziel E, gopalan S, Tampakaki A. P, Lepine F, Padfield
K. E, and Saucier M (2005). The contribution of Mvf R to
Pseudomonas aeruginosa pathogenesis and quorum sensing
circuitry regulation: multiple quorum sensing-regulated genes
are mo du la te d with ou t aecti ng l asRI, r hl R I or t he pro du ct io n of
N-acyl-L-homoserine lactones. mol. Microbiol; 55(4): 9 98–1014.
12. CLSI (2016). Performance standards for antimicrobial
susceptibility testing. Twenty-six informational supplement.
36 (1): M100 -S26.
13. Sambrook J and Rusell DW (2001). molecular cloning: a
laborator y manual. 2, (3), New York: Cold spring Harbor
laboratory press.2(3):22-34
14. Spilker T, Coenye T, Va ndamme P, and LiPuma J. J ( 2004). PCR-
Based Assay for Dierentiation of Pseudomonas aeruginosa
from Other Pseudomonas Species Recovered from Cystic
Fibrosis Patients. J. Clin. Microbiol, 42(5):2074–2079.
15. Cotar A.I, Chifiriuc M.C, Dinu S, Pelinescu D, Banu O,
and Lazăr V (2010). Quntitative real-time pcr study of the
inuence of probiotic culture soluble fraction on the expression
of Pseudomonas aeruginosa quorum sensing genes. J. Arc.
Microbial. Immunol. 69(4):213-223.
16. Huebinger R.M, Stones D.H, Santos M, Carlson D.L, Song J,
Vaz D.P, Keen E, Wolf S.E, Or th K, and Krachler A.M (2016).
Targeting bacterial adherence inhibits multidrug-resistant
Pseudomonas aeruginosa infection following burn injury. Sci.
Rep. 6:393 41.
17. Sallman R.S, Hussein S.S, and Ali M.R (2018). ERIC PCR
Typing, RAPD PCR Fingerprinting and Quorum Sensing gene
Analysis of Pseudomonas aeruginosa Isolated from Dierent
Clinical Sources. Al-Mustansiriyah Jour nal of Science. 29(2):
50-62.
18. Chen J, Wang X, and Han H (2013). A new function of graphene
oxide emerges: inactivating phytopathogenic bacterium
Xanthomonas oryzae pv. Oryzae. J. of nanopar ticle res, 15(5):
1-14.
19. Woese CR (1987). Highly drug-resistant pathogens implicated
in burn-associated Bacterial evolution. Microbiol Rev, 51(2):
221– 271.
20. Othman N, Babakir-Mina M, Chia K. N, and Rashid P. Y
(2014). Pseudomonas aeruginosa infection in burn patients in
Sulaimaniyah, Iraq: risk factors and antibiotic resistance rates.
J. Infect. Dev. Ctries, 8(11): 1498-1502.
21. Ronat J. B, Kakol J, Khoury M. N, Berthelot M, Yun O, Brown
V, and Murphy R. A (2014). Highly drug-resistant pathogens
implicated in burn-associated bacteremia in an Iraqi burn care
un it. PloSon e, 9 (8):e101017.
22. Crăciunaş C, Butiuc-Keul A, Flonta M, Brad A, and Sigarteu
M (2010). Application of molecular techniques to the study
of Pseudomonas aeruginosa clinical isolate in Cluj-Napoca,
Romania. Analele Universităţii din Oradea-Fascicula Biologie,
XVII(2): 243–247.
23. Al-Charrakh A.H, Al-Awadi S. J, and Mohammed A.
S (2016). Detection of metallo-β-lactamase producing
Pseudomonas aeruginosa isolated from public and private
hospitals in Baghdad, Iraq. Acta Medica Iranica, 54(2): 107-113.
24. Hussein Z. K, Kadhim H. S, and Hassan J. S (2018). Detection
of New Delhi Metallo-Beta-Lactamase-1 (blaNDM-1) in
Carbapenem-Resistant Pseudomonas aeruginosa Isolated from
Clinical Samples in Wasit Hospitals. Iraqi JMS. 16(3): 239-246.
25. Amini A, and Namvar A. E (2019). Antimicrobial
Resistance Pattern and Presence of Beta-Lactamase genes in

Interaction between Quorum Sensing Genes in Pseudomonas aeruginosa
IJDDT, Volume 10 Issue 3 July 2020 – September 2020 Page 343
Pseudomonas aeruginosa Strains Isolated from Hospitalized
Patients, Babol-Iran. Journal of Medical Bacteriology. 8 (1, 2):
45-50.
26. Sallman R.S, Ali M.R, Hussein S.S, and Jassim A.M (2018).
Eect of gO Nanomaterials and ZNO Nanoparticles on AHL
signal controlled by QS genes in Pseudomonas aeruginosa.
biochemical and cellular archives, 8(1):637-641
27. Karatuna O, Yagci A (2010). Analysis of quorum sensing-
dependent virulence factor production and its relationship
with antimicrobial susceptibility in Pseudomonas aeruginosa
respiratory isolates. Clin Microbiol Infect,16(12):1770–1775.
28. Deziel E, Lepine F, Milot S, He J, mindrinos M.N, Tompkins R.G,
and Rahme LG (2004). Analysis of Pseudomonas aeruginosa
4-hyd roxy-2-al kylqui nolines ( HAQs) reveal s a role for4 -hydroxy-
2-heptylquinoline in cell-to-cell communication. Proc Natl Acad
Sci USA, 101(5): 1339–1344.
29. Wade D.S, Calfee M.W, Rocha E.R, Ling E.A, Engstrom E,
Coleman J.P and Pesci E.C (2005). Regulation of Pseudomonas
quinolone signal synthesis in Pseudomonas aeruginosa. J
Bacteriol, 187(13): 4372–4380.
30. 30. Medina g, Juárez K, Valderrama B, and Soberón-ChávezG
(2003). Mechanism of Pseudomonas aeruginosa Rhl R
Transcriptional Regulation of the rhlAB Promoter. J Bacteriolv,
185(20):5976 –5983.
31. 31.Diggle S.P, Winzer K, Lazdunski A, Williams P, and Camara
M (2002). Advancing the quorum in Pseudomonas aeruginosa:
MvaT and the regulation of N-acylhomoserine lactone
production and virulence gene expression. J Bacteriol, 184 (10):
2576–2586.
32. Gallagher L.A, McKnightm S.L, Kuznetsova M.S, Pesci E.C,
and Manoil C (2005). Functions required for extracellular
quinolone signaling by Pseudomonas aeruginosa. J Bacteriol,
184(23):6472–6480.
33. Heeb S, Fletcher M.P, Chhabra S.R, Diggle S.P, Williams P, and
Cámara M (2011). Quinolones: from antibiotics to autoinducers.
FEMSMicrobiol, 35(2): 247–274.
34. Schaber J.A, Ca rty N.L, McDonald N.A, gr aham E.D, Cheluvappa
R, griswold JA, and Hamood A.N (2004). Analysis of quorum
sensing-decient clinical isolates of Pseudomonas aeruginosa.
JMed Microbiol,53:841–853.
35. Ali M.R , and khudhair A.M (2018). Detection of Colony Adhesion
Factors and genetic Background of Adhesion genes Among
Multidr ug-Resistant Uropathogenic Escherichia coli Isolated
in Iraq. J Pure Appl Microbiol, 12(4): 2017-2026.
36. McGrath S, Wade D.S, and Pesci E.C (2004). Dueling quorum-
sensing systems in Pseudomonas aeruginosa control the
production of the Pseudomonas quinolone signal (PQS). FEMS
MicrobiolL ett,15;230(1):27-34.
37. Coleman J.P, Hudson L.L, McK night S.L, Farrow J.M, Calfee M.W,
Lindsey C.A, and Pesci E.C (2008). Pseudomonas aeruginosa
PqsA is an anthranilate-coenzyme A ligase. J Bacteriol
190:1247–1255