Content uploaded by Benji Brayan Ilagan Silva
Author content
All content in this area was uploaded by Benji Brayan Ilagan Silva on Apr 12, 2021
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Article
Immunogenicity and Protective Activity of Pigeon Circovirus
Recombinant Capsid Protein Virus-Like Particles
(PiCV rCap-VLPs) in Pigeons (Columba livia) Experimentally
Infected with PiCV
Huai-Ying Huang 1, Benji Brayan I. Silva 2, Shen-Pang Tsai 1, Ching-Yi Tsai 1, Yu-Chang Tyan 3,4,5,6,7,8,9 ,
Tzu-Che Lin 10, Ronilo Jose D. Flores 2 ,11 and Kuo-Pin Chuang 1,3,4,12,13,*
Citation: Huang, H.-Y.; Silva, B.B.I.;
Tsai, S.-P.; Tsai, C.-Y.; Tyan, Y.-C.;
Lin, T.-C.; Flores, R.J.D.; Chuang, K.-P.
Immunogenicity and Protective
Activity of Pigeon Circovirus
Recombinant Capsid Protein
Virus-Like Particles (PiCV
rCap-VLPs) in Pigeons (Columba livia)
Experimentally Infected with PiCV.
Vaccines 2021,9, 98. https://doi.org/
10.3390/vaccines9020098
Academic Editor: Caterina Lupini
Received: 5 January 2021
Accepted: 24 January 2021
Published: 28 January 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
1International Degree Program in Animal Vaccine Technology, International College, National Pingtung
University of Science and Technology, Pingtung 912, Taiwan; vetlaenwe@gmail.com (H.-Y.H.);
ksrobert@ms24.hinet.net (S.-P.T.); j10785002@g4e.npust.edu.tw (C.-Y.T.)
2Graduate School, University of the Philippines Los Baños, Laguna 4031, Philippines;
bisilva@up.edu.ph (B.B.I.S.); rdflores3@up.edu.ph (R.J.D.F.)
3Graduate Institute of Animal Vaccine Technology, College of Veterinary Medicine, National Pingtung
University of Science and Technology, Pingtung 912, Taiwan; yctyan@kmu.edu.tw
4School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan
5Department of Medical Imaging and Radiological Sciences, Kaohsiung Medical University, Kaohsiung 807,
Taiwan
6Institute of Medical Science and Technology, National Sun Yat-sen University, Kaohsiung 804, Taiwan
7
Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan
8Department of Medical Research, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan
9Center for Cancer Research, Kaohsiung Medical University, Kaohsiung 807, Taiwan
10 Department of Plant Industry, College of Agriculture, National Pingtung University of Science and
Technology, Pingtung 912, Taiwan; tclin@mail.npust.edu.tw
11 Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines Los Baños,
Laguna 4031, Philippines
12 Research Center for Animal Biologics, National Pingtung University of Science and Technology,
Pingtung 912, Taiwan
13 School of Dentistry, Kaohsiung Medical University, Kaohsiung 807, Taiwan
*Correspondence: kpchuang@g4e.npust.edu.tw
Abstract:
Pigeon circovirus (PiCV) is the most recurrent virus diagnosed in pigeons and is among the
major causative agents of young pigeon disease syndrome (YPDS). Due to the lack of an established
laboratory protocol for PiCV cultivation, development of prophylaxis is hampered. Alternatively,
virus-like particles (VLPs), which closely resemble native viruses but lack the viral genetic material,
can be generated using a wide range of expression systems and are shown to have strong immuno-
genicity. Therefore, the use of VLPs provides a promising prospect for vaccine development. In this
study, transfected human embryonic kidney (HEK-293) cells, a mammalian expression system, were
used to express the PiCV capsid protein (Cap), which is a major component of PiCV and believed to
contain antibody epitopes, to obtain self-assembled VLPs. The VLPs were observed to have a spheri-
cal morphology with diameters ranging from 12 to 26 nm. Subcutaneous immunization of pigeons
with 100
µ
g PiCV rCap-VLPs supplemented with water-in-oil-in-water (W/O/W) adjuvant induced
specific antibodies against PiCV. Observations of the cytokine expression and T-cell proliferation
levels in spleen samples showed significantly higher T-cell proliferation and IFN-
γ
expression in
pigeons immunized with VLPs compared to the controls (p< 0.05). Experimentally infected pigeons
that were vaccinated with VLPs also showed no detectable viral titer. The results of the current study
demonstrated the potential use of PiCV rCap-VLPs as an effective vaccine candidate against PiCV.
Keywords:
pigeon circovirus (PiCV); young pigeon disease syndrome (YPDS); virus-like particles
(VLPs); immunogenicity; mammalian expression system
Vaccines 2021,9, 98. https://doi.org/10.3390/vaccines9020098 https://www.mdpi.com/journal/vaccines
Vaccines 2021,9, 98 2 of 15
1. Introduction
The pigeon circovirus (PiCV) is among the major causative agents of a multifactorial
disease known as the young pigeon disease syndrome (YPDS) [
1
]. PiCV genome is com-
posed of a single-stranded circular DNA with a length of approximately 2000 nucleotides.
The PiCV genome is characterized by two major open reading frames (ORFs), ORF C1 and
ORF V1.
ORF C1 encodes a 30 kDa protein that is responsible for the assembly of the viral
capsid [
2
]. On the other hand, ORF V1 encodes a nonstructural protein, the replication-
associated protein (Rep) [
3
]. A canonical nonanucleotide motif (NANTATTAC) at the peak
of a stem-loop located between the 5
0
-ends of the two main ORFs (C1 and V1), which is
considered to be a requirement for the initiation of the viral genome replication, is also
present [4].
For more than two decades, one of the common problems in young racing pigeons is
YPDS, which is associated with poor racing performance, and high morbidity and mortality
rates among pigeons of age 3 to 20 weeks [
5
]. The strong immunosuppressive capacity
of PiCV infections increases the probability of secondary infections that result in huge
losses [
6
]. Infected birds display nonspecific symptoms, such as anorexia, lethargy, poor
racing performance, depression, diarrhea, a fluid-filled crop [
7
], polyuria, rapid weight
loss, ruffled feathers, and vomiting [8–10].
The capsid protein of circoviruses is believed to display antigenic properties that
induce antibodies when the host is infected with the virus. This was verified in the
cases of beak and feather disease virus (BFDV), PiCV, and porcine circovirus genotype
2 (PCV2) [
11
–
13
]. An approved commercial vaccine or prophylaxis against PiCV is not
yet available, since there is no laboratory protocol for culturing the virus [
14
,
15
]. To date,
detection of PiCV infection involves the use of conventional methods including histological
observation, electron microscopy, and molecular diagnosis, such as in situ hybridization,
nucleic acid-based dot blot hybridization and polymerase chain reaction (PCR) [16–18].
Virus-like particles (VLPs) are multiprotein structures that mimic the characteristics
of the virus, which are ideal for vaccine development [
19
]. VLPs lack the viral genome
necessary for viral replication, making them one of the safest templates for vaccine devel-
opment. VLPs can assemble into different conformations, but generally tend to assemble
into viral-like structures that range in diameters of 25–100 nm [
20
]. The viral morphology
of VLPs brought advantages to their immunostimulatory activity because it can: (1) be effi-
ciently recognized by antigen presenting cells; (2) be trafficked from the site of injection to
the lymph nodes; and (3) be a promoter of B-cell activation due to its repetitively arranged
structural features, which result in a stronger humoral immune response, along with cellu-
lar mediated immunity and enhanced T-cell stimulation [
21
]. The highly ordered structure
and multivalent display of VLPs may also facilitate recognition by pathogen-associated
molecular pattern motifs that can trigger innate immune sensing mechanisms and can be
recognized by Toll-like receptors and other pattern-recognition receptors that are present in
host cells [
22
,
23
]. As of today, only one study has been performed using VLPs as a potential
vaccine for PiCV, and they found that VLPs induce antibody response in immunized mice.
However, in this study, a baculovirus expression system was used, but no challenge test
was conducted; thus, a comparison of the viral titers of challenged vaccinated and nonva-
ccinated mice was also not reported [
24
]. With a combination of strong immunogenicity
and good safety profiles, VLPs are expected to acquire widespread recognition in different
fields, such as vaccines, therapeutic modalities, and in vitro diagnostics [25].
Due to the high prevalence of PiCV and with no available vaccines, severe losses were
incurred by the poultry and pigeon racing industry. Because of the persistent threats posed
by PiCV, vaccine development would be of great interest.
In this study, recombinant capsid protein was generated using a mammalian expres-
sion system. Transfected human embryonic kidney (HEK-293) cells were used to produce
self-assembled VLPs. Furthermore, challenge tests and qPCR analysis of cytokines were
Vaccines 2021,9, 98 3 of 15
done to determine the immune response post-immunization. The current study is limited
to the development of a vaccine against PiCV alone.
2. Materials and Methods
2.1. Cell Line
Human embryonic kidney 293 cells (HEK-293) (ATCC
®
CRL-1573
™
) were cultured
and propagated in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, Gaithersburg, MD,
USA) supplemented with 10% fetal bovine serum (FBS) (Hyclone laboratories, Inc., Logan,
UT, USA) and with 50
µ
g/mL of penicillin-streptomycin (Gibco, USA) and incubated at
37 ◦C and 5% CO2.
2.2. Construction of Recombinant Capsid Protein (rCap) for Escherichia coli and Mammalian Cell
Expression System
For the E. coli expression of the rCap, the cap gene sequence of PiCV P99/05 strain
(GenBank Accession No. HQ401274.1) was codon usage-optimized by Genomics, New
Taipei City, Taiwan and synthesized in pGS21-a (GenScript Biotech Corp., Piscataway, NJ,
USA) with EcoRI and XhoI as restriction sites. The constructed plasmid contains a genomic
sequence that encodes PiCV capsid gene with a C-terminal GST tag and an N-terminal
His-tag. On the other hand, for the mammalian cell expression system, the same gene
sequence (GenBank Accession No. HQ401274.1) was codon usage-optimized (Genomics,
New Taipei City, Taiwan) and synthesized in pCDNA3.1 (Protech Technology Enterprise
Co., Ltd., Taipei, Taiwan) with KpnI and NotI as restriction sites. The constructed plasmid
contains a genomic sequence that encodes PiCV capsid gene with His-tag. Verification of
the constructed sequence was performed through DNA sequencing. The resulting plasmid
was used for transfection and protein expression experiments.
2.3. E. coli Expression of rCap
One liter (1 L) of LB was inoculated with E. coli (BL21) containing the recombinant
pGS21a-Cap plasmid and incubated at 37
◦
C until O.D. 600 reached 0.6. Afterward, rCap
expression was induced by adding 1 mM Isopropyl
β
-D-1-thiogalactopyranoside (IPTG) to
the medium and subsequently incubating for another 6 h at 37
◦
C. After incubation, the
culture was then centrifuged at 10,000 rpm for 10 min. The resulting bacterial pellet was
resuspended in 10 mL Tris-buffered saline (TBS), and the mixture was sonicated thrice in
20% pulsing cycles (MISONIX Sonicator
®
300, Sunwise, Taipei, Taiwan). Cell debris from
the sonication was removed by centrifugation at 10,000 rpm for 10 min. The supernatant
was subjected to Ni2+ affinity column chromatography to purify the collected recombinant
capsid proteins. Purity of the obtained rCap was assessed by SDS-PAGE Analysis and
Western blot analysis. The purified rCap was then stored at −80 ◦C for further use.
Briefly, 10
µ
L of protein samples was separated using 12% of SDS-PAGE and was
visualized by Coomassie blue dye. For Western blot analysis, separated proteins were elec-
trophoretically transferred onto polyvinylidene difluoride (PVDF) membrane. Unwanted
sites on the membrane were blocked by incubating in 10 mL of 5% skim milk (Anchor,
New Young, Singapore, Singapore) with shaking for 1 h at 37
◦
C. The membrane was
washed with PBST (0.1% Tween 20 in 1x PBS) 5 times for 5 min each. After washing, the
membrane was incubated with mouse anti-His primary antibody (TOOls, Taipei, Taiwan)
diluted 3000-fold in 10 mL 5% skim milk with shaking at 4
◦
C for 12 h to enable the binding
of primary antibody with the histidine tag (6x His-tag) of the target protein. After the
addition of primary antibody, the membrane was again washed with PBST 5 times for 5 min
each. Next, the membrane was incubated with horse radish peroxidase (HRP)-conjugated
rabbit anti-mouse IgG (ZYMED, South San Francisco, CA, USA) diluted 5000-fold in 10 mL
5% skim milk with shaking for 1 h at 37
◦
C. Using a chemiluminescent substrate for the
detection of HRP (West Pico PLUS Chemiluminescent Substrate, Thermo, Waltham, MA,
USA), the blot was visualized by X-ray film development.
Vaccines 2021,9, 98 4 of 15
2.4. Precipitation of Virus-Like Particles (VLPs)
The pCDNA3.1-Cap vector was transfected into HEK-293 cells using lipofectamine
(Invitrogen, Carlsbad, CA, USA) to produce PiCV VLPs. The medium containing the cells
was collected after 72 h of incubation at 37
◦
C, and it was subjected to centrifugation at
1500 rpm for 5 min to separate the cells from the medium. The cells were washed using
PBS, and the mixture was centrifuged again for another 5 min at 1500 rpm. Collected
cells were mixed with whole cell extract buffer and then placed on ice for about 30 min.
Afterward, the mixture was centrifuged at 10,000 rpm for 10 min. The supernatant was
precipitated by adding 7% poly-ethylene glycol (PEG) and 2% NaCl solution, and then
agitating it at 4
◦
C for 4 h. After agitation, it was centrifuged with a speed of 9500 rpm
at 4
◦
C for 30 min. The supernatant was disposed, while the pellet containing the PiCV
VLPs was resuspended in 4 mL PBS. The resulting VLPs solution was stored in
−
20
◦
C
for further characterization, and until use for immunization. SDS-PAGE and subsequent
Western blotting were performed as described above, but the blot was visualized using a
digital imaging system (Fusion Solo S, VILBER LOURMAT, Eberhardzell, Germany). For
size comparison, the protein weight marker captured under visible light was automatically
merged with the image of the blot by the imaging program. Electron microscopy was also
performed to observe the morphology of the VLPs.
2.5. Electron Microscopy
The purified PiCV rCap-VLPs were captured on a carbon coated slotted grid, which
was then stained with phosphotungstic acid (PTA) for 60 s. After staining, a transmission
electron microscope (TEM) (H-7500, Hitachi, Tokyo, Japan) was used to visualize the
morphology of the VLPs.
2.6. Pigeons and Ethics Statement
Twenty (20) twenty-one (21) day old pigeons (Columba livia) obtained from a private
hatchery were used in this study. Prior to immunization, the antibody titers of pigeons
against PiCV capsid protein were measured by ELISA at 21 and 28 days of age. Pigeons
with serum ELISA optical densities (O.D.) higher than that of the 0 day old PiCV-free pigeon
serum (negative control) were not selected for use in this study. The pigeons selected for
both the control and VLP groups were subcutaneously (S.C.) immunized twice at age 28
and 42 days. The control group was immunized with saline solution supplemented with
water-in-oil-in-water (W/O/W) adjuvant (Summit P-168, Country best biotech, Taipei,
Taiwan), while the VLP group was immunized with 100
µ
g PiCV rCap-VLPs supplemented
with W/O/W adjuvant. On 0, 14, and 21 days post-vaccination (dpv), blood samples were
collected from the wing vein of 5 pigeons in each group to measure the antibody titer.
Spleen samples were also collected from 5 pigeons from each group at 21 dpv for T-cell
proliferation and cytokine assays. Additionally, at 21 dpv, a challenge test was administered
to 10 pigeons (5 pigeons per group) by giving the pigeons feed containing 3 g of lymphoid
tissues containing 6
×
10
3.5
copies/g of PiCV. All pigeons were euthanized using CO
2
at
28 dpv for histopathological examination and quantification of the viral load.
All animal tests were conducted as stated in the ethical guidelines for animal rights
protection of the National Pingtung University of Science and Technology-Institutional
Animal Care and Use Committee (NPUST-IACUC), with IACUC permit number NPUST
107-056.
2.7. Sample Collection, Fixation, and Histopathological Examination
Following the euthanasia of pigeons, tissue samples from the spleen were collected.
The extracted tissue samples were fixed in 10% phosphate buffer formalin solution and
embedded in paraffin. For histopathological examination, hematoxylin-eosin was used to
stain 5
µ
m thick tissue samples. The samples were examined under a light microscope,
and images were obtained using a Nikon DS-L2 camera unit connected to a Nikon Eclipse
E-200 microscope.
Vaccines 2021,9, 98 5 of 15
2.8. Indirect Enzyme-Linked Immunosorbent Assay
To determine the PiCV-specific IgG antibodies, the collected sera from the wing vein of
the pigeons were each tested by ELISA. Coating buffer (Candor Bioscience GmbH, Wangen
im Allgäu, Germany) containing 40
µ
g/mL of purified capsid protein expressed in E. coli
was used to coat the wells of the ELISA plate. Each of the collected pigeon sera were
diluted 120-fold in the assay buffer, and 100
µ
L of the serum was deposited in each well.
Serum from 0 day old PiCV-free pigeons, diluted 512-fold, was used as negative control.
For the secondary antibody, horseradish peroxidase (HRP)-labeled goat anti-pigeon IgG
(OrigGene Technologies, Rockville, MD, USA) diluted to 6000-fold was used. The assay was
carried out with ABTS (2,2
0
-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)) substrate
for 15 min. An ELISA plate reader was used to read the optical density (OD) at 405 nm.
2.9. T-Cell Proliferation Analysis
An MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was
used to determine the T cell proliferation activity in the spleen samples. Spleen samples
were macerated through a sieve using a syringe plunger to obtain single-cell suspen-
sion in Hank’s Balanced Salt Solution (HBSS). The cell suspensions were overlaid onto
Histopaque
®
1077 density gradient medium and centrifuged at 1800 rpm for 20 min at
room temperature. Lymphocytes at the interface were collected and washed three times in
HBSS. Lymphocytes isolated from the spleen of both groups were seeded into a 96-well
plate. Each well was seeded with 1
×
10
5
cells in 100
µ
L medium (10% FBS DMEM with
penicillin and streptomycin). The cells were then incubated with 10
µ
g of VLPs for
72 h
at
37
◦
C. Following the incubation, 10
µ
L of MTT with a concentration of 0.5 mg/mL was
added into each well, and the plate was further incubated for another 4 h at room tempera-
ture. The medium inside the ELISA plate was collected and centrifuged at
1500 rpm
for
15 min.
Following centrifugation, the supernatant was discarded, and the cells were lysed
in a buffer (0.01 M HCl + 10% SDS). An ELISA reader (Bio-TEK Instruments, Inc., Winooski,
VT, USA) was used to measure the extent of color change at 570 nm. T cell proliferation
activity was expressed as stimulation index (S.I.).
2.10. Cytokine Analysis by RT-PCR
Lasergene package (DNAStar Inc., Madison, WI, USA) was used to design a RT-PCR
primer pair specific for IFN-
γ
, TGF-
β
, and IL-8. Pigeon
β
-actin was used as internal control
(Table 1). Amounts of 500 mg of spleen tissue samples (frozen and thawed three times) were
first digested with 1 mL TRIzol (Invitrogen, Taipei, Taiwan) and vortexed for 15 s. Then,
the samples were incubated at room temperature for 15 min followed by centrifugation at
12,000 rpm for 15 min to separate the nucleic acid and protein. The aqueous phase was
collected and transferred to a clean tube, and 750
µ
L absolute isopropanol was added. After
gently inverting the tube several times, it was placed at
−
20
◦
C for 20 min.
The solution
was centrifuged at 12,000 rpm for 10 min to isolate the mRNA. The supernatant was
removed, and 500
µ
L of 75% isopropanol solution in diethyl-pyrocarbonate-treated water
(DEPC H
2
O) was added to wash out excess salts followed by centrifugation at 8000
×
gfor
2 min. Excess alcohol was drained, and the RNA pellets were air-dried for 30 min and re-
suspended in 50
µ
L of DEPC H
2
O. RNA concentration was measured using OD at
260 nm,
and its quality was evaluated by calculating the OD260/OD280 ratio. Complementary
DNA was produced from 100 to 200 ng of RNA per reaction. The RNA was subjected
to RT-PCR using a RevertAid First Strand cDNA Synthesis Kit (ThermoFisher, Waltham,
MA, USA) following the manufacturer’s instructions. Furthermore, RT-PCR was carried
out using a thermal cycler (Applied Biosystems
™
, Thermo, Waltham, MA, USA) with the
following conditions: initial denaturation at 95
◦
C for 3 min, 40 cycles of denaturation at
95
◦
C for 30 s, annealing at 60
◦
C for 30 s, and elongation at 72
◦
C for 30 s. The assay was
performed using the StepOne
™
Real-Time PCR System (Applied Biosystems
™
, Thermo,
USA). The calibrated cytokine content relative to the control group was evaluated through
the comparative Ct method (2−∆∆ Ct).
Vaccines 2021,9, 98 6 of 15
Table 1. Primers used for quantitative real-time PCR.
Primer Name Sequence Size Sequence ID Template Position
PiCV
Forward: 50
CTGACAGTGGGTCTCAACGC 30
205 bp GQ844278.1
217–236
Reverse: 50
CGTCAAAGTCCATGAGGGGG 30421–402
β-actin
Forward: 50
TCCTTCTTGGGTATGGAATCTGT 30
203 bp XM_005504502.2
806–828
Reverse: 50
TTTCATTGTGCTGGGTGCCA 30991–972
IFN-γ
Forward: 50
ATCCTGAGCCAGATTGTTTCCA 30
144 bp NM_001282845.1
211–232
Reverse: 50
GATCCTTGAGGTCTTGCAGC 30358–339
IL-8
Forward: 50
GCCAGTGCATAGCCACTCAT 30
172 bp NM_001282837.1
98–117
Reverse: 50
GCATTTACAATCCGCTGGACC 30269–249
TGF-β2
Forward: 50
TCACTTCCACTGTGCTCACC 30
192 bp EU737359.1
290–309
Reverse: 50
AGGTAAGTCCGAGCCCCATA 30481–462
2.11. Detection of Viral Load Using qPCR
To detect the vial load, qPCR primers used were designed specifically for PiCV and
pigeon
β
-actin (Table 1) using Lasergene package (DNAStar Inc., Madison, WI, USA).
The primers
were synthesized by Genomics (Genomics, Taipei, Taiwan). The extracted
DNA from spleen and liver were mixed with the qPCR mixture containing the designed
primer, qPCRBIO SyGreen Blue Mix Hi-ROX (PCRBIOSYSTEM, London, UK), and nuclease
free water. qPCR was carried out using the following conditions: initial denaturation at
95 ◦C
for 3 min, 40 cycles of denaturation at 95
◦
C for 30 s, annealing at 60
◦
C for 30 s, and
elongation at 72
◦
C for 30 s. The assay was performed using the StepOne
™
Real-Time PCR
System (Applied Biosystems
™
, Thermo, USA). Similar to the cytokine analysis, normalized
virus titer relative to the control group was also evaluated through the comparative Ct
method (2−∆∆ Ct).
2.12. Statistical Analysis
GraphPad Prism 5 (GraphPad, San Diego, CA, USA) was used to carry out all sta-
tistical analyses in the study. A two-tailed Student’s t-test was used to conduct statistical
comparisons between the control and VLP groups setting the significance level at p< 0.05.
All data are shown as the mean ±standard deviation [26].
3. Results
3.1. Protein Expression and Morphological Analysis of Virus-Like Particles (VLPs)
The recombinant expression plasmid pCDNA3.1 was assembled for an effective
expression of the target proteins in mammalian cell. Constructed pigeon circovirus recom-
binant capsid protein virus-like particles (PiCV rCap-VLPs) were successfully acquired
by transfection of HEK-293 cells. SDS-PAGE analysis of the expressed capsid protein
was shown in (Figure 1a). Western blot showed a 35 kDa band that corresponds to the
PiCV rCap verified the presence of the protein. Results from this assay showed that the
expressed PiCV rCap was in the cell lysates and not released into the medium (Figure 1b).
Vaccines 2021,9, 98 7 of 15
To further confirm that the Cap protein formed VLPs, electron microscopy was conducted
to reveal the morphology of PiCV VLPs. It was observed that the diameters of VLPs were
approximately 12 to 26 nm (Figure 2).
Vaccines 2021, 9, x 7 of 16
shown in (Figure 1a). Western blot showed a 35 kDa band that corresponds to the PiCV
rCap verified the presence of the protein. Results from this assay showed that the ex-
pressed PiCV rCap was in the cell lysates and not released into the medium (Figure 1b).
To further confirm that the Cap protein formed VLPs, electron microscopy was conducted
to reveal the morphology of PiCV VLPs. It was observed that the diameters of VLPs were
approximately 12 to 26 nm (Figure 2).
(a) (b)
(c) (d)
Figure 1. Prokaryotic and mammalian cell expression of PiCV capsid protein. (a) SDS-PAGE analysis of PiCV rCap-virus-
like particle (VLP) expression in HEK-293 cells. Lane M shows the protein marker (10–170 kDa). Lanes 1, 2, and 3 show
the visualized proteins isolated from the culture medium of the transfected cell, cell lysates of the nontransfected and
transfected cells, respectively. (b) Western blotting analysis of the protein samples using mouse anti-His antibody and
horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG. Lanes contain similar samples as (a). (c) SDS-PAGE anal-
ysis of PiCV rCap expression in E. coli cells. Lane M shows the protein marker (10–170 kDa). Lanes 1, 2, 3, and 4 show the
visualized proteins isolated from the lysate of non-Isopropyl β-D-1-thiogalactopyranoside (IPTG)-induced cells, and ly-
sates of 1 h-, 2 h- and 3 h-IPTG-induced cells, respectively. (d) Western blotting analysis of the protein samples using
mouse anti-His antibody and horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG. Lanes contain similar sam-
ples as (c).
Figure 1.
Prokaryotic and mammalian cell expression of PiCV capsid protein. (
a
) SDS-PAGE analysis of PiCV rCap-virus-
like particle (VLP) expression in HEK-293 cells. Lane M shows the protein marker (10–170 kDa). Lanes 1, 2, and 3 show the
visualized proteins isolated from the culture medium of the transfected cell, cell lysates of the nontransfected and transfected
cells, respectively. (
b
) Western blotting analysis of the protein samples using mouse anti-His antibody and horseradish
peroxidase (HRP)-conjugated rabbit anti-mouse IgG. Lanes contain similar samples as (a). (c) SDS-PAGE analysis of PiCV
rCap expression in E. coli cells. Lane M shows the protein marker (10–170 kDa). Lanes 1, 2, 3, and 4 show the visualized
proteins isolated from the lysate of non-Isopropyl
β
-D-1-thiogalactopyranoside (IPTG)-induced cells, and lysates of 1 h-,
2 h- and 3 h-IPTG-induced cells, respectively. (
d
) Western blotting analysis of the protein samples using mouse anti-His
antibody and horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG. Lanes contain similar samples as (c).
Vaccines 2021,9, 98 8 of 15
Vaccines 2021, 9, x 8 of 16
Figure 2. Morphology of virus-like particles (VLPs) as shown in transmission electron microscopy
(TEM). Drawn to scale: 100 nm. Detected protein as seen in Figure 1b was purified by PEG precipi-
tation using 7% PEG 6000 solution and 2% NaCl solution to verify presence of PiCV VLPs. Puri-
fied VLPs were used to coat a slotted carbon grid and stained with phosphotungstic acid (PTA)
before viewing under transmission electron microscope (TEM).
Furthermore, PiCV capsid protein was expressed and induced in E. coli (BL21) cells
using 1 mM IPTG. Successful expression was observed using SDS-PAGE (Figure 1c), and
further analysis was performed by Western blot (Figure 1d). Lane 1 represents the cells
before IPTG induction, while lanes 2 to 4 represent the cells which were induced with
IPTG for 1, 2, and 3 h, respectively, to express the protein. SDS-PAGE analysis showed
that the purified rCap has a purity of greater than 95%. Accounting for the 26 kDa size of
the GST-tag in addition to the 35 kDa size of the PiCV capsid protein, the Western blot
showed an approximately 60 kDa band.
3.2. Antibody Titer in Pigeons Post-Immunization with PiCV rCap-VLPs
Antibody titers of the pigeons were measured on 0, 14, and 21 days post-vaccination
(dpv) using ELISA. As shown in (Figure 3), the measurements of antibody titers were in
terms of optical density (O.D.) at 405 nm. At 0 dpv, the antibody titer between the control
and immunized group did not have any significant differences. However, at 14 dpv, it
was observed that the antibody response of the VLP group was significantly higher than
that of the control group (p < 0.05). This trend continued to increase as observed at 21 dpv
when the antibody titer of the VLP group reached an ELISA titer O.D. 405 value of ap-
proximately 1.4 (p < 0.05). Overall results verified the effectiveness of VLPs in inducing
antibody response.
Figure 3. Antibody response of pigeons to PiCV rCap-VLPs vaccination. Two groups (10 pi-
geons/group) were utilized in this study. The control group was immunized with saline supple-
mented with water-in-oil-in-water (W/O/W) adjuvant, while the VLP group was immunized with
Figure 2.
Morphology of virus-like particles (VLPs) as shown in transmission electron microscopy
(TEM). Drawn to scale: 100 nm. Detected protein as seen in Figure 1b was purified by PEG precipita-
tion using 7% PEG 6000 solution and 2% NaCl solution to verify presence of PiCV VLPs. Purified
VLPs were used to coat a slotted carbon grid and stained with phosphotungstic acid (PTA) before
viewing under transmission electron microscope (TEM).
Furthermore, PiCV capsid protein was expressed and induced in E. coli (BL21) cells
using 1 mM IPTG. Successful expression was observed using SDS-PAGE (Figure 1c), and
further analysis was performed by Western blot (Figure 1d). Lane 1 represents the cells
before IPTG induction, while lanes 2 to 4 represent the cells which were induced with
IPTG for 1, 2, and 3 h, respectively, to express the protein. SDS-PAGE analysis showed that
the purified rCap has a purity of greater than 95%. Accounting for the 26 kDa size of the
GST-tag in addition to the 35 kDa size of the PiCV capsid protein, the Western blot showed
an approximately 60 kDa band.
3.2. Antibody Titer in Pigeons Post-Immunization with PiCV rCap-VLPs
Antibody titers of the pigeons were measured on 0, 14, and 21 days post-vaccination
(dpv) using ELISA. As shown in (Figure 3), the measurements of antibody titers were
in terms of optical density (O.D.) at 405 nm. At 0 dpv, the antibody titer between the
control and immunized group did not have any significant differences. However, at
14 dpv
,
it was observed that the antibody response of the VLP group was significantly higher
than that of the control group (p< 0.05). This trend continued to increase as observed at
21 dpv
when the antibody titer of the VLP group reached an ELISA titer O.D. 405 value of
approximately 1.4 (p< 0.05). Overall results verified the effectiveness of VLPs in inducing
antibody response.
Vaccines 2021,9, 98 9 of 15
Vaccines 2021, 9, x 8 of 16
Figure 2. Morphology of virus-like particles (VLPs) as shown in transmission electron microscopy
(TEM). Drawn to scale: 100 nm. Detected protein as seen in Figure 1b was purified by PEG precipi-
tation using 7% PEG 6000 solution and 2% NaCl solution to verify presence of PiCV VLPs. Puri-
fied VLPs were used to coat a slotted carbon grid and stained with phosphotungstic acid (PTA)
before viewing under transmission electron microscope (TEM).
Furthermore, PiCV capsid protein was expressed and induced in E. coli (BL21) cells
using 1 mM IPTG. Successful expression was observed using SDS-PAGE (Figure 1c), and
further analysis was performed by Western blot (Figure 1d). Lane 1 represents the cells
before IPTG induction, while lanes 2 to 4 represent the cells which were induced with
IPTG for 1, 2, and 3 h, respectively, to express the protein. SDS-PAGE analysis showed
that the purified rCap has a purity of greater than 95%. Accounting for the 26 kDa size of
the GST-tag in addition to the 35 kDa size of the PiCV capsid protein, the Western blot
showed an approximately 60 kDa band.
3.2. Antibody Titer in Pigeons Post-Immunization with PiCV rCap-VLPs
Antibody titers of the pigeons were measured on 0, 14, and 21 days post-vaccination
(dpv) using ELISA. As shown in (Figure 3), the measurements of antibody titers were in
terms of optical density (O.D.) at 405 nm. At 0 dpv, the antibody titer between the control
and immunized group did not have any significant differences. However, at 14 dpv, it
was observed that the antibody response of the VLP group was significantly higher than
that of the control group (p < 0.05). This trend continued to increase as observed at 21 dpv
when the antibody titer of the VLP group reached an ELISA titer O.D. 405 value of ap-
proximately 1.4 (p < 0.05). Overall results verified the effectiveness of VLPs in inducing
antibody response.
Figure 3. Antibody response of pigeons to PiCV rCap-VLPs vaccination. Two groups (10 pi-
geons/group) were utilized in this study. The control group was immunized with saline supple-
mented with water-in-oil-in-water (W/O/W) adjuvant, while the VLP group was immunized with
Figure 3.
Antibody response of pigeons to PiCV rCap-VLPs vaccination. Two groups
(10 pigeons/group)
were utilized in this study. The control group was immunized with saline
supplemented with water-in-oil-in-water (W/O/W) adjuvant, while the VLP group was immunized
with PiCV rCap-VLPs. Pigeons in both groups were immunized twice (at 28 and 42 days of age).
Antibody titers were determined at 0, 14, and 21 days post-vaccination (dpv) by ELISA quantified by
optical density reading at 405 nm. Significant difference between groups (p< 0.05) was notated as *.
3.3. Virus Titer in Pigeons Challenged with Pigeon Circovirus (PiCV)
In addition to the evaluation of antibody response to VLPs, viral load in each group
was measured in relation to Ct values (Figure 4). The viral titer was measured using spleen
and liver samples from the control and VLP group after oral administration of 3 g lymphoid
tissues that have 6
×
10
3.5
copies/g of PiCV. As shown in Figure 4, both the spleen and
liver from the control group have significantly higher Ct values as compared to the VLP
group (p< 0.05). Moreover, Ct values were undetected for both spleen and liver of the VLP
group, which signified that the pigeons immunized with VLPs showed no detectable levels
of PiCV (p< 0.05).
Vaccines 2021, 9, x 9 of 16
PiCV rCap-VLPs. Pigeons in both groups were immunized twice (at 28 and 42 days of age). Anti-
body titers were determined at 0, 14, and 21 days post-vaccination (dpv) by ELISA quantified by
optical density reading at 405 nm. Significant difference between groups (p < 0.05) was notated as
*.
3.3. Virus Titer in Pigeons Challenged with Pigeon Circovirus (PiCV)
In addition to the evaluation of antibody response to VLPs, viral load in each group
was measured in relation to Ct values (Figure 4). The viral titer was measured using spleen
and liver samples from the control and VLP group after oral administration of 3 g lym-
phoid tissues that have 6 × 10
3.5
copies/g of PiCV. As shown in Figure 4, both the spleen
and liver from the control group have significantly higher Ct values as compared to the
VLP group (p < 0.05). Moreover, Ct values were undetected for both spleen and liver of
the VLP group, which signified that the pigeons immunized with VLPs showed no de-
tectable levels of PiCV (p < 0.05).
Figure 4. Viral load in the spleen and liver of pigeons. Pigeons from the control group and the
PiCV rCap-VLPs immunized were challenged with lymphoid tissues that have 6 × 10
3.5
copies/g of
PiCV. Following immunization and challenge, viral loads in the lymphoid organs of the pigeons
were quantified by qPCR and the data are presented as Ct. Significant difference (p < 0.05) was
notated as *. ND means not detected.
3.4. T-Cell Proliferation and Cytokine-Quantities Post-Vaccination
To further investigate the immune response of pigeons vaccinated with rCap-VLP,
T-cell proliferation and cytokine expression profiles were evaluated as presented in Figure
5. The expression of IL-8, IFN-γ, TGF-β2, as well as T cell proliferation were observed after
the pigeons were subcutaneously administered with rCap-VLP. T cell proliferation in VLP
group was found to be significantly higher than the control group (Figure 5) and it reached
a stimulation index (S.I.) of 2.8-fold (p < 0.05).
Expression of IFN-γ of the immunized group was significantly upregulated with a
fold change of 3-fold, which is higher than the control (p < 0.05). However, fold change of
IL-8 in the spleen samples of both the control and immunized group did not differ signif-
icantly.
Figure 4.
Viral load in the spleen and liver of pigeons. Pigeons from the control group and the PiCV
rCap-VLPs immunized were challenged with lymphoid tissues that have 6
×
10
3.5
copies/g of PiCV.
Following immunization and challenge, viral loads in the lymphoid organs of the pigeons were
quantified by qPCR and the data are presented as Ct. Significant difference (p< 0.05) was notated
as *. ND means not detected.
3.4. T-Cell Proliferation and Cytokine-Quantities Post-Vaccination
To further investigate the immune response of pigeons vaccinated with rCap-VLP, T-
cell proliferation and cytokine expression profiles were evaluated as presented in
Figure 5.
The expression of IL-8, IFN-
γ
, TGF-
β
2, as well as T cell proliferation were observed after
the pigeons were subcutaneously administered with rCap-VLP. T cell proliferation in VLP
group was found to be significantly higher than the control group (Figure 5) and it reached
a stimulation index (S.I.) of 2.8-fold (p< 0.05).
Vaccines 2021,9, 98 10 of 15
Vaccines 2021, 9, x 10 of 16
(a) (b)
(c) (d)
Figure 5. Immunogenic response of pigeons to PiCV rCap-VLPs vaccination. Two groups were observed in the study. The
control group was immunized with saline supplemented with W/O/W adjuvant, while the VLP group was immunized
with PiCV rCap-VLPs. (a) Proliferation of T-cells was determined by isolating lymphocytes from spleen, and subsequently
incubating with VLPs protein for 72 h. Quantifications of the expression of each cytokines (b) IL-8, (c) IFN-γ, and (d) TGF-
β-2 were performed using RT-PCR, with pigeon β-actin as internal control. Significant difference (p < 0.05) was notated as
*.
Additionally, the fold change of TGF-β-2 in the spleen of the VLP group decreased
significantly as compared to the control group. It was observed that the expression of
TGF-β2 in the VLP group was approximately 0.25-fold, a value that is much less in com-
parison to that of the control group (p < 0.05). This result signified that in this experiment,
immunization with rCap-VLP resulted to a suppression of TGF-β-2 expression in the
spleen sample.
3.5. Histopathological Examination through Hematoxylin-Eosin Staining of Spleen Samples
To further confirm the efficacy of PiCV rCap-VLPs as potential vaccines, spleen sam-
ples from pigeons that were orally administered with feeds containing PiCV-positive lym-
phoid tissues were collected and subjected to histopathological examination using hema-
toxylin-eosin (H&E) staining. Results showed that immunization with PiCV rCap-VLPs
helped maintain the integrity of lymphocytes in the spleen (Figure 6a). In contrast, the
nonimmunized group revealed a significant decrease in the color of hematoxylin-eosin
(H&E) stain, signifying the occurrence of lymphopenia (Figure 6b). These results con-
firmed the effectiveness of immunization with PiCV rCap-VLPs in regulating the copies
of PiCV.
Figure 5.
Immunogenic response of pigeons to PiCV rCap-VLPs vaccination. Two groups were observed in the study. The
control group was immunized with saline supplemented with W/O/W adjuvant, while the VLP group was immunized
with PiCV rCap-VLPs. (
a
) Proliferation of T-cells was determined by isolating lymphocytes from spleen, and subsequently
incubating with VLPs protein for 72 h. Quantifications of the expression of each cytokines (
b
) IL-8, (
c
) IFN-
γ
, and
(d) TGF-β-2 were
performed using RT-PCR, with pigeon
β
-actin as internal control. Significant difference (p< 0.05) was
notated as *.
Expression of IFN-
γ
of the immunized group was significantly upregulated with a fold
change of 3-fold, which is higher than the control (p< 0.05). However, fold change of IL-8
in the spleen samples of both the control and immunized group did not
differ significantly.
Additionally, the fold change of TGF-
β
-2 in the spleen of the VLP group decreased
significantly as compared to the control group. It was observed that the expression of
TGF-
β
2 in the VLP group was approximately 0.25-fold, a value that is much less in com-
parison to that of the control group (p< 0.05). This result signified that in this experiment,
immunization with rCap-VLP resulted to a suppression of TGF-
β
-2 expression in the
spleen sample.
3.5. Histopathological Examination through Hematoxylin-Eosin Staining of Spleen Samples
To further confirm the efficacy of PiCV rCap-VLPs as potential vaccines, spleen
samples from pigeons that were orally administered with feeds containing PiCV-positive
lymphoid tissues were collected and subjected to histopathological examination using
hematoxylin-eosin (H&E) staining. Results showed that immunization with PiCV rCap-
VLPs helped maintain the integrity of lymphocytes in the spleen (Figure 6a). In contrast,
the nonimmunized group revealed a significant decrease in the color of hematoxylin-eosin
(H&E) stain, signifying the occurrence of lymphopenia (Figure 6b). These results confirmed
the effectiveness of immunization with PiCV rCap-VLPs in regulating the copies of PiCV.
Vaccines 2021,9, 98 11 of 15
Vaccines 2021, 9, x 11 of 16
(a) (b)
Figure 6. Histopathological examination of spleen samples. Spleen sample from challenged pigeons that were (a) immun-
ized and (b) nonimmunized with PiCV rCap-VLPs. Spleen samples were stained with hematoxylin-eosin (H&E) stain and
were observed under light microscope.
4. Discussion
Currently, there are no available prophylaxis against Young Pigeon’s Disease
(YPDS), resulting in severe losses to pigeon meat and racing industries [24]. Information
on the pathogenesis of the virus and laboratory protocols for culturing pigeon circovirus
(PiCV) is also not available. Given the high prevalence of the occurrence of PiCV in pigeon
flocks, future development of effective vaccines against this virus could be a possible ap-
proach to the treatment of YPDS, considering that this has been conducted in the case of
porcine circovirus [12,27–29]. In recent years, the production of recombinant capsid pro-
tein of various circoviruses, such as duck circovirus (DuCV) [30], porcine circovirus type
2 (PCV2) [31], beak and feather disease virus (BFDV) [11], and PiCV, produced in bacte-
rial, yeast, and baculovirus systems, has already been reported. For this reason, several
experiments that assessed the immunogenicity of PiCV rCap in pigeons were designed
[13]. Considering the literature mentioned above, insights from this study can aid future
development efforts to produce an effective vaccine against PiCV.
Virus-like particles (VLPs) are self-assembled macromolecules that mimic the viral
protein structure of a target virus but contain no genetic materials of the native viral strain.
VLPs exhibit antigenic epitopes that are positioned in a correct conformation and in a
highly repetitive manner [32]. Hence, VLPs have the advantages of both the whole-virus
vaccines and recombinant subunit vaccines, which have increased stability, preservation
of native antigenic confirmation, and sufficient production. To date, there are several pro-
karyotic and eukaryotic systems, such as yeast, insect, plant, E. coli, and mammalian cells,
that have been used to express recombinant proteins for the generation of VLPs. Among
these expression systems, eukaryotic expression hosts, such as yeast (Saccharomyces cere-
visiae, Pichia pastoris, and Hansenula polymorpha) and mammalian cells (Chinese hamster
ovary cell line [CHO]), are used for generating immunogenic VLPs [33]. This research
used mammalian cells as an expression host for assembling the PiCV rCap-VLPs. The
main advantage of using this expression system is its ability to execute a complete post-
translational modification of the recombinant protein that is crucial for controlling the lo-
calization, stability, and conformation of proteins [34]. HEK-293 cell line, which is a well-
established platform in bioprocessing for viruses and viral vectors production, was uti-
lized in the experiments. The use of this cell for the construction of VLPs has already been
previously reported [27]. Mammalian cells are increasingly being used to generate VLP-
based vaccines as exemplified by porcine circovirus (PCV), porcine parvovirus (PPV),
Lassa virus (LASV), Marburg virus (MARV), and Ebola virus (EBOV) VLPs [35]. Due to
the ability of VLPs to trigger strong immune response and to induce antibody production,
VLPs are considered to be a potential novel vaccine candidate [24,36].
The structural protein encoded by PiCV cap (C1) gene is called capsid protein (Cap).
This protein is not only responsible for the capsid assembly, but it is also used as antigen
Figure 6.
Histopathological examination of spleen samples. Spleen sample from challenged pigeons that were (
a
) immunized
and (
b
) nonimmunized with PiCV rCap-VLPs. Spleen samples were stained with hematoxylin-eosin (H&E) stain and were
observed under light microscope.
4. Discussion
Currently, there are no available prophylaxis against Young Pigeon’s Disease (YPDS),
resulting in severe losses to pigeon meat and racing industries [
24
]. Information on the
pathogenesis of the virus and laboratory protocols for culturing pigeon circovirus (PiCV)
is also not available. Given the high prevalence of the occurrence of PiCV in pigeon
flocks, future development of effective vaccines against this virus could be a possible
approach to the treatment of YPDS, considering that this has been conducted in the case
of porcine circovirus [
12
,
27
–
29
]. In recent years, the production of recombinant capsid
protein of various circoviruses, such as duck circovirus (DuCV) [
30
], porcine circovirus
type 2 (PCV2) [
31
], beak and feather disease virus (BFDV) [
11
], and PiCV, produced in
bacterial, yeast, and baculovirus systems, has already been reported. For this reason,
several experiments that assessed the immunogenicity of PiCV rCap in pigeons were
designed [
13
]. Considering the literature mentioned above, insights from this study can
aid future development efforts to produce an effective vaccine against PiCV.
Virus-like particles (VLPs) are self-assembled macromolecules that mimic the viral
protein structure of a target virus but contain no genetic materials of the native viral strain.
VLPs exhibit antigenic epitopes that are positioned in a correct conformation and in a highly
repetitive manner [
32
]. Hence, VLPs have the advantages of both the whole-virus vaccines
and recombinant subunit vaccines, which have increased stability, preservation of native
antigenic confirmation, and sufficient production. To date, there are several prokaryotic and
eukaryotic systems, such as yeast, insect, plant, E. coli, and mammalian cells, that have been
used to express recombinant proteins for the generation of VLPs. Among these expression
systems, eukaryotic expression hosts, such as yeast (Saccharomyces cerevisiae,Pichia pastoris,
and Hansenula polymorpha) and mammalian cells (Chinese hamster ovary cell line [CHO]),
are used for generating immunogenic VLPs [
33
]. This research used mammalian cells as
an expression host for assembling the PiCV rCap-VLPs.
The main
advantage of using
this expression system is its ability to execute a complete post-translational modification
of the recombinant protein that is crucial for controlling the localization, stability, and
conformation of proteins [
34
]. HEK-293 cell line, which is a well-established platform in
bioprocessing for viruses and viral vectors production, was utilized in the experiments.
The use of this cell for the construction of VLPs has already been previously reported [
27
].
Mammalian cells are increasingly being used to generate VLP-based vaccines as exemplified
by porcine circovirus (PCV), porcine parvovirus (PPV), Lassa virus (LASV), Marburg virus
(MARV), and Ebola virus (EBOV) VLPs [
35
]. Due to the ability of VLPs to trigger strong
immune response and to induce antibody production, VLPs are considered to be a potential
novel vaccine candidate [24,36].
Vaccines 2021,9, 98 12 of 15
The structural protein encoded by PiCV cap (C1) gene is called capsid protein (Cap).
This protein is not only responsible for the capsid assembly, but it is also used as antigen
for antibody detection during PiCV infections [
37
]. Aside from Cap being the fundamental
part of the circoviral capsids, it also plays an intermediate role in the penetration of viral
DNA within the nucleus of its host [
38
]. With no method to propagate PiCV in cell
cultures, a suitable alternative method for the detection of PiCV-specific serum antibody
is the expression of recombinant capsid protein [
39
]. A previous study performed on
PCV2 showed that this viral capsid protein induces immune response, which includes
specific antibodies and interferon gamma (IFN-
γ
) production [
40
]. Moreover, the study was
also able to detect the immune responses that were seen in the appearance of antibodies
between two and four weeks after the exposure of piglets to PCV2 or porcine circovirus
capsid protein. Another study demonstrated the capacity of PiCV rCap to induce immune
response in both naturally infected and uninfected pigeons; however, the rate of immune
response differs depending on the severity of PiCV infection [
1
]. Cap expression level was
further increased with the use of codon optimization, which is a prominent approach for
increasing the expression of heterologous proteins in eukaryotic cells. Additionally, this
technique is widely applied for both recombinant proteins and viral vector production [
41
].
Taking into consideration that an approved vaccine against PiCV is not yet available, other
disease control strategies against the spread of PiCV infection can be utilized. Another
study demonstrated a therapeutic approach in controlling the spread of PiCV infection by
subcutaneous treatment of pigeons with PiIFN-
α
that resulted in the upregulation of Mx1
gene and IFN-γ, which proved the antiviral effect of PiIFN-α[15].
In this study, vaccination with VLPs demonstrated an increase in antibody production
of immunized pigeons. Furthermore, the challenge test of experimentally infected pigeons
showed no detectable copies of PiCV in spleen samples post-immunization, therefore
proving that the VLP treatment can significantly reduce PiCV viral loads in the spleen.
Similarly, VLP immunization in mice and guinea pigs was able to significantly induce
specific antibody responses to PCV2 Cap [
42
]. Meanwhile, in another study [
43
], the
protective immune responses of a VLP-based PCV2 vaccine enhanced by the incorporation
of a truncated form of flagellin significantly reduced viral loads in lung samples from
mice. PiCV viral loads in the spleens of naturally infected nonvaccinated pigeons were also
reportedly higher than those of the naturally infected pigeons vaccinated with recombinant
PiCV Cap vaccine formulation [1].
To further understand the immunogenic response to the PiCV rCap-VLPs treatment
in this study, T-cell and cytokines were quantified. It was observed that the immune
response caused by the PiCV rCap-VLPs significantly increased the proliferation of various
T-cell and cytokines. T-cells are an important part of the immune system for the cell
mediated immunity and the activation of immune cells, while cytokines are important
as signaling molecules to regulate immunity [
44
]. Specifically, the VLP group displayed
a T cell proliferation stimulation index that is twice higher and IFN-
γ
fold change that
is thrice higher as compared with the control group. A similar study on PCV2 VLPs
demonstrated that after the vaccination with VLP, the level of IFN-
γ
production was
higher than with Cap vaccine [
43
]. Administration of VLPs enhanced the T helper type 1
(Th1), which promotes inflammatory responses through the secretion of cytokines such as
gamma interferon (IFN-
γ
) that activate macrophages and provide help to CD8+ cytotoxic T
cells [
45
]. Similarly, studies on the immunogenicity a PiCV rCap vaccine formulation have
also reported increased synthesis of IFN-
γ
in uninfected vaccinated pigeons compared
to the uninfected nonvaccinated controls all throughout the observation period post-
vaccination [
1
,
13
]. A high level of IFN-
γ
is important because it is responsible for the
adaptive immune cells, mainly antigen-specific T lymphocytes. Furthermore, this cytokine
is also associated with innate immunity, notably with natural killer and natural killer T
cells [
42
]. On the other hand, expression of TGF-
β
-2 in vaccinated and control groups
was observed to have no significant statistical difference. However, it was also observed
that TGF-
β
-2 decreased to 0.25-fold in the VLP group compared with the control group.
Vaccines 2021,9, 98 13 of 15
TGF-
β
-2 plays an important role in the formation of blood vessels, the regulation of muscle
tissue and body fat development, wound healing, and immune system functions [
46
].
TGF-
β
-2 is also responsible for regulating the cells from growing and dividing too rapidly;
thus, it can also suppress the formation of tumors. In this experiment, immunization of
PiCV rCap-VLPs in pigeons resulted in the suppressed expression of TGF-β-2. Lastly, the
vaccinated and control groups were also observed to have no significant difference with
respect to the expression of IL-8, a chemokine involved in early inflammation. In another
vaccination study testing a PCV2 subunit vaccine containing Cap, it was similarly observed
that IL-8 did not significantly differ between the vaccinated group and the control group
prior to and at the early stage of infection. Nonvaccinated animals were also observed
to have consistently low levels of IL-8, while the vaccinated group had increased IL-8
levels several weeks post-infection, which demonstrated that the innate immune response
of the vaccinated group was more efficient compared to the nonvaccinated group. In
the same study, animals with very low to no detected viral load in the blood also had
higher IL-8 levels, while highly viremic animals had consistently low levels of IL-8 during
infection [47].
Since prophylaxis against PiCV is not available, potential approaches were proposed
for further development of the vaccine research. To summarize the results of this research,
it was demonstrated that PiCV rCap-VLPs was successfully produced using a mammalian
expression system. PiCV rCap-VLPs induced antibody titers in immunized pigeons and
significantly reduced viral titers in experimentally infected pigeons. The constructed
VLPs were proven to be an effective potential candidate vaccine against PiCV. Additional
assessments and research on VLPs generated by mammalian expression system are required
to further test the effectiveness of this vaccine.
5. Conclusions
The nonavailability of laboratory protocols for culturing pigeon circovirus (PiCV) and
prophylaxis against the virus causes severe losses in the pigeon industry. A mammalian
expression system was used in this study to obtain PiCV rCap-VLPs. Immunization
with PiCV rCap-VLPs was shown to induce antibody response and significantly reduced
the viral titer in infected pigeons, which proved its potential as a vaccine candidate.
Further assessment of the VLPs generated by mammalian expression system is needed to
investigate the efficacy of this potential prophylaxis. Results from this experiment provide
important insights into the future development of PiCV vaccine research.
Author Contributions:
Conceptualization, K.-P.C.; Data curation, H.-Y.H., S.-P.T., C.-Y.T. and K.-
P.C.; Formal analysis, H.-Y.H., B.B.I.S., S.-P.T., C.-Y.T., Y.-C.T., T.-C.L., R.J.D.F. and K.-P.C.; Funding
acquisition, K.-P.C.; Investigation, H.-Y.H., S.-P.T. and C.-Y.T.; Methodology, K.-P.C.; Resources,
Y.-C.T. and K.-P.C.; Supervision, R.J.D.F. and K.-P.C.; Visualization, H.-Y.H., B.B.I.S., S.-P.T. and
K.-P.C.; Writing—original draft, H.-Y.H., S.-P.T., C.-Y.T. and K.-P.C.; Writing—review and editing,
B.B.I.S., Y.-C.T., T.-C.L. and R.J.D.F. All authors have read and agreed to the published version of the
manuscript.
Funding:
This research was funded by Higher Education Sprout Project by the Ministry of Education
and the Ministry of Science and Technology (MOST 107-3017-F-020-003).
Institutional Review Board Statement:
The study was conducted according to the guidelines of
the National Pingtung University of Science and Technology—Institutional Animal Care and Use
Committee (NPUST-IACUC), with IACUC permit number NPUST 107-056 approved on 1 July 2018.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available within the article.
Acknowledgments:
The authors also would like to acknowledge the Research Center for Animal
Biologics, from The Featured Areas Research Center Program within the framework of the Higher
Education Sprout Project by the Ministry of Education and the Ministry of Science and Technology
(MOST 107-3017-F-020-003), Taiwan, R.O.C., for the financial support of this study.
Vaccines 2021,9, 98 14 of 15
Conflicts of Interest:
The authors declare no conflict of interest. The funders had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or
in the decision to publish the results.
References
1.
Stenzel, T.; Dziewulska, D.; ´
Smiałek, M.; Tykałowski, B.; Kowalczyk, J.; Koncicki, A. Comparison of the Immune Response to
Vaccination with Pigeon Circovirus Recombinant Capsid Protein (PiCV RCP) in Pigeons Uninfected and Subclinically Infected
with PiCV. PLoS ONE 2019,14, e0219175. [CrossRef]
2.
Mankertz, A.; Hattermann, K.; Ehlers, B.; Soike, D. Cloning and Sequencing of Columbid Circovirus (CoCV), a New Circovirus
from Pigeons. Arch. Virol. 2000,145, 2469–2479. [CrossRef]
3.
Todd, D.; Weston, J.H.; Soike, D.; Smyth, J.A. Genome Sequence Determinations and Analyses of Novel Circoviruses from Goose
and Pigeon. Virology 2001,286, 354–362. [CrossRef] [PubMed]
4.
Loiko, M.R.; Junqueira, D.M.; Varela, A.P.M.; Tochetto, C.; Scheffer, C.M.; Lima, D.A.; Morel, A.P.; Cerva, C.; Paim, W.P.; Mayer,
F.Q.; et al. Columbid Circoviruses Detected in Free Ranging Pigeons from Southern Brazil: Insights on PiCV Evolution.
Arch. Virol.
2018,163, 3083–3090. [CrossRef] [PubMed]
5.
Tsai, S.S.; Chang, Y.L.; Huang, Y.L.; Liu, H.J.; Ke, G.M.; Chiou, C.J.; Hsieh, Y.C.; Chang, T.C.; Cheng, L.T.; Chuang, K.P.
Development of a Loop-Mediated Isothermal Amplification Method for Rapid Detection of Pigeon Circovirus. Arch. Virol.
2014
,
159, 921–926. [CrossRef] [PubMed]
6.
Wang, K.C.; Zhuang, Q.Y.; Qiu, Y.; Wang, T.; Chen, J.M. Genome Sequence Characterization of Pigeon Circoviruses in China.
Virus Res. 2017,233, 1–7. [CrossRef] [PubMed]
7.
Freick, M.; Müller, H.; Raue, R. Rapid Detection of Pigeon Herpesvirus, Fowl Adenovirus and Pigeon Circovirus in Young Racing
Pigeons by Multiplex PCR. J. Virol. Methods 2008,148, 226–231. [CrossRef]
8. Woods, L.W.; Latimer, K.S. Circovirus Infection of Nonpsittacine Birds. J. Avian Med. Surg. 2000,14, 154–163. [CrossRef]
9.
Huang, Y.L.; Castaneda, O.A.; Thongchan, D.; Khatri-Chhetri, R.; Tsai, S.S.; Wu, H.Y. Pigeon Circovirus Infection in Disqualified
Racing Pigeons from Taiwan. Avian Pathol. 2017,46, 359–366. [CrossRef]
10.
Raue, R.; Schmidt, V.; Freick, M.; Reinhardt, B.; Johne, R.; Kamphausen, L.; Kaleta, E.F.; Müller, H.; Krautwald-Junghanns, M.E. A
Disease Complex Associated with Pigeon Circovirus Infection, Young Pigeon Disease Syndrome. Avian Pathol.
2005
,34, 418–425.
[CrossRef]
11.
Bonne, N.; Shearer, P.; Sharp, M.; Clark, P.; Raidal, S. Assessment of Recombinant Beak and Feather Disease Virus Capsid Protein
as a Vaccine for Psittacine Beak and Feather Disease. J. Gen. Virol. 2009,90, 640–647. [CrossRef] [PubMed]
12.
Li, P.C.; Qiao, X.W.; Zheng, Q.S.; Hou, J.B. Immunogenicity and Immunoprotection of Porcine Circovirus Type 2 (PCV2) Cap
Protein Displayed by Lactococcus Lactis. Vaccine 2016,34, 696–702. [CrossRef] [PubMed]
13.
Stenzel, T.; Dziewulska, D.; Tykałowski, B.; ´
Smiałek, M.; Kowalczyk, J.; Koncicki, A. Immunogenicity of Pigeon Circovirus
Recombinant Capsid Protein in Pigeons. Viruses 2018,10, 596. [CrossRef] [PubMed]
14.
Duchatel, J.P.; Todd, D.; Smyth, J.; Costes, B.; Jauniaux, T.; Farnir, F.; Losson, B.; Vanderplasschen, A. Pigeon Circovirus:
Baculovirus Expression of the Capsid Protein Gene, Specific Antibody and Viral Load Measured by Real Time Polymerase Chain
Reaction. Isr. J. Vet. Med. 2011,66, 26–31.
15. Santos, H.M.; Chen, C.C.; Tsai, C.Y.; Hsish, Y.C.; Chung, F.C.; Tyan, Y.C.; Tayo, L.L.; Chuang, K.P. Influence of Pigeon Interferon
Alpha (PiIFN-
α
) on Pigeon Circovirus (PiCV) Replication and Cytokine Expression in Columba Livia. Vet. Microbiol.
2020
,
242, 108591. [CrossRef] [PubMed]
16.
Roy, P.; Dhillon, A.S.; Lauerman, L.; Shivaprasad, H.L. Detection of Pigeon Circovirus by Polymerase Chain Reaction. Avian Dis.
2003,47, 218–222. [CrossRef]
17.
Smyth, J.A.; Weston, J.; Moffett, D.A.; Todd, D. Detection of Circovirus Infection in Pigeons by in Situ Hybridization Using Cloned
DNA Probes. J. Vet. Diagnostic Investig. 2001,13, 475–482. [CrossRef] [PubMed]
18.
Todd, D.; Duchatel, J.P.; Weston, J.H.; Ball, N.W.; Borghmans, B.J.; Moffett, D.A.; Smyth, J.A. Evaluation of Polymerase Chain
Reaction and Dot Blot Hybridisation Tests in the Diagnosis of Pigeon Circovirus Infections. Vet. Microbiol.
2002
,89, 1–16.
[CrossRef]
19.
Kushnir, N.; Streatfield, S.J.; Yusibov, V. Virus-like Particles as a Highly Efficient Vaccine Platform: Diversity of Targets and
Production Systems and Advances in Clinical Development. Vaccine 2012,31, 58–83. [CrossRef] [PubMed]
20.
Mohsen, M.O.; Zha, L.; Cabral-Miranda, G.; Bachmann, M.F. Major Findings and Recent Advances in Virus–like Particle
(VLP)-Based Vaccines. Semin. Immunol. 2017,34, 123–132. [CrossRef] [PubMed]
21.
Braun, M.; Jandus, C.; Maurer, P.; Hammann-Haenni, A.; Schwarz, K.; Bachmann, M.F.; Speiser, D.E.; Romero, P. Virus-like
Particles Induce Robust Human T-Helper Cell Responses. Eur. J. Immunol. 2012,42, 330–340. [CrossRef] [PubMed]
22.
Plummer, E.M.; Manchester, M. Viral Nanoparticles and Virus-like Particles: Platforms for Contemporary Vaccine Design. Wiley
Interdiscip. Rev. Nanomed. Nanobiotechnol. 2011,3, 174–196. [CrossRef] [PubMed]
23.
Crisci, E.; Bárcena, J.; Montoya, M. Virus-like Particles: The New Frontier of Vaccines for Animal Viral Infections. Vet. Immunol.
Immunopathol. 2012,148, 211–225. [CrossRef] [PubMed]
24.
Gai, W.; Zheng, W.; Zhao, Z.; Wong, G.; Sun, P.; Yan, L.; He, H.; Zheng, X. Assembly of Pigeon Circovirus-like Particles Using
Baculovirus Expression System. Microb. Pathog. 2020,139, 103905. [CrossRef] [PubMed]
Vaccines 2021,9, 98 15 of 15
25. Fu, Y.; Li, J. A Novel Delivery Platform Based on Bacteriophage MS2 Virus-like Particles. Virus Res. 2016,211, 9–16. [CrossRef]
26.
Franciosini, M.P.; Fringuelli, E.; Tarhuni, O.; Guelfi, G.; Todd, D.; Casagrande Proietti, P.; Falocci, N.; Asdrubali, G. Development
of a Polymerase Chain Reaction-Based in Vivo Method in the Diagnosis of Subclinical Pigeon Circovirus Infection. Avian Dis.
2005,49, 340–343. [CrossRef]
27.
Alvim, R.G.F.; Itabaiana, I.; Castilho, L.R. Zika Virus-like Particles (VLPs): Stable Cell Lines and Continuous Perfusion Processes
as a New Potential Vaccine Manufacturing Platform. Vaccine 2019,37, 6970–6977. [CrossRef]
28.
Blanchard, P.; Mahé, D.; Cariolet, R.; Keranflec’h, A.; Baudouard, M.A.; Cordioli, P.; Albina, E.; Jestin, A. Protection of Swine
against Post-Weaning Multisystemic Wasting Syndrome (PMWS) by Porcine Circovirus Type 2 (PCV2) Proteins. Vaccine
2003
,21,
4565–4575. [CrossRef]
29.
Fort, M.; Sibila, M.; Pérez-Martín, E.; Nofrarías, M.; Mateu, E.; Segalés, J. One Dose of a Porcine Circovirus 2 (PCV2) Sub-Unit
Vaccine Administered to 3-Week-Old Conventional Piglets Elicits Cell-Mediated Immunity and Significantly Reduces PCV2
Viremia in an Experimental Model. Vaccine 2009,27, 4031–4037. [CrossRef]
30.
Yang, C.; Xu, Y.; Jia, R.; Li, P.; Zhang, L.; Wang, M.; Zhu, D.; Chen, S.; Liu, M.; Yin, Z.; et al. Prokaryotic Expression of a
Codon-Optimized Capsid Gene from Duck Circovirus and Its Application to an Indirect ELISA. J. Virol. Methods
2017
,247, 1–5.
[CrossRef]
31.
Zhu, S.; Zhang, C.; Wang, J.; Wei, L.; Quan, R.; Yang, J.; Yan, X.; Li, Z.; She, R.; Hu, F.; et al. Immunity Elicited by an Experimental
Vaccine Based on Recombinant Flagellin-Porcine Circovirus Type 2 Cap Fusion Protein in Piglets. PLoS ONE
2016
,11, e0147432.
[CrossRef] [PubMed]
32.
Urakami, A.; Sakurai, A.; Ishikawa, M.; Yap, M.L.; Flores-Garcia, Y.; Haseda, Y.; Aoshi, T.; Zavala, F.P.; Rossmann, M.G.; Kuno, S.;
et al. Development of a Novel Virus-like Particle Vaccine Platform That Mimics the Immature Form of Alphavirus. Clin. Vaccine
Immunol. 2017,24. [CrossRef] [PubMed]
33.
Shirbaghaee, Z.; Bolhassani, A. Different Applications of Virus-like Particles in Biology and Medicine: Vaccination and Delivery
Systems. Biopolymers 2016,105, 113–132. [CrossRef] [PubMed]
34.
Hashiguchi, A.; Komatsu, S. Posttranslational Modifications and Plant–Environment Interaction, 1st ed.; Elsevier Inc.: Cambridge,
MA, USA, 2017; Volume 586. [CrossRef]
35. Liu, F.; Ge, S.; Li, L.; Wu, X.; Liu, Z.; Wang, Z. Virus-like Particles: Potential Veterinary Vaccine Immunogens. Res. Vet. Sci. 2012,
93, 553–559. [CrossRef] [PubMed]
36.
Wang, Y.; Wang, G.; Duan, W.T.; Sun, M.X.; Wang, M.H.; Wang, S.H.; Cai, X.H.; Tu, Y.B. Self-Assembly into Virus–like Particles of
the Recombinant Capsid Protein of Porcine Circovirus Type 3 and Its Application on Antibodies Detection. AMB Express
2020
,10.
[CrossRef]
37.
Lai, G.H.; Lin, Y.C.; Tsai, Y.L.; Lien, Y.Y.; Lin, M.K.; Chen, H.J.; Chang, W.T.; Tzen, J.T.C.; Lee, M.S. High Yield Production of
Pigeon Circovirus Capsid Protein in the E. Coli by Evaluating the Key Parameters Needed for Protein Expression. BMC Vet. Res.
2014,10, 1–11. [CrossRef]
38.
Heath, L.; Williamson, A.-L.; Rybicki, E.P. The Capsid Protein of Beak and Feather Disease Virus Binds to the Viral DNA and Is
Responsible for Transporting the Replication-Associated Protein into the Nucleus. J. Virol. 2006,80, 7219–7225. [CrossRef]
39.
Daum, I.; Finsterbusch, T.; Härtle, S.; Göbel, T.W.; Mankertz, A.; Korbel, R.; Grund, C. Cloning and Expression of a Truncated
Pigeon Circovirus Capsid Protein Suitable for Antibody Detection in Infected Pigeons. Avian Pathol.
2009
,38, 135–141. [CrossRef]
40.
Trible, B.R.; Kerrigan, M.; Crossland, N.; Potter, M.; Faaberg, K.; Hesse, R.; Rowland, R.R.R. Antibody Recognition of Porcine
Circovirus Type 2 Capsid Protein Epitopes after Vaccination, Infection, and Disease. Clin. Vaccine Immunol.
2011
,18, 749–757.
[CrossRef]
41.
Zucchelli, E.; Pema, M.; Stornaiuolo, A.; Piovan, C.; Scavullo, C.; Giuliani, E.; Bossi, S.; Corna, S.; Asperti, C.; Bordignon, C.; et al.
Codon Optimization Leads to Functional Impairment of RD114-TR Envelope Glycoprotein. Mol. Ther. Methods Clin. Dev.
2017
,4,
102–114. [CrossRef]
42.
Mutthi, P.; Theerawatanasirikul, S.; Roytrakul, S.; Paemanee, A.; Lekcharoensuk, C.; Hansoongnern, P.; Petcharat, N.; Thangth-
amniyom, N.; Lekcharoensuk, P. Interferon Gamma Induces Cellular Protein Alteration and Increases Replication of Porcine
Circovirus Type 2 in PK-15 Cells. Arch. Virol. 2018,163, 2947–2957. [CrossRef] [PubMed]
43.
Liu, X.; Liu, Y.; Zhang, Y.; Zhang, F.; Du, E. Incorporation of a Truncated Form of Flagellin (TFlg) into Porcine Circovirus Type 2
Virus-like Particles Enhances Immune Responses in Mice. BMC Vet. Res. 2020,16, 1–10. [CrossRef] [PubMed]
44.
Zhu, Y.; Yao, S.; Chen, L. Cell Surface Signaling Molecules in the Control of Immune Responses: A Tide Model. Immunity
2011
,34,
466–478. [CrossRef] [PubMed]
45.
Yang, R.; Murillo, F.M.; Cui, H.; Blosser, R.; Uematsu, S.; Takeda, K.; Akira, S.; Viscidi, R.P.; Roden, R.B.S. Papillomavirus-Like
Particles Stimulate Murine Bone Marrow-Derived Dendritic Cells To Produce Alpha Interferon and Th1 Immune Responses via
MyD88. J. Virol. 2004,78, 11152–11160. [CrossRef]
46.
Gilbert, R.W.D.; Vickaryous, M.K.; Viloria-Petit, A.M. Signalling by Transforming Growth Factor Beta Isoforms in Wound Healing
and Tissue Regeneration. J. Dev. Biol. 2016,4, 21. [CrossRef] [PubMed]
47.
Borghetti, P.; Morganti, M.; Saleri, R.; Ferrari, L.; De Angelis, E.; Cavalli, V.; Cacchioli, A.; Corradi, A.; Martelli, P. Innate
pro-inflammatory and adaptive immune cytokines in PBMC of vaccinated and unvaccinated pigs naturally exposed to porcine
circovirus type 2 (PCV2) infection vary with the occurrence of the disease and the viral burden. Vet. Microbiol.
2013
,163, 42–53.
[CrossRef] [PubMed]
