Molecular detection of Toxoplasma gondii in select cetaceans stranded in the Philippines in 2019

Abstract

Toxoplasma gondii infections affect marine mammal
species worldwide. Investigating the presence of the
protozoan parasite in marine mammals is crucial to
understanding land-sea connection in relation to the
movement of pathogenic and potentially pathogenic
microorganisms in the marine environment. The main objective
of this study was to detect T. gondii, through nested PCR
targeting the RE gene of the parasite, in select cetaceans (n=19)
that stranded in different parts of the Philippines from January
to December 2019. T. gondii was detected in four cetaceans,
specifically, in the brain tissue of a pantropical spotted dolphin
(Stenella attenuata), brain and stomach tissues of a Cuvier’s
beaked whale (Ziphius cavirostris), brain and skeletal tissues of
a pygmy sperm whale (Kogia breviceps), and lung tissue of
another pantropical spotted dolphin. No statistically significant
association was established between the stranding parameters
and presence of T. gondii DNA in tissues of cetaceans. To the
best knowledge of the authors, this study is the first to report the
presence of T. gondii in a Cuvier’s beaked whale (Ziphius
cavirostris). The detection of T. gondii in deep dwelling
cetacean species supports the claim that toxoplasmosis may have
extended beyond coastlines where pathogen run-off is likely. T.
gondii prevalence among cetaceans in the Philippines has
received attention for the past five years, and there is a need to
continue the surveillance of T. gondii among local cetacean
populations given its implications in the conservation and
management of these marine mammals.

Full text

Philippine Science Letters Vol. 13 | No. 02 | 2020
206
Toxoplasmosis
Molecular detection of
Toxoplasma
gondii
in select cetaceans stranded
in the Philippines in 2019
Raphael Joshua C. De Guzman1, Lemnuel V. Aragones2, and Marie Christine M.
Obusan*1
1Microbial Ecology of Terrestrial and Aquatic Systems Laboratory, Institute of Biology, College of
Science, University of the Philippines Diliman
2Marine Mammal Research & Stranding Laboratory, Institute of Environmental Science & Meteorology,
College of Science, University of the Philippines Diliman
oxoplasma gondii infections affect marine mammal
species worldwide. Investigating the presence of the
protozoan parasite in marine mammals is crucial to
understanding land-sea connection in relation to the
movement of pathogenic and potentially pathogenic
microorganisms in the marine environment. The main objective
of this study was to detect T. gondii, through nested PCR
targeting the RE gene of the parasite, in select cetaceans (n=19)
that stranded in different parts of the Philippines from January
to December 2019. T. gondii was detected in four cetaceans,
specifically, in the brain tissue of a pantropical spotted dolphin
(Stenella attenuata), brain and stomach tissues of a Cuvier’s
beaked whale (Ziphius cavirostris), brain and skeletal tissues of
a pygmy sperm whale (Kogia breviceps), and lung tissue of
another pantropical spotted dolphin. No statistically significant
association was established between the stranding parameters
and presence of T. gondii DNA in tissues of cetaceans. To the
best knowledge of the authors, this study is the first to report the
presence of T. gondii in a Cuvier’s beaked whale (Ziphius
cavirostris). The detection of T. gondii in deep dwelling
cetacean species supports the claim that toxoplasmosis may have
extended beyond coastlines where pathogen run-off is likely. T.
gondii prevalence among cetaceans in the Philippines has
received attention for the past five years, and there is a need to
continue the surveillance of T. gondii among local cetacean
populations given its implications in the conservation and
management of these marine mammals.
KEYWORDS
Toxoplasma gondii, cetaceans, Cuvier’s beaked whale,
stranding events, marine microbiology
INRODUCTION
The occurrence of Toxoplasma gondii in marine mammals,
particularly cetaceans, has been reported worldwide (e.g.
Shapiro et al., 2018). The protozoan parasite has been detected
in Hector’s dolphins (Cephalorhynchus hectori) in New Zealand
(Roe et al., 2013), Guiana dolphins (Sotalia guianensis) and
T
ARTICLE
*Corresponding author
Email Address: mmobusan@up.edu.ph
Date received: September 5, 2020
Date revised: November 29, 2020
Date accepted: December 31, 2020

Vol. 13 | No. 02 | 2020 Philippine Science Letters
207
Amazon River dolphins (Inia geoffrensis) in Brazil (Santos et al.,
2011; Marigo et al., 2013), Mediterranean fin whale
(Balaenoptera physalus) and striped dolphins (Stenella
coeruleoalba) in Italian coasts (Guardo et al., 2010; Profeta et
al., 2015), and common bottlenose dolphins (Tursiops
truncatus) in the Eastern Mediterranean Sea (Bigal et al., 2018),
among others. It has also been detected in several cetaceans
(Stenella attenuata, Tursiops truncatus, T. aduncus, Kogia
breviceps, Grampus griseus, Lagenodelphis hosei, S.
longirostris, Globicephala macrorhynchus, S. coeruleoalba, and
Mesoplodon sp.) in the Philippines (Obusan et al., 2015; Obusan
et al., 2019). Toxoplasmosis in cetaceans has often been
considered a secondary disease, usually associated with
immunosuppression, encephalitis, and abortion in stranded
individuals (Grattarola et al., 2016; Mazzariol et al., 2012;
Resendes et al., 2002).
T. gondii is among the most widespread parasites due to its wide
range of host species and ability to be transmitted through
diverse routes (Jeffers et al., 2018). The definitive host of T.
gondii are cats and related wild felids that shed the unsporulated
oocysts, contaminating soils, water bodies, and food items
(Hanafi et al., 2014). The parasite has three infectious stages: the
tachyzoite which is the proliferative stage, the bradyzoite which
is found in tissues, and the sporozoite which is usually
transmitted to hosts in external environments. The presence of T.
gondii in marine mammal tissues presents a public health
concern, as widespread consumption of the meat of these
animals, especially in indigenous communities, provides an
additional route for zoonotic transmission (VanWormer et al.,
2013).
Toxoplasmosis can lead to serious illness and death especially
among immunocompromised patients, making T. gondii a
medically significant parasite. It causes birth defects as well as
neurological and ocular diseases (Maubon et al., 2008; Montoya
and Liesenfeld, 2004). Considering the extent of T. gondii
infections worldwide, toxoplasmosis qualifies as a One Health
disease, linking the health of domestic, terrestrial, and wildlife
animals and their ecosystems (Aguirre et al., 2019).
Under the One Health paradigm, marine mammals are
recognized as sentinels for indicating the health of the marine
environment (Bossart, 2011). Assessing the health status of
stranded cetaceans can provide valuable information for
evaluating the impacts of human activities including biological
pollution to their populations in the wild. A recent study
confirmed the land-sea connection in T. gondii infections
affecting southern sea otter population (Vanwormer et al., 2016).
Investigating the occurrence of T. gondii and other zoonotic
parasites in marine mammal species is crucial to understanding
the movement of pathogenic and potentially pathogenic
microorganisms in the marine environment.
Diagnostic techniques for T. gondii include molecular,
serological, and histological methods. Polymerase chain
reaction (PCR) is used to detect the genes of T. gondii, such as
B1 gene and RE gene. Serological tests to detect specific
antibody (IgG or IgM) against T. gondii is usually the initial and
primary method of diagnosis (Dubey, 2016). Histopathological
and immunohistochemistry techniques are also used to confirm
toxoplasmosis by detecting the presence of the parasite in host
tissues.
As part of cetacean health surveillance, this study generally
aimed to detect the presence of T. gondii in select cetaceans that
stranded in the Philippines from January to December 2019.
Specifically, the study aimed to detect T. gondii in cetacean
tissues through molecular method and find significant
association between the occurrence of T. gondii in cetacean
tissues and stranding event parameters such as stranding season
and cetacean sex and age. The 14-year marine mammal
stranding reports revealed increasing trend in the stranding
events of cetaceans in the Philippines (Aragones and Laggui,
2019; Aragones et al., 2017). These events are opportunities to
collect biological samples from local cetacean species, many of
which are pelagic and deep diving species.
MATERIALS AND METHODS
Collection of tissue samples from cetaceans
The collection of tissue samples from cetaceans that stranded in
the Philippines from January to December 2019 was done by the
research teams of Microbial Ecology of Terrestrial and Aquatic
Systems (METAS) Laboratory, Institute of Biology, and Marine
Mammal Research and Stranding (MMRS) Laboratory, Institute
of Environmental Science and Meteorology, University of the
Philippines Diliman in collaboration with the Philippine Marine
Mammal Stranding Network (PMMSN) and Bureau of Fisheries
and Aquatic Resources, Department of Agriculture (BFAR-DA).
When it is not possible for the researchers to go to the stranding
site, collaborating veterinarians who were trained in
microbiological sampling obtained and sent the specimens
(frozen or in ethanol or formalin) to the laboratory. Biological
specimens were collected based on animal disposition and
physical preservation code system for marine mammals (Geraci
and Lounsbury, 2005).
Molecular method for detecting T. gondii
DNA was extracted from cetacean tissues using a commercial
kit (Wizard® Genomic DNA Purification Kit) following
manufacturer’s instructions. Briefly, 300 µL of tissue sample
was transferred to 1.5 mL microcentrifuge tube and 900 µL of
cell lysis solution was added. The mixture was incubated for 10
minutes and centrifuged at 13,250 x g for 20 seconds. The
supernatant was discarded and 300 µL of nuclei lysis solution
was added together with 1.5 µL of RNAse and 100 µL of protein
precipitation solution. The solution was centrifuged in the same
manner and the supernatant was collected. Finally, 70% ethanol
was used to precipitate the DNA and stored with 100 µL DNA
rehydrating solution.
To detect the T. gondii RE gene, nested Polymerase Chain
Reaction (PCR) was performed using the primers (5′-
TGACTCGGGCCCAGCTGCGTCTCCTCCCTTCGTCCAA
GCCTCC-3’) targeting 529 bp for the first round of nested PCR
and primers (5′-
AGGGACAGAAGTCGAAGGGGGCAGCCAAGCCGGAAA
CATC -3’) targeting 164 bp for the second round of nested PCR
(Fallahi et al., 2014). The reaction mixture for first amplification
was prepared containing 5 µL Taq DNA Pol 2.0 Master Mix (Lot
No.5200300), 0.5 µL forward and 0.5 µL reverse primers, and
2.8 µL nucleotide free water at a final volume of 10 µL. For
second round PCR amplification, the reaction mixture contained
3.4 µL nuclease free water, 5 µL master mix, and 0.5 µL forward
and reverse primers. For amplification of RE gene (529 bp), the
PCR conditions were: initial denaturation for 5 minutes at 94 °C
followed by 30 cycles of denaturation for 20 seconds at 94 °C,
annealing for 20 seconds at 55 °C, extension for 20 seconds at
72 °C, and final extension for 5 minutes at 72 °C. For the second
round of amplification (164 bp), the conditions were: initial
denaturation for 5 minutes at 94 °C followed by 35 cycles of
denaturation for 20 seconds at 94 °C, annealing for 20 seconds
at 55 °C, extension for 20 seconds at 72 °C, and final extension
for 5 minutes at 72 °C.

Philippine Science Letters Vol. 13 | No. 02 | 2020
208
Table 1: Stranded cetaceans that were sampled for T. gondii. The PMMSN Code includes first letters of scientific names, latest count of stranding
for such species in the region, region, and date; these data are included in the PMMSN database of marine mammal strandings in the Philippines.
Sample
Code
PMMSN
Code Common Name Species Region
Collected
Date
Collected
(d/m/year)
Season Sex Age
S1 Pe01R11090
219 melon-headed whale Peponocephala
electra
XI 9/2/2019 NE F A
S2
Kb10R11120
219
pygmy sperm whale
Kogia breviceps
XI 12/2/2019 NE F A
S3
Sb05R20103
19
rough-toothed
dolphin
Steno bredanensis
II 1/3/2019 NE M A
S4
Be01R21003
19 Bryde's whale
Balaenoptera edeni
II 10/3/2019 NE M SA
S5
Zc01R11150
319
Cuvier's beaked
whale
Ziphius cavirostris
XI 15/3/2019 NE F A
S6
Fa01R81603
19
pygmy killer whale
Feresa attenuata
XIII 16/3/2019 NE M A
S7
Tt02R62703
19
common bottlenose
dolphin
Tursiops truncatus
VI 27/3/2019 NE M A
S8
Sa05R4A090
419
pantropical spotted
dolphin
Stenella attenuata
IV-A 9/4/2019 IMSW F SA
S9
Kb03R4A10
0419
pygmy sperm whale
Kogia breviceps
IV-A 10/4/2019 IMSW M A
S10
Gg03R31001
19
Risso's dolphin
Grampus griseus
III 10/1/2019 NE M A
S11
Gg04R4B09
0519
Risso's dolphin
Grampus griseus
IV-B 9/5/2019 IMSW M A
S12
Kb08R11105
19
pygmy sperm whale
Kogia breviceps
I 11/5/2019 IMSW F A
S13
Sb20R12005
19
rough-toothed
dolphin
Steno bredanensis
I
20/5/2019 IMSW M A
S14
Zc02R11300
719
Cuvier's beaked
whale
Ziphius cavirostris
XI 30/7/2019 SW F A
S15
Sa26R11311
19
pantropical spotted
dolphin
Stenella attenuata
II 13/11/2019 SW M C
S16
Pe06R80708
19
melon-headed whale
Peponocephala
electra
VIII 7/8/2019 SW M SA
S17
Gg04R4B09
0519
Risso's dolphin
Grampus griseus
IV-B
9/5/2019
SW
F
A
S18
Gm07R4B05
1119
short finned pilot
whale
Globicephala
macrorhynchus
IV-B
5/11/19
IMNE
M
A
S19
Lh02R13011
119
Fraser's dolphin
Lagenodelphis hosei
XIII
1/11/19
IMNE
*
A
Legend:
Season – NE (Northeast monsoon), SW (Southwest monsoon), IMNE (Inter-monsoon before Northeast), IMSW (Inter-monsoon before Southwest).
Sex – F (Female), M (Male), * (Undetermined). Age Group – A (Adult), SA (Sub adult), C (Calf), * (Undetermined)
PCR products were subjected to electrophoresis on 1.5%
agarose gel containing Gel-Red in TAE (Tris-acetate-EDTA)
buffer at 8 V/cm. Gels were viewed under Gel Doc Bio-Rad to
observe the target DNA bands.
Statistical analysis
Chi-square test was used to find significant association between
the presence of T. gondii RE gene in tissues of cetaceans and
their stranding parameters (i.e., cetacean sex, age group,
stranding season) using NTM SPSS Statistics 20.
RESULTS AND DISCUSSION
Profile of stranded cetaceans
A total of 19 select cetaceans (with codes S1-S19) that stranded
in the Philippines (Fig. 1) were sampled for detection of T.
gondii. Eleven of these cetaceans were males and seven were
females, while the sex of one individual was undetermined. The
sex of cetaceans is determined by observing the distance
between the anal and uro-genital openings (and presence of
mammary slits for females) found in the ventral section of the
animal, which is sometimes difficult to perform in some live
cases, thus the failure of responders to record the data in the field.
As for the age group of the cetaceans, 15 were adults, three were
sub-adults, and one was a calf (Table 1). All these individuals
were involved in single stranding events.
PCR analysis
Molecular detection targeting the T. gondii RE gene in brain,
cardiac, skeletal, kidney, liver, intestine, stomach, lung, and
blood tissues revealed four cetaceans have tissue/s positive for
the parasite: two pantropical spotted dolphins (S8, S15), one
pygmy sperm whale (S9), and one Cuvier’s beaked whale (S14).
Specifically, T. gondii was detected in brain tissues of S8, S9,
and S14, skeletal tissue of S9 (Fig. 2), lung tissue of S15, and
stomach tissue of S14 (Table 2). The presence of the parasite’s

Vol. 13 | No. 02 | 2020 Philippine Science Letters
209
genetic material may be associated with acute infection while its
presence in more than one tissue suggests disseminated
toxoplasmosis. However, further investigation is needed to
confirm these using other methods of detection such as
histopathology and antibody detection.
Overall, T. gondii was detected in 21% of 19 select cetaceans
that stranded during the year 2019. Previous studies reported the
local detection of the parasite in 71% of 28 cetaceans that
stranded from 2016-2018 (Obusan et al., 2019) and in 3% of 23
cetaceans that stranded from 2012-2013 (Obusan et al, 2015).
The differences in the prevalence could be due to the detection
Figure 1: Distribution map of stranded cetaceans sampled for the study.

Philippine Science Letters Vol. 13 | No. 02 | 2020
210
Table 2: Molecular detection of T. gondii targeting the RE gene.
Code Common
Name Scientific Name
Cetacean Tissues for T. gondii RE gene Detection
Brain Cardiac Kidney Skeletal Liver Intestine Lungs Stomach Blood
S1
melon-
headed
whale
Peponocephala
electra
- - - - * * * * *
S5
Cuvier's
beaked
whale
Ziphius
cavirostris
- - - - NT NT NT * *
S8
pantropical
spotted
dolphin
Stenella
attenuata
+ - - - NT * * * NT
S9 pygmy
sperm whale
Kogia breviceps
+ - NT + NT * * * NT
S14
Cuvier's
beaked
whale
Ziphius
cavirostris
+ NT NT - - - NT + *
S15
pantropical
spotted
dolphin
Stenella
attenuata * * NT * NT * + - *
Total number of tissues tested for T.gondii
RE gene
5 5 6 6 5 2 3 2 4
Legend: + positive for T. gondii DNA, - negative for T. gondii DNA, * no available biological sample, NT Not tested
techniques employed; the present study only used PCR while the
other studies used both PCR and serological assays.
Cetacean species with T. gondii
Species found to harbor T. gondii were pantropical spotted
dolphin (Stenella attenuata), pygmy sperm whale (Kogia
breviceps) and Cuvier’s beaked whale (Ziphius cavirostris). The
pantropical spotted dolphin is one of the most abundant dolphins
in the Eastern Tropical Pacific. They are mostly found offshore
but can be found close to the shore where deep water approaches
the coast (e.g., Hawaiian Islands, off Taiwan, and in the
Philippines). Those found offshore feed mainly on epi- and
meso-pelagic fishes, squid, and crustaceans, while those that
stay near shore are thought to feed on larger and tougher fishes
(Jefferson et al., 2008). Cuvier’s beaked whale is more
commonly found in deep-water and rarely nearshore. These
species can be found in waters more than 200 meters deep,
which they prefer for feeding (Heyning et al., 2009). The pygmy
sperm whale is known for uncommon sightings and also thrive
in deep waters with its diet consisting mainly of deep-water
cephalopods. In general, knowledge regarding the ecology and
behavior as well as other information about these species were
obtained from stranded specimens.
The habit of staying near-shore is purported to be a contributing
factor to the susceptibility of some cetacean species to T. gondii
infection. A recent study by Diaz-Delgado et al., (2020)
documented a case of acute systemic toxoplasmosis that caused
the demise of a Bryde’s whale stranded in Brazil. The source of
T. gondii infection in this particular animal is unknown, but
staying along the coastlines might have exposed it to pathogens
through land-based effluents. VanWormer et al. (2016) found
that watersheds characterized by higher level of coastal
development are associated with regions of increased incidence
of marine mammal infection by T. gondii. The occurrence of the
parasites in marine mammals indicates the extent of land based
biological pollution as well as impacts of anthropogenic changes
to regional watersheds (Shapiro et al., 2018). Interesting to note
here though that T. gondii was not detected in Risso’s and
common bottlenose dolphins. Both species are pelagic but are
known to wander near islands with deep waters.
Pantropical spotted dolphins and pygmy sperm whales were
reported in previous studies (Obusan et al., 2015; Obusan et al.,
2019) as among cetacean species in the Philippines found to
have T. gondii (Table 3). To the best knowledge of the authors,
the present study is the first to report the detection of the parasite
in a Cuvier’s beaked whale (Ziphius cavirostris). The species is
an addition to the growing list of deep offshore cetacean species
documented to have T. gondii, and supports the hypothesis that
the extent T. gondii infection has extended beyond coastlines
where pathogen run-off is likely. Furthermore, this suggests that
this parasite might be coupled in the complex food chains of the
oceans.
Transmission of T. gondii to marine mammals and potential
risks to humans
The widely accepted mode of transmission of T. gondii oocysts
from land to sea is through freshwater run-off. Native wild felids,
as well as introduced pet and un-owned or feral domestic cats,
have the potential to shed massive quantities of oocysts in
terrestrial and aquatic habitats (Alfonso et al., 2010). Freshwater
runoff carrying oocyst contaminated waters from felids feces
may explain T. gondii transmission into the marine environment
(Santos et al., 2011; Marigo et al., 2013; Vanwormer et al., 2013;
van de Velde et al., 2016). It has been demonstrated that T.
gondii oocyst can sporulate and remain infectious in seawater
for two years at 4°C and for half-year at room temperature
(Lindsay and Dubey, 2009).
Another mechanism of T. gondii transmission is through
consumption of prey. Prey species of marine mammals such as
anchovies, sardines, and bivalves were found to harbor viable T.
gondii oocysts and have the potential to incorporate T. gondii in
the marine food web (Massie et al., 2010). The decline in the
population of southern sea otters in California (Miller et al.,
2008) was linked to widespread infection of T. gondii facilitated
by the consumption of prey species that harbor the parasite.
Figure 2: Molecular detection of T. gondii DNA in skeletal tissue
of cetaceans (ML molecular ladder, + positive control,
-
negative
control).

Vol. 13 | No. 02 | 2020 Philippine Science Letters
211
The prevalence of T. gondii among wild animals including
cetaceans, is a public health concern. Consumption of meat with
T. gondii cysts remains to be a risk factor for humans, as oral
route is considered a major source of T. gondii infection
(Montoya and Liesenfeld, 2004). Out of 25 toxoplasmosis
outbreaks reported, 24% (6/25) were associated with ingestion
of tissue cysts from undercooked or raw meat in Brazil (Ferreira
et al., 2018). In the Philippines, existing laws such as Republic
Acts 8550 and 9147, and Fisheries Administrative Order No.
185, prohibit the trade and consumption of marine mammal meat.
However, the risk remains since there are reports that illegal
hunting and selling of cetacean meat exists in remote areas (pers
comm., BFAR Region V) and the meat of stranded cetaceans
may be consumed (Reyes, 2019).
The occurrence of T. gondii in marine mammals indicates the
extent of land-based biological pollution as well as
anthropogenic impacts to watersheds (Shapiro et al., 2018). The
prevalence of the parasite among cetaceans suggests that
toxoplasmosis may be circulating among marine life, including
species that are directly associated to humans. Only in recent
years have scientists shed light on the potential role of seafood
consumption in the transmission of T. gondii (Esmerini et al.,
2010; Marino et al., 2019). Studies involving the detection of T.
gondii oocysts in local seafood such as mussels oysters, and
fishes (as mechanical vectors) may help provide the link
between the presence of this parasite in cetaceans and possible
sources of infection.
Association of cetacean stranding parameters and T. gondii
detection
Chi square test of association between the presence of T. gondii
RE gene and stranding parameters yielded a p-value of 0.465 for
gender, 0.135 for stranding season, and 0.102 for age group of
cetaceans (α=0.05).
Shapiro et al., (2018) identified the risk factors for marine
mammals associated with T. gondii infection, and these include
diet, age, sex, location. The present study found no significant
association between the detection of T. gondii RE gene and
stranding parameters (cetacean sex, age group, stranding season).
However, the present finding is limited to the number of
cetaceans that were responded in one year. For finding
significant associations, a long-term study involving more
cetacean species is recommended. Previous studies elsewhere
reported a significant association between the detection or
infection of T. gondii and biological characteristics of marine
mammal species. The prime aged adult Californian sea otters,
where T. gondii in marine mammals was first detected, are said
to be more susceptible to infection compared to juvenile otters
(Kreuder et al., 2003). The same study also reported that male
marine mammals have higher likelihood of exposure to parasites
such as T. gondii, due to larger body mass and caloric demand.
In terms of seasons, it is hypothesized that increased rainfall puts
marine mammals at a higher risk since runoff of oocysts is very
likely (Shapiro et al., 2018).
For future studies, we recommend the concurrent use of other
methods to corroborate the detection of T. gondii by PCR in
cetaceans. For example, avidity test and/or Enzyme Linked
Immunosorbent Assay (ELISA) may be used to detect IgA while
immunohistochemistry staining may be used to detect the
parasites’ cysts in tissues. A combination of detection methods
is needed to confirm acute or chronic infection as well as
disseminated toxoplasmosis in stranded cetaceans and their
counterparts in the wild.
In cases wherein necropsy is conducted as part of the cetacean
stranding response, documentation of clinical manifestations in
relation to toxoplasmosis such as meningoencephalitis, should
be done to substantiate the results of detection assays. Other
tissues should be collected and tested. Moreover, the
determination of the specific genotype of T. gondii circulating
among local cetaceans is recommended to further characterize
the nature of infection in marine wildlife.
CONCLUSION
The study investigated the prevalence of T. gondii in select
cetaceans that stranded in the Philippines in 2019. Three species
of cetaceans (Kogia breviceps, Stenella attenuata, and Ziphius
cavirostris), represented by four stranded individuals, tested
positive for T. gondii RE gene through molecular detection by
Common name Species
Obusan et al.,
(2015) study
Obusan et al.,
(2019) study
This study
pygmy sperm whale
Kogia breviceps
+
+
+
pantropical spotted dolphin
Stenella attenuata
+
+
+
beaked whale
Mesoplodon sp.
+
*
*
Indopacific bottlenose dolphin
Tursiops aduncus
*
*
Risso's dolphin
Grampus griseus
*
+
-
Fraser's dolphin
Lagenodelphis
hosei
*
+
-
spinner dolphin
Stenella
longirostris
-
+
*
melon headed whale
Peponocephala
electra
*
+
-
striped dolphin
Stenella
coeruleoalba
*
+
*
Bryde's whale
Balaenoptera edeni
*
+
-
rough toothed dolphin
Steno bredanensis
-
+
-
Cuvier's beaked whale
Ziphius cavirostris
*
*
+
short finned pilot whale
Globicephala
macrorhynchus
-
+
-
Legend: + detected T. gondii, - did not detect T. gondii, * no available/qualified biological sample
Table 3: T. gondii detection in cetacean species of the Philippines.

Philippine Science Letters Vol. 13 | No. 02 | 2020
212
nested PCR. As cetaceans are difficult to observe and sample,
the information generated from the stranded individuals indicate
the health status of their wild populations which are facing the
impacts of anthropogenic activities such as land-sea movement
of biological pollutants.
ACKNOWLEDGMENTS
The authors thank the Philippine Marine Mammal Stranding
Network (PMMSN) and the Bureau of Fisheries and Aquatic
Resources (BFAR) for the invaluable assistance in the
nationwide cetacean stranding response. Likewise, the authors
express their gratitude to Dr. Gil M. Penuliar for the review of
the manuscript. The Office of the Vice Chancellor for Research
and Development (OVCRD) of the University of the Philippines
Diliman provided support through project grants 171704SOS
(for sampling) and (191930 PhDIA) for laboratory work.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
CONTRIBUTION OF INDIVIDUAL AUTHORS
RJCDG, LVA, and MCMO designed the methodology. LVA led
the cetacean stranding response. LVA and MCMO received
funding for the study. MCMO and RJCDG performed the
laboratory procedures. MCMO, LVA and RJCDG collated and
analyzed all the data, interpreted the results, and prepared the
manuscript. All authors have read and approved the final version
of the manuscript.
REFERENCES
Aguirre AA, Longcore T, Barbieri M, Dabritz H, Hill D, Klein
PN, Lepczyk C, Lilly EL, McLeod R, Milcarsky J, Murphy
CE, Su C, VanWormer E, Yolken R, Sizemore GC. The One
Health Approach to Toxoplasmosis: Epidemiology, Control,
and Prevention Strategies. Ecohealth 2019; 16(2):378–390.
Alfonso E, Thulliez P, Gilot-Fromont E. Local meteorological
conditions, dynamics of seroconversion to Toxoplasma gondii
in cats (Felis catus) and oocyst burden in a rural
environment. Epidemiol Infect 2010; 138(8): 1105-1113.
Aragones LV, Laggui HLM. Marine Mammal Strandings in the
Philippines from 2017 to 2018: Initial Biennial Analysis 2019.
PMMSN Technical Report No. 2. www.pmmsn.org
Aragones LV, Laggui HL, Amor AK. The Philippine Marine
Mammal Strandings from 2005 to 2016. A PMMSN
Publication. Technical Report No. 1 (Issue February) 2017.
Bigal E, Morick D, Scheinin AP, Salant H, Berkowitz A, King
R, Levy Y, Melero M, Sánchez-Vizcaíno JM, Goffman O,
Hadar N, Roditi-Elasar M, Tchernov D. Detection of
Toxoplasma gondii in three common bottlenose dolphins
(Tursiops truncatus); A first description from the Eastern
Mediterranean Sea. Vet Parasitol 2018; 258:74–78.
Bossart GD. Marine mammals as sentinel species for oceans and
human health. Vet Pathol 2011; 48(3):676–690.
Díaz-Delgado J, Groch KR, Ramos HG, Colosio AC, Alves BF,
Pena HF, Catão-Dias JL. Fatal Systemic Toxoplasmosis by a
Novel Non-archetypal Toxoplasma gondii in a Bryde’s Whale
(Balaenoptera edeni). Front Mar Sci 2020.
Dubey JP. Transmission of Toxoplasma gondii — From land to
sea , a personal perspective The scientific scene in 1960 and
significance of the quoted paper. 2016.
Esmerini PO, Gennari SM, Pena HFJ. Analysis of marine
bivalve shellfish from the fish market in Santos city, São Paulo
state, Brazil, for Toxoplasma gondii. Vet Parasitol 2010;
170(1–2):8–13.
Fallahi S, Kazemi B, Seyyed tabaei SJ, Bandehpour M, Lasjerdi
Z, Taghipour N, Zebardast N, Nikmanesh B, Omrani VF,
Ebrahimzadeh F. Comparison of the RE and B1 gene for
detection of Toxoplasma gondii infection in children with
cancer. Parasitol Int 2014; 63(1):37–41.
Ferreira FP, Caldart ET, Freire RL, Mitsuka-Breganó R, de
Freitas FM, Miura AC, Mareze M, Martins FDC, Urbano MR,
Seifert AL, Navarro IT. The effect of water source and soil
supplementation on parasite contamination in organic
vegetable gardens. Rev Bras Parasitol Vet 2018; 27(3):327–
337.
Geraci, J. R., & Lounsbury, V. J. (Eds.). (2005). Marine
mammals ashore: A field guide for strandings (2nd ed.).
College Station: Texas A&M University Sea Grant College
Program.
Grattarola C, Giorda F, Iulini B, Pintore MD, Pautasso A, Zoppi
S, Goria M, Romano A, Peletto S, Varello K, Garibaldi F,
Garofolo G, Di Francesco CE, Marsili L, Bozzetta E, Di
Guardo G, Dondo A, Mignone W, Casalone C.
Meningoencephalitis and Listeria monocytogenes,
Toxoplasma gondii and Brucella spp. coinfection in a dolphin
in Italy. Dis Aquat Organ 2016; 118(2):169–174.
Guardo G, Proietto U, Di Francesco CE, Marsilio F, Zaccaroni
A, Scaravelli D, Mignone W, Garibaldi F, Kennedy S, Forster
F, Iulini B, Bozzetta E, Casalone C. Cerebral toxoplasmosis in
striped dolphins (Stenella coeruleoalba) stranded along the
ligurian sea coast of Italy. Vet Pathol 2010; 47(2):245–253.
Hanafi EM, Ozkan AT, Bowman DD. Protozoa: Toxoplasma
gondii. Encycl Food Saf Academic Press 2014; 2: 54-62.
Heyning JE, Mead JG. Cuvier's Beaked Whale: Ziphius
cavirostris. Encycl Mar Mamm 2009; 294-295.
Jeffers V, Tampaki Z, Kim K, Sullivan WJ. A latent ability to
persist: differentiation in Toxoplasma gondii. Cell Mol Life
Sci 2018; 75 (13): 2355-2373.
Jefferson T, Webber MA, Pitman RL. Mar. Mamm. World A
Compr. Guid. to Their Identif. Elsevier 2008.
Kreuder C, Miller MA, Jessup DA, Lowenstine LJ, Harris MD,
Ames JA, Carpenter TE, Conrad PA, Mazet JAK. Patterns of
mortality in Southern sea otters (Enhydra lutris nereis) from
1998-2001. J Wildl Dis 2003; 39(3):495–509.
Lindsay DS, Dubey JP. Long-Term Survival of Toxoplasma
gondii Sporulated Oocysts in Seawater. J Parasitol 2009;
95(4):1019–1020.
Marino AMF, Giunta RP, Salvaggio A, Castello A, Alfonzetti T,
Barbagallo A, Aparo A, Scalzo F, Reale S, Buffolano W,
Percipalle M. Toxoplasma gondii in edible fishes captured in

Vol. 13 | No. 02 | 2020 Philippine Science Letters
213
the Mediterranean basin. Zoonoses Public Health 2019;
66(7):826–834.
Marigo J, Gonzales-Viera O, Ruoppolo V, Rosas FCW,
Kanamura CT, Takakura C, Fernández A, Catão-Dias JL.
Toxoplasmosis in a Guiana dolphin (Sotalia guianensis) from
Paraná, Brazil. Vet Parasitol 2013; 191(3–4):358–362.
Massie GN, Ware MW, Villegas EN, Black MW. Uptake and
transmission of Toxoplasma gondii oocysts by migratory,
filter-feeding fish. Vet Parasitol 2010; 169(3–4):296–303.
Maubon D, Ajzenberg D, Brenier-Pinchart MP, Dardé ML,
Pelloux H. What are the respective host and parasite
contributions to toxoplasmosis? Trends Parasitol. 2008;
24(7):299–303.
Mazzariol S, Marcer F, Mignone W, Serracca L, Goria M,
Marsili L, Di Guardo G, Casalone C. Dolphin Morbillivirus
and Toxoplasma gondii coinfection in a Mediterranean fin
whale (Balaenoptera physalus). BMC Vet Res 2012; 8(1):20.
Miller M, Conrad P, James ER, Packham A, Toy-Choutka S,
Murray MJ, Jessup D, Grigg M. Transplacental toxoplasmosis
in a wild southern sea otter (Enhydra lutris nereis). Vet
Parasitol 2008; 153(1–2):12–18.
Montoya JG, Liesenfeld O. Toxoplasmosis. Lancet 2004;
363(9425):1965–1976.
Obusan MCM, Aragones LV, Salibay CC, Siringan, MAT,
Rivera, WL. Occurrence of human pathogenic bacteria and
Toxoplasma gondii in cetaceans stranded in the Philippines:
providing clues on ocean health status. Aquat Mamm
2015; 41(2): 149.
Obusan MCM, Villanueva RMD, Siringan MAT, Rivera WL,
Aragones LV. Leptospira spp. and Toxoplasma gondii in
stranded representatives of wild cetaceans in the
Philippines. BMC Vet Res 2019; 15(1): 372.
Profeta F, Di Francesco CE, Marsilio F, Mignone W, Di Nocera
F, De Carlo E, Lucifora G, Pietroluongo G, Baffoni M,
Cocumelli C, Eleni C, Terracciano G, Ferri N, Di Francesco
G, Casalone C, Pautasso A, Mazzariol S, Centelleghe C, Di
Guardo G. Retrospective seroepidemiological investigations
against Morbillivirus, Toxoplasma gondii and Brucella spp. in
cetaceans stranded along the Italian coastline (1998-2014).
Res Vet Sci 2015; 101:89–92.
Resendes AR, Almería S, Dubey JP, Obón E, Juan-Sallés C,
Degollada E, Alegre F, Cabezón O, Pont S, Domingo M.
Disseminated Toxoplasmosis in a Mediterranean Pregnant
Risso’s Dolphin (Grampus griseus) with Transplacental Fetal
Infection. J Parasitol 2002; 88(5):1029–1032.
Reyes R.Stranded dolphin speared, killed in Northern Samar.
Sun Star Tacloban 2019.
Roe WD, Howe L, Baker EJ, Burrows L, Hunter SA. An atypical
genotype of Toxoplasma gondii as a cause of mortality in
Hector’s dolphins (Cephalorhynchus hectori). Vet Parasitol
2013; 192(1–3):67–74.
Santos PS, Albuquerque GR, da Silva VMF, Martin AR,
Marvulo MFV, Souza SLP, Ragozo AMA, Nascimento CC,
Gennari SM, Dubey JP, Silva JCR. Seroprevalence of
Toxoplasma gondii in free-living Amazon River dolphins
(Inia geoffrensis) from central Amazon, Brazil. Vet Parasitol
2011; 183(1–2):171–173.
Shapiro K, Murray MJ, Miller MA, Haulena M. Protozoan
parasites of marine mammals. CRC Handb Mar mammal Med
Mar mammal Med 2018; 3: 425-470.
van de Velde N, Devleesschauwer B, Leopold M, Begeman L,
IJsseldijk L, Hiemstra S, IJzer J, Brownlow A, Davison N,
Haelters J, Jauniaux T, Siebert U, Dorny P, De Craeye S.
Toxoplasma gondii in stranded marine mammals from the
North Sea and Eastern Atlantic Ocean: Findings and
diagnostic difficulties. Vet Parasitol 2016; 230:25–32.
VanWormer E, Carpenter TE, Singh P, Shapiro K, Wallender
WW, Conrad PA, Largier JL, Maneta MP, Mazet JAK.
Coastal development and precipitation drive pathogen flow
from land to sea: Evidence from a Toxoplasma gondii and felid
host system. Sci Rep 2016; 6.
VanWormer E, Fritz H, Shapiro K, Mazet JAK, Conrad PA.
Molecules to modeling: Toxoplasma gondii oocysts at the
human-animal-environment interface. Comp Immunol
Microbiol Infect Dis 2013;6(3).