ArticlePDF Available

Promising Preclinical Data to a Possible Antidiabetic Drug

Authors:
  • Collage of pharmacy /Mustansiriyah
  • College of Pharmacy/Mustansiriyah University

Abstract and Figures

Purpose: Current studies propose that SIRT1 activating compounds are a promising class of anti-diabetic drugs, while their mechanism of action remains elusive. The main goal of this study is to determine the role of SIRT1 aptamer, a selective activator of SIRT1, as a potential therapy for type 2 diabetes mellitus. Experimental design: Using in vivo (animal experiments) approach, the role of SIRT1 agonists (SIRT1 aptamer) as antidiabetic agent in diabetic rats (pre-treatment with 160mg/kg intraperitoneal injection of alloxan) was studied. Blood glucose level and SIRT1 activity was assessed after treating the rats with different concentrations of SIRT1 aptamer (12.5, 25 and 50µM) at 24hr, 48hr and 8 days. Results: Results showed that the increase of glucose level in diabetic rats was greatly abrogated by exposing the rats to 50 µM of SIRT1 aptamer, and this type of SIRT1 agonist can activate in particularly of SIRT1 activity more than twice its value compared with 200µM Resveratrol. Conclusions: Taken both our results detect an essential role for SIRT1 aptamer to activate SIRT1 enzyme and controlled the glucose level in vivo. SIRT1 aptamer could therefore be a promising therapeutic strategy to treat type 2 diabetes mellitus. Abbreviation: T2DM, type 2 diabetes mellitus; SIRT1, Sirtuin type 1;Apt; aptamer PGC-1α, peroxisome proliferator-activated receptor-γ coactivator-1α; FOXO, forkhead box O;RSV, Resveratrol.
Content may be subject to copyright.
2737| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
Research Article
Promising Preclinical Data to a Possible Antidiabetic
Drug
RUSUL AHMED TARIQ1, BASMA TALIB AL-SUDANI2, INAM SAMEH ARIF *1
1 College of Pharmacy, Department of Pharmacology & Toxicology, Mustansiriyah University, Iraq,
2 College of Pharmacy, Department of Clinical Laboratory Sciences, Mustansiriyah University, Iraq
*Corresponding Author
Email ID: pharm.dr.isamalhaj@uomustansiriyah.edu.iq
Received: 26.07.20, Revised: 02.08.20, Accepted:15.09.20
ABSTRACT:
Purpose: Current studies propose that SIRT1 activating compounds are a promising class of anti-diabetic
drugs, while their mechanism of action remains elusive. The main goal of this study is to determine the role of
SIRT1 aptamer, a selective activator of SIRT1, as a potential therapy for type 2 diabetes mellitus.
Experimental design: Using in vivo (animal experiments) approach, the role of SIRT1 agonists (SIRT1
aptamer) as antidiabetic agent in diabetic rats (pre-treatment with 160mg/kg intraperitoneal injection of
alloxan) was studied. Blood glucose level and SIRT1 activity was assessed after treating the rats with different
concentrations of SIRT1 aptamer (12.5, 25 and 50µM) at 24hr, 48hr and 8 days.
Results: Results showed that the increase of glucose level in diabetic rats was greatly abrogated by exposing
the rats to 50 µM of SIRT1 aptamer, and this type of SIRT1 agonist can activate in particularly of SIRT1 activity
more than twice its value compared with 200µM Resveratrol.
Conclusions: Taken both our results detect an essential role for SIRT1 aptamer to activate SIRT1 enzyme
and controlled the glucose level in vivo. SIRT1 aptamer could therefore be a promising therapeutic strategy to
treat type 2 diabetes mellitus.
Abbreviation: T2DM, type 2 diabetes mellitus; SIRT1, Sirtuin type 1;Apt; aptamer PGC-1α, peroxisome
proliferator-activated receptor-γ coactivator-1α; FOXO, forkhead box O;RSV, Resveratrol.
Keywords: SIRT1 activity, Resveratrol, T2DM.
INTRODUCTION
More than 400 million persons about the world
be affected by a disease called type 2 diabetes
mellitus (T2DM). On the other hand, there will be
in excess of 640 million individuals with diabetes
worldwide in 2040. (1) To reach good metabolic
control in diabetes and keep extended period, a
combination of alterations in lifestyle and
pharmacological treatment is essential. For that
reason, novel therapeutic approaches are
necessary to prevent T2DM (2). Aptamer are
oligonucleotides, like single-strand ribonucleic
acid (RNA) and deoxyribonucleic acid (ssDNA) or
peptide molecules that have ability to bind to their
targets together with high specificity and affinity
as a result of their specific three-dimensional
structures (3). Actually, aptamer was known as
biochemical antibodies because of numerous of
the following benefits: high affinity (4, 5), solubility
and specificity (6, 7), high reproducibility, ease of
chemical modifications (8, 9), low-toxic (10, 11) and
low prices for mass production. (12, 13)
consequently, Al-Sudani et al has been reported
about the first discover for an aptamer which can
activator of SIRT1 (14). Researcher used this type of
aptamer to alleviate the injurious special effects of
T2DM in vitro experimentations by different
mechanisms (15). These mechanisms range from
the reduction of blood glucose concentration by
the restoration of abnormal insulin signalling
pathways by SIRT1 aptamer which can up
regulation of expression of genes like SIRT1,
FOXO, INS, and PCG-1 α. The main substrates of
SIRT1 involved FOXO, PGC-1α. Furthermore,
SIRT1 is expectant a promising future in the
pharmacological therapeutic target so as to treat-
ment of insulin-resistance and following T2DM
(16). In many studies proposed that SIRT1 have
capability to contribute in the organization of
insulin excretion from pancreatic β-cells (16). SIRT1
might contribute in the control of glucose
homeostasis within the subsequent mechanisms:
adjustment insulin secretion (17) as well as
protecting pancreatic β-cells (18) improved insulin
resistance as a result of the adjustment of post
insulin receptor signalling; reducing lipid
mobilization, inflammation, and adiponectin
secretion (19) controlling mitochondrial biogenesis
and fatty acid oxidation (20,21) and regulating
circadian rhythms and hepatic glucose production
ISSN 0975-2366
DOI:https://doi.org/10.31838/ijpr/2020.12.04.378
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2738| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
skeletal muscle, monocytes/macrophages,
adipose tissue and the liver (22) . The chief
objective of this study is to determine the function
of SIRT1 aptamer, a selective activator of SIRT1,
as a potential therapy for type 2 diabetes mellitus.
It has been proved in this research at the first time
in vivo study, that 50 µM SIRT1 aptamer was
significantly might prevent T2DM in animal model
via elevated the activity of SIRT1 and controlled
the level of blood glucose. On the other hand, the
different mechanism of actions of SIRT1 aptamer
in vitro and in animals linked with the described
health assistances in type2DM humans had better
be a driving force for showing clinical
investigation. The time is suitable to board on
large, well-controlled clinical studies to indorse
the efficacy of SIRT1 in the administration of
diabetes mellitus and improvement a well vision
into its biological special effects in humans.
Additionally, the effective doses of SIRT1 aptamer
and treatment period might vary among pre-
emptive and therapeutic trials. For that reason, it
is essential to examine the dose dependent effects
at variable treatment times. A combinational
method in addition to enhanced designs of SIRT1
aptamer might assistance to overwhelm the
challenge of maintaining an effective
concentration at the site of action for a suitable
period. By taking into consideration the above-
mentioned influences limiting clinical usefulness
of SIRT1 aptamer in consequent studies, we may
be able to use SIRT1 aptamer to treat or avoid
diabetes mellitus in individuals in the nearest
future.
METHODS
Animals
A total of 32 adults male Wister rats (79 weeks
old) weighting (165-220) gm were used in this
research. Rats were obtained from the animal
house of (Ministry of health /National centre for
drug control and research). Animals were placed
in animal house at (Department of Pharmacology
& Toxicology, College of Pharmacy- Mustansiriya
University). Animals were kept in plastic cages
with dimension (20×25×35 cm) that harbour
four rats, animals inside similar cage were
distinguished by back bone fur coloration by
water impermeable colour marker. Prior the
starting of the study protocol, the animals were
kept at 24±1°C with 4050% moisture in a
hygienic environment with a 12h light & dark
cycle for 10 days under controlled condition and
all animals were free access to pellet and purify
water. Agreement of the Ethical Comity of the
College of Pharmacy-Mustansiriya University was
achieved.
Groups and sample preparation
The animals were administered 160mg/kg
intraperitoneal injection of alloxan (23) (Lonza).
Alloxan was dissolved in purified water (Thermo
Scientific, USA) and always prepared freshly for
direct utilization within 5 min in a dark room. (24)
72h after alloxan injection blood glucose level
was checked for each rat starved overnight.
Glucometer (ACCU-CHECK) (Switzerland) (25) was
applied for measuring fasting blood glucose (tail
vein rat). Rats with hyperglycemia (random blood
glucose 200 mg/dl) selected as animals with
hyperglycaemia for use in this study. Animals
were divided into 8 groups and each group
contain 4 animals as shown in figure 1: Group 1
(control): Rats were administered normal saline
IM. Group 2 (Diabetic group): Rats were
administered IP injection of alloxan 160 mg/kg.
Group 3: Diabetic group treated with IM injection
of 12.5 µM aptamer. Group 4: Diabetic group
treated with IM injection of 25 µM aptamer.
Group 5: Diabetic group treated with IM injection
of 50 µM aptamer. Group 6: Diabetic group
treated with IM injection of 50µM resveratrol.
Group 7: Diabetic group treated with IM injection
of 100µM resveratrol. Group 8: Diabetic group
treated with IM injection of 200µM resveratrol.
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2739| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
Fig.1: Animal experiment design.
In order to collect blood samples from all groups
above, a hygienic and sterile cotton ball (Lonza)
was saturated in chloroform (Sigma-Aldrich Ltd )
and kept with the rat inside a desiccator with a
firmly closed lid for 2 to 3 min until the rat loses
the ability to move, then blood samples were
obtained directly from the retro-orbital centre.
(26)The retro-orbital centre technique was used to
collected blood via utilizing heparinized capillary
tubes (Takara, Japan ) as show figure 2 .The
blood samples obtained from retro-orbital centre
for each rat before induction and after induction
and after treatment; 24h, 48h and 8 days.
Samples saved into a tubes having gel (Takara,
Japan) as showed in figure 3, then blood left to
clot at room temperature for 2h. Afterward
centrifugation for 10 min at 3000 rpm and 4°C,
bring out the serum and aliquot in sterilized tubes
and kept in deep freezer at (-20 °C) for assessing
the activity of SIRT1 before and after induction
and treatment with SIRT1 aptamer (5'-
CGGACTGCAACCTATGCTATCGTTGATGTCTGT
CCAAGCA-3') (Bonier-Korea).
Fig.2: Collected blood sample from Retro-orbital centre.
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2740| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
Fig.3: Gel tube contain a separated serum that was centrifuged at 3000 rpm for 10 min.
Determination of blood glucose in vivo
Fasting blood glucose levels were checked by
glucometer (ACCU-CHECK) for each rat before
and after induction and after treatment; 24h, 48h
and 8 days. This process was implemented in
awake rats with appropriate manual hold; the rat
was caught in horizontal situation with its tail
pulled and cleaned with antiseptic spirit,
subsequently few seconds scratching the tail s vein
with Accu-check tip pen lancets (Switzerland) then
a drop of blood was added on the strip that
situated in Accu-check glucometer to measure
fasting blood glucose as shown in figure 4.
Fig.4: Measurement blood glucose from rats' tail vein.
Assessment of SIRT1 enzyme activity in vivo
SIRT1 activity was measured using a sandwich
enzyme immunoassay Rat SIRT1 ELISA Kit
(MyBioSource Inc. USA). All reagents and samples
were remained at room temperature (18-25oC)
before used. In this technique; the antigen was
allowed to bind to a definite antibody (primary
antibody) which was consecutively recognized by
a secondary enzyme-linked antibody. Serum
samples were mixed with specific substrates and
established at room temperature. SIRT1 activity
was measured using a fluorometric micro plate
reader at 340/440 nm. The procedure of Rat
SIRT1 activity by ELISA assessment was done
according to the procedure of manufacturing
company. Briefly, the 37 well plate was prepared
for 8 wells of the standards as figure below, 2
well for blank, 27 wells for samples.
Tube 1 2 3 4 5 6 7 8
ng/ml 50 25 12.5 6.25 3.12 1.56 0.781 0
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2741| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
100μl of samples were added into the
appropriate wells. The Plate covered and
incubated for 2h at 37oC, then removed the liquid
from each well. Detection reagent (100μl working
solution) was added to each well, then incubated
for 1h at 37oC after covering it. The solution was
aspirated and washed with 350μl of 1x wash
solution to each well by a squirt bottle, multi-
channel pipette, manifold dispenser or auto-
washer, and stayed for 1-2 min. Then washed
process was repeated for 5 times. The remaining
liquid was removed from all wells completely by
tapping the plate onto absorbent paper, then
washed the well carefully 3 times. Subsequently
the last wash, any remaining wash buffer was
detached by aspirating. Reverse the plate and blot
it against absorbent paper. Detection reagent
(100μl working solution) was added to each well,
then well plate incubated for 1h at 37oC after
covered it. 90μl of substrate solution was added
to each well, then covered with a new plate sealer
and incubated for 15-25 min at 37oC, the colour
converted blue.50μl of stop solution was added to
each well, the colour converted yellow. Remove
any drops of water and finger prints on the
bottom of the plate and any bubbles on the
surface of the liquid. The absorbance measured
by micro plate reader at 450nm immediately.
Statistical analysis
All statistical analyses were performed using SPSS
19. All results are presented as the mean ±
standard error of the mean (SEM). Significant
differences in mean values were evaluated using
one-way analysis of variance with Tukey's post
hoc test. P<0.05 was considered to indicate a
statistically significant difference.
RESULTS:
Determination of blood glucose level in vivo
after treatment with different concentrations of
aptamer and resveratrol
As shown in figure 5, the levels of blood glucose
were significantly increased in the alloxan -
induced diabetic as compared with the normal
control group p< 0.0005. The results in figure 5
demonstrated significant decrease in the level of
blood glucose after treatment with 50µM aptamer
at 24h as compared with the other concentration
25 and 12.5 µM aptamer and other times 48h
and 8 days, p<0.0001. The results also
demonstrated that 25 µM of aptamer can inhibit
the level of glucose better than 200 µM
resveratrol at 24hr, p< 0.05, figure 5. Finally,
these statistics advocated that aptamer at 50 µM
was the best dose significantly improved the level
of blood glucose as compared with other dose of
SIRT1 aptamer and resveratrol (27).
Fig.5: In vivo; blood glucose level: Group 1 (control), Group 2 (Diabetic), Group 3 diabetic rats
(after 24h treatment with 12.5, 25, and 50µM aptamer and 50,100,200µM resveratrol), Group 4
diabetic rats (after 48h treated with 12.5, 25, and 50µM aptamer and 50,100,200µM resveratrol),
Group 5 diabetic rats (after 8 days treated with 12.5, 25, and 50µM aptamer and 50,100,200µM
resveratrol). Representing of the results as mean ± SEM. P< 0. 05.
Assessment of the activity of SIRT1 enzyme in
vivo
In this experiment, SIRT1 activity was markedly
increased in serum of animals treated with 50µM
aptamer as compared with control (the level of
SIRT1 in serum animals were administered
normal saline orally for 30 days), p< 0.0001 as
well as diabetic group, p< 0.0005. Figure 6
demonstrate the standard curve for SIRT1 ELISA.
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2742| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
Fig.6: Standard curve of SIRT1 ELISA, the Conc. were 50, 25, 12.5, 6.25, 3.12, 1.56 and 0.781.
As it can be seen in figure 7 the 50µM of aptamer elevated the SIRT1 activity more than twice its
value as compared with 200µM Resveratrol, p< 0.005.
Fig.7: In vivo, SIRT1 activity in control (rats received normal saline only), 50 µM aptamer & 200
µM resveratrol treated diabetic rats. The results represent the mean ± SEM of three different
experiments performed in triplicate. P ˂ 0.0005.
Discussion
Our results well discovered that 25 µM of SIRT
aptamer decreases blood glucose levels in
animals with experimental type 2 diabetes better
than 200 µM of resveratrol at 24h, p< 0.05. The
blood glucose-lowering effect of SIRT1 aptamer
was found in rats with diabetes induced through
alloxan. In animal models, in order to destroy
pancreatic β-cells, alloxan is used and thereby
induces insulin-deficient diabetes. On the other
hand, the β-cells of animals that exposed to
alloxan induction, DNA undergo disintegration
and mending mechanisms are activated (28). The
fundamental role in DNA repair is credited to
poly (ADP-ribose) polymerase-1 (PARP-1). This
enzyme be able to catalyses the synthesis of poly
(ADP-ribose) from NAD+ and its action is
frequently useful to the cell. On the other hand, in
the case of widespread DNA damage, an
overstated action of PARP-1 leads to exhaustion of
intracellular NAD+ and ATP, and β-cells suffer
necrosis (28).As a result, animals with alloxan
induced diabetes are considered via extensive
high blood glucose. In alloxan-induced model,
elevated blood glucose, acting through
suppression of PARP-1 and delivery of NAD+,
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2743| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
partly keeps β-cells against alloxan and blood
glucose levels are temperately raised (29). In this
study, linear BAS aptamer was capable of
reducing blood glucose levels in animals with
moderate diabetes. It is identified that diabetes in
animals outcomes from the rise in hepatic glucose
output and from the reduction in peripheral
glucose use (29). Individually these procedures are
controlled by insulin, and the increase in insulin
excretion in diabetic subjects decreases blood
glucose levels. The probable explanation of the
anti-diabetic effect of SIRT1 aptamer in results as
shown in figure 5 may be from the increase in
blood insulin levels as research had been
reported the elevated INS gene level in the INS-1
832/13 HF rat insulinoma cell lines which treated
with 10µM SIRT1 aptamer (15 ). Also, the other
probability is the suppression of hepatic glucose
output and the rise in peripheral glucose
utilization. To further verify that SIRT1 aptamer
had significant effects on SIRT1 activity to make it
an attractive applicant for pharmacological
targeting, the outcomes of an in vivo study
showed that 50 µM SIRT1 aptamer increases
SIRT1 activity as shown in figure 7. The results of
the present study determine that SIRT1 aptamer is
able to mitigate the alloxan-induced inhibition of
SIRT1. These conclusions lead us to propose a
role for SIRT1 aptamer as a molecular switch that
regulates SIRT1 activity under different metabolic
conditions. As mentioned in previous study in vitro
(15), SIRT1 aptamer affects the expression of PGC-
1α and FOXO3a via SIRT1 in INS-1 832/13 HF
cell lines. Therefore, 50 µM SIRT1 aptamer
treatment may alleviated diabetes-induced via
different endogenous signalling pathways
including overexpression of SIRT1, PGC-1α (30)
and FOXO3a (31) and insulin metabolism because
SIRT1 aptamer treatment significantly reduced the
blood glucose level in alloxan-treated diabetic
animals. To sum up, most of the research on
resveratrol as SIRT1 activator has been performed
on animals or in vitro studies comprising tissue
extracts, then, therefore, scientists are not until
now certain about the health benefits of
resveratrol for individuals who consume normal
quantities of resveratrol-containing nutrients.
Clearly, the effective doses of 25 µM SIRT1
aptamer compared with the high dose of 200 µM
resveratrol in vivo and the several advantages of
aptamer due to their unique characteristics makes
it a possible treatment for diabetes mellitus in
humans in the adjacent future after carrying out
all the experiments to study the mechanisms,
stability and safety in vivo.
Acknowledgment
The authors show their appreciation to Al-
Mustansiryiah University (www.
uomustansiryiah.edu.iq), Baghdad-Iraq for
assistance rendered.
REFERENCE:-
1. International Diabetes Foundation. Diabetes:
facts and figures (accessed 2016 Mar 22).
Available from: http://www.idf.org/WDD15-
guide/facts-and-figures.html.
2. Floyd JS, Psaty BM. The application of genomics
in diabetes: barriers to discovery and
implementation. Diabetes care. 2016 Nov 1;
39(11):1858-69.
3. Bunka DH, Platonova O, Stockley PG.
Development of aptamer therapeutics. Current
opinion in pharmacology. 2010 Oct 1; 10
(5):557-62.
4. Birch JR, Racher AJ. Antibody production.
Advanced drug delivery reviews. 2006 Aug 7;
58(5-6):671-85.
5. Ferreira CS, Missailidis S. Aptamer-based
therapeutics and their potential in
radiopharmaceutical design. Brazilian archives of
biology and technology. 2007 Sep; 50(SPE):63-76.
6. Sefah K, Shangguan D, Xiong X, O'donoghue MB,
Tan W. Development of DNA aptamers using
Cell-SELEX. Nature protocols. 2010 Jun;
5(6):1169
7. Tuerk C, Gold L. Systematic evolution of ligands
by exponential enrichment: RNA ligands to
bacteriophage T4 DNA polymerase. Science.
1990 Aug 3; 249(4968):505-10
8. Jayasena SD. Aptamers: an emerging class of
molecules that rival antibodies in diagnostics.
Clinical chemistry.1999 Nov; 45(9), pp.1628-
1650.
9. Ireson CR, Kelland LR. Discovery and
development of anticancer aptamers. Molecular
cancer therapeutics. 2006 Dec 1; 5(12):2957-62.
10. Eyetech Study Group. Anti-vascular endothelial
growth factor therapy for subfoveal choroidal
neovascularization secondary to age-related
macular degeneration: phase II study results.
Ophthalmology. 2003 May 1; 110(5):979-86.
11. Song KM, Lee S, Ban C. Aptamers and their
biological applications. Sensors. 2012 Jan;
12(1):612-31. Jayasena SD. Aptamers: an
emerging class of molecules that rival antibodies
in diagnostics.
12. Pristoupil TI, Kramlovă M.
Microchromatographic separation of ribonucleic
acids from proteins on nitrocellulose
membranes. Journal of chromatography. 1968
Feb 20; 32 (4):769.
13. Gopinath SC. Methods developed for SELEX.
Analytical and bioanalytical chemistry. 2007 Jan 1;
387 (1):171-82.
14. Al-Sudani BT, Hameed B, Alahmar AT, Ragazzon
P. Gene Expression Analysis in MOTN-1 Cell
Rusul Ahmed Tariq et al/ Promising Preclinical Data to a Possible Antidiabetic Drug
2744| International Journal of Pharmaceutical Research | Oct - Dec 2020 | Vol 12 | Issue 4
Line after Treating with New Development
Aptamer. Systematic Reviews in Pharmacy. 2020;
11(2):123-34
15. Tariq RA, Arif IS, Al-Sudani BT. SIRT1, a novel
approach in the treatment diabetes mellitus.
Systematic reviews in pharmacy 2020 ;
11(11):117-128.
16. Kitada M, Kume S, Kanasaki K, Takeda-
Watanabe A, Koya D. Sirtuins as possible drug
targets in type 2 diabetes. Current drug targets.
2013 Jun 1; 14(6):622-36.
17. Bordone L, Motta MC, Picard F, Robinson A,
Jhala US, Apfeld J, McDonagh T, Lemieux M,
McBurney M, Szilvasi A, Easlon EJ. Sirt1 regulates
insulin secretion by repressing UCP2 in
pancreatic β cells. PLoS Biol. 2005 Dec 27;
4(2):e31.
18. Lee JH, Song MY, Song EK, Kim EK, Moon WS,
Han MK, Park JW, Kwon KB, Park BH.
Overexpression of SIRT1 protects pancreatic β-
cells against cytokine toxicity by suppressing the
nuclear factor-κB signaling pathway. Diabetes.
2009 Feb 1; 58(2):344-51.
19. Picard F, Kurtev M, Chung N, Topark-Ngarm A,
Senawong T, de Oliveira RM, Leid M, McBurney
MW, Guarente L. Sirt1 promotes fat
mobilization in white adipocytes by repressing
PPAR-γ. Nature. 2004 Jun; 429(6993):771-6.
20. GerhartHines Z, Rodgers JT, Bare O, Lerin C,
Kim SH, Mostoslavsky R, Alt FW, Wu Z,
Puigserver P. Metabolic control of muscle
mitochondrial function and fatty acid oxidation
through SIRT1/PGC1α. The EMBO journal.
2007 Apr 4; 26(7):1913-23.
21. Lotfy M, Adeghate J, Kalasz H, Singh J, Adeghate
E. Chronic complications of diabetes mellitus: a
mini review. Current diabetes reviews. 2017 Feb
1;13(1):3-10.
22. Zhang Z, Xin H, Li MD. Circadian Rhythm of
Lipid Metabolism in Health and Disease. Small
Methods. 2020 Jan 20:1900601.
23. Chougale AD, Shrimant N. Panaskar, Pradeep M.
Gurao and Akalpita U. Optimization of Alloxan
Dose is Essential to Induce Stable Diabetes for
Prolonged Period Ashok D.,India. Asian J.
Biochem. 2007; 2:402-8.
24. Aksakal E, Akaras N, Kurt M, Tanboga IH, Halici
Z, Odabasoglu F, Bakirci EM, Unal B. The role of
oxidative stress in diabetic cardiomyopathy: an
experimental study. Eur Rev Med Pharmacol Sci.
2011 Nov 1; 15(11):1241-6.
25. 25-Muktabhant B, Sanchaisuriya P, Sarakarn P,
Tawityanon W, Trakulwong M, Worawat S,
Schelp FP. Use of glucometer and fasting blood
glucose as screening tools for diabetes mellitus
type 2 and glycated haemoglobin as clinical
reference in rural community primary care
settings of a middle income country. BMC Public
health. 2012 Dec 1;12(1):349.
26. Parasuraman S, Raveendran R, Kesavan R. Blood
sample collection in small laboratory animals.
Journal of pharmacology &
pharmacotherapeutics. 2010 Jul; 1(2):87.
27. Hausenblas HA, Schoulda JA, Smoliga JM.
Resveratrol treatment as an adjunct to
pharmacological management in type 2 diabetes
mellitussystematic review and metaanalysis.
Molecular nutrition & food research. 2015
Jan;59(1):147-59.
28. Szkudelski T. The mechanism of alloxan and
streptozotocin action in B cells of the rat
pancreas. Physiological research. 2001 Jan
1;50(6):537-46.
29. Szkudelski T, Szkudelska K. Resveratrol and
diabetes: from animal to human studies.
Biochimica et Biophysica Acta (BBA)-Molecular
Basis of Disease. 2015 Jun 1;1852(6):1145-54.
30. Finck BN, Kelly DP. PGC-1 coactivators:
inducible regulators of energy metabolism in
health and disease. The Journal of clinical
investigation. 2006 Mar 1;116(3):615-22 .
31. Gross DN, Van den Heuvel AP, Birnbaum MJ.
The role of FoxO in the regulation of
metabolism. Oncogene. 2008 Apr;27(16):2320-
36.
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
The circadian temporal organization of cellular functions segregates chemically incompatible processes into different times of the day. It is emerging that the molecular temporal organization of lipid metabolism throughout the day is crucial for physiological fitness, the dysfunction of which contributes to current epidemic metabolic diseases related to lipids. Here, current conceptual frameworks of the circadian clock system and knowledge of the circadian rhythm of lipid metabolism in different metabolic tissues and organs in health and disease are summarized. Recent advances in dietary and chemical approaches to modulate the circadian rhythm of lipids and the implications to treating human diseases are also reviewed. From storage and trafficking, to biosynthesis and degradation, lipid metabolism clearly exhibits circadian rhythm. Mass spectrometry‐based methods have driven a surge of research programs to explore circadian rhythm of lipid metabolism in health and disease for novel biology, biomarkers, and therapy. This review summarizes recent advances in this topic and provides a primer for future research.
Article
Full-text available
Introduction: Diabetes mellitus (DM) is a major metabolic disorder currently affecting over 350 million people worldwide. Also, another one billion people in the world are pre-diabetic, who may eventually end up with full- blown diabetes. It costs around 1,200 billion USD to diagnose, treat and care for both type 1 DM (T1DM) and type 2 DM (T2DM) patients globally. The disorder is rapidly increasing out of proportion in both developed and developing countries, especially T2DM, which is associated with modern lifestyle habits such as reduced physical activity, diet, obesity and genetic factors. If left untreated, DM can lead to a number of diseases and long-term complications leading subsequently to death. Areas covered: In this mini review, we aim to highlight a number of complications, cascades or pathways (polyol, hexosamine, protein kinase C, advanced glycation-end product) of events and cellular, sub-cellular and molecular mechanisms associated with DM-induced hyperglycaemia. Conclusion: Chronic complications of DM are caused largely by HG-induced cellular and molecular impairment of neural and vascular structure and function. HG-induced oxidative stress is a major contributor in the development of long-term complications of DM. DM-induced neuropathy and angiopathy, in turn, may lead to the dysfunction of cells, tissues and organ systems.
Article
Full-text available
Diabetes mellitus (DM) has a negative effect on cardiovascular functions. Little, however, is known of the overall effect of DM on the cardiac histology or the pathophysiological basis of this. We aimed to investigate the role of oxidative stress on the pathogenesis of diabetic cardiomyopathy in an experimental model. 12 week-old female Sprague Dawley rats were randomly allocated into a healthy control group (n=6) and an DM group (n=6). After 12 weeks of alloxan induced DM, the groups' cardiac tissues were histopathologically analyzed and examined for determination of oxidant and antioxidant enzymes [activities of catalase (CAT), superoxide dismutase (SOD), and myeloperoxidase (MPO) and amount of reduced glutathione (GSH) and lipid peroxidation (LPO)]. When compared to the control group, the DM group showed cardiomyopathic changes. In the DM group, activities of CAT (144 +/- 0.9 vs. 112 +/- 1.4, p < 0.05) and LPO amount (27.0 +/- 0.74 vs. 14.4 +/- 0, 20, p < 0.05) were significantly increased whereas activities of SOD (142 +/- 0.2 vs. 146 +/- 0.7, p < 0.05) and amount of GSH (3.48 +/- 0.01 vs. 3.73 +/- 0.01, p < 0.05) were significantly decreased when compared to the control group. Besides, activities of MPO (7.3 +/- 0.02 vs. 8.6 +/- 0.11, p < 0.05) were comparable between groups. Using the experimental animal model, we were able to demonstrate that DM causes cardiomyopathic changes, and we propose that these changes could be mediated by an oxidative stress.
Article
Full-text available
Collection of blood from small laboratory animals is necessary for a wide range of scientific research and there are a number of efficient methods available for that. It is important that blood sample collection from experimental animals should be least stressful because stress will affect the outcome of the study. Various regulatory agencies and guidelines have restricted the use of animals and the techniques used for blood collection in laboratory animals. This article deals with the approved blood collection techniques for laboratory animals like rodents, lagomorphs and nonrodents. Permission of the Institute Animal Ethics Committee has been obtained for the use of animals for demonstrating the techniques.
Article
Diabetes mellitus is a serious disease affecting about 5% of people worldwide. Diabetes is characterized by hyperglycemia and impairment in insulin secretion and/or action. Moreover, diabetes is associated with metabolic abnormalities and serious complications. Resveratrol is a natural, biologically active polyphenol present in different plant species and known to have numerous health-promoting effects in both animals and humans. Anti-diabetic action of resveratrol has been extensively studied in animal models and in diabetic humans. In animals with experimental diabetes, resveratrol has been demonstrated to induce beneficial effects that ameliorate diabetes. Resveratrol, among others, improves glucose homeostasis, decreases insulin resistance, protects pancreatic β-cells, improves insulin secretion and ameliorates metabolic disorders. Effects induced by resveratrol are strongly related to the capability of this compound to increase expression/activity of AMPK and SIRT1 in various tissues of diabetic subjects. Moreover, anti-oxidant and anti-inflammatory effects of resveratrol were shown to be also involved in its action in diabetic animals. Preliminary clinical trials show that resveratrol is also effective in type 2 diabetic patients. Resveratrol may, among others, improve glycemic control and decrease insulin resistance. These results show that resveratrol holds great potential to treat diabetes and would be useful to support conventional therapy. This article is part of a Special Issue entitled: Resveratol: Challenges in translating pre-clincial findigns to iproved patient outcomes, guest edited by J. Dyck and P. Schrauwen. Copyright © 2014 Elsevier B.V. All rights reserved.
Article
The red wine polyphenol, resveratrol, is highly effective in treating type 2 diabetes mellitus (T2DM) in animal models, but there is no consensus regarding its efficacy in humans. We conducted a systematic review, which included searches in nine scholarly databases and six clinical trial registries, and identified randomized controlled clinical trials whereby resveratrol was used as an adjunct to pharmaceutical interventions in T2DM. Meta-analysis on clinical parameters was performed for available data. Of 764 articles originally identified, data from 6 unique data sets, examining a total of 196 T2DM patients (104 resveratrol, 92 control/placebo) ultimately met inclusion criteria. Statistically significant (p<0.05) positive effects, indicating that resveratrol supplementation was more effective than placebo/control, were identified for systolic blood pressure, hemoglobin A1c, and fasting glucose and creatinine, but not for fasting glucose, HOMAIR, diastolic blood pressure, insulin, triglycerides, LDL, or HDL cholesterol. No major adverse events were reported and side effects of resveratrol were not different than placebo/control. Though limitations in sample size and treatment duration preclude definitive changes in clinical practice, significant improvements in multiple cardiometabolic biomarkers and an excellent safety profile support resveratrol as a leading candidate as an adjunct to pharmacological management of T2DM.This article is protected by copyright. All rights reserved
Article
The rising incidence of type 2 diabetes mellitus (T2DM) is a major public health problem in industrialized countries, and new therapeutic strategies to prevent T2DM are urgently needed worldwide. It is well known that calorie restriction (CR) can retard the aging process in organisms ranging from yeast to rodents and delay the onset of numerous age-related diseases, including diabetes. Molecules that mimic CR metabolically may therefore represent new therapeutic targets for T2DM. Sirtuin1 (SIRT1), the mammalian homolog of Sir2, was originally identified as a NAD+-dependent histone deacetylase, and its activity is closely associated with longevity under CR. Growing evidence suggests that SIRT1 regulates glucose-lipid metabolism through its deacetylase activity for many known substrates and has many roles in the metabolic pathway through its direct or indirect involvement in insulin signaling in insulin-sensitive organs, including adipose tissue, liver and skeletal muscle. In addition, SIRT1 regulates insulin secretion, and adiponectin production, inflammation, gluconeogenesis, circadian rhythms and oxidative stress, which together contribute to the development of insulin resistance. Moreover, the overexpression of SIRT1 and several SIRT1 activators have beneficial effects on glucose homeostasis and insulin sensitivity in diabetic animal models and humans. Therefore, SIRT1 may represent a new therapeutic target for the prevention of diseases related to insulin resistance and T2DM. In addition, SIRT3 and SIRT6 play crucial roles in glucose and lipid metabolism. In this review, we summarize the current understanding of the biological functions of SIRT1, SIRT3 and SIRT6 in metabolism and discuss their potential role as therapeutic targets in T2DM.
Article
SIRT1, a class III histone/protein deacetylase, is known to interfere with the nuclear factor-kappaB (NF-kappaB) signaling pathway and thereby has an anti-inflammatory function. Because of the central role of NF-kappaB in cytokine-mediated pancreatic beta-cell damage, we postulated that SIRT1 might work in pancreatic beta-cell damage models. RINm5F (RIN) cells or isolated rat islets were treated with interleukin-1beta and interferon-gamma. SIRT1 was activated by resveratrol, a pharmacological activator, or ectopic overexpression. The underlying mechanisms of SIRT1 against cytokine toxicity were further explored. Treatment of RIN cells with cytokines induced cell damage, and this damage was well correlated with the expression of the inducible form of nitric oxide (NO) synthase (iNOS) and NO production. However, SIRT1 overexpression completely prevented cytokine-mediated cytotoxicity, NO production, and iNOS expression. The molecular mechanism by which SIRT1 inhibits iNOS expression appeared to involve the inhibition of the NF-kappaB signaling pathway through deacetylation of p65. In addition, SIRT1 activation by either resveratrol or adenoviral-directed overexpression of SIRT1 could prevent cytokine toxicity and maintain normal insulin-secreting responses to glucose in isolated rat islets. This study will provide valuable information not only into the mechanisms underlying beta-cell destruction but also into the regulation of SIRT1 as a possible target to attenuate cytokine-induced beta-cell damage.
Article
Alloxan and streptozotocin are widely used to induce experimental diabetes in animals. The mechanism of their action in B cells of the pancreas has been intensively investigated and now is quite well understood. The cytotoxic action of both these diabetogenic agents is mediated by reactive oxygen species, however, the source of their generation is different in the case of alloxan and streptozotocin. Alloxan and the product of its reduction, dialuric acid, establish a redox cycle with the formation of superoxide radicals. These radicals undergo dismutation to hydrogen peroxide. Thereafter highly reactive hydroxyl radicals are formed by the Fenton reaction. The action of reactive oxygen species with a simultaneous massive increase in cytosolic calcium concentration causes rapid destruction of B cells. Streptozotocin enters the B cell via a glucose transporter (GLUT2) and causes alkylation of DNA. DNA damage induces activation of poly ADP-ribosylation, a process that is more important for the diabetogenicity of streptozotocin than DNA damage itself. Poly ADP-ribosylation leads to depletion of cellular NAD+ and ATP. Enhanced ATP dephosphorylation after streptozotocin treatment supplies a substrate for xanthine oxidase resulting in the formation of superoxide radicals. Consequently, hydrogen peroxide and hydroxyl radicals are also generated. Furthermore, streptozotocin liberates toxic amounts of nitric oxide that inhibits aconitase activity and participates in DNA damage. As a result of the streptozotocin action, B cells undergo the destruction by necrosis.