Study on the protective effect and mechanism of Dicliptera chinensis (L.) Juss (Acanthaceae) polysaccharide on immune liver injury induced by LPS

Abstract

The purpose of this study is to use Dicliptera chinensis (L.) Juss (Acanthaceae) polysaccharide (DCP) to act on the NF-κB inflammatory pathway and Fas/FasL ligand system, in order to find a new method to improve immune liver injury. Lipopolysaccharide (LPS) was used to establish an injury model in vivo (Kunming mice) and in vitro (LO2 cells). In this experiment, hematoxylin-eosin (H&E) staining and related biochemical indicators were used to observe the pathological changes of liver tissues, oxidative stress and inflammatory reactions. Immunohistochemistry, ELISA, RT-PCR and Western blot were used to detect protein or mRNA expressions associated with inflammation response and apoptosis. The experimental results show that the model group has obvious liver cell damage and inflammatory infiltration. After DCP intervention, it could significantly reduce the levels of ALT, AST, ALP, TBIL and MDA in serum, and increase the content of SOD and GSH-Px. In addition, DCP can reduce the expression level of NF-κB in the liver and reduce the release of downstream inflammatory factors TNF-α, IL-6 and IL-1β, thereby reducing the inflammation. At the same time, DCP can significantly inhibit the expression of Fas/FasL ligand system and apoptosis related-proteins and mRNA, which in turn can reduce cell apoptosis. In conclusion, DCP can alleviate liver injury by inhibiting liver inflammation and apoptosis, which provides a new strategy for clinical treatment of immune liver injury.

Full text

Biomedicine & Pharmacotherapy 134 (2021) 111159
Available online 25 December 2020
0753-3322/© 2020 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Study on the protective effect and mechanism of Dicliptera chinensis (L.) Juss
(Acanthaceae) polysaccharide on immune liver injury induced by LPS
Qiongmei Xu
a
,
1
, Jie Xu
a
,
1
, Kefeng Zhang
a
, Mingli Zhong
a
, Houkang Cao
b
, Riming Wei
a
,
Ling Jin
b
,
**, Ya Gao
a
,
b
,
*
a
College of Pharmacy, Guilin Medical University, Guilin 541004, Guangxi, China
b
College of Pharmacy, Gansu University of Chinese Medicine, Lanzhou, 730000, Gansu, China
ARTICLE INFO
Keywords:
Polysaccharides from Dicliptera chinensis
Immunological liver injury
NF-κB
Fas/FasL
ABSTRACT
The purpose of this study is to use Dicliptera chinensis (L.) Juss (Acanthaceae) polysaccharide (DCP) to act on the
NF-κB inammatory pathway and Fas/FasL ligand system, in order to nd a new method to improve immune
liver injury. Lipopolysaccharide (LPS) was used to establish an injury model in vivo (Kunming mice) and in vitro
(LO2 cells). In this experiment, hematoxylin-eosin (H&E) staining and related biochemical indicators were used
to observe the pathological changes of liver tissues, oxidative stress and inammatory reactions. Immunohis-
tochemistry, ELISA, RT-PCR and Western blot were used to detect protein or mRNA expressions associated with
inammation response and apoptosis. The experimental results show that the model group has obvious liver cell
damage and inammatory inltration. After DCP intervention, it could signicantly reduce the levels of ALT,
AST, ALP, TBIL and MDA in serum, and increase the content of SOD and GSH-Px. In addition, DCP can reduce the
expression level of NF-κB in the liver and reduce the release of downstream inammatory factors TNF-
α
, IL-6 and
IL-1β, thereby reducing the inammation. At the same time, DCP can signicantly inhibit the expression of Fas/
FasL ligand system and apoptosis related-proteins and mRNA, which in turn can reduce cell apoptosis. In
conclusion, DCP can alleviate liver injury by inhibiting liver inammation and apoptosis, which provides a new
strategy for clinical treatment of immune liver injury.
1. Introduction
The liver is an important organ for the biotransformation and
detoxication of various harmful substances. In recent years, the pro-
portion of people suffering from liver injury has been increasing. Liver
injury is the common basis for diseases such as hepatitis, liver brosis
and even cirrhosis. However, there are many factors that cause liver
injury. The most common liver injury is immune liver injury caused by
alcohol, drugs, chemicals and other factors [1,2]. In the occurrence and
development of chemical, drug and (non-)alcoholic liver steatosis, the
excessive response of the body’s immune system is an important cause of
liver parenchymal damage [3]. Therefore, it is an inevitable choice to
nd a hepatoprotective drug or a new target with dual effects of regu-
lating the body immune function and liver protection.
Nuclear factor kappa-B (NF-κB) is a nuclear transcription factor
widely present in various cells in the body, and plays an important role
in regulating cellular inammation and apoptosis. In the resting stage,
NF-κB binds to the inhibitory protein IκB-
α
to form a complex in the
cytoplasm. When IκB-
α
is phosphorylated, NF-κB dissociates from IκB-
α
and enters the nucleus through the cell nuclear membrane. It binds to
the corresponding sites on the DNA, activates the transcription and
translation processes, induces the synthesis and release of inammatory
factors, and thus plays a key role in pathological processes such as cell
injury and apoptosis [4,5]. Some scholars reported that during the
process of liver inammation by lipopolysaccharide (LPS)-induced
activation, the NF-κB signaling pathway was signicantly activated [6].
The Fas/FasL ligand system is a signaling pathway that regulates
apoptosis. Fas antigen is an apoptosis-related molecule on the surface of
cell membranes and is widely expressed in a variety of tissue nuclear
cells, among which the immune system is the most abundantly expressed
[7]. FasL is a natural ligand of Fas, which can transmit death signals to
Fas through T cell-mediated cellular immunity, thereby inducing
* Corresponding author at: College of Pharmacy, Guilin Medical University, Guilin, 541199, Guangxi, China.
** Corresponding author.
E-mail addresses: zyxyjl@163.com (L. Jin), svidy@163.com (Y. Gao).
1
These authors contributed equally to this work.
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy
journal homepage: www.elsevier.com/locate/biopha
https://doi.org/10.1016/j.biopha.2020.111159
Received 23 October 2020; Received in revised form 13 December 2020; Accepted 14 December 2020

Biomedicine & Pharmacotherapy 134 (2021) 111159
2
apoptosis or death [8,9]. After lung injury in mice induced by LPS,
alveolar cell Fas/FasL was up-regulated in a dose-dependent manner
[10]. Ansinoside can reduce the high expression of Fas and FasL caused
by Bacillus Calmette-Guerin Bacillus plus LPS, suggesting that it may
effectively protect the liver by affecting Fas/FasL ligand [11]. It can be
seen that effectively inhibiting the NF-κB pathway and the Fas/FasL
ligand system is a potential treatment for alleviating immune liver
injury.
The chemical constituents of Dicliptera chinensis (L.) Nees are mainly
polysaccharides, organic acids, amino acids and other substances, which
have the functions of clearing heat and detoxication, clearing liver and
improving eyesight. This medicine is a food that can be used for cooking
porridge, soup, etc. It is widely used in the folk. At the same time, it is
also a common folk medicine. Its whole herb can treat stomachache,
enteritis and diarrhea [12]. Dicliptera chinensis (L.) Juss (Acanthaceae)
polysaccharide (DCP) has been researched by our research group in the
previous period. In accordance with Procedures for toxicological Assess-
ment on Food Safety, we carried out a series of experiments, including
acute toxicity to mice, micronucleus experiment for bone marrow cell in
mice, sperm shape abnormality test in mice, Ames experiment, and rat
30 d feeding experiment, and the experimental results reect that DCP is
nontoxic [13]. We have found that DCP has a variety of anti-oxidant and
anti-inammatory biological activities, and can signicantly relieve
liver injury induced by carbon tetrachloride or D-galactosamine [14,15].
DCP also has a positive effect on mice with immune liver injury, but the
specic mechanism remains elusive. Base on the previous period study,
the purpose of our research is to use DCP to regulate the NF-κB and
Fas/FasL pathways and explore new strategies to improve liver injury.
First, an in vivo and in vitro model of immune liver injury was estab-
lished. Second, this model was used to study the effect of DCP on liver
injury caused by immune factors. Finally, this model was used to further
explore the effects of DCP on the NF-κB inammatory pathway and
Fas/FasL apoptotic pathway.
2. Materials and methods
2.1. Preparation of DCP
Dicliptera chinensis (L.) Juss is widely distributed in southern China.
However, the content of polysaccharide in Dicliptera chinensis (L.) Juss
originated from Guilin is the highest [16]. The herb of Dicliptera chinensis
(L.) Juss in this study was native to Guilin, and was purchased from the
Chinese herbal medicine market in Guilin, PR China and identied by
professor Kefeng Zhang. The chopped 1 kg dried herb was placed in a
reux device and defatted with 95 % ethanol under high temperature
conditions. The ratio of herb to ethanol was 1:18 (w/v), 1.5 h/time, and
repeated 5 times. Then, it was extracted with distilled water, and the
extracts were combined. The pure extract of Dicliptera chinensis was
concentrated to 2000 mL under reduced pressure at 50 ◦C. The
concentrated solution was added with ethanol with a nal concentration
of 90 % (v/v) and placed at 4 ◦C overnight. The next day, the poly-
saccharide in the concentrated solution was precipitated. The collected
polysaccharide was dissolved in 1600 mL of water, placed in a separa-
tory funnel and shaken with butanol/chloroform (1/5), and centrifuged
to remove denatured protein. The supernatant was lyophilized to obtain
a crude polysaccharide. The crude polysaccharide is dissolved with
distilled water, and is decolorized with the activated carbon and then
lyophilized to obtain a rened polysaccharide. In addition, the puried
polysaccharide was passed through a Sephadex G-75 column (2.5 cm ×
100 cm), and the liquid was collected after elution at a ow rate of 0.5
mL/min. The collected samples were mixed with sulfuric acid and
phenol to verify a characteristic color reaction of polysaccharide. The
collected solution was concentrated and lyophilized to obtain puried
light yellow polysaccharide. Our previous experiments have studied the
main components of DCP. The gel permeation chromatography (GPC)
was used to determine Mw and distribution of polysaccharides. The
weight average Mw of DCP-1 and DCP-2 were 9650 Da and 2273 Da.
Among them, the content of DCP2 is high, and its efcacy is obvious. The
component used in this study was DCP2. For specic chemical infor-
mation of DCP2, refer to literature [14]. The puried polysaccharide
was stored in a desiccator for further experiments.
2.2. Ethical approval
All procedures followed the National Institutes of Health’s Guide for
the Care and Use of Laboratory Animals and approved by the Guilin
Medical University Animal Ethics Committee (Approved No. 2019-
0033).
2.3. Animals and experimental design
The experimental SPF-grade male Kunming mice were purchased
from Hunan Slake Jingda Experimental Animal Co., Ltd (SCXK [Xiang]
2016-0002, Hunan, CHN). All mice were kept in a temperature of 22 ±2
◦C, humidity of 45 %–50 %, and 12 h of light/dark cycle. The mice were
access to food and water, and were acclimatized for one week before the
experiment.
Sixty mice were randomly divided into Control group, Model (LPS)
group, Silymarin group (150 mg/kg) and DCP dose group (200, 100, 50
mg/kg), 10 mice in each group. After one week of adaptive feeding, the
Control group and the Model group were given saline and the other
groups were given drug by intragastric administration for 7 days, once a
day. After the last administration, except the Control group, mice were
injected intraperitoneally with LPS (5 mg/kg, purity>99 %, Solarbio
Science & Technology Co., Beijing, CHN) to establish an immune liver
injury model [17].After fasting for 16 h, blood was collected from the
eyeballs, and the liver tissues were collected and xed in 4 % para-
formaldehyde solution. The remaining liver tissues were stored in a
refrigerator at −80 ◦C for liver tissue index detection. The brain, heart,
lung, spleen and kidney of each group of mice were xed at 4 %
paraformaldehyde.
2.4. Histopathological examination
2.4.1. Hematoxylin and eosin (H&E) staining
Liver tissues were xed for 48 h, and then dehydrated and embedded
in parafn. The sections were sequentially treated with xylene and
gradient ethanol, and then stained with hematoxylin and eosin staining
solution for 10 min and 5 min. After being soaked in 95 % alcohol and
absolute ethanol, the slides were mounted with neutral resin, under a
200×optical microscope to observe histopathological changes.
In this study, while observing the protective effect of DCP on mice
with immunological liver injury, we further investigated whether high-
dose DCP had an effect on brain, heart, spleen, lung, and kidney tissue
structures. Therefore, we collected brain, heart, lung, liver, spleen, and
kidney of the DCP (200 mg/kg) group for H&E staining, and observed
whether the tissue structure was damaged under an optical microscope.
2.4.2. Immunohistochemistry
The liver sections were dewaxed, rehydrated and placed in 1x citrate
buffer (ThermoFisher Scientic, Shanghai, CHN) for high pressure an-
tigen repair over 5 min. The sections were then allowed to cool natu-
rally. After the liver peroxidase was blocked by H
2
O
2
, the sections were
incubated with a p-NF-κBp65 (1:100; Abcam, Cambridge, UK) or an
IKK
α
/β (1:100, Abcam) antibody at 4 ◦C overnight. The next day, after
incubation with the secondary antibody, DAB reagent was added for
hematoxylin counterstaining. Then, gradient ethanol and xylene were
dehydrated and transparent, neutral gum was mounted, and the sections
were observed under optical microscope at 200×.
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
3
2.5. Analysis of serum samples
According to the kit instructions (Nanjing Jiancheng Bioengineering
Institute, Nanjing, CHN), biochemical method was used to detect the
activity of alanine aminotransferase (ALT), aspartate aminotransferase
(AST), alkaline phosphatase, (ALP) and the content of total bilirubin
(TBIL) in serum. At the same time, strictly follow the instructions
(Nanjing Jiancheng Bioengineering Institute, Nanjing, CHN) of the
malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione
peroxidase (GSH-Px) kits to add samples and related working solutions.
After the air bath, follow the kit instructions to detect absorbance on a
microplate reader and calculate the content of MDA, SOD and GSH-Px in
serum.
2.6. Analysis of liver samples
After the liver tissue was shredded, 9 times volume of saline was
added, which was fully ground to obtain a 10 % (v/w) liver tissue ho-
mogenate. The samples and corresponding working solutions were
added according to the ELISA kit instructions (Wuhan Elabscience
Biotechnology Co., Hubei, China). After standard procedures, detect and
calculate the levels of Interleukin-1β (IL-1β), Interleukin-6 (IL-6) and
Tumor necrosis factor-
α
(TNF-
α
) in the liver tissue using a microplate
reader.
2.7. In vivo experiments with LO2 cells
2.7.1. LO2 cell culture and model establishment
LO2 cells were purchased from chunmai Biotechnology Co., Ltd
(Shanghai, China) and cultured in a 37 ◦C, 5 % CO
2
incubator. The
complete medium contains RPMI-1640 medium, 10 % FBS (900–108;
Gemini, CA, USA), 1 % penicillin-streptomycin. After the cells are fused
to 80 %, follow-up experiments are performed.
2.7.2. MTT experiment
LO2 cells at logarithmic growth stage were inoculated in 96-well
plates at a density of 1 ×10
4
cells/well and incubated with DCP at
different concentrations (0–1.5 mg/mL) with or without LPS (10
μ
g/mL)
for 24 h [18]. Then 10
μ
L MTT (5 mg/mL) was added to each well and
incubated for 4 h. The colored products were then dissolved in 150
μ
L
DMSO and the absorbance at 490 nm was measured using a microplate
reader. The experiment was repeated three times and the survival rate of
the cells was calculated.
2.7.3. Immunouorescence
After DCP and LPS interfered with LO2 cells, the cells were washed
with phosphate-buffered saline (PBS) for three times, xed with 4 %
paraformaldehyde for 30 min and then washed. A permeable solution
containing 0.2 % (V/V) TritonX-100/PBS was added and incubated at
room temperature for 30 min. The cell was washed three times with PBS
and blocked with 5 % (m/v) BSA/PBST for 30 min. The blocking solu-
tion was discarded and incubated with NF-κB p65 primary antibody
(1:200, CST) at 4 ◦C overnight. The next day, the mixture was reheated
for 1 h, washed with PBS three times, and added with uorescent sec-
ondary antibody (1:200, Jackson) to incubate for 1 h in dark. After
washing, DAPI was added for nuclear staining for 5 min, followed by
washing with PBS for three times. After anti-uorescence quencher was
added dropwise, the water-soluble sealing tablets were sealed and
observed under a uorescent microscope.
2.8. Real-time reverse transcription polymerase chain reaction
Trizol reagent (Beyotime Biotechnology Co., Shanghai, China) was
added to the liver and LO2 cells of each experimental group to obtain
total RNA. Following the reverse transcription kit instructions (Cwbio
Century Biotechnology Co., Beijing, China), total RNA was reverse
transcribed into cDNA. Using the reverse transcription reaction product
as a template, a real-time quantitative PCR amplication reaction was
performed, and cDNA was amplied on the CFX96 uorescence quan-
titative PCR instrument according to the reaction conditions of the
detection kit (Cwbio Century Biotechnology Co.). Under the conditions
of 95 ◦C for 10 min, 95 ◦C for 15 s, and 60 ◦C for 1 min, the cycle was
repeated 40 times. Expressions of the target genes were carried out by a
comparative method (2
−ΔΔCt
) using GAPDH as an internal reference.
The primer sequences (Huada Gene Research Institute, Shenzhen,
China) are shown in Tables 1 and 2.
2.9. Western blot analysis
In each experimental group, 1 mL of cultured cell protein lysate
(protein phosphatase inhibitor with 1 % PMSF, Beyotime Biotechnology
Co.) was added to the liver and LO2 cells of each experimental group,
and lysed on ice for 30 min. Centrifuge at 4 ◦C for 15 min at a speed of 12
000 g/min, draw the supernatant, and determine the protein concen-
tration by BCA method (P0010S, Beyotime Biotechnology Co.). Take 20
μ
g of denatured protein for each group and load the protein on 10 %
SDS-PAGE (concentrated gel voltage 80 V, separated gel voltage 120 V);
constant current (300 mA current, 1.5 h) to 0.45
μ
m PVDF membrane
(Millipore, Billerica, MA, USA); add 5 % skim milk powder was shaken
for 1.5 h at room temperature and shaker. After washing the membrane
with TBST, incubate with the following antibodies at 4 ◦C in a shaker
overnight: β-actin (1: 2000, Proteintech, Wuhan, China), NF-κBp65 (1:
1000, Cell Signaling Technology, Boston, MA, USA), p-NF-κBp65, TNF-
α
, IL-1β, IL-6 (1: 1000, Abcam), Caspase-8, Fas, FasL, Caspase-3, FADD,
Bax, Bcl2 (1: 1000, Cell Signaling Technology, Boston, MA, USA). After
washing the membrane with TBST, goat anti-mouse IgG and goat anti-
rabbit IgG secondary antibody (1:2000, Proteintech) were incubated
at room temperature for 1 h, place the image in a fully automated
chemiluminescence image analysis system (Tanon Technology Co.,
Shanghai, China), and analyze using Quantity One 4.6.2 software Strip
protein gray, calculate relative protein expression based on β-actin gray
value.
Table 1
Primer sequences used in RT-PCR of Mice.
Genes Primer Mice Sequence(5′–3′)
TNF-
α
Forward GACGTGGAACTGGCAGAAGAG
Reverse TTGGTGGTTTGTGAGTGTGAG
IL-6 Forward CCAAGAGGTGAGTGCTTCCC
Reverse CTGTTGTTCAGACTCTCTCCCT
IL-1β Forward GCAACTGTTCCTGAACTCAACT
Reverse ATCTTTTGGGGTCCGTCAACT
NF-κB Forward CCCTGAGAAAGAAACACAAGGT
Reverse ATGAAGGTGGATGATGGCTAAG
GAPDH Forward AGGTCGGTGTGAACGGATTTG
Reverse TGTAGACCATGTAGTTGAGGTCA
Table 2
Primer sequences used in RT-PCR of LO2 cell.
Genes Primer Sequence(5′–3′)
TNF-
α
Forward GAGGCCAAGCCCTGGTATG
Reverse CGGGCCGATTGATCTCAGC
IL-6 Forward ACTCACCTCTTCAGAACGAATTG
Reverse CCATCTTTGGAAGGTTCAGGTTG
IL-1β Forward ATGATGGCTTATTACAGTGGCAA
Reverse GTCGGAGATTCGTAGCTGGA
NF-κB Forward GGTGCGGCTCATGTTTACAG
Reverse GATGGCGTCTGATACCACGG
FAS Forward AGATTGTGTGATGAAGGACATGG
Reverse TGTTGCTGGTGAGTGTGCATT
FASL Forward TGCCTTGGTAGGATTGGGC
Reverse GCTGGTAGACTCTCGGAGTTC
GAPDH Forward ACAACTTTGGTATCGTGGAAGG
Reverse GCCATCACGCCACAGTTTC
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
4
2.10. Statistical analysis
All analyses were carried out by Graph Pad Prism 5.0 software, the
data was expressed as mean ±SD. To assess the differences between
groups, one-way analysis of variance was used. Independent sample t-
test was used for comparison between two groups. P <0.05 indicated
statistical signicance.
3. Results
3.1. Establishment of immune liver injury model
ALT, AST, ALP, and TBIL are the most representative indicators of
liver function. After intraperitoneal injection of LPS, the serum levels of
ALT, AST, ALP, and TBIL in the LPS group were signicantly higher than
those in the Control group (Fig. 1A). The liver surface of the LPS group
was rough and dull, while the liver of the Control group was smooth and
bright red (Fig. 1B). The results of HE staining showed that the structure
of the liver lobule in the LPS group was fuzzy and unclear, the hepato-
cytes were disorderly arranged, and there were a large number of in-
ammatory cell inltrations near the central vein and the junction area,
showing obvious characteristics of liver injury. In the Control group, the
liver cells were evenly arranged and liver lobules were intact (Fig. 1C).
The above data indicates that we have successfully established a model
of immune liver injury in mice.
3.2. Effects of DCP on liver function
The results show that DCP intervention can signicantly reduce the
activity of ALT, AST, ALP, and the content of TBIL in the serum of mice
with liver injury caused by LPS (Fig. 1A). Compared with the LPS group,
the liver color of mice in each dose group of DCP returned to bright red
and shiny (Fig. 1B), and cell necrosis and inammatory inltration in
the manifold area were signicantly reduced (Fig. 1C). The results
indicate that DCP has a protective effect on immune liver injury in mice.
In order to investigate whether DCP is toxic to main organs while pro-
tecting the liver, H&E staining results of brain, heart, lung, liver, spleen,
and kidney in the DCP200 group showed no signicant pathological
differences in tissues (Fig. 1D), indicating that DCP has no obvious side
effects on major organs in mice.
3.3. Effects of DCP on oxidative stress and inammation in liver
Compared with the Control group, the content of MDA in LPS group
Fig. 1. The effect of DCP on liver function. (A) The activity of ALT, AST, ALP and the content of TBIL in serum, (B) liver morphology and (C) HE staining, (D) HE
staining of brain, heart, lung, liver, spleen and kidney in DCP200. All data are presented as the means ±SD (n =10). (*p <0.05, **p <0.01). Bar=100
μ
m.
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
5
was increased signicantly, and the content of SOD and GSH-Px showed
a downward trend (Fig. 2A and B). ELISA and RT-PCR results showed
that the levels of inammatory factors TNF-
α
, IL-1β, IL-6 and mRNA in
liver tissue of LPS group mice were signicantly higher than that of
Control group, and the level of NF-κBp65 mRNA was higher than Con-
trol group (Fig. 2C and D). Immunohistochemistry showed that the liver
tissue p-NF-κBp65 and p-IKK
α
/β in the LPS group were signicantly
higher than those in the Control group (Fig. 2E). The above data in-
dicates that immune liver injury is closely related to oxidative stress and
inammation.
After DCP intervention, the MDA content in the serum of DCP200
mice decreased signicantly, and the SOD and GSH-Px contents
increased (Fig. 2A and B), indicating that DCP can signicantly inhibit
oxidative stress. The levels of TNF-
α
, IL-1β, IL-6 and mRNA in the liver of
DCP group decreased, and the level of NF-κBp65 mRNA decreased, of
which the most signicant reduction was in the DCP200 group (Fig. 2C
and D). The expression of p-NF-κBp65 and p-IKK
α
/β in liver tissue of
DCP200 group was signicantly lower than that of LPS group (Fig. 2E).
The results show that DCP reduces liver damage by inhibiting oxidative
stress and inammatory response.
3.4. Effect of DCP on NF-κB and Fas/FasL pathway in vivo
Western blot results showed that after intraperitoneal injection of
LPS, the protein expression of iNOS, p-NF-κBp65, TNF-
α
, IL-6 and IL-1β
signicantly increased (Fig. 3A–D), indicating that LPS stimulated the
liver inammatory response, activates the NF-κB pathway, and causes
liver damage. In addition, the protein expression levels of Bax, Fas, FasL,
FADD, Cleaved Caspase-3, and Cleaved Caspase-8 in the LPS group were
signicantly higher than those in the Control group, while the expres-
sion level of the inhibitory protein Bcl2 was signicantly reduced
(Fig. 3E–I). The results show that liver injury is closely related to Fas/
FasL pathway.
The gray statistics results showed that the protein expression levels
of iNOS, p-NF-κBp65, TNF-
α
, IL-6, and IL-1β in the Silymarin group were
lower than the LPS group. After DCP administration, iNOS, p-NF-κBp65,
TNF -
α
, IL-6 and IL-1β protein expression was signicantly down-
regulated (Fig. 3A–D), indicating that DCP can inhibit the NF-κB
pathway to reduce inammation and improve liver injury. The expres-
sion of Bax, Fas, FasL, FADD, Cleaved Caspase-3, and Cleaved Caspase-8
in the DCP group was signicantly down-regulated, while the expression
Fig. 2. The effect of DCP on oxidative stress and inammation. Serum (A) The content of MDA, (B) The content of SOD and GSH-Px, liver (C) The levels of TNF-
α
, IL-
6 and IL-1β, (D) The expression of TNF-
α
, IL-6, IL-1β and NF-κBp65 mRNA, (E) The expression of p-NF-κBp65, p-IKK
α
/β in immunohistochemistry. All data are
presented as the means ±SD (n =10). (*p <0.05, **p <0.01). Bar=100
μ
m.
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
6
level of the inhibitory apoptosis protein Bcl2 was signicantly up-
regulated (Fig. 3E–I), indicating that DCP improves liver damage by
inhibiting cell apoptosis.
3.5. The effect of DCP and LPS in vitro
MTT results showed that treatment with DCP in the range of 0–1.5
mg/mL had no signicant effect on LO2 cell viability (Fig. 4A). How-
ever, after stimulation with LPS (10 ug/mL), the DCP dose showed a
downward trend in the cell viability of LO2 cells within a certain range
(Fig. 4B). After immunouorescence staining, the expression level of NF-
κBp65 in the LPS group was signicantly higher than that in the Control
group (Fig. 4C and D), indicating that we have successfully established
liver injury model in vitro. In addition, after LPS stimulation, the levels of
TNF-
α
, IL-6, IL-1β, NF-κBp65, Fas and FasL mRNA were signicantly
higher than those in the Control group (Fig. 4E and F). After DCP
intervention, the results of immunouorescence showed that the
expression level of NF-κBp65 was signicantly lower than that of the LPS
group (Fig. 4C and D). At the same time, the levels of TNF-
α
, IL-6, IL-1β,
NF-κBp65, Fas and FasL mRNA were signicantly reduced (Fig. 4E and
F).
3.6. Effect of DCP on NF-κB and Fas/FasL pathway in vitro
Western blot results showed that after LPS intervention, the protein
expression of iNOS, p-NF-κBp65, TNF-
α
, IL-6 and IL-1β was signicantly
Fig. 3. The effect of DCP on NF-κB and Fas/FasL pathway in vivo. Liver (A-D) the protein expression of iNOS, p-NF-κBp65, NF-κBp65, TNF-
α
, IL-6 and IL-1β, (E-I) the
protein expression of Bcl2, Bax, Fas, FasL, FADD, Cleaved Caspase-3, Cleaved Caspase-8. All data are presented as the means ±SD (n =3). (*p <0.05, **p <0.01).
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
7
Fig. 4. Effect of DCP on LPS-treated LO2 cells. (A) Effect of DCP on the viability of LO2 cells, (B) Effect of DCP on the viability of LO2 cells treated with LPS (10ug/
mL), (C-D) The expression of NF-κBp65 in immunouorescence, (E) Fas and FasL mRNA levels, (F) TNF-
α
, IL-6, IL-1β and NF-κBp65 mRNA levels. All data are
presented as the means ±SD (n =5). (*p <0.05, **p <0.01).
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
8
higher than that in the Control group (Fig. 5A–D). At the same time, in
the LPS-induced cell injury model, the expressions of apoptosis-related
proteins Fas, FasL, FADD, Cleared Caspase-3, Cleared Caspase-8, and
Bax were signicantly up-regulated, and the expression of the inhibitory
apoptosis protein Bcl2 was signicantly down-regulated (Fig. 5E–I). The
results showed that the immune liver injury with LPS intervention was
closely related to inammatory response and apoptosis.
Compared with the LPS group, after DCP intervention, the protein
expressions of iNOS, p-NF-κBp65, TNF-
α
, IL-6 and IL-1β were signi-
cantly reduced (Fig. 5A–D). At the same time, the expression of Fas,
FasL, FADD, Cleaved Caspase-3, Cleaved Caspase-8 and Bax in the DCP
dose group was signicantly down-regulated, and the expression of Bcl2
was up-regulated (Fig. 5E–I). The results show that DCP reduces the
inammatory response by inhibiting the NF-κB pathway, and improves
liver injury by inhibiting cell apoptosis.
4. Discussion
The activation of the NF-κB signaling pathway is closely related to
the inammatory response [17]. At the same time, the Fas/FasL-related
apoptosis signaling pathway plays an important role in immune liver
injury [19]. Therefore, we use DCP to simultaneously regulate NF-κB
pathways and Fas/FasL related apoptotic signaling pathways to reduce
inammation, and also regulate apoptosis ligands to reduce apoptosis.
We used LPS-induced SPF-grade Kunming mice to establish an immune
liver injury model to evaluate the effects of DCP on oxidative stress,
inammation, and apoptosis-related proteins. To further verify the ef-
fect of DCP on NF-κB pathway and Fas/FasL related apoptosis signal,
Fig. 5. The effect of DCP on NF-κB and Fas/FasL pathway in vitro. In LO2 cells, (A-D) the protein expression of iNOS, p-NF-κBp65, NF-κBp65, TNF-
α
, IL-6 and IL-1β,
(E-I) the protein expression of Bcl2, Bax, Fas, FasL, FADD, Cleaved Caspase-3, Cleaved Caspase-8. All data are presented as the means ±SD (n =3). (*p <0.05, **p
<0.01).
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
9
LO2 cells were cultured in vitro and an immune liver injury model was
established.
We found that DCP interfered with the NF-κB signaling pathway to
inhibit liver inammation and regulated the expression of key genes and
proteins in the Fas/FasL signaling pathway. The results of this study
provide a new strategy for clinical application of DCP to reduce liver
injury. First, in this study, we successfully established a mouse immune
liver injury model induced by LPS, the main component of endotoxin,
which is intraperitoneally injected into mice to trigger systemic immune
response, inammation and damage liver structure [20]. ALT and AST in
damaged liver cells were spilled into the blood, resulting in increased
activity of ALT and AST in the blood [21]. Liver biomarker enzymes viz.
ALP, ALT, AST and TBIL were increased due to LPS/d-GalN [22]. In this
experiment, liver tissues of LPS-treated mice was signicantly damaged,
hepatic lobule structure was signicantly damaged, liver cells were ar-
ranged in disorder with more inammatory inltration, and the activ-
ities of ALT, AST, ALP, and TBIL in the serum were increased
signicantly (Fig. 1). In conclusion, the immune liver injury model
established by LPS can be used in the study of liver protection by DCP.
Studies have shown that most inammatory reactions are often
accompanied by varying degrees of oxidative stress, which is the com-
mon pathogenesis of a variety of liver diseases [23]. MDA is the most
important lipid peroxides, and its overexpression implies a state of
oxidative stress [24]. Enzyme antioxidant system is an important anti-
oxidant system of the body. Antioxidant enzymes mainly include SOD
and GSH-Px, which can effectively reduce the generation of peroxides
such as MDA and maintain the body’s normal redox reaction [25].
Studies have shown that in LPS-induced immunological liver injury
mice, SOD and GSH-Px contents in liver tissues were signicantly
decreased, and MDA contents were signicantly increased, indicating
that oxidative stress in LPS-induced mice appeared [26], which was
consistent with the results of this study. In addition, DCP intervention
can signicantly enhance the content of SOD and GSH-Px in serum of
mice with LPS-induced immunological liver injury, and reduce the
content of MDA (Fig. 2), suggesting that DCP can inhibit oxidative stress,
which may be one of the important mechanisms of DCP to protect the
liver.
NF-κB is the central regulator of inammatory cytokines and plays an
important role in hepatocyte injury, brosis and hepatocellular carci-
noma. After LPS stimulation, the NF-κB signaling pathway is activated to
produce downstream pro-inammatory cytokines and chemokines,
leading to increased inammation in liver tissue and liver injury [27].
Immunohistochemical results showed that DCP inhibited NF-κB
signaling pathway and reduced inammatory response, improving im-
mune liver injury in mice. DCP signicantly inhibited the regulation of
NF-κB signaling pathway and improved liver damage caused by immune
factors in mice. Inhibition of NF-κB activation is a key pathway to reduce
inammatory responses in liver injury [28]. For example, curcumin
signicantly down-regulates the expression of p-NF-κBp65 in liver, re-
duces TNF-
α
and IL-1β, and improves immune liver injury by inhibiting
NF-κB pathway [29]. This is consistent with the decrease in protein
expression of DCP in this experiment. TNF-
α
and IL-6 not only promote
liver inammation, but the pro-inammatory cytokines IL-1β also
initiate immune and inammatory responses, leading to hepatocyte
apoptosis or necrosis [30]. In this study, DCP inhibited the release of
TNF-
α
, IL-6 and IL-1β (Fig. 2), reducing inammation and thereby
protecting the liver. Ginsenosides reduce the release of inammatory
cytokines TNF-
α
, IL-6 and IL-1β, thereby reducing liver injury [31].
Angelica polysaccharide can protect the liver by inhibiting the release of
inammatory cytokines TNF-
α
, IL-6 and IL-1β and alleviating
LPS-induced immunological liver injury in mice [32]. Their research is
similar to the effect of using DCP to inhibit TNF-
α
, IL-6 and IL-1β in the
improvement of liver injury.
Liver injury is usually accompanied by hepatocyte inammation,
apoptosis and necrosis [33], and the role of DCP may be related to the
inhibition of apoptotic pathways. Apoptosis, also known as programmed
cell death, is a process in which cells automatically die under the
regulation of their own genetic mechanism under different physiological
and pathological conditions, and is the main procedure to exclude
harmful cells and excess cells in the body [34]. At present, the pathways
Fig. 6. Proposed model depicting the underlying mechanisms of DCP in regulating liver inammation responses and apoptosis in immune liver injury.
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
10
involved in apoptosis signaling pathways are death receptor pathway,
mitochondrial-dependent pathway and endoplasmic reticulum
pathway. Fas receptor ligand system is the main receptor-mediated
pathway to stimulate hepatocyte apoptosis. The extracellular mem-
brane region of hepatocytes contains a death domain associated with
apoptosis. When the cell surface contains a sufcient density of Fas
antigen, Fas and its ligand FasL combine to form oligomers, which
mediate downward transmission of Fas apoptosis signal [35]. FasI type
cells, after binding with their ligand FasL, activate Fas, attracting the
formation of another related protein (FADD) with the same death
domain in the cytoplasm. The FAS-FADD dimer activates FADD and
activates Caspase-8. The combination of FasII cells and ligands lead to an
increase in membrane permeability, thus convening and activating
Caspase-3, thereby triggering cascade reactions of the Caspases family,
which ultimately leads to apoptosis [36,37]. The Bcl-2 family protein is
often associated with hepatocyte apoptosis and necrosis in liver injury.
Bcl-2 protein is an important substance against cell apoptosis [38]. Bax,
a Bcl-2 family protein, binds to the Bcl-2 protein on the mitochondrial
membrane, thereby inhibiting the activity of Bcl-2 and promoting
apoptosis [39]. Both Bcl-2 protein and Bax can be widely positioned on
organelles such as mitochondrial membrane. Bcl-2 prevents the release
of pro-apoptotic protein cytochrome C into cytoplasm by stabilizing
mitochondrial membrane potential and maintaining mitochondrial
integrity [40]. Bax can form a heterodimer with Bcl-2 protein and
inactivate it, enhance the expression of Bax to form a homodimer, and
accelerate cell death [41]. In summary, Fas/FasL-mediated apoptosis
plays an important role in the occurrence and development of liver
injury. The experimental results showed that the DCP with different
concentration gradient could signicantly inhibit the protein expression
of Fas, FasL, FADD, Caspase-8, Caspase-3 and Bax, and increase the
expression level of Bcl2 (Figs. 3 and 5). This shows that the DCP has a
repairing effect on immune liver injury, which is related to the Fas/FasL
apoptosis pathway and its cascade reaction.
By blocking the NF-κB signaling pathway and inhibiting the activity
of Fas/FasL apoptotic pathway, we found that DCP alleviates LPS-
induced liver injury. DCP inhibits the NF-κB signaling pathway, result-
ing in the reduction of downstream inammatory factors TNF-
α
, IL-6, IL-
1β, reducing the inammatory response. On the other hand, it inhibits
the activity of Fas/FasL apoptosis pathway, reduces the proteins
expression of Fas, FasL, FADD, Caspase-8, Caspase-3 and Bax, increases
the expression level of Bcl2, and thus reduces apoptosis to protect the
liver (Fig. 6). The results of this study provide a new strategy for the
clinical treatment of immune liver injury by DCP.
Authors’ contributions
Ling Jin and Ya Gao designed the study; Qiongmei Xu, Jie Xu, Mingli
Zhong, performed experiments, Jie Xu, Riming Wei drew the gure and
the table; Qiongmei Xu, Kefeng Zhang, Houkang Cao, Ya Gao wrote the
manuscript. All authors read and approved the nal manuscript.
Declaration of Competing Interest
The authors report no declarations of interest.
Acknowledgements
This study was supported by National Natural Science Foundation of
China (81960779, 81760114, 81660104, 81860673), National Science
Foundation of Guangxi Province of China (2017GXNSFAA198218,
2017GXNSFAA198326 and 2018GXNSFAA281040), and Special fund-
ing for 2017 Guangxi BaGui Scholars.
References
[1] B.L. Woolbright, H. Jaeschke, Role of the inammasome in acetaminophen-
induced liver injury and acute liver failure, J. Hepatol. 66 (4) (2017) 836–848.
[2] G.A. Kullak-Ublick, R.J. Andrade, M. Merz, P. End, A. Benesic, A.L. Gerbes, G.
P. Aithal, Drug-induced liver injury: recent advances in diagnosis and risk
assessment, Gut 66 (6) (2017) 1154–1164.
[3] D.G. Koch, J.L. Speiser, V. Durkalski, R.J. Fontana, T. Davern, B. McGuire, R.
T. Stravitz, A.M. Larson, I. Liou, O. Fix, M.L. Schilsky, T. McCashland, J.E. Hay,
N. Murray, O.S. Shaikh, D. Ganger, A. Zaman, S.B. Han, R.T. Chung, R.S. Brown,
S. Munoz, K.R. Reddy, L. Rossaro, R. Satyanarayana, A.J. Hanje, J. Olson, R.
M. Subramanian, C. Karvellas, B. Hameed, A.H. Sherker, W.M. Lee, A. Reuben, The
natural history of severe acute liver injury, Am. J. Gastroenterol. 112 (9) (2017)
1389–1396.
[4] M. Sun, Z. Zhang, L. Bei, Y. Yang, Breviscapine reduces intestinal ischemia
reperfusion via inhibiting IκB-
α
/NF-κB/ICAM-1 pathway in a rat model, J. Pract.
Med. 33 (19) (2017) 3201–3204.
[5] J.A. DiDonato, F. Mercurio, M. Karin, NF-κB and the link between inammation
and cancer, Immunol. Rev. 246 (1) (2012) 379–400.
[6] Y.J.L. Byung Hyuk Han, Jung Joo Yoon, Eun Sik Choi, Seung Namgung, Xian
Jun Jin, Da Hye Jeong, Dae Gill Kang, Ho Sub Lee, Hwangryunhaedoktang exerts
anti-inammation on LPS-induced NO production by suppressing MAPK and NF-κB
activation in RAW264.7 macrophages, J. Integr. Med. 15 (4) (2017) 326–336.
[7] R.F. Schwabe, T. Luedde, Apoptosis and necroptosis in the liver: a matter of life and
death, Nat. Rev. Gastroenterol. Hepatol. 15 (12) (2018) 738–752.
[8] H.A. Khan, M.Z. Ahmad, J.A. Khan, M.I. Arshad, Crosstalk of liver immune cells
and cell death mechanisms in different murine models of liver injury and its
clinical relevance, Hepatobiliary Pancreat. Dis. Int. 16 (3) (2017) 245–256.
[9] F.J. Cubero, M.M. Woitok, M.E. Zoubek, A. de Bruin, M. Hatting, C. Trautwein,
Disruption of the FasL/Fas axis protects against inammation-derived
tumorigenesis in chronic liver disease, Cell Death Dis. 10 (2) (2019) 115.
[10] Y. Kitamura, S. Hashimoto, N. Mizuta, A. Kobayashi, K. Kooguchi, I. Fujiwara,
H. Nakajima, Fas/FasL-dependent apoptosis of alveolar cells after
lipopolysaccharide-induced lung injury in mice, Am. J. Respir. Crit. Care Med. 163
(3) (2001) 762–769.
[11] J. Zhao, T. Liu, L. Ma, M. Yan, Y. Zhao, Z. Gu, Y. Huang, Protective effect of
acteoside on immunological liver injury induced by Bacillus calmette-Guerin plus
lipopolysaccharide, Planta Med. 75 (14) (2009) 1463–1469.
[12] K. Zhang, Q. Xu, Y. Gao, H. Cao, Y. Lian, Z. Li, J. Xu, M. Zhong, J. Li, R. Wei,
Polysaccharides from Dicliptera chinensis ameliorate liver disturbance by
regulating TLR-4/NF-κB and AMPK/Nrf2 signalling pathways, J. Cell. Mol. Med. 24
(11) (2020) 6397–6409.
[13] K. Zhang, Z. Jiang, Toxicity experiment of polysaccharides from Dicliptera
chinensis (L.) Juss, Medicinal Plant 8 (1) (2017) 43–47.
[14] Y. Xu, Y. Gao, M. Zhong, J. Li, H. Cao, S. Huang, R. Wei, K. Zhang, Isolation,
characterization and bioactivities of the polysaccharides from Dicliptera chinensis
(L.) Juss, Int. J. Biol. Macromol. 101 (2017) 603–611.
[15] K. Zhang, Y. Gao, M. Zhong, Y. Xu, J. Li, Y. Chen, X. Duan, H. Zhu,
Hepatoprotective effects of Dicliptera chinensis polysaccharides on
dimethylnitrosamine-induced hepatic brosis rats and its underlying mechanism,
J. Ethnopharmacol. 179 (2016) 38–44.
[16] F. Peng, Z. Hua, Y. Shi-lian, Y. Hui-wen, Determination of polysaccharides in
Dicliptera chinensis (L.) Nees from various cultivation locations, Chin. J. Tradit.
Chin. Med. Pharm. (4) (2010) 626–628.
[17] M.P. Jiang, C. Xu, Y.W. Guo, Q.J. Luo, L. Li, H.L. Liu, J. Jiang, H.X. Chen, X.Q. Wei,
β-arrestin 2 attenuates lipopolysaccharide-induced liver injury via inhibition of
TLR4/NF-κB signaling pathway-mediated inammation in mice, World J.
Gastroenterol. 24 (2) (2018) 216–225.
[18] F.N. Chai, J. Zhang, H.M. Xiang, H.S. Xu, Y.F. Li, W.Y. Ma, X.G. Li, X.L. Ye,
Protective effect of Coptisine from Rhizoma Coptidis on LPS/D-GalN-induced acute
liver failure in mice through up-regulating expression of miR-122, Biomed.
Pharmacother. 98 (2018) 180–190.
[19] M. Bachmann, J. Pfeilschifter, H. Mühl, A prominent role of Interleukin-18 in
acetaminophen-induced liver injury advocates its blockage for therapy of hepatic
necroinammation, Front. Immunol. 9 (2018) 161.
[20] Z. Do˘
ganyi˘
git, A. Okan, E. Kaymak, D. Pandır, S. Silici, Investigation of protective
effects of apilarnil against lipopolysaccharide induced liver injury in rats via TLR
4/ HMGB-1/ NF-κB pathway, Biomed. Pharmacother. 125 (2020), 109967.
[21] Z. Ge, C. Wang, J. Zhang, X. Li, J. Hu, Tempol protects against acetaminophen
induced acute hepatotoxicity by inhibiting oxidative stress and apoptosis, Front.
Physiol. 10 (2019) 660.
[22] N. Mishra, K.S. Yadav, V.K. Rai, N.P. Yadav, Polysaccharide encrusted multilayered
nano-colloidal system of andrographolide for improved hepatoprotection, AAPS
PharmSciTech 18 (2) (2017) 381–392.
[23] I. Hwang, M.J. Uddin, E.S. Pak, H. Kang, E.J. Jin, S. Jo, D. Kang, H. Lee, H. Ha, The
impaired redox balance in peroxisomes of catalase knockout mice accelerates
nonalcoholic fatty liver disease through endoplasmic reticulum stress, Free Radic.
Biol. Med. 148 (2020) 22–32.
[24] X. Chen, H. Yuan, F. Shi, Y. Zhu, Effect of garden cress in reducing blood glucose,
improving blood lipids, and reducing oxidative stress in a mouse model of diabetes
induced by a high-fat diet and streptozotocin, J. Sci. Food Agric. 100 (5) (2020)
2074–2081.
[25] G.L. Yang, L.Q. Jia, J. Wu, Y.X. Ma, H.M. Cao, N. Song, N. Zhang, Effect of
tanshinone IIA on oxidative stress and apoptosis in a rat model of fatty liver, Exp.
Ther. Med. 14 (5) (2017) 4639–4646.
Q. Xu et al.

Biomedicine & Pharmacotherapy 134 (2021) 111159
11
[26] C. Han, Y. Wei, X. Wang, Y. Cui, Y. Bao, W. Shi, Salvia miltiorrhiza polysaccharides
protect against lipopolysaccharide-induced liver injury by regulating NF-κb and
Nrf2 pathway in mice, Food Agric. Immunol. 30 (1) (2019) 979–994.
[27] R. Li, J. Li, Y. Huang, H. Li, S. Yan, J. Lin, Y. Chen, L. Wu, B. Liu, G. Wang, T. Lan,
Polydatin attenuates diet-induced nonalcoholic steatohepatitis and brosis in mice,
Int. J. Biol. Sci. 14 (11) (2018) 1411–1425.
[28] Y. Tian, Z. Li, B. Shen, Q. Zhang, H. Feng, Protective effects of morin on
lipopolysaccharide/d-galactosamine-induced acute liver injury by inhibiting
TLR4/NF-κB and activating Nrf2/HO-1 signaling pathways, Int.
Immunopharmacol. 45 (2017) 148–155.
[29] D. Feng, J. Zou, D. Su, H. Mai, S. Zhang, P. Li, X. Zheng, Curcumin prevents high-
fat diet-induced hepatic steatosis in ApoE(-/-) mice by improving intestinal barrier
function and reducing endotoxin and liver TLR4/NF-κB inammation, Nutr.
Metab. 16 (2019) 79.
[30] M.S.H. Akash, K. Rehman, A. Liaqat, Tumor necrosis factor-alpha: role in
development of insulin resistance and pathogenesis of type 2 diabetes mellitus,
J. Cell. Biochem. 119 (1) (2018) 105–110.
[31] Y. Xin, J. Wei, M. Chunhua, Y. Danhong, Z. Jianguo, C. Zongqi, B. Jian-An,
Protective effects of Ginsenoside Rg1 against carbon tetrachloride-induced liver
injury in mice through suppression of inammation, Phytomedicine 23 (6) (2016)
583–588.
[32] K. Wang, Z. Song, H. Wang, Q. Li, Z. Cui, Y. Zhang, Angelica sinensis
polysaccharide attenuates concanavalin A-induced liver injury in mice, Int.
Immunopharmacol. 31 (2016) 140–148.
[33] W. Liu, Z.T. Jing, C.R. Xue, S.X. Wu, W.N. Chen, X.J. Lin, X. Lin, PI3K/AKT
inhibitors aggravate death receptor-mediated hepatocyte apoptosis and liver
injury, Toxicol. Appl. Pharmacol. 381 (2019), 114729.
[34] D.R. Green, J.C. Reed, Mitochondria and apoptosis, Science 281 (5381) (1998)
1309–1312.
[35] K. Shams, K. Kalantar, M.H. Karimi, M. Nasiri, A. Afshari, Z. Amirghofran, Fas, FasL
and Foxp3 gene expression in post-liver transplant autoimmune hepatitis patients
with and without acute rejection, Clin. Exp. Hepatol. 5 (2) (2019) 103–108.
[36] X.Y. Li, T. Li, X.J. Li, J.N. Wang, Z. Chen, TSG-6 induces apoptosis of human
hypertrophic scar broblasts via activation of the Fas/FasL signalling pathway,
Folia Biol. (Praha) 64 (5–6) (2018) 173–181.
[37] S. Yao, H. Tian, C. Miao, D.W. Zhang, L. Zhao, Y. Li, N. Yang, P. Jiao, H. Sang,
S. Guo, Y. Wang, S. Qin, D4F alleviates macrophage-derived foam cell apoptosis by
inhibiting CD36 expression and ER stress-CHOP pathway, J. Lipid Res. 56 (4)
(2015) 836–847.
[38] L. Wei, Q. Chen, A. Guo, J. Fan, R. Wang, H. Zhang, Asiatic acid attenuates CCl(4)-
induced liver brosis in rats by regulating the PI3K/AKT/mTOR and Bcl-2/Bax
signaling pathways, Int. Immunopharmacol. 60 (2018) 1–8.
[39] C.M. Knudson, S.J. Korsmeyer, Bcl-2 and Bax function independently to regulate
cell death, Nat. Genet. 16 (4) (1997) 358–363.
[40] K. McArthur, L.W. Whitehead, J.M. Heddleston, L. Li, B.S. Padman, V. Oorschot, N.
D. Geoghegan, S. Chappaz, S. Davidson, H. San Chin, R.M. Lane, M. Dramicanin, T.
L. Saunders, C. Sugiana, R. Lessene, L.D. Osellame, T.L. Chew, G. Dewson,
M. Lazarou, G. Ramm, G. Lessene, M.T. Ryan, K.L. Rogers, M.F. van Delft, B.T. Kile,
BAK/BAX macropores facilitate mitochondrial herniation and mtDNA efux during
apoptosis, Science 359 (6378) (2018).
[41] K.J. Campbell, S.W.G. Tait, Targeting BCL-2 regulated apoptosis in cancer, Open
Biol. 8 (5) (2018), 180002.
Q. Xu et al.