ArticlePDF Available

Enhanced growth and yield of oyster mushroom by growth‐promoting bacteria Glutamicibacter arilaitensis MRC119

Authors:

Abstract

Promotion of mushroom growth by means of biological agents replacing chemicals is an emerging and highly demanded issue in the sector of mushroom cropping. The present study was aimed to search for a novel bacterium potentially able to enhance mushroom growth and yield. A total of 2165 bacterial isolates purified from different samples were scrutinized through various growth‐promoting attributes. As a consequence of rigorous screening, 26 isolates found exhibiting positive traits of mushroom growth promotion. Thereafter, in response to the cocultivation (fungus and bacteria), a potent bacterial strain was isolated capable to improve significantly the mycelial growth. In cocultivation the highest radial and linear growth rate was 7.6 and 8.1 mm/day on 10th and 11th days, respectively. The fruitbody yields and biological efficiency (BE) of the inoculated sets were 28% and 58% higher than the uninoculated control sets. The bacterium was molecularly identified based on 16S ribosomal RNA sequencing and confirmed as Glutamicibacter arilaitensis MRC119. Therefore, the bioinoculant of the current bacterium can be potentially useful as an ecofriendly substitute stimulating the production of mushroom fruit bodies with improved BE.
Received: 15 June 2020
|
Revised: 25 July 2020
|
Accepted: 28 November 2020
DOI: 10.1002/jobm.202000379
RESEARCH PAPER
Enhanced growth and yield of oyster mushroom by
growthpromoting bacteria Glutamicibacter arilaitensis
MRC119
Simpal Kumari |Ram Naraian
Department of Biotechnology, Faculty of
Science, Mushroom Training and
Research Center (MTRC), Veer Bahadur
Singh Purvanchal University, Jaunpur,
Uttar Pradesh, India
Correspondence
Ram Naraian, Department of
Biotechnology, Faculty of Science,
Mushroom Training and Research Center
(MTRC), Veer Bahadur Singh Purvanchal
University, Jaunpur, Uttar Pradesh
222003, India.
Email: ramnarain_itrc@rediffmail.com
Funding information
Science and Engineering Research Board
(SERB), Ministry of Science and
Technology, Govt. of India, New Delhi,
India, Grant/Award Number:
SB/EMER022/2013
Abstract
Promotion of mushroom growth by means of biological agents replacing
chemicals is an emerging and highly demanded issue in the sector of mush-
room cropping. The present study was aimed to search for a novel bacterium
potentially able to enhance mushroom growth and yield. A total of 2165
bacterial isolates purified from different samples were scrutinized through
various growthpromoting attributes. As a consequence of rigorous screening,
26 isolates found exhibiting positive traits of mushroom growth promotion.
Thereafter, in response to the cocultivation (fungus and bacteria), a potent
bacterial strain was isolated capable to improve significantly the mycelial
growth. In cocultivation the highest radial and linear growth rate was 7.6 and
8.1 mm/day on 10th and 11th days, respectively. The fruitbody yields and
biological efficiency (BE) of the inoculated sets were 28% and 58% higher than
the uninoculated control sets. The bacterium was molecularly identified based
on 16S ribosomal RNA sequencing and confirmed as Glutamicibacter
arilaitensis MRC119. Therefore, the bioinoculant of the current bacterium can
be potentially useful as an ecofriendly substitute stimulating the production of
mushroom fruit bodies with improved BE.
KEYWORDS
bioinoculant, biological efficiency, Glutamicibacter sp., Pleurotus sp., mycelial growth rate
1|INTRODUCTION
Biological approaches particularly the use of growth
stimulating microorganisms to improve crop growth and
yield have been extensively practiced for ecoand
agriculturefriendly cropping worldwide. Beneficial mi-
crobes not only promote growth but also maintain the
health and development of individual plants [1]. Though,
the use of chemical and biological additives has
shortened the crop and enhances the yield of oyster
mushrooms but only up to a certain limit [2]. Potent
microbial population indeed plays a very crucial role in
mycelial growth and other cultivation stages of mush-
rooms including fructification [3]. Various bacterial
species belonging to particularly genus Pseudomonas
may play a significant role in the artificial growing of
edible mushrooms [4]. The knowledge about the role of
microorganisms in the development of mushrooms is
J Basic Microbiol. 2020;110. www.jbm-journal.com © 2020 WileyVCH GmbH
|
1
Abbreviations: ACC deaminase, 1aminocyclopropane1carboxylic acid deaminase; BE, biological efficiency; IAA, indole acetic acid; MGPB,
mushroom growthpromoting bacteria; SEM, scanning electron microscopy.
still insufficient and needs further research. However, it
has been speculated that growth stimulatory bacteria
responds in mushroom growth promotion and pro-
ductivity enhancement through secretion of growth
hormones, catabolism of inhibitory volatiles produced
from vegetative mycelia, phosphate solubilization, side-
rophore production, 1aminocyclopropane1carboxylic
acid deaminase (ACC deaminase), and so forth [5,6]. A
typical soil bacterium of Arthrobacter genera has been
reported to be present during the initial stages of fruit-
body development in basidiomycetes [7]. The genera is
currently known as Glutamicibacter arilaitensis (formerly
Arthrobacter arilaitensis)[810].
The use of bioinoculant with mushroom growth media
with improvements was successfully investigated the first
time by Ahlawat and Rai [11]. Various contemporary stu-
dies have discovered that interaction among fungi and
bacteria create physically and metabolically interdependent
consortia distinct from their single partner [12]. The phy-
sical contact between fungi and bacteria can change their
physiology and the pattern of interactions. Nutritional
exchanges and competition between fungal and bacterial
partners for dynamic relationships are documented to aid
the general growth requirements through metabolite
conversion [13]. Generally, bacteria associated with fungal
mycelia first respond with an increase in the rate of hyphal
extension, and second by the stimulation and formation of
primordia [14]. The addition of specific bacteria potentially
can stimulate the growth and fruiting of Pleurotus and
Agaricus mushrooms, because fruit bodies are dependent
not only on the substrate itself but also on bacteria and
other fungi present in the substrate [3,15]. In comparison to
Agaricus bisporus, the effects of the bacteria on Pleurotus
ostreatus are less understood [16].
Therefore, the present study mainly focuses on the
isolation purification, screening, characterization, and
molecular identification of mushroom growth and yield
promoting bacterium. The isolated bacterium was further
evaluated for its stimulatory effect on the mycelial
growth rates and cultivation of oyster mushrooms in
terms of fruitbody yield and biological efficiency (BE) of
oyster mushrooms. The study would play a significant
role in the approach of sustainable and environmentally
friendly cultivation of mushrooms.
2|MATERIALS AND METHODS
2.1 |Sampling and purification of
bacteria
Soil samples from the rhizosphere of different crops from
various districts of Eastern Uttar Pradesh (82°59East,
25°15North and 82°33East, 25°8North) were collected
during variable seasons of consecutive years (20152018).
The collected samples were aseptically brought to the la-
boratory in sterile plastic bags, stored at 4°C during trans-
port and the microbiological studies were performed within
24 h. The collected samples were used for the isolation of
bacteria using the serial dilution method followed by the
pour plate technique. For this purpose, 1 g of the soil was
mixed in 2 ml of sterile water and shaken properly.
Thereafter, aliquots (1 ml) of the soil solution were plated
on nutrient agar (HiMedia Laboratories) and incubated at
37°C ± 1°C for 3 days. Then, discrete colonies of bacteria
differentiated by morphology and pigmentation were
picked up and subcultured to purify through successive
streaking on nutrient agar plates.
2.2 |Media and culture conditions for
bacteria
The purified bacterial isolates were preserved on nutrient
agar media (peptone, 5 g; HM peptone B, 1.5 g; yeast
extract, 1.5 g; NaCl, 5 g; agar, 15 g in 1000 ml of distilled
water; pH 7.4; HiMedia Laboratories) at 37°C ± 1°C. The
culture of each isolate was maintained in culture tubes
by frequent subculturing every fortnightly.
2.3 |Mushroom strain
The culture of oyster mushroom (Pleurotus florida PF05)
was obtained from the culture collection of Mushroom
Training and Research Center (MTRC), Veer Bahadur
Singh Purvanchal University, Jaunpur Uttar Pradesh,
India. The P. florida PF05 belongs to saprobiotic white
rot basidiomycete edible fungi; it is easy to cultivate, it
has good nutritional value and it gives good yields. It was
cultured on Potato Dextrose Agar (peeled, sliced, and
boiled potato, 200 g; dextrose, 20 g; agar, 20 g in 1000 ml
of distilled water) and maintained in culture tubes at
22°C ± 1°C by frequent subculturing every fortnightly.
2.4 |Screening of mushroom
growthpromoting bacteria (MGPB)
To screen MGPB, morphologically and physiologically dis-
tinct isolates were subjected to various mushroom growth
promoting tests. The screening was performed based on
mushroom growthpromoting traits including phosphate
solubilization, siderophore production, indole acetic acid
(IAA) production, HCN production, ammonia production,
and ACC deaminase activity employing the standard
2
|
KUMARI AND NARAIAN
methods. Chosen strains were finally cocultivated with
fungal mycelia to select growthpromoting bacterium on
the bases of the mycelial elongation and the growth rate.
2.5 |In vitro radial growth test
Radial growth of fungal mycelia was evaluated in the
presence and the absence of bacteria on PDA plates
according to the modified method of Kim et al. [17]. For
this, a 0.5ml aliquot of overnight grown diluted bacterial
culture (colonyforming units [CFU] 10
8
cell/ml) was
spread on preprepared potato dextrose agar plates using a
spreader. Mycelial plugs of 9mm diameter from the edge
of the growing colony were cut using cork borer and
placed at the center of plates containing a lawn of test
bacteria followed by the incubation of plates at
25°C ± 1°C for 4 days whereas, control plate contained
no inoculum of bacterial culture. Thereafter, mycelial
growth in each plate was measured using a ruler both on
the longest and shortest widths of fungal colonies and an
average was calculated. The measurement of colony
diameter was repeated three times at intervals of 6, 8, and
10 days. All sets of radial growth tests were performed in
ten experimental replicates (n= 10) (Table S1).
2.6 |In vitro linear growth test
The linear growth of the fungus was determined by
growing fungus in test tubes containing wheat straw
soaked with distilled water overnight and sterilized by
autoclaving at 121°C for 40 min. After cooling sterilized
wheat straw was inoculated with a 0.2ml aliquot of di-
luted liquid culture (CFU 10
8
cell/ml) of bacteria. Tubes
were then inoculated on their opening ends with a
7dayold mycelial plug touching the wheat straw sub-
strate and incubated at 25°C ± 1°C for 5 days to investigate
the influence of bacteria on mycelial growth. Control sets
were not inoculated with bacteria, they contained only
mycelial plugs. The linear growth of mycelia was mea-
sured after 5 days and the growth rate was calculated as
mm/day [18]. The presence of the introduced bacterium
and its viability was culturally assured in all sets of linear
growth tests. The tests of linear growth were performed in
10 experimental replicates (n= 10) (Table S1).
2.7 |Cultivation of oyster mushroom
with bacterial inoculum
Cultivation of oyster mushroom P. florida PF05 was
performed in 16 × 18cm sized polythene bags. The
spawning in all cultivation bags was done uniformly
employing seed spawn with a ratio of 2% (w/w) through a
layerwise manner. The substrate was supplemented
with a 10ml aliquot of diluted bacterial broth (CFU 10
8
cell/ml) before spawning whereas; sets not added with
bacteria were treated as uninoculated control. Before the
use of culture, it was centrifuged at 5000 g for 10 min in a
cooling centrifuge machine (Remi Pvt Ltd.) to separate
the extent of nutrient media. The spawned bags were
then tightly closed and kept in a cooled dark room
followed by regular monitoring to record complete
mycelia run. When the mycelial run was completed the
bags were uncovered by removing polythene bags and
subjected to regular irrigation with 120 ml of sterile water
per bed. The treatments of cultivation beds with diluted
bacterial culture (CFU 10
8
cells/ml) were further
repeated two subsequent times through minute drop
sprinkling and then waited for primordia initiation. The
colonization success and viability of introduced bacter-
ium on wheat straw was culturally confirmed in all sets
of polybag cultivation. The harvesting of matured fruit
bodies (when margins started curling) from the cultiva-
tion beds was performed by pressing and twisting
gently. The fruit bodies were separately harvested from
every flush of mushroom growth. The experiment was
conducted in three identical replicates (n= 3).
2.8 |Evaluation of fruitbody yield and
biological efficiency
Total numbers of fruiting bodies harvested from all flu-
shes were weighed and the total yield of mushroom was
calculated as per kg wet substrate [19]. However, BE was
calculated using the following formula.
B
E(%) = Weightofthefruitbodies
Dryweightofsubstrate × 100
.
2.9 |Scanning electron
microscopy (SEM)
The preparation of specimens for the SEM was per-
formed according to the modified method of Zivanovic
et al. [20]. The fungal mycelia grown on PDA for 8 h were
fixed employing modified Karnovsky's fixative containing
1.5% glutaraldehyde and 2.5% paraformaldehyde pre-
pared in 0.1 M cacodylate buffer (pH 7.4) for 24 h.
Thereafter sample mycelia were removed from the fixa-
tive and rinsed three times in 0.1 M phosphate buffer (pH
7.4), for 5 min every time. The dehydration of samples
was done with a series of ethanol at 50%, 60%, 70%, 80%,
KUMARI AND NARAIAN
|
3
90%, and 95% (v/v) for 5 min of exposure in each con-
centration, followed by the two 5min treatments with
absolute ethanol to complete dehydration. Thus prepared
samples were rinsed in 1,1,1,3,3,3hexamythyldisilazane
solution and stored at ambient temperature for 24 h to air
dry. After drying dehydrated samples were then sputter
coated with gold to a thickness of 20 nm. Observation for
obtaining photographs, samples were observed under
Octane SuperA SEM at 10 kV.
2.10 |Biochemical characterization
Biochemical characterization of the potent isolate was
carried out through multiple biochemical tests, namely,
catalase, oxidase, indole production, Vogusproskaur,
methyl red, citrate utilization, nitrate reduction, gelatin
liquefaction, urease hydrolysis, H
2
S production, glucose,
mannitol, sucrose, and lactose fermentation as per
Bergey's Manual of Determinative Bacteriology [21].
2.11 |Genomic DNA extraction
The extraction of genomic DNA was performed according to
the standard protocol described by Sambrook et al. [22].
Overnight grown bacterial culture in LuriaBertani broth
was centrifuged at 8000 rpm for 10 min to harvest cells. The
bacterial pellet was suspended into 400 µl of TrisEDTA (TE)
buffer, and added with 32 µl of lysosome and incubated at
37°C for 30 min. Thereafter the 100 µl of 0.5 mM EDTA was
added following the addition of 60 µl of 10% SDS and 1.5 µl
of proteinase K (50 µl/m,) respectively and incubated at 50°C
for 60 min. The tubes were then brought to room tempera-
ture and 250 µl mixture of phenol:chloroform:isoamylalcohol
(25:24:1) was added and centrifuged at 1000 rpm for 10 min.
After centrifugation, the aqueous phase was transferred into
different tubes and the solution of RNase with a final con-
centration of 50 µl/ml was supplemented and the mixture
was incubated at 60°C for 1 h. Following the incubation, the
content of DNA was precipitated using icecold ethanol and
collected through centrifugation (1000 rpm) for 10 min. The
pellets thus obtained were washed with 70% ethanol and
after air drying, it was resuspended in l00 μl of TE buffer
(pH 8.0) for further uses.
2.12 |Polymerase chain reaction (PCR)
amplification and 16S ribosomal RNA
(rRNA) sequencing
The 16S rRNA gene from the genomic DNA of bacteria
was amplified using PCR with universal primer
including forward (fd1) AGAGTTTGATCCTGGCTCAG
and reverse rd1 primer (AAGGAGGTGATCCAGCC).
The isolated DNA was amplified with 16S rRNA specific
primer (8F and 1492R) using Veriti® 96 well Thermal
cycler (Model No. 9902). The fragment of 16S rRNA gene
was enzymatically purified and subjected to Sanger se-
quencing protocol. Forward and reverse DNA sequen-
cing reaction of PCR amplicon was carried out with 8F
and 1492R primer using BDT v3.1 Cycle sequencing kit
on ABI 3730xI Genetic Analyzer. The consensus se-
quence of 16S rDNA was generated from forward and
reverse sequence data using aligner software.
2.13 |Phylogenetic analysis
The phylogenetic analysis of the 16S rRNA sequence was
carried out by using the Maximum Likelihood method
based on the Kimura 2parameter model [23]. The first
ten sequences were selected based on the maximum
identified score and aligned using multiple alignment
software program Clustal W tool. Evolutionary distance
analyses were conducted using molecular evolutionary
genetics analysis version 6.0 (MEGA 6) [24]. The evolu-
tionary history was inferred by using the Maximum
Likelihood method by the Kimura2 parameter model.
However, the evolutionary history of taxa was carried out
by a bootstrap consensus tree inferred from 1000 re-
plicates. Bootstrap replicates are collapsed less than 50%
in corresponding branches. The associated taxa clustered
together in the bootstrap test (1000 replicates) replicate
tree percentage are shown next to the branches [25].
NeighborJoin and BioNJ algorithms were applied for the
initial tree heuristic search.
2.14 |Statistical analysis
For statistical analysis of the data; analysis of variance was
performed using a statistical package for the social sciences
(SPSS 16.0). Multiplecomparison ttests for the least sig-
nificant difference were conducted to compare every mean
with the control of their respective treatment (p<.05).
3|RESULTS
3.1 |Isolation and purification of
bacterial isolates
In order of the isolation, purification, and screening of
MGPB, initially, several bacterial isolates of different
morphology and pigmentation were purified from the
4
|
KUMARI AND NARAIAN
varied sources of randomly collected soil samples of
different sites. Different bacterial colonies were picked
according to their variable shape, size, and coloring
pigments with many other distinguishing characteristics.
Therefore, a total number of 2165 distinct isolates were
achieved from the 147 randomly collected soil samples.
Furthermore, these 2165 bacterial isolates were in-
dividually analyzed with the criteria of mushroom
growthpromoting effect on mycelial elongation. The
attempt of isolation of the bacteria from the mushroom
substrate was also made but none of the isolates
responded positively.
3.2 |Screening of MGPB through
mycelial growthpromoting activity
All 2165 bacterial isolates were subsequently subjected to
six important mushroom growth promontory tests such
as; ACC deaminase, HCN, IAA, siderophore production,
nitrogen reductase, and phosphate solubilization tests
were conducted to characterize the selected MGPBs. As a
consequence, out of 2165 isolates total of 26 isolates were
screened out exhibiting mushroom growthpromoting
effects. Later on, the 26 mushroom growthpromoting
isolates were further analyzed and screened with the
radial and linear growth tests of mushroom mycelia.
After rigorous screenings from 26 isolates, only a single
isolate was found exhibiting a positive and stimulating
effect on the mycelia elongation. Bacterial isolate ex-
hibiting the enormous potential of mycelia growth pro-
motion was consequently subjected to radial and linear
growth tests for further confirmation as MGPB.
3.3 |Impact of bacteria on radial
growth rate (RGR)
The addition of bacterial inoculum to mushroom mycelia
remarkably increased hyphal elongation resulting in
healthy and cottony whitish mycelial growth on solid
media. The hyphal extension was recorded both in the
presence and absence of the bacterial inoculum. The sets
inoculated with bacteria was tainted from dark brown to
light, whereas control remains unaffected. After 3 days of
incubation mycelial growth started and the influence of
bacterial inoculum was visible, which was better in con-
trast to control. After 6 days of incubation mycelial growth
rate of 4.1 mm/day was recorded in inoculated sets,
whereas in control sets it was 3.6 mm/day. The growth
rate of fungal mycelia on eighth day of incubation was
7.2 mm/day, which was much higher than 3.8 mm/day
in control. Furthermore, the growth promotion of mycelia
in test plates recorded was 7.6 mm/day on the 10th day of
incubation and the control set showed a lesser growth rate
of 4.1 mm/day. Therefore, the highest growth rate
(7.6 mm/day) of mycelia was recorded on 10th day of
incubation (Figure 1a,b), which was the utmost rate of
FIGURE 1 Influence of bacterial inoculant on the mycelial growth rate of oyster mushroom Pleurotus florida PF05. (a) In vitro radial
growth test, (b) radial growth rate of mushroom mycelia, (c) in vitro linear growth test, and (d) linear growth rate of mushroom mycelia
KUMARI AND NARAIAN
|
5
mycelia elongation. After analyzing the data it was
obvious that bacterial inoculation with fungal culture
designed for cocultivation significantly (p<.05)improved
the mycelial extension rate.
3.4 |Impact of bacteria on linear
growth rate
The linear growth rate of mycelia was investigated by
inoculating culture tubes filled with a moistened wheat
straw with bacterial inoculation. The remarkable
enhancement in linear growth rate was recorded in the
sets containing substrate inoculated with bacterial cul-
ture, whereas control sets devoid of bacterial culture
represented a comparatively slower growth rate. The
growth rates of mycelia in the set of inoculated tubes can
be represented as 4.66, 6.33, and 8.1 mm/day during 7th,
9th, and 11th days of incubations respectively. Whereas,
uninoculated controls correspondingly resulted in lower
growth rates as 3.16, 4.16, and 4.5 mm/day, which were
comparatively much slower to inoculated sets. Hence,
the inoculation of the substrate with the MGPB stimu-
lated the growth rate and elongation of mycelia sig-
nificantly (p< .05) above uninoculated control sets
(Figure 1c,d).
3.5 |Effect of bacterial culture on
fruitbody yield and BE
To evaluate the response of bacterial treatment on total
yield and BE of mushroom, the fruit bodies were sepa-
rately harvested from treated and untreated sets. The
fruitbodies from three subsequent flushes were weighed
accurately and combined to calculate the total yield. The
number of flushes was not differed in response to bac-
terial treatments rather each flush varied in the fruitbody
yields. It was observed that the inoculation of bacterial
inoculum enhanced the yield 28% (w/w) significantly
(p< .05) over uninoculated controls. However, the BE of
the treated beds was also improved and it was recorded
as 58% higher to uninoculated control sets. Therefore,
the bacterium was found to be not only increasing the
mycelial growth but also enhanced the yield and BE
of oyster mushroom P. florida PF05 (Figure 2).
3.6 |Biochemical characterization
of MGPB
The potent bacterial isolate achieved after rigorous
investigations of growthpromoting traits, radial and
linear growth tests was accordingly confirmed as
MGPB and various morphological, biochemical, and
physiological tests were done for its characterization.
Morphologically rodshaped bacteria showed positive
key characters of Grampositive, catalase, indole pro-
duction, Vogusproskaur test, citrate utilization, nitrate
reduction, gelatin liquification, urease, ACC deami-
nase, siderophore, and fermentation of the glucose,
mannitol, sucrose in addition of lactose. However, it
exhibited negative results with endospore stain, KOH,
motility, oxidase, methyl red tests,H
2
SandHCNpro-
duction, and phosphate solubilization. All the above
mentioned standard biochemical tests were performed
in triplicates (n= 3). On the basis of the results
obtained and according to the classification scheme
of Bergey's Manual of Determinative Bacteriology
the presumptive genus level was established as
Arthrobacter (presently Glutamicibacter arilaitensis),
which is a Grampositive and nonendospore forming
rodshaped bacteria.
3.7 |SEM of fungus and MGPB
SEM was performed for morphological observations of
mushroom mycelia, MGPB, and the integrative interac-
tion of both fungus and bacteria grown in cocultivation.
MGPBs were Grampositive, nonendospore forming,
rodshaped bacteria with spherical ends. However, mi-
croscopic observation of fungus revealed the clear fila-
mentous appearance of mycelium with long branches,
FIGURE 2 Oyster mushroom Pleurotus
florida PF05 cultivated on wheat straw
substrate inoculated with mushroom
growthpromoting bacteria
6
|
KUMARI AND NARAIAN
which typically created an intertwined mycelial network.
The electron microscopy visualization of the cocultiva-
tion (Fungus + MGPB) revealed an appearance of fungal
mycelia (hyphae) thicker and healthier than the unin-
oculated mycelia. In the microscopic image of coculti-
vation, it is visible that the interaction (attachment of
bacterial cell with hyphae) of bacteria with mushroom
mycelia improved the health of mycelia, and conse-
quently, this association was found to be mutually ben-
eficial for both MGPB and fungal hyphae (Figure 3a,b).
3.8 |Phylogenetic tree of MGPB
A phylogenetic tree was constructed based on the com-
parison of 16S rRNA sequences of MGPB strain with other
closely related bacterial strains, which were available from
the GenBank database online. For the phylogenetic tree
construction, a basic local alignment search tool (BLAST)
of the National Center for Biotechnology Information
(NCBI) (www.ncbi.nlm.nih.gov/gene)withpreviously
available sequences was performed. On the basis of nu-
cleotide homology and phylogenetic analysis the bacterial
strain, which was labeled as MRC119 (GenBank:
MN626391) showed the highest similarity with Glutamici-
bacter arilaitensis (formerly Arthrobacter arilaitensis)based
on nucleotide homology and phylogenetic analysis. On the
basis of the 16S rRNA sequencing, the isolated strains,
therefore, were identified and confirmed as Glutamicibacter
arilaitensis MRC119 (GenBank accession: MN626391). The
partial nucleotide sequence of a total 801base pair long 16S
rRNA gene has been successfully submitted in the database
of the National Center for Biotechnology Information
(NCBI) which is available online on the official website of
NCBI (https://www.ncbi.nlm.nih.gov/nuccore/MN626391)
with an accession number of MN626391. The phylogenetic
neighborjoining tree constructed in this analysis is
represented in Figure 4.
4|DISCUSSION
The occurrence of beneficial microorganisms with the
substrates used for the cultivation of mushrooms stimu-
lates the growth and the primordia formation. Several
studies have reported the application of beneficial mi-
crobes for improving the productivity of edible mush-
rooms [6,16,17], particularly product quality and
uniformity [26]. Some bacteria have the potential to
promote mycelial growth and yield of edible mushrooms
through the production and secretion of some biologi-
cally active compounds such as phytohormones [27].
Azotobacter,Bacillus,Paenibacillus, and Pseudomonas
have been reported as nutritional supplements/bio-
fertilizers [28] in mushroom cultivation. Therefore, new
bacterial isolates are selected and identified for fungal
growth and yield promotion with an ecofriendly
approach. It is known that MGPB strongly synthesizes
and secrete various known and unknown growth
stimulating compounds in addition to ACC deaminase
enzymes, phosphate solubilizing enzymes, siderophores,
and enzymes involved in nitrogen fixation [29]. There-
fore, we have isolated and successfully screened out
26 bacterial isolates based on their growthpromoting
biochemical characteristics.
The mycelial growth stimulation was determined in
terms of growth rate by measuring the linear growth of
mycelia in response to bacterial treatments and we re-
vealed a single isolate significantly stimulating the ex-
tension of fungal mycelia. The identified bacterium
Glutamicibacter arilaitensis is reported as a homotypic
synonym of Arthrobacter arilaitensis [30,31] exhibiting
similar physiological characteristics. Notably, some iso-
lates in the study showed negative or no effect on the
mushroom growth which could be due to the interaction
between bacteria and fungi [6]. Our results are in
agreement with previous studies, which have suggested
the growth stimulatory role of bacteria [32]. Similar
FIGURE 3 Scanning electron microscopy of the (a) fungal mycelia after 5 days of growth, (b) interaction established by fungal mycelia
and bacterial cells attached over it to influence the mycelia (magnification: ×5.00 K)
KUMARI AND NARAIAN
|
7
investigations of positive interaction were also reported
during cocultivation of whiterot fungus P. florida and a
fluorescent pseudomonas bacterium [16]. In a distinct
study, Azotobacter sp. synergistically increased the linear
growth of oyster mushroom P. eous [32]. Kim et al. [17]
reported that Pseudomonas sp. P7014 enhanced the
growth of the edible oyster mushroom P. eryngii in bottle
cultures. Kang and Cho [33] suggested that Pseudomonas
sp. P7014 secretes IAA that plays an important role in
promoting the growth of oyster mushroom P. eryngii
mycelia. In recent studies, it was found that bacteria with
nitrifying properties were more active in mushroom
compost that increases the extractable nitrate in the
compost [34,35], and plays a role in mushroom growth
promotion.
The inoculation of mushroom growth stimulatory
bacteria enhanced the yield and BE of oyster mushroom
Pleurotus florida PF05 as compared to uninoculated
substrates. A wide range of microbes establishes a variety
of interactions among bacteria and fungi ranging from
antagonism to mutualism [3,36]. Many mutualistic bac-
teria create mushroom substrate benefits to fungal my-
celia and influences the fruitbody yield and BE of
mushrooms. In a previous study Bacillus subtilis pro-
moted the mushroom yield when applied in lower con-
centrations [37]. Similarly an enhancement of fruiting
body yield in Pseudomonas sp. P7014 inoculated cultures
were also achieved [17]. Addition of Pseudomonas sp.
P7014 to cultures resulted in the earlier initiation of
primordia compared to control of P. eryngii. Likewise,
Young et al. [1] reported a significant increase, 64% in
yield of Agaricus blezzi inoculated with two bacterial
isolates Exignobacterium sp. (JN03) and Arthobacter sp.
(JN12) over uninoculated cultures. Moreover, bacterial
inoculation was also able to reduce the cropping period
and increase fresh mushroom yield up to 215% [38].
Mohammad and Sabaa [39] also recorded a 26.6%
increase in mushroom yield when inoculated with
Pseudomonas putida in comparison with noninoculated
sets. Contrary to these observations [39] a negative effect
of Pseudomonas aeruginosa and Pseudomonas tolaasii up
to 70. 55% and 72.56% decrease in the yield of mushroom.
Inoculation of the casing with Alcaligenes faecalis ex-
hibited significantly higher fruitbody yields compared to
uninoculated [40] and Cetin et al. [41] also recorded the
positive effect of bacterial isolates, which provided
8%40% enhancement in the total yield of A. bisporus
mushroom. The yield inducing nature of bacteria might
be due to their synergistic effects on mycelium growth
stimulation and through releasing nutrients within sub-
strate [3,42]. The effective microorganisms simplify the
oyster mushroom substrate with the release of different
simple sugars as sources of carbon easily utilized by the
oyster mushroom result in good growth and increased
production of mushrooms [43,44].
The present study proved that the identified bacteria
were closely attached to the mycelia surface and conse-
quently enhanced the hyphal growth. Such interaction
between mushroom mycelia and bacterial cells played a
significant role in mycelial growth promotion and de-
velopment through beneficial secretions from both sides.
The oyster mushroom substrate inoculated with bacterial
inoculum improved the mushroom yield and BE.
Therefore, we can assume that the employment of this
novel bacterium in mushroom cultivation can be the
paramount biological substitute. Hence, the employment
of bacterial bioinoculant during the cultivation of
mushrooms is recommended to improve the outputs.
FIGURE 4 Phylogenetic neighborjoining tree of strain Glutamicibacter arilaitensis constructed using molecular evolutionary genetics
analysis version 7 based on 16S rRNA gene sequence analysis showing the position of isolates retrieved from the NCBI database. The
numbers mentioned next to each node indicate the percentage of bootstrap values of 1000 replicates. The scale bar represents a genetic
distance of two changes per nucleotides
8
|
KUMARI AND NARAIAN
ACKNOWLEDGMENT
Financial assistance from the Science and Engineering Re-
search Board (SERB), Ministry of Science and Technology,
Govt. of India, New Delhi, India, (No. SB/EMER022/2013)
is highly acknowledged.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are
openly available in [repository name e.g. figshare]at
[doi], reference number [reference number].
ORCID
Ram Naraian http://orcid.org/0000-0001-9641-0554
REFERENCES
[1] Young LS, Chu JN, Young CC. Beneficial bacterial strains on
Agaricus blazei cultivation. Pesqagropec Bras. 2012;47:
81521.
[2] Naraian R, Sahu RK, Kumar S, Garg SK, Singh CS,
Kanaujia RS. Influence of different nitrogenrich supple-
ments during cultivation of Pleurotus florida on corn cob
substrate. Environmentalist. 2009;29:17.
[3] Carrasco J, Preston GM. Growing edible mushrooms: a
conversation between bacteria and fungi. Environ Microbiol.
2020;22:85872.
[4] Noble R, Fermor TR, Lincoln S, DobrovinPennington A,
Evered C, Mead A. Primordia initiation of mushroom
(Agaricus bisporus) strains on axenic casing materials.
Mycologia. 2003;95:6209.
[5] Henry MB, Lynch JM, Fermor TR. Role of siderophores in
the biocontrol of Pseudomonas tolaasii by fluorescent pseu-
domonad antagonists. J Appl Bacteriol. 1991;70:1048.
[6] Zarenejad F, Yakhchali B, Rasooli I. Evaluation of indigenous
potent mushroom growth promoting bacteria (MGPB) on
Agaricus bisporus production. World J Microbiol Biotechnol.
2012;28:99104.
[7] Zagryadskaya YA, Lysak LB, Chernov IY. Bacterial commu-
nities in the fruit bodies of ground basidiomycetes. Eurasian
Soil Sci. 2015;48:6206.
[8] Cleary JL, Kolachina S, Wolfe BE, Sanchez LM. Copropor-
phyrin III produced by the bacterium Glutamicibacter ar-
ilaitensis binds zinc and is upregulated by fungi in cheese
rinds. Appl. Environ Sci. 2018;3:115.
[9] Haastrup MK, Johansen P, Malskær AH, CastroMejía JL,
Kot W, Krych L, et al. Cheese brines from Danish dairies
reveal a complex microbiota comprising several halotolerant
bacteria and yeasts. Int J Food Microbiol. 2018;285:17387.
[10] Sutthiwong N, Fouillaud M, Dufosse L. The influence of pH,
NaCl, and the deacidifying yeasts Debaryomyces hansenii and
Kluyveromyces marxianus on the production of pigments by
the cheeseripening bacteria Arthrobacter arilaitensis. Foods.
2018;7:1908.
[11] Ahlawat OP, Rai RD. Effect of Azotobacterand Phosphotika
biofertilizers on the spawn run, pinning and yield of the
white Button mushroom (Agaricus bisporus). Mush Res.
1997;6:6974.
[12] Tarkka MT, Sarniguet A, FreyKlett P. Interkingdom en-
counters: recent advances in molecular bacteriumfungus
interactions. Curr Genet. 2009;55:23343.
[13] FreyKlett P, Burlinson P, Deveau A, Barret M, Tarkka M,
Sarniguet A. Bacterialfungal interactions: hyphens between
agricultural, clinical, environmental, and food micro-
biologists. Microbiol Mol Biol Rev. 2011;75:583609.
[14] Rainey PB. Effect of Pseudomonas putida on hyphal growth
of Agaricus bisporus. Mycol Res. 1991;95:699704.
[15] Kertesz MA, Thai M. Compost bacteria and fungi that in-
fluence growth and development of Agaricus bisporus and
other commercial mushrooms. Appl Microbiol Biotechnol.
2018;102:163950.
[16] Cho YS, Kim JS, Crowley DE, Cho BG. Growth promotion of
the edible fungus Pleurotus ostreatus by fluorescent pseudo-
monads. FEMS Microbiol Lett. 2003;218:2716.
[17] Kim MK, Math RK, Cho KM, Shin KJ, Kim JO, Ryu JS, et al.
Effect of Pseudomonas sp. P7014 on the growth of edible
mushroom Pleurotus eryngii in bottle culture for commercial
production. Bioresour Technol. 2008;99:33068.
[18] Duncan KW. An ecophysiological approach to the evalua-
tion, modification and production of mushroom growing
media. Mush News. 1997;45:127.
[19] Chang ST, Lau OW, Cho KY. The cultivation and nutritive
value of Pleurotus sajorcaju. Eur J Appl Microbiol
Biotechnol. 1981;12:5862.
[20] Zivanovic S, Buescher RW, Kim KS. Textural changes in
mushrooms associated with tissue ultrastructure and com-
position. J Food Sci. 2000;65(8):14048.
[21] Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST.
Bergey's manual of determinative bacteriology. 9th ed. Bal-
timore, MD: Williams & Wilkins; 1994.
[22] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a
laboratory manual. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory; 1989.
[23] Kimura M. A simple method for estimating evolutionary rate
of base substitutions through comparative studies of nu-
cleotide sequences. J Mol Evol. 1980;16:11120.
[24] Kumar S, Stecher G, Tamura K. MEGA7: molecular evolu-
tionary genetics analysis version 7.0 for bigger datasets. Mol
Biol Evol. 2016;33:18704.
[25] Felsenstein J. Confidence limits on phylogenies: an approach
using the bootstrap. Evolution (NY). 1985;394:78391.
[26] Choudhary DK. First preliminary report on isolation and
characterization of novel Acinetobacter spp. in casing soil
used for cultivation of button mushroom, Agaricus bisporus
(Lange) Imbach. Int J Microbiol. 2011;2011:790285.
[27] Kaneko M, Tanimoto E. Auxinregulation of hyphal elonga-
tion and spore germination in arbuscular mycorrhizal fun-
gus, Gigaspora margarita. International Symposium Root
Research and ApplicationsRoot RAP, 2009 September 24;
Boku, Vienna, Austria.
[28] Carrasco J, Zied DC, Pardo JE, Preston GM, PardoGiménez A.
Supplementation in mushroom crops and its impact on yield
and quality. AMB Exp. 2018;8:14654.
[29] Ebadi A, Alikhani HA, Rashtbari M. Effect of plant growth
promoting bacteria (PGPR) on the morpho physiological
KUMARI AND NARAIAN
|
9
properties of button mushroom Agaricus bisporus in two
different culturing beds. Int Res J Basic Appl Sci. 2012;3:
20312.
[30] Irlinger F, Bimet F, Delettre J, Lefevre M, Grimont PAD.
Arthrobacter bergerei sp. nov. and Arthrobacter arilaitensis sp.
nov., novel coryneform species isolated from the surfaces of
cheeses. Int J Syst Evol Microbiol. 2005;55:45762.
[31] Busse HJ. Review of the taxonomy of the genus Arthrobacter,
emendation of the genus Arthrobacter sensulato and proposal
to reclassify selected Arthrobacter species in the novel genera
Glutamicibacter gen. nov., Paeniglutamicibacter gen. nov.,
Pseudoglutamicibacter gen. nov., Paenarthrobacter gen. nov.,
Pseudarthrobacter gen. nov., respectively, and emended de-
scription of Arthrobacterroseus sp. emend. Int J Syst Evol
Microbiol. 2016;66:937.
[32] Eyini M, Parani K, Pothiraj C, Rajapandy V. Effect of Azoto-
bacterbioinoculant on the growth and substrate utilization
potential of Pleurotus eous seed spawn. Mycobiol. 2005;33:1922.
[33] Kang YM, Cho KM. Identification of auxin from Pseudomo-
nas sp. P7014 for the rapid growth of Pleurotus eryngii my-
celium. Korean J Microbiol. 2014;50:1521.
[34] McGee CF, Byrne H, Irvine A, Wilson J. Diversity and dy-
namics of the DNA and cDNAderived bacterial compost
communities throughout the Agaricus bisporus mushroom
cropping process. Ann Microbiol. 2017;67:75161.
[35] McGee CF. Microbial ecology of the Agaricus bisporus
mushroom cropping process. Appl Microbiol Biotechnol.
2018;102:107583.
[36] Deveau A, Bonito G, Uehling J, Paoletti M, Becker M,
Bindschedler S, et al. Bacterialfungal interactions: ecology,
mechanisms and challenges. FEMS Microbiol Rev. 2018;42:
33552.
[37] Potocnik I, Rekanovic E, Todorovic B, Lukovic J, Paunovic D,
Stanojevic O, et al. The effects of casing soil treatment with
Bacillus subtilis Ch13 biofungicide on green mould control and
mushroom yield. Pestic Phytomed (Belgrade). 2019;34:5360.
[38] Young LS, Chu JN, Hameed A, Young CC. Cultivable
mushroom growthpromoting bacteria and their impact on
Agaricus blazei productivity. Pesqagropec Bras Brasília. 2013;
48:63644.
[39] Mohammad A, Sabaa AK. In vitro and in vivo impact of some
Pseudomonas spp. on growth and yield of cultivated mush-
room (Agaricus bisporus). Egypt J ExpBiol (Bot). 2015;11:
1637.
[40] Ahlawat OP, Manikandan K. Evaluation of bacterial in-
oculants for yield enhancement of white button mushroom,
Agaricus bisporus under commercialscale cultivation. Mush
Res. 2015;24:95104.
[41] Cetin M, Ozaktan H, Boztok K. Effects of some beneficial
bacteria in casing soil on growth and yield of cultivated
mushroom Agaricus bisporus. T J Agri Food Sci Technol.
2016;4:197203.
[42] Kadam P, Narute TK, Shrivastava S, Ambore G, Saha S. Ef-
fect of liquid biofertilizers on the yield of button mushroom.
J Mycopathol Res. 2017;55:13541.
[43] Vetayasuporn S. Effective microorganisms for enhancing
Pleurotus ostreatus (Fr.) Kummer production. J Biol Sci. 2004;
4:70610.
[44] Zadrazil F. Influence of ammonium nitrate and organic
supplements on the yield of Pleurotus Sajor Caju (Fries),
Singer. Eur J Appl Microbiol Biotechnol. 1980;9:315.
SUPPORTING INFORMATION
Additional Supporting Information may be found online
in the supporting information tab for this article.
How to cite this article: Kumari S, Naraian R.
Enhanced growth and yield of oyster mushroom by
growthpromoting bacteria Glutamicibacter
arilaitensis MRC119. J Basic Microbiol. 2020;110.
https://doi.org/10.1002/jobm.202000379
10
|
KUMARI AND NARAIAN
... For mycelium, a batch of MPGBs could promote mycelial growth. It has been reported that Pseudomonas putida Bt4, Glutamicibacter arilaitensis MRC119, Paenibacillus pectinilyticus, and Paenibacillus taichungensis could promote the growth of Agaricus bisporus (Zarenejad et al., 2012), Pleurotus florida (Kumari and Naraian, 2021), Pleurotus ostreatus (Suarez et al., 2020), and Tricholoma matsutake (Oh and Lim, 2018), respectively. Among them, a field experiment using P. putida Bt4 increased A. bisporus yield by 14.04%, indicating the huge potential of applying these MGPBs in the mushroom industry. ...
... The effects of strain CACMS001 on fungi growth were further evaluated by co-culturing CACMS001 with P. umbellatus and A. gallica because the cultivation of P. umbellatus relies on A. gallica (Xing et al., 2013). Previously reported MGPB strains could increase mycelia growth by 29 to 180% (Suarez et al., 2020;Kumari and Naraian, 2021;Sari and Aryantha, 2021). The promoting rates of CACMS001 on P. umbellatus and A. gallica were 21 and 78%, respectively. ...
Article
Full-text available
Polyporus umbellatus is a well-known edible and medicinal mushroom, and some bacteria isolated from mushroom sclerotia may have beneficial effects on their host. These mushroom growth-promoting bacteria (MGPBs) are of great significance in the mushroom production. In this work, we aimed to isolate and identify MGPBs from P. umbellatus sclerotia. Using the agar plate dilution method, strain CACMS001 was isolated from P. umbellatus sclerotia. The genome of CACMS001 was sequenced using PacBio platform, and the phylogenomic analysis indicated that CACMS001 could not be assigned to known Rhizobium species. In co-culture experiments, CACMS001 increased the mycelial growth of P. umbellatus and Armillaria gallica and increased xylanase activity in A. gallica . Comparative genomic analysis showed that CACMS001 lost almost all nitrogen fixation genes but specially acquired one redox cofactor cluster with pqqE , pqqD , pqqC , and pqqB involved in the synthesis of pyrroloquinoline quinone, a peptide-derived redox participating in phosphate solubilization activity. Strain CACMS001 has the capacity to solubilize phosphate using Pikovskaya medium, and phnA and phoU involved in this process in CACMS001 were revealed by quantitative real-time PCR. CACMS001 is a new potential Rhizobium species and is the first identified MGPB belonging to Rhizobium. This novel bacterium would play a vital part in P. umbellatus , A. gallica , and other mushroom cultivation.
... A mycovirus impeded growth and formation of extracellular lignolytic enzymes in P. ostreatus compared with a virus-cured strain [89], whereas Glutamicibacter arilaitensis, a bacterium belonging to the phylum Actinomycetota and found on some French cheese, promoted growth and yield [90]. Based on 16 S rRNA gene-terminal restriction fragment length polymorphism, a succession pattern of the microbial community was found, which was thought to protect P. ostreatus against competing fungi [91]. ...
... They thrive on most of the substrates shown in Table 1 by quickly inducing large enzymatic networks (own experiments, data not shown). As a result, the composition of the fruiting bodies depends on the growth substrate [33,55,57,60,67,72,74], the strain chosen [33,60,[74][75][76][77][78]80], its developmental stage [29][30][31][32]38], and the associated adverse or beneficial microbial community [83][84][85][86][87][88][89][90][91] and is thus variable like no other food. The same applies to the mass production of fungal mycelia. ...
Article
Full-text available
Edible mushrooms are widely appreciated for their appealing flavours, low caloric values and high content of presumably health-protecting metabolites. Their long history of safe use together with the looming worldwide food crisis have revived the idea of generating meat analogues and protein isolates by the controlled fermentation of mycelia of these edible fungi as a dietary option. The occurrence of proteins, polysaccharides, smaller metabolites, metal ions and toxins in mycelia and fruiting bodies is compared among the three most popular species, Agaricus bisporus (button mushroom), Pleurotus ostreatus (oyster mushroom), Lentinus edodes (shiitake) and some closely related species. Large effects of substrate chemistry, strain, developmental stage and ecological interactions result in a wide variation of the concentrations of some metabolites in both mycelial cells and fruiting bodies. This is obviously a result of the high adaptation abilities required to survive in natural habitats. Fungal bioprocesses are decoupled from agricultural production and can be operated anytime, anywhere, and on any scale according to demand. It is concluded that fungal biomass, if produced under food-grade conditions and on an industrial scale, could provide a safe and nutritious meat substitute and protein isolates with a high biological value for future vegan foods.
... It seems likely that the Agaricus species may require an interacting consortium of both bacteria and fungi for effective lignocellulose breakdown, though further studies are required to confirm the relevance of this finding. The bioinoculant Actinobacteria and Glutamicibacter arilaitensis involved in cultivation have the potential to improve the biological efficiency of the oyster mushroom P. florida [162]. Benucci and Bonito [163] reported that the phylum Proteobacteria was most abundant, followed by Actinobacteria and Firmicutes, in the tissue samples of truffle species. ...
Article
Full-text available
Lignocellulosic materials commonly serve as base substrates for mushroom production. Cellulose, hemicellulose, and lignin are the major components of lignocellulose materials. The composition of these components depends upon the plant species. Currently, composted and non-composted lignocellulosic materials are used as substrates in mushroom cultivation depending on the mushroom species. Different substrate compositions can directly affect the quality and quantity of mushroom production yields. Consequently, the microbial dynamics and communities of the composting substrates can significantly affect mushroom production. Therefore, changes in both substrate composition and microbial diversity during the cultivation process can impact the production of high-quality substrates and result in a high degree of biological efficiency. A brief review of the current findings on substrate composition and microbial diversity for mushroom cultivation is provided in this paper. We also summarize the advantages and disadvantages of various methods of mushroom cultivation by analyzing the microbial diversity of the composting substrates during mushroom cultivation. The resulting information will serve as a useful guide for future researchers in their attempts to increase mushroom productivity through the selection of suitable substrate compositions and their relation to the microbial community.
... P. putida was the best growth-promoting inoculant among 23 tested bacterial strains that could increase the fruiting-body yield of Agaricus bisporus (Zarenejad et al., 2012). The bioinoculant of Glutamicibacter arilaitensis MRC119 can be potentially used as an eco-friendly substitute improving the fruitbody yields and biological efficiency of oyster mushrooms (Kumari and Naraian, 2021). Pseudomonas fluorescens strains could promote the formation of the primordium, the mycelial growth, and the fruiting body productivity of Pleurotus eryngii (Kim et al., 2008) and Pleurotus ostreatus (Cho et al., 2003). ...
Article
Full-text available
The effects of biological factors on the vegetative growth process of mushrooms remain largely unexplored. We investigated the bacterial community in different growth stages of Pleurotus eryngii by high-throughput sequencing technology to explore the relationship between interacting bacteria and the growth and development of P. eryngii. We found significant variances in mushroom interacting association bacteria (MIAB) compositions among the samples from different growth stages, and 410 genera were identified. The bacteria in the full-bag and post-ripe stages were shifted to the biocontrol and growth-promotion ones. The mushroom growth-promoting bacteria (MGPB) were also isolated successfully and identified as B. cereus Bac1. The growth speed and density of mycelial pellets of P. eryngii , and activities of two exoenzymes (laccase and amylase), were analyzed by adding the different volumes of cell-free fermentation broth of B. cereus Bac1 to fungal culture media. The results showed that when a 5 mL cell-free fermentation broth was used, the growth speed of P. eryngii hyphae was enhanced by 1.15-fold over the control and reached 0.46 mm/h. The relative activity of laccase and amylase was increased by 26.9 and 43.83%. Our study revealed that the abundant interacting bacteria coexist with P. eryngii hyphae. Moreover, the abundance of some bacteria exhibiting a positive correlation with the growth periods of their host fungi can effectively promote the growth of the host, which will provide technical supports on the high-efficiency production of P. eryngii in factory cultivation.
... The isolates belonging to genera Rhodococcus, Agrobacterium, Glutamicibacter and Microbacterium associated with genus Aspergillus and Rhizopus. Microbacterium humic and Microbacterium agarici have previously been isolated from the fungi Agaricus blazei [69], whereas Glutamicibacter arilaitensis has been described to associate with Penicillium [70] and to significantly improve the mycelial growth of edible mushroom Pleurotus florida [71]. Bacteria of the genus Rhodococcus sp. have been isolated from a wide variety of enviroments, including soils and composts [72,73] and have been found dispersing along the mycelia of the oomycete Pythium ultimum [40]. ...
Article
Full-text available
Use of compost is a common agricultural practice. It improves soil fertility by adding nutrients and plant growth promoting (PGP) microorganisms. The role of bacterial-fungal interactions for compost-driven fertilization, however, is still poorly understood. In this study, we investigated whether putative PGP bacteria associate to and disperse along mycelia of fungal isolates. A ‘Fungal highway column system’ was used to isolate and characterize fungal—bacterial couples derived from commercial compost (C), non-composted bulk soil (BS) and rhizosphere soil with compost application (RSC). Bacterial-fungal couples were identified by 16S and 18S rRNA gene sequencing and isolated bacteria were tested for representative PGP traits. Couples of fungi and associated migrator bacteria were isolated from C and RSC only. They included the fungal genera Aspergillus, Mucor, Ulocladium, Rhizopus and Syncephalastrum, and the bacterial genera Rhodococcus, Bacillus, Pseudomonas, Agrobacterium, Glutamicibacter and Microbacterium. Many of migrator bacteria in RSC and C showed PGP traits (e.g., tryptophane—induced auxin synthesis or phytate mineralizing activity) suggesting that fungi contained in C and RSC allow for dispersal of putative PGP bacteria. Next to being provider of nutrients, compost may therefore be source for PGP bacteria and fungal mycelia serving as networks for their efficient dispersal.
Article
Mushroom-forming fungi establish mutual beneficial interactions with plants and degrade organic waste. These fungi also play an important role in human societies to produce mycelium materials, as a source of medicinal compounds, and as food. Bacteria interact with mushroom-forming fungi not only as competitors for nutrients and as pathogens but also to establish beneficial interactions. This review discusses the positive interactions of bacteria during the different stages of the life cycle of the white button mushroom Agaricus bisporus and other highly consumed mushroom-forming fungi. Bacteria are key in forming a selective substrate, in providing nutrients, in stimulating growth and mushroom formation, and in protection against pathogens. Implications for the mushroom industry are being discussed.
Article
Hydroxylamine, an intermediate product in the nitrification process, is widely found in nature. However, hydroxylamine accumulation can decrease the biological nitrogen removal efficiency by reducing the activities, inhibiting the reproductions, and even causing the death of microorganisms. In this study, a novel heterotrophic nitrification bacterium was separated from biogas digester and identified as Glutamicibacter arilaitensis EM-H8. Strain EM-H8 exhibited efficient hydroxylamine removal (93.75%). The optimal conditions for hydroxylamine removal were as follows: Carbon source, glucose; C/N ratio, 25; temperature, 20 °C; inoculum size, 0.53 × 10⁸ CFU; and shaking speed, 150 rpm. The nitrogen balance results using strain EM-H8 showed that about 26.86% of the initial nitrogen was removed as nitrogenous gas, while 4.6% was converted into biomass under aerobic conditions, confirming that strain EM-H8 possessed the capacity for heterotrophic nitrification. Furthermore, the successful expression of hydroxylamine oxidase (0.065 U/mg protein) showed that strain EM-H8 had the ability to transform hydroxylamine from wastewater.
Article
Full-text available
Study was undertaken to elucidate the interactions and effects of two commercial biofertilizers namely non-symbiotic N fixer 'Azotobacter' and phosphate-solubilizing bacteria 'Phosphotika' on mycelial growth, pinhead formation and yield of Agaricus bisporus strain S-11. Both biofertilizers mixed in compost @ 1.0% w/w at spawning stimulated mycelial colonization in compost. However. only 'Phosphotika' resulted in early pinning as well as early first harvest and significant increase (32%) in yield. Azotobacter and Phosphotika added in casing delayed pinning but did not affect yield significantly. Bacteria isolated from these biofertilizers were either stimulatory or neutral to mycelial growth of A. bisporus but exhibited strong antagonism against the common competitor mould, Trichoderma viride.
Article
Full-text available
We present the latest version of the Molecular Evolutionary Genetics Analysis (MEGA) software, which contains many sophisticated methods and tools for phylogenomics and phylomedicine. In this major upgrade, MEGA has been optimized for use on 64-bit computing systems for analyzing bigger datasets. Researchers can now explore and analyze tens of thousands of sequences in MEGA. The new version also provides an advanced wizard for building timetrees and includes a new functionality to automatically predict gene duplication events in gene family trees. The 64-bit MEGA is made available in two interfaces: graphical and command line. The graphical user interface (GUI) is a native Microsoft Windows application that can also be used on Mac OSX. The command line MEGA is available as native applications for Windows, Linux, and Mac OSX. They are intended for use in high-throughput and scripted analysis. Both versions are available from www.megasoftware.net free of charge.
Article
Full-text available
Mushroom cropping consists of the development and fructification of different fungal species in soil or selective substrates that provide nutrients and support for the crop. The microorganisms present in these environments strongly influence, and in some cases are required for the growth and fructification of cultivated mushrooms. Some fungi such as truffles and morels form ectomycorrhizal associations with host plants. For these fungi helper bacteria play an important role in the establishment of plant‐fungal symbioses. Selective processes acting on the microbiota present in substrates and soils determine the composition of the microbiota inhabiting the fruit bodies or interacting with fungal hyphae, and both configure the mushroom holobiont, understood as the fungus plus associated microorganisms. Here we review current knowledge regarding the cross talk between bacteria and fungi during mushroom cultivation. We highlight the potential use of bioinoculants as agronomical amendments to increase mushroom productivity through growth promotion, or as biocontrol agents to control pests and diseases. This article is protected by copyright. All rights reserved.
Article
Full-text available
The impact of a biofungicide based on Bacillus subtilis Ch-13 on mushroom yield and efficacy in suppression of Trichoderma aggressivum f. europaeum T77 from Serbia was estimated in comparision with a similar microbial fungicide, Bacillus velezensis QST713, and the chemical fungicide prochloraz manganese. The biofungicide B. velezensis QST713 is registered for treatments of mushrooms and other crops in many countries but it is not currently available on the Serbian market. The tested B. subtilis Ch-13 fungicide enhanced mushroom yield 12%, compared with an uninoculated control, and notably more than B. velezensis QST713 applied at its higher test concentrations. Regarding the efficacy of the biofungicides in control of the compost pathogen T. aggressivum f. europaeum, B. subtilis Ch-13 applied in concentration of 3 × 108 CFU per m2 showed higher efficacy than the higher concentrations (5 × 109 and 1 × 1010 CFU per m2) of B. velezensis QST713. The biofungicide based on B. subtilis Ch-13 should be further investigated regarding its different modes of application to ensure better efficacy in disease control as it showed beneficial features in both promoting A. bisporus production and suppressing the growth of the aggressive compost pathogen T. aggressivum, the causal agent of devastating green mould disease.
Article
Full-text available
Arthrobacter arilaitensis is a food-related bacterial species under investigation for its involvement in the coloration of surface-ripened cheeses. Presently, information about this species in association with the development of appropriate cheese coloration is still lacking. This study was performed in order to investigate—with the use of spectrocolorimetry—the influence of pH, NaCl, and deacidifying yeasts on the pigmentation of Arthrobacter arilaitensis biofilms. Three types of cheese-based (curd) solid media were prepared by using different deacidification methods: (i) chemical deacidification by NaOH (CMNaOH); (ii) biological deacidification by the yeast strain Debaryomyces hansenii 304 (CMDh304); and (iii) biological deacidification by the yeast strain Kluyveromyces marxianus 44 (CMKm44). Each medium was prepared with initial pH values of 5.8, 7.0, and 7.5. After pasteurization, agar was incorporated and NaCl was added in varying concentrations (0%, 2%, 4%, and 8% (w/v)). A. arilaitensis Po102 was then inoculated on the so prepared “solid-curd” media, and incubated at 12 °C under light conditions for 28 days. According to the data obtained by spectrocolorimetry in the Compagnie Internationale de l’Eclairage (CIE) L*a*b* color system, all controlled factors appeared to affect the pigments produced by the A. arilaitensis strain. NaCl content in the media showed distinct inhibitory effects on the development of color by this strain when the initial pH was at 5.8. By contrast, when the initial pH of the media was higher (7.0, 7.5), only the highest concentration of NaCl (8%) had this effect, while the coloring capacity of this bacterial species was always higher when D. hansenii 304 was used for deacidification compared to K. marxianus 44.
Article
Full-text available
Mushroom supplementation is an agronomic process which consists of the application of nutritional amendments to the substrates employed for mushroom cultivation. Different nitrogen and carbohydrate rich supplements have been evaluated in crops with a substantial impact on mushroom yield and quality; however, there is still controversy regarding the nutritional requirements of mushrooms and the necessity for the development of new commercial additives. The addition of external nutrients increases the productivity of some low-yielding mushroom varieties, and therefore is a useful tool for the industry to introduce new commercially viable varieties. Spent mushroom compost is a waste material that could feasibly be recycled as a substrate to support a new commercially viable crop cycle when amended with supplements. On the other hand, a new line of research based on the use of mushroom growth promoting microorganisms is rising above the horizon to supplement the native microbiota, which appears to cover nutritional deficiencies. Several supplements employed for the cultivated mushrooms and their agronomic potential in terms of yield and quality are reviewed in this paper as a useful guide to evaluate the nutritional requirements of the crop and to design new formulas for commercial supplementation.
Article
Full-text available
The Danish Danbo cheese is a surface ripened semi-hard cheese, which before ripening is submerged in brine for up to 24 h. The brining is required in order to obtain the structural and organoleptic properties of the cheeses. Likewise, the content of NaCl in the cheese will influence especially the surface microbiota being of significant importance for flavour development and prevention of microbial spoilage. Even though the microbiota on cheese surfaces have been studied extensively, limited knowledge is available on the occurrence of microorganisms in cheese brine. The aim of the present study was to investigate by both culture-dependent and -independent techniques the brine microbiota in four Danish dairies producing Danbo cheese. The pH of the brines varied from 5.1 to 5.6 with a dry matter content from 20 to 27% (w/w). The content of lactate varied from 4.1 to 10.8 g/L and free amino acids from 65 to 224 mg/L. Bacteria were isolated on five different media with NaCl contents of 0.85-23.0% (w/v) NaCl. The highest count of 6.3 log CFU/mL was obtained on TSA added 4% (w/v) NaCl. For yeasts, the highest count was 3.7 log CFU/mL on MYGP added 8% (w/v) NaCl. A total of 31 bacterial and eight eukaryotic species were isolated including several halotolerant and/or halophilic species. Among bacteria, counts of ≥6.0 log CFU/mL were obtained for Tetragenococcus muriaticus and Psychrobacter celer, while counts between ≥4.5 and < 6.0 log CFU/mL were obtained for Lactococcus lactis, Staphylococcus equorum, Staphylococcus hominis, Chromohalobacter beijerinckii, Chromohalobacter japonicus and Microbacterium maritypicum. Among yeasts, counts of ≥3.5 log CFU/mL were only obtained for Debaryomyces hansenii. By amplicon-based high-throughput sequencing of 16S rRNA gene and ITS2 regions for bacteria and eukaryotes respectively, brines from the same dairy clustered together indicating the uniqueness of the dairy brine microbiota. To a great extent the results obtained by amplicon sequencing fitted with the culture-dependent technique though each of the two methodologies identified unique genera/species. Dairy brine handling procedures as e.g. microfiltration were found to influence the brine microbiota. The current study proves the occurrence of a specific dairy brine microbiota including several halotolerant and/or halophilic species most likely of sea salt origin. The importance of these species during especially the initial stages of cheese ripening and their influence on cheese quality and safety need to be investigated. Likewise, optimised brine handling procedures and microbial cultures are required to ensure an optimal brine microbiota.
Article
Full-text available
Microbial communities of fermented food microbiomes typically exhibit predictable patterns of microbial succession. However, the biochemical mechanisms that control the diversity and dynamics of these communities are not well described. Interactions between bacteria and fungi may be one mechanism controlling the development of cheese rind microbiomes. This study characterizes a specific bacterium-fungus interaction previously discovered on cheese rinds between the bacterium Glutamicibacter arilaitensis (formerly Arthrobacter arilaitensis ) and fungi of the genus Penicillium and identifies the specialized metabolites produced during cocultures. G. arilaitensis was previously shown to produce an unknown pink pigment in response to the presence of Penicillium . Using a combination of mass spectrometry, nuclear magnetic resonance (NMR), and transcriptome sequencing (RNA-seq), we determined that this pigment production is associated with production of coproporphyrin III. The discovery that coproporphyrin III preferentially bound zinc over other trace metals found in cheese curds highlights the value of using analytical chemistry to confirm identity of predicted chemical species. IMPORTANCE Bacterium-fungus interactions play key roles in the assembly of cheese rind microbial communities, but the molecular mechanisms underlying these interactions are poorly characterized. Moreover, millions of people around the world enjoy eating cheeses and cheese rinds, but our understanding of the diversity of microbial metabolites ingested during cheese consumption is limited. The discovery of zinc coproporphyrin III as the cause of pink pigment production by Glutamicibacter arilaitensis suggests that secretion of this molecule is important for microbial acquisition of trace metals.
Article
Full-text available
Mushrooms are an important food crop for many millions of people worldwide. The most important edible mushroom is the button mushroom (Agaricus bisporus), an excellent example of sustainable food production which is cultivated on a selective compost produced from recycled agricultural waste products. A diverse population of bacteria and fungi are involved throughout the production of Agaricus. A range of successional taxa convert the wheat straw into compost in the thermophilic composting process. These initially break down readily accessible compounds and release ammonia, and then assimilate cellulose and hemicellulose into compost microbial biomass that forms the primary source of nutrition for the Agaricus mycelium. This key process in composting is performed by a microbial consortium consisting of the thermophilic fungus Mycothermus thermophilus (Scytalidium thermophilum) and a range of thermophilic proteobacteria and actinobacteria, many of which have only recently been identified. Certain bacterial taxa have been shown to promote elongation of the Agaricus hyphae, and bacterial activity is required to induce production of the mushroom fruiting bodies during cropping. Attempts to isolate mushroom growth-promoting bacteria for commercial mushroom production have not yet been successful. Compost bacteria and fungi also cause economically important losses in the cropping process, causing a range of destructive diseases of mushroom hyphae and fruiting bodies. Recent advances in our understanding of the key bacteria and fungi in mushroom compost provide the potential to improve productivity of mushroom compost and to reduce the impact of crop disease.
Article
Fungi and bacteria are found living together in a wide variety of environments. Their interactions are significant drivers of many ecosystem functions and are important for the health of plants and animals. A large number of fungal and bacterial families are engaged in complex interactions that lead to critical behavioural shifts of the microorganisms ranging from mutualism to pathogenicity. The importance of bacterial-fungal interactions (BFI) in environmental science, medicine and biotechnology has led to the emergence of a dynamic and multidisciplinary research field that combines highly diverse approaches including molecular biology, genomics, geochemistry, chemical and microbial ecology, biophysics and ecological modelling. In this review, we discuss most recent advances that underscore the roles of BFI across relevant habitats and ecosystems. A particular focus is placed on the understanding of BFI within complex microbial communities and in regards of the metaorganism concept. We also discuss recent discoveries that clarify the (molecular) mechanisms involved in bacterial-fungal relationships, and the contribution of new technologies to decipher generic principles of BFI in terms of physical associations and molecular dialogues. Finally, we discuss future directions for researches in order to catalyse a synergy within the BFI research area and to resolve outstanding questions.