ArticlePDF Available

Multidrug Resistance in Enterococci Isolated From Wild Pampas Foxes (Lycalopex gymnocercus) and Geoffroy's Cats (Leopardus geoffroyi) in the Brazilian Pampa Biome

Authors:

Abstract and Figures

Enterococci are ubiquitous microorganisms present in various environments and within the gastrointestinal tracts of humans and other animals. Notably, fecal enterococci are suitable indicators for monitoring antimicrobial resistance dissemination. Resistant bacterial strains recovered from the fecal samples of wild animals can highlight important aspects of environmental disturbances. In this report, we investigated antimicrobial susceptibility as well as resistance and virulence genes in fecal enterococci isolated from wild Pampas foxes ( Lycalopex gymnocercus ) ( n = 5) and Geoffroy's cats ( Leopardus geoffroyi ) ( n = 4) in the Brazilian Pampa biome. Enterococci were isolated from eight out of nine fecal samples and Enterococcus faecalis was identified in both animals. However, E. faecium and E. durans were only detected in Pampas foxes, while E. hirae was only detected in Geoffroy's cats. Antimicrobial susceptibility analysis showed resistance to rifampicin (94%), erythromycin (72.6%), ciprofloxacin/norfloxacin (40%), streptomycin (38%), and tetracycline (26%). The high frequency of multidrug-resistant enterococci (66%) isolated in this study is a matter of concern since these are wild animals with no history of therapeutic antibiotic exposure. The tet M/ tet L and msr C/ erm B genes were detected in most tetracycline- and erythromycin-resistant enterococci, respectively. The gelE, ace, agg, esp , and clyA virulence genes were also detected in enterococci. In conclusion, our data suggest that habitat fragmentation and anthropogenic activities in the Pampa biome may contribute to high frequencies of multidrug-resistant enterococci in the gut communities of wild Pampas foxes and Geoffroy's cats. To the best of the authors' knowledge, this is the first report of antimicrobial-resistant enterococci in the Pampa biome.
Content may be subject to copyright.
ORIGINAL RESEARCH
published: 04 December 2020
doi: 10.3389/fvets.2020.606377
Frontiers in Veterinary Science | www.frontiersin.org 1December 2020 | Volume 7 | Article 606377
Edited by:
Marina Spinu,
University of Agricultural Sciences and
Veterinary Medicine of
Cluj-Napoca, Romania
Reviewed by:
Naouel Klibi,
Tunis El Manar University, Tunisia
Sudhakar G. Bhandare,
University of Nottingham,
United Kingdom
*Correspondence:
Ana Paula Guedes Frazzon
ana.frazzon@ufrgs.br
These authors have contributed
equally to this work
Specialty section:
This article was submitted to
Veterinary Infectious Diseases,
a section of the journal
Frontiers in Veterinary Science
Received: 14 September 2020
Accepted: 03 November 2020
Published: 04 December 2020
Citation:
Oliveira de Araujo G, Huff R,
Favarini MO, Mann MB, Peters FB,
Frazzon J and Guedes Frazzon AP
(2020) Multidrug Resistance in
Enterococci Isolated From Wild
Pampas Foxes (Lycalopex
gymnocercus) and Geoffroy’s Cats
(Leopardus geoffroyi) in the Brazilian
Pampa Biome.
Front. Vet. Sci. 7:606377.
doi: 10.3389/fvets.2020.606377
Multidrug Resistance in Enterococci
Isolated From Wild Pampas Foxes
(Lycalopex gymnocercus) and
Geoffroy’s Cats (Leopardus geoffroyi)
in the Brazilian Pampa Biome
Gabriella Oliveira de Araujo 1†, Rosana Huff 1† , Marina Ochoa Favarini 2,
Michele Bertoni Mann 1, Felipe Bortolotto Peters 2, Jeverson Frazzon 3and
Ana Paula Guedes Frazzon 1
*
1Graduate Program in Agricultural and Environmental Microbiology, Institute of Basic Health Sciences, Federal University of
Rio Grande Do Sul, Porto Alegre, Brazil, 2Institute for the Conservation of Neotropical Carnivores— “Pró-Carnívoros”,
Atibaia, Brazil, 3Institute of Food Science and Technology, Federal University of Rio Grande Do Sul, Porto Alegre, Brazil
Enterococci are ubiquitous microorganisms present in various environments and within
the gastrointestinal tracts of humans and other animals. Notably, fecal enterococci
are suitable indicators for monitoring antimicrobial resistance dissemination. Resistant
bacterial strains recovered from the fecal samples of wild animals can highlight important
aspects of environmental disturbances. In this report, we investigated antimicrobial
susceptibility as well as resistance and virulence genes in fecal enterococci isolated from
wild Pampas foxes (Lycalopex gymnocercus) (n=5) and Geoffroy’s cats (Leopardus
geoffroyi) (n=4) in the Brazilian Pampa biome. Enterococci were isolated from eight out
of nine fecal samples and Enterococcus faecalis was identified in both animals. However,
E. faecium and E. durans were only detected in Pampas foxes, while E. hirae was only
detected in Geoffroy’s cats. Antimicrobial susceptibility analysis showed resistance to
rifampicin (94%), erythromycin (72.6%), ciprofloxacin/norfloxacin (40%), streptomycin
(38%), and tetracycline (26%). The high frequency of multidrug-resistant enterococci
(66%) isolated in this study is a matter of concern since these are wild animals with
no history of therapeutic antibiotic exposure. The tetM/tetL and msrC/ermB genes were
detected in most tetracycline- and erythromycin-resistant enterococci, respectively. The
gelE,ace,agg,esp, and clyA virulence genes were also detected in enterococci. In
conclusion, our data suggest that habitat fragmentation and anthropogenic activities in
the Pampa biome may contribute to high frequencies of multidrug-resistant enterococci
in the gut communities of wild Pampas foxes and Geoffroy’s cats. To the best of the
authors’ knowledge, this is the first report of antimicrobial-resistant enterococci in the
Pampa biome.
Keywords: Enterococcus spp., pampa biome, wildlife animals, Pampas fox, Geoffroy’s cat, multidrug-resistance,
virulence factors, antibiotic resistance genes
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
INTRODUCTION
Brazil hosts six terrestrial biomes, which include the Amazon,
Atlantic Forest, Caatinga, Cerrado, Pampa, and Pantanal biomes.
Notably, the Pampa biome covers 63% of Rio Grande do Sul State
and extend to Uruguay and the central region of Argentina (1
3). The fauna of the Brazilian Pampa biome consists of 83 native
mammal species, of which some are endemic and/or considered
endangered species. Among the mammal species, Geoffroy’s cat
(Leopardus geoffroyi) (Felidae) and the Pampas fox (Lycalopex
gymnocercus) (Canidae) are listed as species of “least concern” in
the IUCN Red List of Threatened Species (4,5). The main factors
contributing to the decline of these species are habitat destruction
and hunting (2,6,7). Farming activities have converted natural
areas of the Brazilian Pampa into agricultural and grazing lands,
with 48.7% of this biome now being used for plantation crops
(1,3).
This biome has been suffering constant disturbances due to
anthropogenic impacts and the reduction of natural habitat has
forced wild animals to live near human settlements, which has
resulted in negative outcomes for wildlife conservation (8,9).
Pampas fox and Geoffroy’s cat population density in Brazilian
Pampa biome is 0.2 and 0.27 ind/km2, respectively (10,11).
Studies of wild canids and felids from the Pampa biome have
shown that these animals exhibit adaptability in foraging based
on prey availability, which can lead them to establish secondary
food sources on farms. They are known to consume domestic
vertebrates, fruit, insects, and carrion as well as to get food into
the farms trash (1214). In the past year, various studies have
been published regarding habitat degradation and its effects on
the wildlife and environment of the Pampa biome; however,
studies evaluating the impact of multidrug-resistant bacteria on
the wildlife in this biome remain scarce.
Enterococci are ubiquitous microorganisms found in water,
soil, plants, and gastrointestinal tracts of wild animals, domestic
animals, and humans (1519). This ubiquitous distribution has
been associated with phenotypic plasticity since they can tolerate
a wide range of temperature and pH and grow in the presence of
6.5% sodium chloride (NaCl) or 40% of bile salts (20). The genus
Enterococcus comprises at least 50 species (21). Among these, E.
faecalis is the predominant species in the gastrointestinal tracts
of mammals, followed by E. faecium,E. durans,E. hirae, and E.
mundtii (18).
Additionally, enterococci are considered opportunistic
pathogens in susceptible hosts. They cause urinary tract, wound,
and soft tissue infections as well as bacteremia (22,23). Although
enterococci are considered a common cause of nosocomial
infections, they can also cause several diseases including bovine
mastitis, endocarditis, septicemia, and diarrhea in dogs, cats,
pigs, and rats (24). The treatment of enterococcal infections
has been complicated by the emergence of antibiotic-resistant
strains, which makes these infections an important public health
concern. Resistance to different classes of antimicrobials is a
hallmark of Enterococcus spp. since they are intrinsically resistant
to β-lactams, cephalosporin, lincosamides, streptogramins, and
aminoglycosides (25). Meanwhile, resistant strains are not
restricted to clinically known species since such strains have
been isolated from different environments, including wildlife
(15,17,19,24,2630). Due to their remarkable ability to adapt
to the environment, ubiquity in gut and to acquire antibiotic
resistance determinants, enterococci have been employed
as sentinel organisms for resistance to antimicrobials with
Gram-positive activity.
Resistant bacterial strains recovered from wild animals
can highlight important aspects of microbial interactions and
environmental disturbances in wildlife (31,32). Wild animals
can be considered sentinels for the emergence and spread of
antimicrobial-resistant bacteria in the environment. Therefore,
the present study evaluated the presence of resistant enterococci
in wild mammals aiming to detect previously unstudied variation
in antimicrobial resistance distribution patterns in these animals.
Additionally, to date, relatively few reports on antimicrobial
resistance strains have been produced based on samples from
wild canids and felids when compared to the number of
reports on domestic animals. This difference could largely be
explained by the migratory habits of some wild species and
the difficulty of obtaining samples from wildlife. To the best of
the authors’ knowledge, this is the first study of antimicrobial
resistance profiles and virulence genes in fecal enterococci
isolated from wild Pampas foxes and Geoffroy’s cats in the
Brazilian Pampa biome.
MATERIALS AND METHODS
Samples Collection
Rectal swabs were collected from wild Pampas foxes (n=5) and
Geoffroy’s cats (n=4) (Figure 1). The animals were captured in
two sites from Brazilian Pampa Biome, Rio Grande do Sul, Brazil.
The first site was located near to Candiota city (313306.73′′S;
534040.63′′W), proximal to Jaguarão river, and characterized by
intense agricultural, mining activity and roads; in this site, five
samples were obtained. The second site was located near Arroio
Grande city (321358.99′′S; 530511.75′′ W), characterized by
forest fragments and agricultural activities; in this site, four
samples were obtained (Supplementary Table 1).
The capture, manipulation, and samples collections were
authorized by Brazilian Institute of Environment and Renewable
Natural Resources, IBAMA, Brasília, Brazil, and Chico Mendes
Institute for Biodiversity Conservation (ICMBio). The protocol
was approved by the Information Authorization System in
Biodiversity (SISBIO) number 0200 1.007 9 10 12006-32. The
animals were captured with the assistance of Tomahawk traps
and anaesthetized via intramuscular (100 mg/mL of ketamine
hydrochloride and 20 mg/mL of xylazine hydrochloride).
Rectal swabs were collected by veterinarians, all animals were
clinically healthy (e.g., heart and respiratory rates and body
temperature) and were classified according to gender and age
group. Rectal swabs were collected from the perirectal area,
stored in Stuart transport medium (Kasvi, Paraná, Brazil), and
transported to our laboratory for microbiological analyses. After
sample collection, the animals were returned to their habitats. All
animals were in health conditions.
Frontiers in Veterinary Science | www.frontiersin.org 2December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
FIGURE 1 | Wild Pampas fox (Lycalopex gymnocercus)(A) and Geoffroy’s cat (Leopardus geoffroyi)(B) during their capture in the Brazilian Pampa Biome. Source:
Felipe Peters.
Isolation and Identification of Enterococci
Isolation of enterococci was performed as described previously
(17). Rectal samples were inoculated in 9 mL of azide dextrose
broth (Himedia, Mumbai, India) and incubated for 24 h at 37C.
Aliquots of 1 mL were placed in 9 mL of saline water, and initial
samples were further diluted 10-fold to obtain a final dilution
factor of 1/1,000. From each dilution, 100 µL was inoculated in
brain heart infusion (BHI) agar plates (Himedia, Mumbai, India)
supplemented with 6.5% NaCl.
Since enterococci are present in high concentrations in fecal
samples, typically between 105and 107CFU/g, we randomly
selected 10 colonies from each fecal sample. Phenotypic criteria
(size/volume, shape, color, Gram staining, catalase production),
and bile esculin reaction were used to separate the enterococci
group and the non-enterococcal strains. Selected pure colonies
were stored at 20C in a 10% (w/v) solution of skim milk
(Difco, Sparks, MD, USA) and 10% (v/v) glycerol (Neon
Comercial Ltda).
Bacterial species identification was performed by matrix-
assisted laser desorption and ionization time-of-flight mass
spectrometry method (MALDI-TOF) technique applied to
Enterococcus (33). MALDI-TOF analysis was performed using
a LT Bruker microflex mass spectrometer (Bruker Daltonik
GmbH) and spectra were automatically identified using
BrukerBioTyperTM 1.1 software. The identification by MALDI-
TOF MS is based on the score value released by the equipment.
A higher or similar 2.3 value indicates that the identifications of
genus and species are reliable. 2.0–2.29 show that the genus is
reliable and the species is probable. 1.7–1.99 values indicate that
the identification of genus is probable.
Antimicrobial Susceptibility Testing
Antimicrobial susceptibility of all strains was determined
by Kirby-Bauer disk diffusion method, according to Clinical
and Laboratory Standards Institute (34). Twelve antibiotics
were tested: ampicillin 10 µg (AMP), vancomycin 30 µg
(VAN), erythromycin 15 µg (ERY), tetracycline 30 µg
(TET), ciprofloxacin 5 µg (CIP), norfloxacin 10 µg (NOR),
nitrofurantoin 300 µg (NIT), chloramphenicol 30 µg (CHL),
gentamicin 120 µg (GEN), linezolid 30 µg (LNZ), rifampicin 5
µg (RIF), and streptomycin 300 µg (STR). Reference strain E.
faecalis ATCC 29212 was used as control.
Intermediate and resistant-strains were included in a single
category as resistant-strains. Strains were classified as single (SR),
double (DR) or multidrug-resistant (MDR) phenotype when
showed resistance for one, two, and three or more antimicrobial
classes, respectively (35).
Detection of Resistance and Virulence
Genes
Genomic DNA was extracted by a physicochemical method
as previously described (36). The presence of resistance
and virulence genes commonly observed in clinical and
environmental enterococci was tested by PCR (Table 1). The
resistance-related genes evaluated were: ermB (which encodes
a ribosomal methylase that mediates macrolides, lincosamides
and type B streptogramins resistance); msrC (which encodes
for a macrolide and streptogramin B efflux pump); tetM and
tetS (which encodes for tetracycline resistance via a ribosomal
protection protein mechanism); and tetL (which encodes for
tetracycline resistance via efflux pumps proteins). As well the
virulence genes tested were: ace (adhesin to collagen of E.
faecalis); cylA (cytolysin); agg (aggregation substance); gelE
(gelatinase); and esp (enterococcal surface protein).
Amplifications were carried out in a total volume of 25 µL
containing: 100 ng of template DNA, 1 X reaction buffer (Ludwig
Biotechnology), 0.4 µM of each primer (Ludwig Biotechnology),
1.5 mM MgCl2, 200 µM of dNTPs (Ludwig Biotechnology),
Frontiers in Veterinary Science | www.frontiersin.org 3December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
TABLE 1 | Primers used in the PCR reactions carried out for detection of resistance and virulence genes.
Gene Nucleotide sequence (5-3) ATa(C) Size (bp)bReferences
Erythromycin
ermB_F GAAAAGGTACTCAACCAAATA 52 645 (37)
ermB_R AGTAACGGTACTTAAATTGTTTAC
msrC_F AAGGAATCCTTCTCTCTCCG 52 342 (38)
msrC_R GTAAACAAAATCGTTCCCG
Tetracycline
tetL_F ACTCGTAATGGTGTAGTTGC 58 627 (26)
tetL_R TGTAACTCCGATGTTTAACACG
tetM_F GTTAAATAGTGTTCTTGGAG 52 656 (39)
tetM_R CTAAGATATGGCTCTAACAA
tetS_F TGGAACGCCAGAGAGGTATT 58 660 (39)
tetS_R ACATAGACAAGCCGTTGACC
Adhesion
ace_F AAAGTAGAATTAGATCACAC 56 320 (40)
ace_R TCTATCACATTCGGTTGCG
Cytolysin
cylA TE17 TGGATG’ATAGTGATAGGAAGT 56 517 (41)
cylA TE18 TCTACAGTAAATCTTTCGTCA
Biofilm
esp 46 TTACCAAGATGGTTCTGTAGGCAC 60 1198 (42)
esp 47 CCAAGTATACTTAGCATCTTTTGG
Gelatinase
gelE_F ACCCCGTATCATTGGTTT 50 402 (41)
gelE_R ACGCATTGCTTTTCCATC
Aggregation
agg TE3 AAGAAAAAGAAGTAGACCAAC 62 1553 (41)
agg TE4 AAACGGCAAGACAAGTAAATA
aAT, annealing temperatures; bbp, base pair.
1 U Taq DNA polymerase (Ludwig Biotechnology), and MilliQ
water. PCR amplifications were performed in the conventional
thermocycler (Applied Biosystems 2720 Thermal Cycler)
according to the following program: 94C for 5 min followed by
35 cycles of 94C for 1 min, appropriate annealing temperature
for each primer for 1 min, extension at 72C for 1 min, and a
final extension at 72C for 5 min. The DNA fragments amplified
were analyzed in 1.5% (w/v) agarose gels stained with SYBR R
Safe DNA Gel, and visualized on a photo-documenter.
RESULTS
In order to not overestimate the data referring to species
distribution and antimicrobial susceptibility profile, strains
isolated from the same animal with similar phenotypic and
genotypic characteristics, which could indicate clonal strains,
were grouped, generating a total of 50 strains, 30 from Pampas
foxes and 20 from Geoffroy’s cats. The number of isolates per
wild animal ranged from 5 (samples PF3, PF4 and GC1) to 9
(sample GC3).
Isolation and Identification of Enterococci
Enterococci were isolated from eight out of nine fecal samples.
Furthermore, 50 Enterococcus spp. strains were isolated and
characterized of wild Pampas fox and Geoffroy’s cat from the
Brazilian Pampa biome, including E. faecalis (64%; n=32), E.
faecium (22%; n=11), E. hirae (10%; n=5), and E. durans (4%;
n=2).
The species distribution between wild Pampas foxes and
Geoffroy’s cats are shown on Table 2. Changes in the composition
of Enterococcus species were detected in both animals. E. faecalis
was the most frequent species in fecal samples of both animals;
however, E. faecium and E. durans were isolated only in Pampas
fox and E. hirae just in Geoffroy’s cat.
Frontiers in Veterinary Science | www.frontiersin.org 4December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
Antimicrobial Susceptibility Profile
All enterococci isolated from wild canids and felids were tested
for antimicrobial resistance, and almost all strains (98%, n
=49) were resistant to at least one evaluated antimicrobial
agent (Table 3). Only one E. hirae isolated from Geoffroy’s
cat was susceptible to all antimicrobials tested. The highest
frequency was found for rifampicin (94%; n=47), followed by
erythromycin (72%; n=36), ciprofloxacin/norfloxacin (40%; n
=20), streptomycin (38%; n=19), and tetracycline (26%; n=
13). Resistance to nitrofurantoin (18%; n=9); gentamycin (14%,
n=7), and chloramphenicol (4%; n=2), was noted in less
frequency. No strains showed a resistance profile to ampicillin,
linezolid and vancomycin.
The most remarkable result to emerge from the data is that
a high frequency (66%; n=33) of MDR strains isolated from
wild canids and felids from Brazilian Pampa biome (Table 3).
TABLE 2 | Distribution of Enterococcus species among wild Pampas fox and
Geoffroy’s cat.
Number of species isolated
E. faecalis E. faecium E. hirae E. durans Total
Pampas fox PF1 4 1 0 1 6
PF2 2 5 0 0 7
PF3 2 3 0 0 5
PF4 2 2 0 1 5
PF5 7 0 0 0 7
Geoffroy’s cat GC1 5 0 0 0 5
GC2 0 0 0 0 0
GC3 9 0 0 0 9
GC4 1 0 5 0 6
Total 32 (64) 11 (22) 5 (10) 2 (4) 50 (100)
The percentages of double and MDR strains isolated from wild
Pampas fox (30%; n=9 and 63.33%; n=19) were similar to
wild Geoffroy’s cat (20%; n=4 and 70%; n=14). Of the 33 MDR
strains, 15 (45.45%) were resistant to four or more antimicrobials,
it is important to highlight that one E. faecalis strain isolated from
wild Pampas fox showed resistance to seven antimicrobials tested
(ciprofloxacin; chloramphenicol; erythromycin; streptomycin;
nitrofurantoin; rifampicin; tetracycline) (Table 4).
Frequency of Antimicrobial Resistance and
Virulence Related Genes
The resistance genes were investigated only in phenotypically
resistant erythromycin and tetracycline strains (Table 5). Of the
36 erythromycin- resistant, four (11.11%) harbored ermB and
nine (25%) msrC genes. Among the 13 tetracycline-resistant
enterococci, tetL and tetM genes were found in 7 (53.85%)
strains. None strain was positive to tetS gene.
All strains were tested for the presence of enterococci
commonly associated virulence genes. The Table 6 shows the
results of gelE, cylA, esp, ace, and agg genes. The highest
frequencies of virulence genes were found in E. faecalis and E.
faecium. The gelE (62%; n=31) and ace (48%; n=24) showed
elevated prevalence among these species. The agg gene (22%; n
=11) was recorded only on E. faecalis strains. Otherwise, esp
and cylA genes were observed in just one E. faecium and E. hirae
strains, respectively.
DISCUSSION
Isolation and Identification of Enterococci
Relatively few studies have reported enterococci isolated from
wild canids and felids such as red foxes (43), Iberian wolves, and
Iberian lynx (44,45). The results of the present study corroborate
with previous results showing that E. faecalis,E. faecium,E. hirae,
and E. durans are commonly encountered in the fecal samples of
TABLE 3 | Antimicrobial resistance profiles among enterococci isolated from fecal samples of wild Pampas fox and Geoffroy’s cat.
Strains (n)
Number (%) of resistant strainsaProfilesb
ERY CIP/NOR RIF STR GEN NIT CHL TET SR DR MDR
Pampas fox
E. faecalis (17) 13 (76.47) 7 (41.18) 16 (94.12) 7 (41.18) 4 (23.53) 3 (17.65) 1 (5.88) 2 (11.76) 1 (5.88) 5 (29.41) 11 (64.70)
E. faecium (11) 7 (63.64) 4 (36.36) 11 (100) 4 (36.36) 0 1 (9.09) 0 4 (36.36) 1 (9.09) 4 (36.36) 6 (54.55)
E. durans (2) 2 (100) 0 2 (100) 1 (50) 1 (50) 0 0 1 (50) 0 0 2 (100)
Subtotal (30) 22 (73.33) 11 (36.67) 29 (96.67) 12 (40) 5 (16.67) 4 (13.33) 1 (3.33) 7 (23.33) 2 (6.67) 9 (30) 19 (63.33)
Geoffroy’s cat
E. faecalis (15) 12 (80) 9 (60) 15 (100) 3 (20) 2 (13.33) 1 (6.67) 1 (6.67) 1 (6.67) 0 4 (26.67) 10 (66.67)
E. hirae (5) 2 (40) 0 3 (60) 4 (80) 0 4 (80) 0 5 (100) 1 (20) 0 4 (80)
Subtotal (20) 14 (70) 9 (45) 18 (90) 7 (35) 2 (10) 5 (25) 1(5) 6 (30) 1 (5) 4 (20) 14 (70)
Total (50) 36 (72) 20 (40) 47 (94) 19 (38) 7 (14) 9 (18) 2 (4) 13 (26) 3 (6) 13 (26) 33 (66)
aAntimicrobials: ERY,erythromycin; CIP, ciprofloxacin; NOR, norfloxacin; RIF, rifampicin; STR, streptomycin; GEN, gentamicin; NIT, nitrofurantoin; CHL, chloramphenicol; TET,tetracycline.
bProfiles: SR, single-resistance; DR, double-resistance; MDR, multidrug-resistance.
Frontiers in Veterinary Science | www.frontiersin.org 5December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
TABLE 4 | Antimicrobial resistance phenotypic profile of Enterococcus sp.
isolated from fecal samples of wild Pampas fox and Geoffroy’s cat.
ProfileaAntimicrobialsbSpecies
Number of resistances
PFcGCd
SR RIF E. faecalis 1
E. faecium 1
TET E. hirae 1
DR ERY/RIF E. faecalis 3 3
E. faecium 2
STR/RIF E. faecium 1
CIP-NOR/RIF E. faecalis 1 1
E. faecium 1
NIT/RIF E. faecalis 1
MDR CIP-NOR/ERY/RIF E. faecalis 3 4
E. faecium 1
CIP/STR/RIF E. faecalis 1
CIP/ERY/TET E. faecium 1
CIP/CHL/RIF E. faecalis 1
ERY/STR/TET E.durans 1
ERY/GEN/RIF E. faecalis 1
E. durans 1
ERY/STR/RIF E. faecium 1
STR/GEN/RIF E. faecalis 1
CHL/ERY/RIF E. faecalis 1
CIP/ERY/GEN/RIF E. faecalis 1
CIP/STR/GEN/RIF E. faecalis 2
CIP/ERY/STR/RIF E. faecalis 1 1
STR/NIT/TET/NOR E. hirae 1
STR/NIT/TET/RIF E. hirae 1
ERY/STR/GEN/RIF E. faecalis 1
ERY/STR/TET/RIF E. faecium 1
ERY/STR/NIT/TET/RIF E. faecium 1
E. faecalis 1 1
E. hirae 2
CIP/ERY/STR/GEN/RIF E. faecalis 1
CIP/CHL/ERY/STR/NIT/TET/RIF E. faecalis 1
aSR, single-resistance; DR, double-resistance; MDR, multidrug-resistance.
bAntimicrobials: ERY, erythromycin; CIP, ciprofloxacin; NOR, norfloxacin; RIF, rifampicin;
STR, streptomycin; GEN, gentamicin; NIT, nitrofurantoin; CHL, chloramphenicol;
TET, tetracycline.
cPF, Pampas fox (L. gymnocercus).
dGC, Geoffroy’s cat (L. geoffroyi).
wild and domestic canids and felids (31,4347). However, when
we verified the distribution of enterococci in Pampas foxes and
Geoffroy’s cats, we observed a higher frequency of E. faecalis than
those previously reported for wild red foxes, Iberian lynx, and
Iberian wolves (44,45). Moreover, our results are comparable to
those of domestic canids and felids (31,46,47) since frequencies
of E. faecalis (64.9%), E. faecium (18.2%), and E. durans (6.5%)
were detected. This minor disagreement is supported by the
fact that the distribution of enterococci may vary according to
individual characteristics (e.g., species, age, and sex), habitat (e.g.,
seasonal variations and diet), and the geographic distribution of
the animals (20).
Enterococcal species prevalence varied according to the host
species studied. Although these species occupy the same area of
the Biome, several types of foods are available to them. Geoffroy’s
cat and Pampas fox are considered generalist omnivores that
opportunistically feed on a wide variety of foods. Pampas fox
has a diet dominated by animal prey, mainly wild mammals,
insects, while the Geoffroy cat feeds mainly on rodents and
hares, and also remains of fish and frogs alongside reptiles and
birds (48,49). Thus, the distribution of Enterococcus species
among hosts observed in the present study can be justified by
the availability of the animals’ food, since enterococcal species
have been isolated from mammals, birds, fish, insects, and
reptiles (20).
Notably, it was not possible to isolate enterococci from one
of Geoffroy’s cat fecal samples. Previously, Santestevan et al. (50)
and Layton et al. (51) also sought to isolate enterococci from
mammalian fecal samples and were unsuccessful.
Antimicrobial Susceptibility Profile
The results of this study are consistent with previous studies,
which found high rates of resistance to erythromycin (65%),
ciprofloxacin (59.5%), and tetracycline (36.5%) in fecal
enterococci isolates from wild mammals, including wolves
and foxes (31). Some reports have detected enterococci resistant
to tetracycline and erythromycin in wild Iberian wolves,
Iberian lynx, and red foxes in Portugal (4345). Additionally,
domestic canids and felids also harbored antimicrobial-resistant
enterococci (47,52,53).
While MDR enterococci strains have previously been
observed in enterococci isolated from wild mammals, their
resistance levels were not as high as those detected here.
In the present study, 66% of MDR was observed for wild
canids and felids from the Brazilian Pampa biome. The high
frequency of MDR strains may be associated with the proximity
of these animals to human activities since they are sentinel
species (i.e., indicators of danger to the environment). It is
commonly known that wild canids and felids are indifferent to
the presence of humans and often share the same environment.
Our results are in line with those of Nowakiewicz et al. (54),
who observed a high frequency of E. faecalis strains (44%)
among wild mammalian carnivores in Poland. On the other
hand, our data are six times higher than those detected by
Dec et al. (30). According to Hu et al. (55), MDR bacteria are
more commonly associated with environmental contamination
than naturally occurring genes. Moreover, studies of wild foxes
and carnivorous mammals revealed positive correlations with
environmental pollution and the abundance of resistant bacteria
in samples, thereby highlighting the selective pressures that
Frontiers in Veterinary Science | www.frontiersin.org 6December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
TABLE 5 | Distribution of erythromycin- and tetracycline-resistance genes in the enterococci isolated from wild Pampas Fox and Geoffroy’s cat.
Strains Number (%) of strains positive for resistance genes
Erythromycin Tetracycline
R* ermBmsrC R* tetMtetLtetS
Pampa fox E. faecalis 13 0 5 (38.46) 2 0 0 0
E. faecium 7 0 3 (42.86) 4 0 0 0
E. durans 2 1 (50) 1 (50) 1 1 (100) 1 (100) 0
Subtotal 22 1 (4.55) 9 (40.91) 7 1 (14.29) 1 (14.29) 0
Geoffroy’s cat E. faecalis 12 1 (8.33) 0 1 1 (100) 1 (100) 0
E. hirae 2 2 (100) 0 5 5 (100) 5 (100) 0
Subtotal 14 3 (21.43) 0 6 6 (100) 6 (100) 0
Total 36 4 (11.11) 9 (25) 13 7 (53.85) 7 (53.85) 0
*Resistant strains.
TABLE 6 | Number (%) of virulence genes among enterococci isolated from wild Pampas Foxes and Geoffroy’s cat.
Pampas fox Geoffroy’s cat
Virulence genes E. faecalis (n=17) E. faecium (n=11) E. durans (n=2) E. faecalis (n=15) E. hirae (n=5) Total (%)
gelE 12 (70.59) 5 (45.45) 0 14 (93.33) 0 31 (62)
cylA 0 0 0 0 1 (20) 1 (2)
esp 0 1 (9.09) 0 0 0 1 (2)
ace 12 (70.59) 7 (63.64) 0 5 (33.33) 0 24 (48)
agg 7 (41.18) 0 0 4 (26.67) 0 11 (22)
human activities and environmental disturbances exert on the
microbial communities of wildlife (31,54).
The elevated frequency of resistant and MDR enterococci
observed in the fecal samples of wild Pampas foxes and
Geoffroy’s cats might be associated with anthropogenic activities.
Agriculture and livestock are the main economic activities
in the Brazilian Pampa and represents a source of food for
billions of people and animals (mainly cattle and sheep). Since
1998, many drugs have been prohibited from being used as
growth promoters in Brazil. In livestock, antimicrobials such
as amoxicillin, erythromycin and tetracycline are used by
veterinarians to treat bacterial infections (56). Despite bringing
benefits to production, the use of antimicrobials in animals has
fostered the emergence and spread of antimicrobial resistance.
Antibiotics and/or antibiotic-resistant bacteria can be secreted
with animal urine and feces and contaminate the environments
(soils, surface waters, and ground waters) and species inhabiting
these environments (57). In the presence of environmental
concentrations of antibiotics, bacteria face a selective pressure
leading to a gradual increase in the prevalence of resistance.
The association of antibiotic resistance genes in mobile genetic
elements is also an important factor for spreading and persistence
of antimicrobial resistance in the environment (58). It is
important to highlight that the impact created by the presence
of antimicrobial agents in the environment and the frequency
with which these resistance genes are transferred remains a
subject of academic and practical debate. Our results suggest
that the impacted environment occupied by Pampas foxes and
Geoffroy’s cats —with intense agricultural and livestock activities
in the sampling area—possibly contributed to the selection of
resistant bacteria in the environment and subsequent acquisition
of resistant strains by these mammals. Despite anthropogenic
activities, the presence of antibiotic-resistant strains in wild
animals may also be associated with the environmental
resistome, which is composed of genes that naturally occur
in the environment (59). One example is the genes associated
with the expression of efflux pumps, which protect cells
against toxic molecules such as heavy metals, expelling them
to the external environment and leading to antimicrobial
resistance (60).
Frequency of Antibiotic Resistance Genes
The ermB and msrC genes, conferring resistance to macrolides,
were present in 11.11 and 25% of isolates, respectively. The
low frequency of ermB genes detected in the present study
is congruent with the results obtained in previous studies
conducted on Enterococcus strains isolated from wild animals
(17,18,30,50), as in regarding to msrC gene (28). Additionally,
we detected the presence of the msrC gene not only in E. faecium
but also in E. durans and E. faecalis. Although the msrC gene
is considered an intrinsic gene to E. faecium, some studies have
Frontiers in Veterinary Science | www.frontiersin.org 7December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
noted the presence of this gene in other Enterococcus species such
as E. hirae and E. faecalis (30,38).
In the present study, tetL and tetM genes were detected in
tetracycline-resistant enterococci strains. Previous findings of
enterococci in wild animals such as Iberian wolves and Iberian
lynx also harbored those genes in tetracycline-resistant strains
(44,45). Some erythromycin- and tetracycline-resistant strains
did not amplify for the tested gene and may carry other antibiotic
resistance genes such as ermA, C, D, E, F, G, Q, msrA/B, other
tet-group genes, and the poxtA gene for tetracycline-resistance
(61). Our results point to the notion that other reported genes
could be associated with erythromycin-resistant enterococci
isolated from Pampas foxes and Geoffroy’s cats. Furthermore,
whole-genome sequencing (WGS) of these enterococci might
be useful in identifying additional mechanisms associated with
resistance profiles.
Antibiotic resistance genes commonly reside on transmissible
plasmids or on other mobile genetic elements, which allow the
horizontal transfer of these genes between strains. The tetM,
tetL, and ermB genes are carried out by mobile genetic elements,
such as transposons (Tn916, Tn1545, and Tn917), conjugative
transposons or plasmids (58). The association of these genes
in mobile genetic elements might be an important factor for
spreading of antimicrobial resistant enterococci in wild Pampas
foxes and Geoffroy’s cats.
Frequency of Virulence-Related Genes
The results of the present study suggest that enterococci obtained
from wild Pampas foxes and Geoffroy’s cats harbored virulence
genes. Moreover, E. faecalis was the most common species
to carry virulence factors. These results are congruent with
previous studies highlighting E. faecalis as the most common
enterococcal species associated with infections, which accounts
for 80–90% of infections. The presence of virulence factors
in clinical enterococci strains is associated with persistent and
difficult-to-treat infections. However, some authors consider the
occurrence of these genes in non-clinical strains as a common
characteristic that increases their ability to colonize hosts, which
improves the survival and proliferation of the strains. Since the
ubiquity of enterococci across a wide range of environments was
initiated by the establishment of these bacteria in either abiotic
surfaces or live tissues, their colonization can be facilitated by
the expression of virulence genes that likely contribute to the
persistence of enterococci in the environment (20).
One limitation of our study is the low number of animals
sampled, which is due to the difficulty of obtaining samples from
wildlife. For example, a study conducted in an anthropogenic
area of the Brazilian Pampa during a 1 year period, 12
Geoffroy’s cat individuals were captured (62). Notably, capturing
and handling wild animals requires specialized equipment, the
consideration of animal welfare concerns (regardless of the
reason for capture), and the efforts of experienced biologists and
wildlife technicians to plan and study suitable capture methods.
In light of these points, the number of animals evaluated in the
present study should be well-considered. Despite its relatively
small sample size, this study demonstrated the importance of
conducting research related to the impact of human activities on
the Brazilian Pampa biome.
In conclusion, this study observed the presence of resistant
Enterococcus strains in wild Pampas foxes and Geoffroy’s cats
from the Brazilian Pampa biome. The presence of MDR
enterococci in fecal samples from these wild animals suggests
that habitat fragmentation and the impact of anthropogenic
activities on the environment might contribute to the occurrence
of resistant strains in the microbial gut communities of these
animals. Furthermore, these animals may contribute to the
spread of resistant strains between different ecosystems. To
the best of our knowledge, this is the first study of resistant
commensal enterococci recovered from wild animals in the
Brazilian Pampa biome. We believe that our research will serve
as a foundation for future studies on the Pampa biome.
DATA AVAILABILITY STATEMENT
The original contributions presented in the study are included
in the article/Supplementary Materials, further inquiries can be
directed to the corresponding author.
ETHICS STATEMENT
The animal study was reviewed and approved by Instituto
Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis
(IBAMA), and Chico Mendes Institute for Biodiversity
Conservation (ICMBio). The protocol was approved by
Information Authorization System in Biodiversity (SISBIO) no.
0200 1.007 9 10 12006-32.
AUTHOR CONTRIBUTIONS
GO, JF, and AG designed the study. FP and MF carried out the
sampling work. GO, RH, MM, JF, and AG analyzed the data and
drafted the manuscript. All authors have read and approved the
final manuscript.
FUNDING
This research was supported by CNPq—Nos. 407886/2018-4,
302574/2017-4, and 303251/2014-0 and the PROAP-CAPES.
ACKNOWLEDGMENTS
We thank the Conselho Nacional de Desenvolvimento
Científico e Tecnológico do Brasil (CNPq), Coordenação
de Aperfeiçoamento de Pessoal de Nível Superior (CAPES);
Federal University of Rio Grande do Sul and Lutheran University
of Brazil.
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found
online at: https://www.frontiersin.org/articles/10.3389/fvets.
2020.606377/full#supplementary-material
Frontiers in Veterinary Science | www.frontiersin.org 8December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
REFERENCES
1. Roesch LFW, Vieira FCB, Pereira VA, Schünemann AL, Teixeira IF, Senna
AJT, et al. The Brazilian Pampa: a fragile biome. Diversity. (2009) 1:182–
98. doi: 10.3390/d1020182
2. Andrade BO, Bonilha CL, Overbeck GE, Vélez-Martin E, Rolim RG,
Bordignon SAL, et al. Classification of South Brazilian grasslands: implications
for conservation. Appl. Veg. Sci. (2018) 22:168–84. doi: 10.1111/avsc.12413
3. Ministério do Meio Ambiente [MMA]. Pampa – Conhecimentos e
Descobertas. (2020). Available online at: https://www.mma.gov.br/biomas/
pampa (accessed September 4, 2020).
4. International Union for Conservation of Nature [IUCN]. Leopardus
geoffroyi. (2020). Available online at: https://www.iucnredlist.org/species/
15310/50657011 (accessed September 4, 2020).
5. International Union for Conservation of Nature [IUCN]. Lycalopex
gymnocercus. (2020). Available online at: https://www.iucnredlist.org/species/
6928/85371194 (accessed September 4, 2020).
6. Espinosa CC, Galiano D, Kubiak BB, Marinho JR. Medium- and large-sized
mammals in a steppic savanna area of the brazilian pampa: survey and
conservation issues of a poorly known fauna. Braz. J. Biol. (2016) 76:73–
9. doi: 10.1590/1519-6984.12714
7. Valmorbida I, Cherman MA, Jahn DS, Guedes JVC. Abundance and
diversity in the melolonthidae community in cultivated and natural
grassland areas of the Brazilian Pampa. Environ. Entomol. (2018) 47:1064–
71. doi: 10.1093/ee/nvy109
8. Gothwal R, Shashidhar T. Antibiotic pollution in the environment: a review.
Clean Soil Air Water. (2015) 43:479–89. doi: 10.1002/clen.201300989
9. Hassell JM, Begon M, Ward MJ, Fèvre EM. Urbanization and disease
emergence: dynamics at the wildlife–livestock–human interface. Trends Ecol.
Evol. (2017) 32:55–67. doi: 10.1016/j.tree.2016.09.012
10. Almeida LB, Queirolo D, Oliveira TG, Beisiegel BM. Avaliação do risco de
extinção do gato-do-mato Leopardus geoffroyi (d’Orbigny & Gervais 1844) no
Brasil. Bio Brasil. (2013) 3:84–90. Available online at: https://www.icmbio.gov.
br/portal/images/stories/biodiversidade/fauna-brasileira/avaliacao-do- risco/
carnivoros/gato-do-mato_leopardus_geoffroyi.pdf (accessed November,19
2020).
11. Queirolo D, Kasper CB, Beisiegel BM. Avaliação do risco de extinção do
graxaim-do-campo Lycalopex gymnocercus (G. Fischer 1814) no Brasil.
Bio Brasil. (2013) 3:172–8. Available online at: https://www.icmbio.gov.br/
portal/images/stories/biodiversidade/fauna-brasileira/avaliacao-do- risco/
carnivoros/graxaim-do-campo_lycalopex_gymnocercusi.pdf (accessed
November,19 2020).
12. Manfredi C, Lucherini M, Canepuccia AD, Casanave EB. Geographical
variation in the diet of Geoffroy’S cat (Oncifelis geoffroyi) in Pampas grassland
of Argentina. J. Mammal. (2004) 85:1111–5. doi: 10.1644/BWG-133.1
13. Canepuccia AD, Martinez MM, Vassallo AI. Selection of waterbirds by
Geoffroy’scat: effects of prey abundance size and dist ance. Mamm. Biol. (2007)
72:163–73. doi: 10.1016/j.mambio.2006.07.003
14. Canel D, Scioscia NP, Denegri GM, Kittlein YM. The diet of the Pampas fox
(Lycalopex gymnocercus) in the province of Buenos Aires. Mastozool Neotrop.
(2016) 23:359–70. Available online at: https://bibliotecadigital.exactas.uba.ar/
collection/paper/document/paper_03279383_v23_n2_p359_Canel (accessed
November, 19 2020).
15. Poeta P, Costa D, Sáenz Y, Klibi N, Ruiz-Larrea F, Rodrigues J. et al.
Characterization of antibiotic resistance genes and virulence factors in faecal
enterococci of wild animals in Portugal. Zoonoses Public Health. (2005)
52:396–402. doi: 10.1111/j.1439-0450.2005.00881.x
16. Byappanahalli MN, Nevers MB, Korajkic A, Staley ZR, Harwood VJ.
Enterococci in the environment. Microbiol. Mol. Biol. Rev. (2012) 76:685–
706. doi: 10.1128/MMBR.00023-12
17. Prichula J, Pereira RI, Wachholz GR, Cardoso LA, Tolfo NCC, Santestevan
NA, et al. Resistance to antimicrobial agents among enterococci isolated from
fecal samples of wild marine species in the southern coast of Brazil. Mar.
Pollut. Bull. (2016) 105:51–7. doi: 10.1016/j.marpolbul.2016.02.071
18. García-Solache M, Rice B. The enterococcus: a model of adaptability to its
environment. Clin. Microbiol. Rev. (2019) 32:2. doi: 10.1128/CMR.00058-18
19. Huff R, Pereira RI, Pissetti C, de Araújo AM, d’Azevedo PA, Frazzon J,
et al. Antimicrobial resistance and genetic relationships of enterococci from
siblings and non-siblings Heliconius erato phyllis caterpillars. PeerJ. (2020)
8:e8647. doi: 10.7717/peerj.8647
20. Lebreton F, Willems RJL, Gilmore MS. Enterococcus diversity origins in nature
and gut colonization. In: Gilmore MS, Clewell DB, Ike Y, Shankar N, editors.
Enterococci: From Commensals to Leading Causes of Drug Resistant Infection.
New York, NY: Eye and Ear Infirmary (2014). p. 1–82.
21. List of prokaryotic names with standing in nomenclature [LPSN]. Genus
Enterococcus. Available online at: https://lpsn.dsmz.de/genus/enterococcus
(accessed November, 19 2020).
22. Prieto AMG, Van Schaik W, Rogers MRC, Coque TM, Baquero F,
Corander J, et al. Global emergence and dissemination of Enterococci
as nosocomial pathogens: attack of the clones? Front. Microbiol. (2016)
7:788. doi: 10.3389/fmicb.2016.00788
23. Selleck EM, van Tyne D, Gilmore MS. Pathogenicity
of Enterococci. Microbiol. Spectr. (2018) 7:GPP3-0053-
2018. doi: 10.1128/microbiolspec.GPP3-0053-2018
24. Torres C, Alonso CA, Ruiz-Ripa L, León-Sampedro R, Del Campo R, Coque
TM. Antimicrobial resistance in Enterococcus spp. of animal origin. Microbiol.
Spectr. (2018) 6:ARBA-0032-2018. doi: 10.1128/9781555819804.ch9
25. Miller WR, Munita JM, Arias CA. Mechanisms of antibiotic
resistance in enterococci. Expert Rev. Anti Infect. Ther. (2014)
12:1221–36. doi: 10.1586/14787210.2014.956092
26. Frazzon APG, Gama BA, Hermes V, Bierhals CG, Pereira RI, Guedes AG,
et al. Prevalence of antimicrobial resistance and molecular characterization
of tetracycline resistance mediated by tet(M) and tet(L) genes in Enterococcus
spp. isolated from food in Southern Brazil. World. J. Microbiol. Biotechnol.
(2010) 26:365–70. doi: 10.1007/s11274-009-0160-x
27. Cassenego APV, d’Azevedo PA, Ribeiro AML, Frazzon J, Van Der Sand
ST, Frazzon APG. Species distribution and antimicrobial susceptibility of
enterococci isolated from broilers infected experimentally with Eimeria spp
and fed with diets containing different supplements. Braz. J. Microbiol. (2013)
42:480–8. doi: 10.1590/S1517-83822011000200012
28. Grassotti TT, Zvoboda DD, Xavier LCF, De Araújo AJG, Pereira RI, Soares
RO, et al. Antimicrobial resistance profiles in Enterococcus spp. isolates from
fecal samples of wild and captive black capuchin monkeys (Sapajus nigritus) in
South Brazil. Front. Microbiol. (2018) 9:2366. doi: 10.3389/fmicb.2018.02366
29. Novais C, Campos J, Freitas AR, Barros M, Silveira E, Coque TM, et al.
Water supply and feed as sources of antimicrobial-resistant Enterococcus spp.
in aquacultures of rainbow trout (Oncorhyncus mykiss) Portugal. Sci. Total
Environ. (2018) 625:1102–12 doi: 10.1016/j.scitotenv.2017.12.265
30. Dec M, Stepie ´
n-Py´
sniak D, Gnat S, Fratini F, Urban-Chmiel R, Cerri D,
et al. Antibiotic susceptibility and virulence genes in Enterococcus isolates
from wild mammals living in Tuscany Italy. Microb. Drug Resist. (2019)
26:505–19. doi: 10.1089/mdr.2019.0052
31. Tripathi V, Cytryn E. Impact of anthropogenic activities on the dissemination
of antibiotic resistance across ecological boundaries. Essay. Biochem. (2017)
61:11–21. doi: 10.1042/EBC20160054
32. Mo SS, Urdahl AM, Madslien K, Sunde M, Nesse LL, Slettemeås JS,
et al. What does the fox say? Monitoring antimicrobial resistance in the
environment using wild red foxes as an indicator PLoS ONE. (2018)
13:e0198019. doi: 10.1371/journal.pone.0198019
33. Sauget M, Valot B, Bertrand X, Hocquet D. Can MALDI-TOF mass
spectrometry reasonably type bacteria? Trends Microbiol. (2017) 25:447–
55. doi: 10.1016/j.tim.2016.12.006
34. Clinical and Laboratory Standards Institute [CLSI]. Per formance Standards for
Antimicrobial Susceptibility Testing. 28th ed. Wayne, PA: CLSI (2018).
35. Schwarz S, Silley P, Simjee S, Woodford N, van Duijkeren E, Johnson AP, et al.
Editorial: assessing the antimicrobial susceptibility of bacteria obtained from
animals. J. Antimicrob. Chemother. (2010) 65:601–4. doi: 10.1093/jac/dkq037
36. Depardieu F, Perichon B, Courvalin P. Detection of the van
alphabet and identification of enterococci and staphylococci at
the species level by multiplex PCR. J. Clin. Microbiol. (2004)
42:5857–60. doi: 10.1128/JCM.42.12.5857-5860.2004
37. Sutcliffe J, Grebe T, Tait-Kamradt A, Wondrack L. Detection of erythromycin-
resistant determinants by PCR. Antimicrob. Agents Chemother. (1996)
40:2562–6. doi: 10.1128/AAC.40.11.2562
38. Werner G, Hildebrandt B, Witte W. The newly described
msrC gene is not equally distributed among all isolates of
Frontiers in Veterinary Science | www.frontiersin.org 9December 2020 | Volume 7 | Article 606377
Oliveira de Araujo et al. Resistant Enterococci in Wildlife Animals
Enterococcus faecium.Antimicrob. Agents Chemother. (2001)
45:3672–3. doi: 10.1128/AAC.45.12.3672-3673.2001
39. Aarestrup FM, Agerso Y, Gerner-Smidt P, Madsen M, Jensen LB. Comparison
of antimicrobial resistance phenotypes and resistance genes in Enterococcus
faecalis and Enterococcus faecium from humans in the community broilers
and pigs in Denmark. Diagn. Microbiol. Infect. Dis. (2000) 37:127–
37. doi: 10.1016/S0732-8893(00)00130-9
40. Mannu L, Paba A, Daga E, Comunian R, Zanetti S, Duprè I, et al. Comparison
of the incidence of virulence determinants and antibiotic resistance between
Enterococcus faecium strains of dairy animal and clinical origin. Int. J. Food
Microbiol. (2003) 88:291–304. doi: 10.1016/S0168-1605(03)00191-0
41. Eaton TJ, Gasson MJ. Molecular screening of Enterococcus
virulence determinants and potential for genetic exchange between
food and medical isolates. Appl. Environ. Microbiol. (2001)
67:1628–35. doi: 10.1128/AEM.67.4.1628-1635.2001
42. Shankar V, Baghdayan AS, Huycke MM, Lindahl G, Gilmore MS.
Infection-derived Enterococcus faecalis strains are enriched in esp a
gene encoding a novel surface protein. Infect. Immun. (1999) 67:193–
200. doi: 10.1128/IAI.67.1.193-200.1999
43. Radhouani H, Igrejas G, Gonçalves A, Pacheco R, Monteiro R, Sargo
R, et al. Antimicrobial resistance and virulence genes in Escherichia coli
and enterococci from red foxes (Vulpes vulpes). Anaerobe. (2013) 23:82–
6. doi: 10.1016/j.anaerobe.2013.06.013
44. Gonçalves A, Igrejas G, Radhouani H, Correia S, Pacheco R, Santos T,
et al. Antimicrobial resistance in faecal enterococci and Escherichia coli
isolates recovered from Iberian wolf. Lett. Appl. Microbiol. (2013) 56:268–
74. doi: 10.1111/lam.12044
45. Gonçalves A, Igrejas IG, Radhouani H, Santos T, Monteiro R, Pacheco R,
et al. Detection of antibiotic resistant enterococci and Escherichia coli in free
range Iberian Lynx (Lynx pardinus). Sci. Total Environ. (2013) 456-457:115–
9. doi: 10.1016/j.scitotenv.2013.03.073
46. Kataoka Y, Umino Y, Ochi H, Harada K, Sawada T. Antimicrobial
susceptibility of enterococcal species isolated from antibiotic-treated dogs and
cats. J. Vet. Med. Sci. (2014) 76:1399–402. doi: 10.1292/jvms.13-0576
47. Ben Said L, Dziri R, Sassi N, Lozano C, Ben Slama K, Ouzari I,
et al. Species distribution antibiotic resistance and virulence traits in
canine and feline enterococci in Tunisia. Acta Vet. Hung. (2017) 65:173–
84. doi: 10.1556/004.2017.018
48. Farías AA, Kittlein MJ. Small-scale spatial variability in the diet of Pampa foxes
(Pseudalopex gymnocercus) and human-induced changes in prey base. Ecol.
Res. (2008) 23:543–55. doi: 10.1007/s11284-007-0407-7
49. Trigo F, Tirelli FP, Machado LF, Peters FB, Indrusiak CB, Mazin FD, et al.
Geographic distribution and food habits of Leopardus tigrinus and L. geoffroyi
(Carnivora Felidae) at their geographic contact zone in southern Brazil. Stud.
Neotrop. Fauna Environ. (2013) 23:56–67. doi: 10.1080/01650521.2013.774789
50. Santestevan NA, Zvoboda DA, Prichula J, Pereira RI, Wachholz GR, Cardoso
LA, et al. Antimicrobial resistance and virulence factor gene profiles of
Enterococcus spp. isolates from wild Arctocephalus australis (South American
fur seal) and Arctocephalus tropicalis (Subantarctic fur seal). World J.
Microbiol. Biotechnol. (2015) 31:1935–46. doi: 10.1007/s11274-015-1938-7
51. Layton BA, Walters SP, Lam LH, Boehm A. Enterococcus species distribution
among human and animal hosts using multiplex PCR. J. Appl. Microbiol.
(2010) 109:539–47. doi: 10.1111/j.1365-2672.2010.04675.x
52. Aslanta¸s Ö, Tek E. Isolation of ampicillin and vancomycin
resistant Enterococcus faecium from dogs and cats. Kafkas
Univ.Vet. Fak. Derg. (2019) 25:263–9. doi: 10.9775/kvfd.2018.
20912
53. Iseppi R, Di Cerbo A, Messi P, Sabia C. Antibiotic resistance and
virulence traits in vancomycin-resistant enterococci (VRE) and extended-
spectrum β-lactamase/ampc-producing (esbl/ampc) Enterobacteriaceae from
humans and pets. Antibiotics. (2020) 9:1–14. doi: 10.3390/antibiotics
9040152
54. Nowakiewicz A, Zieba P, Gnat S, Tro´
scia´
nczyk A, Osi´
nska M,
Łagowski D, et al. A significant number of multi-drug resistant
Enterococcus faecalis in wildlife animals; long-term consequences and
new or known reservoirs of resistance? Sci. Total Environ. (2020)
705:135830. doi: 10.1016/j.scitotenv.2019.135830
55. HuY, Gao GF, Zhu B. Antibiotic resistome: gene flow in
environments animals and human beings. Front. Med. (2017)
11:161–8. doi: 10.1007/s11684-017-0531-x
56. Rabello RF, Bonelli RR, Penna BA, Albuquerque JP, Souza RM, Cerqueira
AMF. Antimicrobial resistance in farm animals in Brazil: an update overview.
Animals. (2020) 10:1–43. doi: 10.3390/ani10040552
57. Kummerer K. Antibiotics in the aquatic environment-a review-part I.
Chemosphere. (2009) 75:417–34. doi: 10.1016/j.chemosphere.2008.11.086
58. Hegstad K, Mikalsen T, Coque TM, Werner G, Sundsfjord A.
Mobile genetic elements and their contribution to the emergence of
antimicrobial resistant Enterococcus faecalis and Enterococcus faecium.
Clin. Microbiol. Infect. (2010) 16:541–54. doi: 10.1111/j.1469-0691.2010.
03226.x
59. Pal C, Bengtsson-Palme J, Kristiansson E, Larsson DGJ. The structure and
diversity of human animal and environmental resistomes. Microbiome. (2016)
4:1–15. doi: 10.1186/s40168-016-0199-5
60. Allen HK, Donato J, Wang HH, Cloud-Hansen KA, Davies J, Handelsman J.
Call of the wild: antibiotic resistance genes in natural environments. Nat. Rev.
Microbiol. (2010) 8:251–9. doi: 10.1038/nrmicro2312
61. Antonelli A, D’Andrea MM, Brenciani A, Galeotti CL, Morroni G, Pollini S,
et al. Characterization of poxtA a novel phenicol-oxazolidinone-tetracycline
resistance gene from an MRSA of clinical origin. J. Antimicrob. Chemother.
(2018) 73:1763–9. doi: 10.1093/jac/dky088
62. Tirelli FP. Análises ecológicas de duas espécies de felídeos (Leopardus
Geoffroyi e L. Colocolo) em áreas antropizadas da savana Uruguaia (master’s
thesis). Porto Alegre Pontifícia Universidade Católica de Porto Alegre, Porto
Alegre, Brazil (2017).
Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Copyright © 2020 Oliveira de Araujo, Huff, Favarini, Mann, Peters, Frazzon
and Guedes Frazzon. This is an open-access article distributed under the terms
of the Creative Commons Attribution License (CC BY). The use, distribution or
reproduction in other forums is permitted, provided the original author(s) and the
copyright owner(s) are credited and that the original publication in this journal
is cited, in accordance with accepted academic practice. No use, distribution or
reproduction is permitted which does not comply with these terms.
Frontiers in Veterinary Science | www.frontiersin.org 10 December 2020 | Volume 7 | Article 606377
... Animals, with their feces, may represent sources of enterococcal infection for humans, but they act as a "source of antimicrobial resistance genes," too [26]. MDR and XDR enterococci are generally involved in human nosocomial infections [27]; in recent years, Enterococcus strains with these resistant phenotypes are frequently detected in wild animals, too, with percentages similar to our investigation [25,28,29]. Wildlife could represent the reservoir and a possible source of these bacteria, which are very hazardous to treat. ...
Article
Full-text available
Bacteria of the genus Enterococcus are opportunistic pathogens, part of the normal intestinal microflora of animals, able to acquire and transfer antimicrobial resistance genes. The aim of this study was to evaluate the possible role of wild avifauna as a source of antimicrobial-resistant enterococci. To assess this purpose, 103 Enterococcus spp. strains were isolated from the feces of wild birds of different species; they were tested for antimicrobial resistance against 21 molecules, vancomycin resistance, and high-level aminoglycosides resistance (HLAR). Furthermore, genes responsible for vancomycin, tetracycline, and HLAR were searched. E. faecium was the most frequently detected species (60.20% of isolates), followed by E. faecalis (34.95% of isolates). Overall, 99.02% of the isolated enterococci were classified as multidrug-resistant, with 19.41% extensively drug-resistant, and 2.91% possible pan drug-resistant strains. Most of the isolates were susceptible to amoxicillin/clavulanic acid (77.67%) and ampicillin (75.73%), with only 5.83% of isolates showing an ampicillin MIC ≥ 64 mg/L. HLAR was detected in 35.92% of isolates, mainly associated with the genes ant(6)-Ia and aac(6′)-Ie-aph(2′’)-Ia. Few strains (4.85%) were resistant to vancomycin, and the genes vanA and vanB were not detected. A percentage of 54.37% of isolates showed resistance to tetracycline; tet(M) was the most frequently detected gene in these strains. Wild birds may contribute to the spreading of antimicrobial-resistant enterococci, which can affect other animals and humans. Constant monitoring is essential to face up to the evolving antimicrobial resistance issue, and monitoring programs should include wild avifauna, too.
... Wild animals were shown to be the source of enterococci, with significant resistance levels. [34]. It is notable that, in our study, resistance to streptomycin in wild animal isolates was higher than in farm animal isolates, except for turkeys. ...
Article
Full-text available
Background and aim: Although Enterococcus faecalis and Enterococcus faecium are common members of human and animal gut microbiota, their resistance to different antimicrobials makes them important pathogens. Multidrug-resistant enterococci often contaminate foods of animal origin at slaughterhouses. The World Health Organization and the World Organization for Animal Health recommend including animal-derived enterococci in antimicrobial resistance (AMR) monitoring programs. This study aimed to fill a literature gap by determining the current AMR prevalence of E. faecalis and E. faecium from different food-producing animals in Russia. Materials and methods: Samples of biomaterial were taken from chickens (n=187), cattle (n=155), pigs (n=49), turkeys (n=34), sheep (n=31), and ducks (n=31) raised at 28 farms in 15 regions of Russia. Isolates of E. faecalis (n=277) and of E. faecium (n=210) (487 isolates in total; 1 isolate per sample) were tested for resistance to 12 antimicrobials from 11 classes using the broth microdilution method. Three criteria were used for the interpretation of minimum inhibitory concentration: Epidemiological cutoff values (ECOFFs) from the European Committee on Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) clinical breakpoints. The AMR cloud online platform was used for data processing and statistical analysis. Results: A difference of >10% was found between E. faecalis and E. faecium resistance to several antimicrobials (erythromycin, gentamycin, tetracycline, chloramphenicol, ciprofloxacin, and streptomycin). In total, resistance to most antimicrobials for enterococci isolates of both species taken from turkeys, chicken, and pigs was higher than cattle, sheep, and ducks. The highest levels were found for turkeys and the lowest for ducks. Among antimicrobials, resistance to bacitracin and virginiamycin was 88-100% in nearly all cases. High levels of clinical resistance were found for both bacteria species: Rifampicin (44-84%) from all animals, tetracycline (45-100%) from poultry and pigs, and erythromycin (60-100%), ciprofloxacin (23-100%), and trimethoprim-sulfamethoxazole (33-53%) from chickens, turkeys, and pigs. No vancomycin-resistant isolates were found. Most isolates were simultaneously resistant to one-three classes of antimicrobials, and they were rarely resistant to more than three antimicrobials or sensitive to all classes. Conclusion: Differences in resistance between enterococci from different farm animals indicate that antimicrobial application is among the crucial factors determining the level of resistance. Conversely, resistance to rifampicin, erythromycin, tetracycline, and ciprofloxacin found in enterococci from farm animals in our study was notably also found in enterococci from wild animals and birds. Our results may be partly explained by the intrinsic resistance of E. faecium and E. faecalis to some antimicrobials, such as trimethoprim/sulfamethoxazole and bacitracin.
... Resistance to penicillin was found in almost all of the analyzed samples (93.7%) and 75% of the isolates were also resistant to ampicillin and amoxicillin-clavulanic acid, followed by ciprofloxacin (68.7%). Similar resistance profiles were described also by Olivera de Araujo et al. [44] for E. faecalis and other Enterococcus spp. strains isolated from fecal samples of wild Pampas foxes and Geoffroy's cats in the Brazilian Pampa biome. ...
Article
Full-text available
The importance of wild boar lies in its role as a bioindicator for the control of numerous zoonotic and non-zoonotic diseases, including antibiotic resistance. Mannitol Salt Agar (MSA) is a selective medium used for isolation, enumeration, and differentiation of pathogenic staphylococci. Other genera such as Enterococcus spp. are also salt tolerant and able to grow on MSA. The present study focused on the identification, by matrix assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF-MS), of bacteria grown on MSA isolated from the nasal cavities of 50 healthy wild boars hunted in Campania Region (southern Italy) in the year 2019. In addition, the antimicrobial resistance phenotype of the isolated strains was determined by disk diffusion method. Among genus Staphylococcus, coagulase-negative Staphylococcus (CoNS) were the most common isolated species, with Staphylococcus xylosus as the most prevalent species (33.3%). Furthermore, Enterococcus spp. strains were isolated, and Enterococcus faecalis was the species showing the highest frequency of isolation (93.8%). For staphylococci, high levels of resistance to oxacillin (93.3%) were recorded. Differently, they exhibited low frequencies of resistance to tested non-β-lactams antibiotics. Among enterococci, the highest resistances were observed for penicillin (93.7%), followed by ampicillin (75%), and ciprofloxacin (68.7%). Interestingly, 43.7% of the isolated strains were vancomycin-resistant. In conclusion, this study reports the phenotypic antibiotic resistance profiles of Staphylococcus spp. and Enterococcus spp. strains isolated from nasal cavities of wild boars hunted in Campania Region, highlighting that these wild animals are carriers of antibiotic resistant bacteria.
... The tetW gene, the most widespread tetracycline resistance determinant in bacteria of different origins, may be a good example of disseminating resistance genes among clinical and environmental strains. The occurrence of tetW in soil and water samples nearby of swine and cattle farms is evidence of the persistence of resistance genes in the various environment, including wildlife [52,61,[63][64][65]. Our findings obtained for T. pyogenes isolated from European bison also confirmed the easy spread of tetW among strains that occurred in wild ruminants. ...
Article
Full-text available
Determinants of tetracycline resistance in Trueperella pyogenes are still poorly known. In this study, resistance to tetracycline was investigated in 114 T. pyogenes isolates from livestock and European bison. Tetracycline minimum inhibitory concentration (MIC) was evaluated by a microdilution method, and tetracycline resistance genes were detected by PCR. To determine variants of tetW and their linkage with mobile elements, sequencing analysis was performed. Among the studied isolates, 43.0% were tetracycline resistant (MIC ≥ 8 µg/mL). The highest MIC90 of tetracycline (32 µg/mL) was noted in bovine and European bison isolates. The most prevalent determinant of tetracycline resistance was tetW (in 40.4% of isolates), while tetA(33) was detected only in 8.8% of isolates. Four variants of tetW (tetW-1, tetW-2, tetW-3, tetW-4) were recognized. The tetW-3 variant was the most frequent and was linked to the ATE-1 transposon. The tetW-2 variant, found in a swine isolate, was not previously reported in T. pyogenes. This is the first report on determinants of tetracycline resistance in T. pyogenes isolates from European bison. These findings highlight that wild animals, including wild ruminants not treated with antimicrobials, can be a reservoir of tetracycline-resistant bacteria carrying resistance determinants, which may be easily spread among pathogenic and environmental microorganisms.
Article
Full-text available
Abstract Enterococcus faecalis (E. faecalis) was identified among the most relevant antimicrobial‐resistant (AMR) bacteria in the EU for poultry in a previous scientific opinion. Thus, it has been assessed according to the criteria of the Animal Health Law (AHL), in particular criteria of Article 7 on disease profile and impacts, Article 5 on its eligibility to be listed, Annex IV for its categorisation according to disease prevention and control rules as in Article 9 and Article 8 for listing animal species related to the bacterium. The assessment has been performed following a methodology previously published. The outcome is the median of the probability ranges provided by the experts, which indicates whether each criterion is fulfilled (lower bound ≥ 66%) or not (upper bound ≤ 33%), or whether there is uncertainty about fulfilment. Reasoning points are reported for criteria with uncertain outcome. According to the assessment here performed, it is uncertain whether AMR E. faecalis can be considered eligible to be listed for Union intervention according to Article 5 of the AHL (33–66% probability). According to the criteria in Annex IV, for the purpose of categorisation related to the level of prevention and control as in Article 9 of the AHL, the AHAW Panel concluded that the bacterium does not meet the criteria in Sections 1, 2 and 4 (Categories A, B and D; 0–5%, 5–10% and 1–10% probability of meeting the criteria, respectively) and the AHAW Panel is uncertain whether it meets the criteria in Sections 3 and 5 (Categories C and E, 33–66% and 33–66% probability of meeting the criteria, respectively). The animal species to be listed for AMR E. faecalis according to Article 8 criteria are mostly birds of the orders Galliformes and Anseriformes, but also mammals and reptiles can serve as reservoirs.
Article
Full-text available
In animal husbandry, antimicrobial agents have been administered as supplements to increase production over the last 60 years. Large-scale animal production has increased the importance of antibiotic management because it may favor the evolution of antimicrobial resistance and select resistant strains. Brazil is a significant producer and exporter of animal-derived food. Although Brazil is still preparing a national surveillance plan, several changes in legislation and timely programs have been implemented. Thus, Brazilian data on antimicrobial resistance in bacteria associated with animals come from official programs and the scientific community. This review aims to update and discuss the available Brazilian data on this topic, emphasizing legal aspects, incidence, and genetics of the resistance reported by studies published since 2009, focusing on farm animals and derived foods with the most global public health impact. Studies are related to poultry, cattle, and pigs, and mainly concentrate on non-typhoid Salmonella, Escherichia coli, and Staphylococcus aureus. We also describe legal aspects of antimicrobial use in this context; and the current occurrence of genetic elements associated with resistance to beta-lactams, colistin, and fluoroquinolones, among other antimicrobial agents. Data here presented may be useful to provide a better understanding of the Brazilian status on antimicrobial resistance related to farm animals and animal-derived food products.
Article
Full-text available
Background: We investigated the virulence factors, genes, antibiotic resistance patterns, and genotypes (VRE and ESBL/AmpC) production in Enterococci and Enterobacteriaceae strains isolated from fecal samples of humans, dogs, and cats. Methods: A total of 100 fecal samples from 50 humans, 25 dogs, and 25 cats were used in the study. MICs of nine antimicrobials were determined using the broth microdilution method. Polymerase chain reaction was used for the detection of genes responsible for antibiotic resistance (VRE and ESBL/AmpC) and virulence genes both in Enterococcus species, such as cytolysin (cylA, cylB, cylM), aggregation substance (agg), gelatinase (gelE), enterococcal surface protein (esp), cell wall adhesins (efaAfs and efaAfm), and in Enterobacteriaceae, such as cytolysin (hemolysin) and gelatinase production (afa, cdt, cnf1, hlyA, iutA, papC, sfa). Results: Enterococcus faecium was the most prevalent species in humans and cats, whereas Enterococcus faecalis was the species isolated in the remaining samples. A total of 200 Enterobacteriaceae strains were also detected, mainly from humans, and Escherichia coli was the most frequently isolated species in all types of samples. In the Enterococcus spp, the highest percentages of resistance for ampicillin, amoxicillin/clavulanate, erythromycin, tetracycline, ciprofloxacin, teicoplanin, and vancomycin were detected in cat isolates (41.6%, 52.8%, 38.9%, 23.6%, 62.5%, 20.8%, and 23.6% respectively), and in E. coli, a higher rate of resistance to cefotaxime and ceftazidime emerged in cat and dog samples, if compared with humans (75.4% and 66.0%, 80.0% and 71.4%, and 32.0% and 27.2%, respectively). Regarding the total number of enterococci, 5% and 3.4% of the strains were vancomycin and teicoplanin resistant, and the vancomycin resistance (van A) gene has been detected in all samples by PCR amplification. All the Enterobacteriaceae strains were confirmed as ESBL producers by PCR and sequencing, and the most frequent ESBL genes in E.coli strains from humans and pet samples were blaCTX-M-1 and blaCTX-M-15. Conclusions: Our results provide evidence that one or more virulence factors were present in both genera, underlining again the ability of pet strains to act as pathogens.
Article
Full-text available
Background Studies evaluating bacteria in insects can provide information about host–microorganism–environment interactions. The gut microbial community has a profound effect on different physiological functions of insects. Enterococcus spp. are part of the gut community in humans and other animals, as well as in insects. The presence and antimicrobial resistance profile of enterococci are well studied in different animals; however, data for Heliconius erato phyllis (Lepidoptera: Nymphalidae) do not yet exist. Therefore, the aims of this study were to evaluate the distribution of enterococcal species, their antimicrobial resistance profile and virulence genes, and the genetic relationships between enterococci isolated from fecal samples from sibling and non-sibling H. erato phyllis caterpillars collected from different sites in South Brazil. Methods Three H. erato phyllis females were captured (two from a forest fragment and one from an urban area), and kept individually in open-air insectaries. Eggs were collected and caterpillars (siblings and non-siblings) were fed daily with Passiflora suberosa leaves. Fecal samples ( n = 12) were collected from fifth-instar caterpillars, inoculated in selective medium, and 15 bacterial colonies were randomly selected from each sample. Enterococci were identified by PCR and MALDI-TOF, analyzed by disk diffusion antimicrobial susceptibility tests, and screened for resistance and virulence genes by PCR. The genetic relationships between the strains were determined using pulsed-field gel electrophoresis (PFGE). Results A total of 178 enterococci strains were identified: E. casseliflavus (74.15%; n = 132), E. mundtii (21.34%; n = 38), E. faecalis (1.12%; n = 2) and Enterococcus sp. (3.37%; n = 6). High rates of resistance to rifampicin (56%) and erythromycin (31%) were observed; 120 (67.41%) of the isolates showed resistance to at least one antibiotic and six (3.37%) were multidrug-resistant.None of the erythromycin-resistant strains was positive for the erm (B) and msr C genes. The virulence genes esp , ace , and gelE were observed in 35%, 7%, and 1% of the strains, respectively. PFGE separated the enterococci into 22 patterns, four being composed of strains from sibling caterpillars. Conclusion Enterococcus casseliflavus was the dominant species in fecal samples of fifth-instar caterpillars. Resistant enterococci strains may be related to environmental pollution or the resistome. The PFGE analysis showed genetic relationships between some strains, suggesting that the enterococci isolated from fecal samples of the sibling caterpillars might have come from common sources, e.g., via diet (herbivory) and/or vertical transmission (through the egg surface). Further studies will be conducted to better understand the role of Enterococcus in the microbial community of the gastrointestinal tract of these insects, and the mechanisms involved in acquisition and maintenance of enterococci.
Article
Full-text available
Aims We offer a first classification of South Brazilian grasslands (Campos Sulinos) based on quantitative vegetation data and describing grassland types in terms of dominant and indicator species. Location South Brazilian grasslands (Paraná, Santa Catarina, Rio Grande do Sul states). Methods We described vegetation plots in 167 sampling units throughout the region using a stratified nested design, totalizing 1502 1 m² quadrats. We classified vegetation using cluster analysis based on Bray‐Curtis dissimilarities, establishing three vegetation types and ten subtypes. We conducted indicator species analysis within the resulting subtypes, and for all possible combinations of subtypes. Results In Cluster analyses, a clear separation of poorly drained grasslands from the drier sites appeared. Further, a clear distinction of grasslands in the South Brazilian highland region, situated in the Atlantic Forest biome, and the grasslands of the Pampa biome, to the south, emerged, reflecting climatic and management differences. Highland grasslands showed lower species cover dominance, while in the Pampa, Paspalum notatum clearly was the most important species and the abundance of exotic species was higher. Conclusions Our study provides the first classification of South Brazilian grasslands based on quantitative vegetation data recorded in a standardized sampling design. The data supports the division of grasslands into the main phytogeographic units of the region (Brazilian biome classification). Grasslands in these two regions also differ in terms of species dominance pattern (higher dominance in Pampa grasslands, likely also due to higher grazing level) and in terms of conservation state (low presence of exotic species in highland grasslands). Our results are important for conservation policies, which can now consider the presence of different grassland types in different region, but more data will be necessary for a more detailed classification that considers different abiotic features in more detail. This article is protected by copyright. All rights reserved.
Article
Full-text available
The environment, human, and animals play an important role in the spread of antibiotic-resistant bacteria. Enterococci are members of the gastrointestinal tracts of humans and animals and represent important reservoirs of antibiotic resistance genes. Until today, few studies have examined antibiotic susceptibility in enterococci isolated from primates. Therefore, the present study investigated species distribution, antibiotic susceptibility, and resistance genes in enterococci isolated from wild and captive black capuchins monkeys (Sapajus nigritus) in Rio Grande do Sul, South Brazil. A total of 24 swabs/fecal samples were collected, including 19 from wild monkeys living in two forest fragments [São Sebastião do Caí (SSC) and Santa Cruz do Sul (SCS)], and five in captive [Parque Zoológico da Fundação Zoobotânica (ZOO)], between August 2016 and November 2017. Fifteen colonies were randomly selected from each sample. Enterococci were identified by MALDI-TOF, tested for susceptibility to 12 antibiotics; and screened for tet(S), tet(M), tet(L), msrC, and erm(B) genes by PCR. Two-hundred ninety-six enterococci were isolated (SSC n = 137; SCS n = 86; ZOO n = 73) and differences in Enterococcus species distribution were detected on three monkey groups, with low abundance in SCS (1 - D = 0.2), followed by ZOO (1 - D = 0.68), and SSC (1 - D = 0.73). The enterococci frequently recovered include the following: Enterococcus faecalis (42.6%), E. hirae (29.1%), and E. faecium (15.9%). Antibiotic-nonsusceptible was observed in 202 (67.9%) strains. The rate of non-susceptibility to rifampicin, tetracycline, erythromycin, nitrofurantoin, chloramphenicol, and ampicillin was 46%, 26%, 22% and 19%, 13%, 0.3%, and 0.3%, respectively. All strains were susceptible to vancomycin, streptomycin, gentamycin, and linezolid. Forty-three (14.52%) isolates were identified as multidrug resistant (MDR), and the highest number of MDR enterococci were E. faecium recovered from wild monkeys living close to a hospital and water treatment plant. Elevated rates of antibiotic resistance genes msrC and tet(L) were isolates from ZOO. In conclusion, differences in the frequency of enterococci species, antibiotic-nonsusceptible and antibiotic resistance genes in all groups of monkeys were identified. These data suggest that anthropogenic activities could have an impact in the resistome of primate gut enterococci communities.
Article
As the last link in the food chain in a complex ecosystem covering at least three different environmental spheres, species of wildlife carnivorous mammals constitute a group accumulating potential pathogens and factors resulting from human activity, including the emergence of drug resistance. Therefore, the aim of this study was to evaluate the level and range of resistance in commensal E. faecalis isolated from wildlife carnivorous mammals and genetic relationships in terms of the source of these strains as well as resistance and virulence genes. Differentiation between strains was performed based on ADSRRS-fingerprinting method. The results showed that almost half of the tested animals (48%) were carriers of at least one multidrug resistant E. faecalis strain. Moreover, 44% of MDR-positive animals showed two or three strains differing in both the genotype and the resistance phenotype. A significant percentage of strains were resistant to high-level aminoglycosides (from 20% to even 57.5%). The resistance and virulence gene profiles showed a rich panel of genes closely related to isolates from nosocomial infection and from livestock animals. The presence of the same genotypes in different hosts reflects not only a possible transfer of genes between E. faecalis strains but also exchange of strains between animals. The obtained results reflect a very high level of contamination of animals that are not subjected to targeted antibiotic therapy, which may suggest the degree of pollution of the environment. Wildlife animals and their environment can be a link closing the circulation cycle of genes and even epidemiologically important strains; therefore, there is a high risk that this pool will never run out and will be maintained at a high level.
Article
Drug resistance is of great importance to human and animal health, but wild environments are still poorly understood in terms of their function as reservoirs of dangerous microbes and resistance determinants. The aim of the study was to determine the antibiotic susceptibility and virulence factors of Enterococcus bacteria from wildlife in Tuscany, Italy. Of the 36 mammalian fecal samples, 52 isolates were derived and classified as Enterococcus faecium (46% of isolates), Enterococcus hirae (19%), Enterococcus faecalis (13%), Enterococcus gallinarum (8%), Enterococcus casseliflavus (6%), Enterococcus durans (4%), Enterococcus mundtii (2%), and Enterococcus canintestini (2%) using both matrix-assisted laser desorption/ionization-time of flight mass spectrometry and methods based on analysis of genetic material. The isolates tested showed the most frequent resistance to tetracycline (36.5% isolates), ciprofloxacin (36.5%), and erythromycin (25%). Three isolates showed high level of resistance (minimal inhibitory concentration ≥1,024 μg/mL) to vancomycin and teicoplanin, and 15% of the isolates demonstrated multidrug resistance. No isolate resistant to ampicillin, linezolid, or streptomycin was found. Among resistance genes, aac(6)-Ii (50% isolates), msrA/B (48%), msrC (42%), and tetM (31%) were identified most frequently. All E. faecium and E. faecalis isolates were positive for the efaAfm and efaAfs genes, respectively. Other virulence-associated genes, that is, gelE, cylA, asa1, esp, ace, orf1481, ptsD, and sgrA, were found in the majority of E. faecalis and several E. faecium isolates. Multilocus sequence typing analysis performed for selected isolates revealed three new sequence types. The results obtained indicate that wild mammals might act as reservoirs of resistance and virulence determinants that could be transferred between different ecosystems.
Article
Pathogenicity of Enterococci, Page 1 of 2 Abstract Enterococci are unusually well adapted for survival and persistence in a variety of adverse environments, including on inanimate surfaces in the hospital environment and at sites of infection. This intrinsic ruggedness undoubtedly played a role in providing opportunities for enterococci to interact with other overtly drug-resistant microbes and acquire additional resistances on mobile elements. The rapid rise of antimicrobial resistance among hospital-adapted enterococci has rendered hospital-acquired infections a leading therapeutic challenge. With about a quarter of a genome of additional DNA conveyed by mobile elements, there are undoubtedly many more properties that have been acquired that help enterococci persist and spread in the hospital setting and cause diseases that have yet to be defined. Much remains to be learned about these ancient and rugged microbes, particularly in the area of pathogenic mechanisms involved with human diseases.
Article
The genus Enterococcus comprises a ubiquitous group of Gram-positive bacteria that are of great relevance to human health for their role as major causative agents of health care-associated infections. The enterococci are resilient and versatile species able to survive under harsh conditions, making them well adapted to the health care environment. Two species cause the majority of enterococcal infections: Enterococcus faecalis and Enterococcus faecium . Both species demonstrate intrinsic resistance to common antibiotics, such as virtually all cephalosporins, aminoglycosides, clindamycin, and trimethoprim-sulfamethoxazole. Additionally, a remarkably plastic genome allows these two species to readily acquire resistance to further antibiotics, such as high-level aminoglycoside resistance, high-level ampicillin resistance, and vancomycin resistance, either through mutation or by horizontal transfer of genetic elements conferring resistance determinants.