GENETIC POLYMORPHISM OF IL-22 AND IL-27 GENES IN IRAQI PATIENTS WITH URINARY BLADDER CARCINOMA

Abstract

The aim of this work was to study the association between three single nucleotide polymorphisms (SNP), rs 2227485 in IL-22 gene, rs 153109 and rs 17855750 in IL-27 gene and its levels in bladder cancer (BC) patients. One hundred bladder cancer patients and 100 healthy volunteers were registered in this study. Results showed a significant increase in IL-22 and IL-27 in BC patients when compared to healthy participants, also the level of both interleukins increased significantly with progressing of the disease. The SNP rs2227485 of IL-22 was genotyped by PCR-sequencing. The results revealed high frequency of TT and T allele compared with control with a significant positive odds ratio (OR) (12 67% confidence interval (CI= 4.76-34, P = 0.000) and T allele (OR = 3.23, CI = 2.15-4.86 P = 0.000). Results of IL-22 concentration were estimated by ELISA which was compared with genotyping results at rs2227485 SNP. The genotyping data revealed that the mutant TT genotype showed a significant high level in patients and a significant decreasing level in healthy control. The genotyping results of rs 17855750 in IL-27 gene showed a significant positive (OR) of GG genotype (13.83) (CI = 1.42-5.00, P = 0.003) and G allele (3.62) (CI = 5.3-17.4, P = 0.000). While the results of IL-27 concentration revealed that the mutant TT genotype showed insignificant high level followed by GG genotype. The SNP (rs 1531109) of IL-27 showed GG genotype OR (51.19) (CI = 3.09-847, P = 0.000) and G allele with positive OR (6) (CI = 3.5-10.30, P = 0.000) and AG genotype (2.67) (CI = 0.9-10.8, P = 0.029) and the IL-27 level showed that AG genotype with a significant higher level in patients and with a significant lowest level in the healthy control. Our results suggested that the mutant TT genotype and T allele for IL-22 rs 2227485 and GG genotype and G allele for IL-27 rs 17855750 and rs 153109 may play a role in the etiology of the bladder cancer and the patients with this genotype displayed a significant high level of IL-22.

Full text

GENETIC POLYMORPHISM OF IL-22 AND IL-27 GENES IN IRAQI
PATIENTS WITH URINARY BLADDER CARCINOMA
Mahmood Al-Mualm1, Shahlaa M. Salih2, Rawaa Alchalabi3
1Biology Department, Al-Rasheed university college, Baghdad-Iraq.
2College of Biotechnology, Al-Nahrain university, Baghdad-Iraq.
3College of Biotechnology, Al-Nahrain university, Baghdad-Iraq.
(Received 10 February 2020, Revised 26 May 2020, Accepted 12 June 2020)
ABSTRACT : The aim of this work was to study the association between three single nucleotide polymorphisms (SNP), rs
2227485 in IL-22 gene, rs 153109 and rs 17855750 in IL-27 gene and its levels in bladder cancer (BC) patients. One hundred
bladder cancer patients and 100 healthy volunteers were registered in this study. Results showed a significant increase in IL-
22 and IL-27 in BC patients when compared to healthy participants, also the level of both interleukins increased significantly
with progressing of the disease. The SNP rs2227485 of IL-22 was genotyped by PCR-sequencing. The results revealed high
frequency of TT and T allele compared with control with a significant positive odds ratio (OR) (12 67% confidence interval (CI=
4.76- 34, P = 0.000) and T allele (OR = 3.23, CI = 2.15- 4.86 P = 0.000). Results of IL-22 concentration were estimated by ELISA
which was compared with genotyping results at rs2227485 SNP. The genotyping data revealed that the mutant TT genotype
showed a significant high level in patients and a significant decreasing level in healthy control. The genotyping results of rs
17855750 in IL-27 gene showed a significant positive (OR) of GG genotype (13.83) (CI = 1.42 – 5.00, P = 0.003) and G allele
(3.62) (CI = 5.3-17.4, P = 0.000). While the results of IL-27 concentration revealed that the mutant TT genotype showed
insignificant high level followed by GG genotype. The SNP (rs 1531109) of IL-27 showed GG genotype OR (51.19) (CI = 3.09-
847, P = 0.000) and G allele with positive OR (6) (CI = 3.5-10.30, P = 0.000) and AG genotype (2.67) (CI = 0.9-10.8, P = 0.029) and
the IL-27 level showed that AG genotype with a significant higher level in patients and with a significant lowest level in the
healthy control. Our results suggested that the mutant TT genotype and T allele for IL-22 rs 2227485 and GG genotype and G
allele for IL-27 rs 17855750 and rs 153109 may play a role in the etiology of the bladder cancer and the patients with this
genotype displayed a significant high level of IL-22.
Kew Words: Genetic polymorphism, IL-22, IL-27, urinary bladder carcinoma.
Biochem. Cell. Arch. Vol. 20, No. 2, pp. 4451-4456, 2020 www.connectjournals.com/bca ISSN 0972-5075
INTRODUCTION
Bladder cancer is the most common cancer of the
urinary system and is the fourth most commonly
diagnosed malignancy in men in the United States. It is
estimated that 76, 000 new cases of bladder cancer are
expected to occur which in turn would increase the
mortality rate to 16, 000 in the United States in 2016
(Siegel, Miller and Jemal 2016). Tobacco smoking and
exposure to the different environmental carcinogens like,
synthetic aromatic toxins, pesticides with estrogen-like
activity and radiation are thought to be involved with
development of urinary bladder (David et al., 2011;
Stanislaw et al., 2013). However, given the fact that not
all the exposed individuals develop bladder cancer in their
lifetime (Dimitrios et al, 2010), suggesting that the cause
of the bladder cancer are multifactorial interaction of
environmental triggers with genetic susceptibility
(Horikawa, Gu and Wu 2008; Volanis et al., 2010).
Epidemiological studies have suggested that inflammation
have critical role in cancer as a tumor-supporting
microenvironment that is a fundamental participant in the
neoplastic process (Lin and Karin 2007).
Interleukin -22 is a member of IL-10 family cytokines,
a class of potent mediators of cellular inflammatory
responses. It is produced by variety of cells types, primarily
by Th17, Th1, Th22 and NK22 cells (Zhang et al., 2011)
and promotes anti-microbial defense, pro-inflammatory
and tissue remodeling responses. IL-22 has also been
shown to modulate cell cycle, tumorigenesis and tumor
progression in cancers (Kim et al., 2014). The gene
expression of cytokines is tightly regulated and the irregular
expression has been implicated in the susceptibility to a
range of infectious diseases and it have been demonstrated
that some cytokines single-nucleotide polymorphism are
important in altering expression or function of the cytokine
gene (Connelly, 2015). The genetic alterations in cytokine
genes may lead to a high or low production of certain
cytokines that may influence native antitumor immune
responses or tumor progression by acting on pathways of
tumor angiogenesis (Zhou et al., 2015).
The human IL22 gene is located on the longer arm of
chromosome 12, on 12q15, approximately 52- and 99-
DocID: https://connectjournals.com/03896.2020.20.4451

kbp upstream from the IL-26 and IFN-γ locus,
respectively and has the same transcriptional orientation
as these two adjoining genes (Wolk, Sabat, et al., 2006).
The IL-22 receptor is a heterodimer composed of IL-22
receptor 1 (IL-22R1) and IL-10 receptor 2 (IL-10R2),
which is ubiquitously expressed by most cell types, while
the expression of IL-22R1 is limited to nonhematopoietic
cells (such as hepatic cells, pancreatic cells, kidney cells,
epithelial cells and skin keratinocytes). Therefore, the
expression profile of IL-22R1 determines how IL-22
specifically targets innate cell populations and not
adaptive immune cells (Sonnenberg, Fouser and Artis
2011).
Interleukin -27 is a heterodimeric cytokine that
contains Epstein-Barr virus–induced gene 3 (EBI3;
similar to the p40 subunits of IL-12) and IL-27p28, which
signals through a receptor composed of gp130 (utilized
by many cytokines, including IL-6) and IL-27Rα (also
known as WSX-1 or TCCR) (Iwasaki et al., 2015). There
are a number of distinct structural motifs that characterize
the receptor and cytokine subunits of IL-27 and that
highlight their evolutionary relationship to the IL-6, IL-12
and IL-23 signaling cassettes, as well as their ability to
engage Janus kinase, signal transducer and activator of
transcription (STAT) and mitogen-activated protein kinase
(MAPK) pathways. IL-27 is largely secreted from
activated antigen-presenting cells (APCs) such as
macrophages and Dendritic cells (DCs). IL-27 can
mediate Th1 cells differentiation and proliferation. IL-27
has potent antitumor activities by activation of cytotoxic
T lymphocytes CD8+ T cells, Natural killer (NK) cells,
NK T cells and anti-angiogenic factors (Yoshida and
Hunter 2015).
MATERIALS AND METHODS
Subject
One hundred bladder cancer Iraqi patients’ blood
samples at different stage and grade collected from 84
male and 16 female, age range of 35–85 years old. Most
of the patients included in this study had suffered from
recurrent bladder tumor after chemotherapy treatment.
One hundred blood samples collected from healthy
volunteers. Their age range was 25 ± 75 years, 60 males
and 40 females. Forty patients with none muscle invasive
bladder cancer (NMIBC) and 60 with muscle invasive
bladder cancer (MIBC).
Estimation of Cytokine level
Enzyme linked immunosorbent assay (ELISA) was
used to estimate IL-22 and IL-27 by ELISA kit according
to the instructions provided by manufacturer (abcam,
USA).
Genetic Analysis
Whole blood (3 ml) was obtained by venepuncture
using standard EDTA collection tubes. DNA was
extracted from whole blood samples with EDTA using
AceuPrep Genomic DNA Extraction Bioneer Kit
(Republic of Korea) according to manufacturer’s
instructions. Genotypes of 1 common polymorphisms of
the IL-22 gene and 2 of the IL-27 were determined by
PCR-Sequencing. primers were designed by Primer
BLAST software to amplify the appropriate DNA
fragments. . The following primer pairs was used: rs
2227485 of IL-22 forward 5’-
GGTGTCACCCCTGAACCCAC-3’and reverse 5’-
CCTGGTCGAAGACAACGTGA-3’. The rs17855750
of IL-27 forward 5’- CCTGGTTCAAGCTGGTGTCT-
3’and reverse 5’- CTCCAGCTCAATCTCCAGCC-3.
The rs rs153109 forward 5’-
AACCCCATCCTCTCCCTGAA-3 and reverse 5’-
TGGTTGATCCCAGAGTCCCA -3. Each PCR reaction
was performed in a 25µl tube containing 3µl of DNA,
12.5µl (2X) GoTaq. Green master mix (Promega), 8.1µl
nuclease free water and 0.7µl (10µM) of each of the
reverse and forward primers. The PCR cycling conditions
starting by an initial denaturation at 95°C for 5 min,
followed by 35 cycles of denaturation for 30 sec. at 95°C,
annealing for 30 sec. at 55°C for IL-22, 58°C for IL-27
rs 17855750 and 60°C for rs 153109. Extension were for
30 sec at 72°C. A final extension was carried out for 9
min at 72°C. For right amplification check up, 5µl of PCR
products were subjected to electrophoresis in a 2 %
agarose gel stained with Et.Br. Then, 20µl of PCR
product were sent for sanger sequencing by Macrogen,
Korea. SNPs were analyzed using CodonCode aligner
software.
Statistical Analysis
Serum level of cytokines was statically analyzed using
SPSS program version 24. Their data were given as mean
± Standard error (S.E.) and differences between means
were assessed by ANOVA (Analysis of Variance)
followed by LSD (Least Significant Difference) or
Duncan test. Data of alleles and genotypes of the
cytokines were presented using simple statistical
parameter such as frequencies and significant difference
between their distribution in BC patients and healthy
subjects were assessed by two tailed Fisher’s exact
probability (p). In addition, odds ratio (OR), etiological
fraction (EF) and preventive fraction (PF) were
calculated by using the WINPEPI computer programs
for epidemiologists. The latest version of the WINPEPI
package (inducing the program and their manuals) is
available free online at http://www.brixtonhealth.com.
Mahmood Al-Mualm et al.

Genetic polymorphism of IL-22 and IL-27 genes in Iraqi patients with Urinary bladder carcinoma
Allele frequencies calculated by direct gene counting
method and H-W calculator for two alleles was used to
estimate the significant departure from Hardy-Weinberg
(H-W) equilibrium using H-W calculator for two alleles,
which is available free online at http://
www.had2know.com/academics/hardy-weinberg-
equilibrium-calculator-3alleles.html.
RESULTS AND DISCUSSION
IL- 22 and invasion
The results of IL-22 level in healthy was significantly
(144.25 ±26.3 pg/ml) lower than UBC patients. Level of
IL-22 in muscle invasive bladder cancer (MIBC) was
(250.60± 20.7 pg/ml) followed by none muscle invasive
bladder cancer (NMIBC) (233.4 ± 13.7 pg/ml) with no
significant differences between them Fig. 1.
In our study an increased in IL-22, level in UBC
patients that orchestrate pro-survival signaling, cell
migration, dysplasia and angiogenesis. While these
functions can prevent initial establishment of tumors, they
can also be used by aggressive cancers to enhance tumor
growth and metastasis (Bi et al., 2016). IL-22 are highly
expressed in various chronic inflammation conditions
(Zenewicz and Flavell 2011) and may play a role in
bladder cancer metastasis (Lim and Savan 2014). IL-22
signaling propagates downstream phosphorylation signals,
including several of the mitogen-activated protein kinase
(MAPK) pathways (extracellular signal-regulated kinase
(ERK) 1/2, MEK1/2, C-Jun N-terminal kinase (JNK) and
p38 kinase) and STAT1, STAT3 and STAT5 by utilizing
Janus kinase (JAK) 1 and tyrosine protein kinase (TYK)
2 (Pan et al., 2014). Similar to other IL-10 family
cytokines, IL-22 primarily relies on STAT3 to mediate its
functions. Binding of cytokines to this receptor results in
the activation of STAT3 signaling pathways, which in turn
leads to the induction and production of various tissue-
specific genes (Bishop et al., 2014). We demonstrated
that IL-22+CD4+ T cells promote colorectal cancer
stemness via STAT3 transcription factor activation and
induction of the methyltransferase DOT1L and that this
is relevant for outcome in patients with colon cancer
(Kryczek, et al., 2014).
IL-27 and invasion
The results of the IL-27 level exhibited a significant
increase in the invasive bladder cancer patients
(455.83±26.6 pg/ml) followed by the non-invasive BC
patients serum (448.9±29.8 pg/ml). While the healthy
control showed a significant low level (329.4 ±18.2 pg/
ml ) Fig. 2. These results disagreed with Zhou et al.,
(2015) who suggested that IL-27 decreased in NMIBC
and MIBC while the IL-27 level still hight in healthy
control.
Fig. 1: Serum IL-22 in invasive and non-invasive Urinary Bladder
Carcinoma and healthy subjects.
Fig. 2: Serum IL-27 in invasive and non-invasive Urethelial Bladder
Carcinoma and healthy subjects.
Many recent studies had been demonstrated how IL-
27 had a pro-inflammatory function in both the adaptive
and innate immune responses (Wynick, Petes and Gee
2014). IL-27 may cause tumor progress and metastasis
because of its relation to the occurrence and development
of tumors. IL-27 can also be used as a reference marker
for tumor diagnosis (He and Wang 2015).
IL-22 and UBC grade
Comparison between the IL-22 levels in high and
low grades of bladder cancer and the healthy control
demonstrated that the low grade BC had higher level of
IL-22 (266.6 ± 25 pg./ml) than the high grade (226.2 ±
21 pg./ml) with no significant differences. While the level
was (144.25 ± 15 pg./ml), lower in healthy control with
significant differences compared with low and high
grades Fig. 3. Significant increase in IL-22 level of low
and high-grade patients may revealed that how the
cytokine affect the tumor genesis.
IL-27 and UBC grade

Mahmood Al-Mualm et al.
The result of the serum IL-27 showed that high level
recorded (433.7±27 pg./ml) in low grade BC followed by
high grade (414.4±23 pg./ml) with no significant difference
between them. The level was significantly lower in
healthy subjects (329.4±18 pg./ml) Fig. 4.
Serum IL-22 and UBC stage
The results in the Fig. 5 exhibited the higher level of
IL-22 was detected in the progressed stages of the cancer
T4 (305 ± 41 pg./ml) and T3 (291 ± 6 pg./ml) with no
significant difference between them, followed by Ta stage
was (233 ±13 pg./ml) and T1 which had (271 ±32 pg./
ml). While the healthy controls still maintain a significant
low level of IL-22 (144±15 pg./ml).
So when the staging system is describing the size of
a cancer and how far it has grown into the tissue.
Therefore, the increased level of IL-22 in the progressed
stages means that the interleukin had played a role in the
progression of the bladder cancer. These result may due
to its function on increasing the expression of mobility-
and migration-regulating proteins and reducing the
expression of the differentiation-associated molecules
(Wolk, Witte, et al., 2006).
Many researches had been reported how the IL-22
enhance the tumor proliferation and effect on the
inflammation. Jiang et al., (2011) demonstrated that
Serum IL-22 level was significantly over expressed in
mice with Hepatocellular carcinoma compared with
controls suggesting that IL-22 having a promotion effect
in proliferation, cell survival, metastasis and
transformation from chronic hepatitis to Hepatocellular
carcinoma.
IL-27 and UBC stage
The results of serum IL-27 level showed a significant
highest level was recorded in T4 (525 ±93 pg/ml) stage
which is the most progressed stage followed by T3 stage
(478 ± 10 pg/ml) with a significant difference between
them. Followed by stage T1 (424 ±31 pg/ml) with no
significant difference. Then stage T2 (377 ±23 pg/ml)
showed a significant difference with stage T1 but no
significant difference with Ta (373. ±79 pg/ml) which
had the lowest level among cancer stages. The healthy
control had the significant low level (329 pg/ml) Fig. 6.
Fig. 3: Serum IL-22 level and tumor grade in Urethelial Bladder
Carcinoma patients and healthy subjects.
Fig. 4: Serum IL-27 level and tumor grade in Urethelial bladder
carcinoma and healthy subjects.
Fig. 5: Serum IL-22 level and tumor stage in Urethelial Bladder
Carcinoma and healthy subjects.
Fig. 6: Serum IL-27 and tumor stage in Urethelial Bladder Carci-
noma and healthy subjects.

Genetic polymorphism of IL-22 and IL-27 genes in Iraqi patients with Urinary bladder carcinoma
IL-27 has antitumor, antiangiogenic and antimetastatic
activities by inducing NK cells and cytotoxic T
lymphocyte (Shimizu et al., 2006). Besides these facts,
many researchers correlate the increase of the IL-27
level and the cancer. In oral squamous cell carcinoma
patients had found that the level of serum IL-27 the
patients was significantly higher than that in the control
group (Liu and Sun 2013). The expression of serum IL-
27 correlates significantly with the clinicopathologic
stages of ASCO. A significantly higher levels of IL-27 in
patients with gastroesophageal squamous cell carcinoma
had been found by Diakowska et al., (2013). Also the
serum level of IL-27 had proved to be increased in
patients with breast cancer (Lu et al., 2014).
IL-22 genotype and allele frequencies
The sequencing results showed the intronic upstream
(5’UTR) SNP (rs2227485) in IL22. Which was presented
with three genotypes (CT, TT and CC). The highest
frequency was represented in the CT genotype which
was (47%) of UBC, followed by TT genotype (40%) of
UBC and CC genotype (13%) of UBC respectively.
Results of the healthy control showed CT genotype
frequency (60%) followed by CC (40%) and none of the
healthy subject showed TT genotype. No significant
difference was observed between the expected and
observed frequencies of the three genotypes (a good
agreement with Hardy-Weinberg equilibrium) table 1.
The frequencies of CT genotype recorded a
significant highest frequency (47%) with odds ratio 0.59
but with no significant differences. While the TT genotype
and T allele were significantly increased in UBC patients
(40 and 63.5%, respectively) compared to the control
(5.0% and 35%, respectively). The (OR) for such a
positive association was 12.67 and 3.23 respectively. In
contrast CC genotype and C allele were significantly
Fig. 7: Serum IL-22 level in Urinary Bladder Carcinoma patient and
Healthy control at SNP (rs2227485) genotypes.
Table 1: Hardy-Wienberg equilibrium of IL-22 (rs2227485),
Observed numbers and percentage frequencies in the
Urinary Bladder Carcinoma and control.
Group Genotype H-W
CC CT TT CT(p ≤≤
≤≤
≤)
UBC Observed No. 13 47 40 37 127 N.S.
%13.0 47.0 40.0 36.5 63.5
Expected No. 13.3 46.3 40.3 Not
%13.3 46.3 40.3 Estimated
Healthy Observed No. 35 60 5130 70 N.S.
%35.0 60 5.0 70.0 30.0
Expected No. 42.25 45.5 12.25 Not
%42.25 45.5 12.25 Estimated
NS: Not significant (P > 0.05).
Table 2: Statistical analysis of association between IL-22 rs2227485 genotype or allele
in Urinary Bladder Cancinoma and control.
IL-22 patient control Statistical Evolution
rs2227485 Odds etiological or Fisher’s 95%
Genotype No. %No. %Ratio preventive Exact Confidence
or Allele fraction Probability Interval
CC 13 13.0 35 35.0 0.28 0.25 1.0 * 10 -4 0.14 - 0.56
CT 47 47.0 60 60.0 0.59 0.25 N.S. 0.34 - 1.03
TT 40 40.0 55.0 12.67 0.37 1.0 * 10 -4 4.76 - 34
C73 36.5 130 65.0 0.31 0.45 1.0 * 10 -4 0.21 - 0.47
T127 63.5 70 35.0 3.23 0.44 1.0 * 10 -4 2.15 - 4.86
NS: Not significant (P > 0.05).
decreased in UBC patients (13 and
36.5%, respectively) when compared to
control (35% and 65 respectively). The
preventive fraction of such negative
association were 0.28 and 0.31
respectively table 2.
These results are consistent with
those obtained by Zhao et al., (2015)
who found that the patients with bladder
cancer had a significantly higher
frequency of the IL-22 -429 TT
Table 3: Hardy-Wienberg equilibrium of IL-27 (rs17855750),
Observed numbers and percentage frequencies in the
Urethelial Bladder Carcinoma and control.
Group Genotype H-W
TT TG GG (p ≤≤
≤≤
≤)
UBC Observed No. 74 20 6N.S.
%74.0 20.0 6.0
Expected No. 70.5 26.8 2.5
%70.5 26.8 2.5
Healthy Observed No. 90 10 ND N.S.
%90 10 0.0
Expected No. 90.2 9.5 0.25
%90.2 9.5 0.25
NS: Not significant (P > 0.05).
ND: Not detected

Mahmood Al-Mualm et al.
genotype than the healthy control subjects.
IL-22 level and SNP (rs2227485)
The results in Fig. 7 represented that the level of IL-
22 in BC patients were significantly higher in TT genotype
(302.6±24.6 pg/ml) and that’s genotype, which previously
had shown a high Odds ratio. Then followed by the CT
genotype (174.9.9±18.8 pg/ml) and CC genotype
(127.3±11.9) with no significant difference between
them. While the healthy control showed a lower level of
IL-22 in two genotypes CT (121±6.3 pg/ml) and CC (145.
±6.1 pg/ml) with no significant difference between them.
Also, TT genotype (141± 4.9 pg/ml).
Interleukine-27 gene rs17855750
The rs17855750 SNP located in
28503907bp site on the chromosome and
is responsible for changing amino acid
serine codon (TCC) to another Alanine
codon (GCC). This SNP has three
genotypes (TG, TT and GG). The TT
genotype was with frequency (74%) of
UBC followed by the TG genotype with
frequency (20%) and the GG genotype
recorded the lowest frequency (6%). The
TT genotype was recorded in 90 (90%)
Table 4: Statistical analysis of association between IL-27 rs17855750 genotype or allele
in Urinary Bladder Cancinoma and control.
IL-27 patient control Statistical Evolution
rs17855750 Odds etiological or Fisher’s 95%
Genotype No. %No. %Ratio preventive Exact Confidence
or Allele fraction Probability Interval
TT 74 74.0 90 90 0.32 0.62 0.005 0.14 - 0.70
TG 20 20.0 10 10.0 2.25 0.15 0.073 1.00 - 5.07
GG 66.0 ND 0.0 13.83 0.06 0.029 0.9 -10.8%
T168 84.0 190 100 0.28 0.69 0.000 0.13 - 0.58
G32 16.0 10 0.0 3.62 0.12 0.000 5.3 -17.4%
Fig. 8: Serum IL-27 level in Urethelial Bladder Carcinoma patients
and Healthy subjects and genotype at SNP (rs17855750).
sample (10%) while none of the healthy
showed GG genotype. The genotype
frequencies were in a good agreement
with HWE table 3.
Genotype distribution and allele
frequencies of rs17855750 SNP were
shown in tables 3-6. The GG genotype
were shown in frequency 6% in patient
and 0% in control and the OR for this
positive association was 13.83, with a
EF=0.06. While in the term of allele
Fig. 9: Serum IL-27 level in Urethelial Bladder Carcinoma patients
and healthy subjects and genotype at SNP (rs153109).
Table 5: Hardy-Wienberg equilibrium of IL-27 (rs153109), Observed
numbers and percentage frequencies in the Urethelial
Bladder Carcinoma and control.
Group Genotype H-W
AA AG GG (p ≤≤
≤≤
≤)
UBC observed No. 40 40 20 N.S.
%40.0 40.0 20.0
expected No. 36.0 48.0 16.0
%36.0 48.0 16.0
Healthy observed No. 80 20 0N.S.
%80 20 0.0
expected No. 81.0 18.0 1.0
%81.0 18.0 1.0
NS: Not significant (P > 0.05).
Table 6: Statistical analysis of association between IL-27 rs rs153109 genotype or allele
in Urinary Bladder Cancinoma and control.
IL-27 patient control Statistical Evolution
rs153109 Odds etiological or Fisher’s 95%
Genotype No. %No. %Ratio preventive Exact Confidence
or Allele fraction Probability Interval
AA 40 40 80 80 0.17 0.67 00.09 - 0.31
AG 40 40 20 20 2.67 0.25 0.003 1.42 – 5.00
GG 20 20 0 0 51.19 0.2 03.09 – 847
A120 60 180 90 0.17 0.75 00.10- 0.29
G80 40 20 10 60.33 03.50 - 10.30
NS: Not significant (P > 0.05).
healthy subjects and TG genotype were found only in 10

frequency the G allele showed frequency in patients
(16.6%) than in control (0.0%) and the OR for such
positive association was (3.62) and the etiological fraction
was (EF = 0.12). while the T allele frequency showed a
significant decrease in patients (74%) than in control
(90%) and the preventive fraction (PF) for such a negative
association was 0.62 and it may play a protective role.
IL-27 level and genotyping (rs 17855750)
The results showed no significant differences in serum
IL-27 concentration between the three genotyping of
(rs17855750). The higher level reported with the TT
genotype was (439 ±46.4 pg/ml) followed by the TG (416
±45.6 pg/ml) and the lowest level was in the GG genotype
(347 ± 1.4 pg/ml) Fig. 8. These results are agreed with
Zhou et al., (2015) who found that the plasma IL-27 levels
in patients with the homozygous TT genotype were higher
than that of heterozygous TG genotype but with no
significant difference between them. While the healthy
controls showed the TT genotype with level was (329
±18 pg/ml) and the TG genotype lower level (307 ± 22).
Interleukine-27 rs 153109
The intronic SNP (rs 153109) in IL-27 gene has three
genotypes (AG, GG and AA). The AA was with
frequency (40%) followed by the GG genotype which
was with frequency (20%). While the AA genotype was
recorded with frequency (80%), followed by the AG
genotype with frequency (20%) and none of the control
showed GG genotype. Genotype frequencies of UBC
patients and control were in a good agreement with
Hardy-Wienberg equilibrium table 5.
The GG genotype frequency was increased in
patients (20%) than in control (0%) and the OR for such
a positive association was 51.19 table 6. The G allele
frequency was also increased in patients than in control
with a significant difference and the odd ratio for such a
positive association were 6. In contrast, decreased
frequencies were observed with AA genotype and A.
allele in patients than in control .The Relative Risk for
such a negative association were (0.17) for both.
Interleukine 27 level and (rs 153109) SNP
The results in the Fig. 9 showed that serum IL-27
AG genotype had a significant higher level of IL-27
(466±47.2 pg/ml) followed by the AA genotype (404±74
pg/ml) and GG with the lowest level (403±42.9 pg/ml).
While the healthy control showed the AA genotype with
high level of IL-27 (339±19 pg/ml) followed by the AG
genotype (280±1.9 pg/ml) and none of the healthy control
showed GG genotype.
REFERENCES
Bishop, J L et al. (2014) “Lyn Activity Protects Mice from DSS
Colitis and Regulates the Production of IL-22 from Innate
Lymphoid Cells.” Mucosal Immunol. 7(2), 405–16.
Diakowska, Dorota, Andrzej Lewandowski, Krystyna Markocka-
M¹czka and Krzysztof Grabowski (2015) Concentration of
Serum Interleukin-27 Increase in Patients with Lymph Node
Metastatic Gastroesophageal Cancer. Advances in Clinical and
Experimental Medicine 22(5), 683–91. .
He Jia and Qing-qing Wang (2015) Progress on Interleukin-27 in Tumor
Immunity. Zhejiang Da Xue Xue Bao. Yi Xue Ban = Journal of
Zhejiang University. Medical Sciences 44(2), 223–28.
Horikawa Yohei, Jian Gu and Xifeng Wu (2008) Genetic Susceptibility
to Bladder Cancer with an Emphasis on Gene–gene and Gene–
environmental Interactions. Current Opinion in Urology 18(5),
493–98.
Iwasaki Yukiko, Keishi Fujio, Tomohisa Okamura and Kazuhiko
Yamamoto (2015) Interleukin-27 in T Cell Immunity. Inte. J.
Molecular Sci. 16(2), 2851–63.
Kim, Karam Garam Kim, Jin-Young Kim, Hyo Jeong Yun, Sung-Chul
Lim and Hong Seok Choi (2014) Interleukin-22 Promotes
Epithelial Cell Transformation and Breast Tumorigenesis via
MAP3K8 Activation. Carcinogenesis 35(6), 1352–61.
Lim Chrissie and Ram Savan (2014) The Role of the IL-22/IL-22R1
Axis in Cancer. Cytokine and Growth Factor Reviews 25(3),
257–71.
Lin Wan-Wan and Michael Karin (2007) A Cytokine-Mediated Link
between Innate Immunity, Inflammation, and Cancer.” The
Journal of Clinical Investigation 117(5), 1175–83.
Liu Qi and Zu-jun Sun (2013) Expression and Clinical Significance of
Serum Interleukin-27 Level in Patients with Oral Squamous Cell
Carcinoma. Shanghai Kou Qiang Yi Xue = Shanghai Journal of
Stomatology 22(2), 181–83.
Lu Dapeng, Xiangyu Zhou, Lutian Yao, Caigang Liu, Feng Jin, Yunfei
Wu (2014) Clinical Implications of the Interleukin 27 Serum
Level in Breast Cancer. J. Investigative Medicine 62(3), 627–31.
Shimizu Motomu, Mariko Shimamura, Toshiyuki Owaki, Masayuki
Asakawa, Koji Fujita, Motoshige Kudo, Yoichiro Iwakura,
Yasutaka Takeda, Andrew D. Luster, Junichiro Mizuguchi and
Takayuki Yoshimoto (2006) Antiangiogenic and Antitumor
Activities of IL-27. The J. Immunol. 176(12), 7317-7324.
Siegel Rebecca L, Kimberly D Miller and Ahmedin Jemal (2016) Cancer
Statistics, 2016. CA: A Cancer J. Clinicians 66(1), 7–30.
Sonnenberg Gregory F, Lynette A Fouser and David Artis (2011)
Border Patrol: Regulation of Immunity, Inflammation and Tissue
Homeostasis at Barrier Surfaces by IL-22. Nature Immunology
12(5), 383–90.
Volanis Dimitrios, Tanya Kadiyska, AlexGalanis, Dimitrios Delakas,
Stella Logothetic andVassilisZoumpourlis (2010) Environmental
Factors and Genetic Susceptibility Promote Urinary Bladder
Cancer. Toxicology Letters 193(2), 131–37.
Wolk Kerstin, Ellen Witte, Elizabeth Wallace , Wolf-Dietrich Döcke,
Stefanie Kunz, Khusru Asadullah, Hans-Dieter Volk, Wolfram
Sterry and Robert Saba (2006) IL-22 Regulates the Expression
of Genes Responsible for Antimicrobial Defense, Cellular
Differentiation, and Mobility in Keratinocytes: A Potential Role
in Psoriasis. European J. Immunol. 36(5), 1309–23.
Genetic polymorphism of IL-22 and IL-27 genes in Iraqi patients with Urinary bladder carcinoma

Wolk Kerstin and Robert Sabat (2006) Interleukin-22: A Novel T- and
NK-Cell Derived Cytokine That Regulates the Biology of Tissue
Cells. Cytokine & Growth Factor Reviews 17(5), 367–80.
Wynick Christopher, Carlene Petes and Katrina Gee (2014)
Interleukin-27 Mediates Inflammation During Chronic Disease.
J. Interferon & Cytokine Res. 34(10), 741–49.
Yoshida Hiroki and Christopher A Hunter (2015) The Immunobiology
of Interleukin-27. Ann. Rev. Immunol. 33(1), 417–443.
Zenewicz L A and R A Flavell (2011) Recent Advances in IL-22
Biology. Int. Immunol. 23(3), 159–63.
Zhang Ye, Melissa A Cobleigh, Jian–QiLian, Chang–XingHuang,
Carmen J Booth, Xue–Fan Bai and Michael D.Robek (2011) A
proinflammatory role for interleukin-22 in the immune response
to hepatitis B virus. Gastroenterology 141(5), 1897–1906.
Zhou Bin, Peng Zhang, Tielong Tang, Hong Liao, Kui Zhang, Yan Pu,
Peng Chen, Yaping Song and Lin Zhang (2015) Polymorphisms
and Plasma Levels of IL-27: Impact on Genetic Susceptibility
and Clinical Outcome of Bladder Cancer. BMC Cancer 15, 433.
Bishop J L, Roberts M E, Beer J L, Huang M, Chehal M K, Fan X,
Fouser L A, Ma H L, Bacani J T and Harder K W(2014) Lyn
Activity Protects Mice from DSS Colitis and Regulates the
Production of IL-22 from Innate Lymphoid Cells. Mucosal
Immunology 7(2), 405–16.
Diakowska Dorota, Andrzej Lewandowski, Krystyna Markocka-
M¹czka and Krzysztof Grabowski (2013) Concentration of
Serum Interleukin-27 Increase in Patients with Lymph Node
Metastatic Gastroesophageal Cancer. Adv. Clin. Exp. Med. 22(5),
683–691.
Mahmood Al-Mualm et al.
He Jia and Qing-qing Wang (2015) Progress on Interleukin-27 in Tumor
Immunity].” Zhejiang Da Xue Xue Bao. Yi Xue Ban = Journal of
Zhejiang University. Medical Sciences 44(2), 223–28.
Horikawa Yohei, Jian Gu and Xifeng Wu (2008) Genetic Susceptibility
to Bladder Cancer with an Emphasis on Gene–gene and Gene–
environmental Interactions. Curr. Opi. Urol. 18(5), 493–498.
Iwasaki Yukiko, Keishi Fujio, Tomohisa Okamura and Kazuhiko
Yamamoto (2015) Interleukin-27 in T Cell Immunity.” Int. J.
Mol. Sci.16(2), 2851–63.
Lim Chrissie and Ram Savan (2014) The Role of the IL-22/IL-22R1
Axis in Cancer.”Cytokine and Growth Factor Reviews 25(3),
257–271.
Lin Wan-Wan and Michael Karin (2007) A Cytokine-Mediated Link
between Innate Immunity, Inflammation, and Cancer. The J.
Clin. Investig. 117(5), 1175–1183.
Liu Qi and Zu-jun Sun (2013) Expression and Clinical Significance of
Serum Interleukin-27 Level in Patients with Oral Squamous Cell
Carcinoma. Shanghai Kou Qiang Yi Xue = Shanghai Journal of
Stomatology 22(2), 181–183.
Siegel Rebecca L, Kimberly D Miller and Ahmedin Jemal (2016) Cancer
Statistics, 2016. CA: A Cancer J. Clin. 66(1), 7–30.
Sonnenberg Gregory F, Lynette A Fouser and David Artis (2011)
Border Patrol: Regulation of Immunity, Inflammation and Tissue
Homeostasis at Barrier Surfaces by IL-22. Nature Immunol.
12(5), 383–390.