Access to this full-text is provided by Springer Nature.
Content available from Canine Medicine and Genetics
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H Open Access
Short and sweet: foreleg abnormalities in
Havanese and the role of the FGF4
retrogene
Kim K. L. Bellamy
1,2*
and Frode Lingaas
1,2
Abstract
Background: Cases of foreleg deformities, characterized by varying degrees of shortened and bowed forelegs, have
been reported in the Havanese breed. Because the health and welfare implications are severe in some of the
affected dogs, further efforts should be made to investigate the genetic background of the trait.
A FGF4-retrogene on CFA18 is known to cause chondrodystrophy in dogs. In most breeds, either the wild type
allele or the mutant allele is fixed. However, the large degree of genetic diversity reported in Havanese, could entail
that both the wild type and the mutant allele segregate in this breed. We hypothesize that the shortened and
bowed forelegs seen in some Havanese could be a consequence of FGF4RG-associated chondrodystrophy.
Here we study the population prevalence of the wild type and mutant allele, as well as effect on phenotype. We
also investigate how the prevalence of the allele associated with chondrodystrophy have changed over time. We
hypothesize that recent selection, may have led to a gradual decline in the population frequency of the lower-risk,
wild type allele.
Results: We studied the FGF4-retrogene on CFA18 in 355 Havanese and found variation in the presence/absence
of the retrogene. The prevalence of the non-chondrodystrophic wild type is low, with allele frequencies of 0.025
and 0.975 for the wild type and mutant allele, respectively (linked marker).
We found that carriers of the beneficial wild type allele were significantly taller at the shoulder than mutant allele
homozygotes, with average heights of 31.3 cm and 26.4 cm, respectively.
We further found that wild type carriers were born on average 4.7 years earlier than mutant allele homozygotes and
that there has been a gradual decline in the population frequency of the wild type allele during the past two
decades.
Conclusions: Our results indicate that FGF4RG-associated chondrodystrophy may contribute to the shortened
forelegs found in some Havanese and that both the wild type and mutant allele segregate in the breed. The
population frequency of the wild type allele is low and appear to be decreasing. Efforts should be made to
preserve the healthier wild type in the population, increase the prevalence of a more moderate phenotype and
possibly reduce the risk of foreleg pathology.
Keywords: FGF4, Chondrodystrophy, Chondrodysplasia, Havanese, Short ulna, Genetic diversity, Exaggerations in
conformation
© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if
changes were made. The images or other third party material in this article are included in the article's Creative Commons
licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons
licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain
permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the
data made available in this article, unless otherwise stated in a credit line to the data.
* Correspondence: kimbella@nmbu.no
1
Department of Preclinical Sciences and Pathology, Faculty of Veterinary
Medicine, Norwegian University of Life Sciences, P.O. Box 369 sentrum,
N-0102 Oslo, Norway
2
The Norwegian Kennel Club, P.O. Box 52 Holmlia, 1201 Oslo, Norway
Canine Medicine an
d
Ge
n
et
i
cs
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19
https://doi.org/10.1186/s40575-020-00097-5
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Plain English summary
Previous research and statements from owners, breeders
and breed clubs, show that some Havanese have short
and bowed forelegs. Most of these dogs show no signs of
pain or discomfort, but a few of them do.
Some dog breeds are so-called chondrodystrophic,
meaning that their legs are “too short”compared to the
size of their body. Examples of chondrodystrophic
breeds are dachshunds, bassets and corgis. The gene that
causes chondrodystrophy is known and can be tested for
(FGF4-retrogene on chromosome 18).
There is a lot of variation in the Havanese breed as
regards color, size, head shape etc. We hypothesize that
because there is so much variation in Havanese, it is
possible that some of them are chondrodystrophic and
some are not.
Could it be that Havanese with short and bowed fore-
legs do not have a “breed specific syndrome”as we have
thought, but are simply chondrodystrophic?
We DNA-tested 355 Havanese to check this and to in-
vestigate whether things have changed over time. Is it pos-
sible that selection for certain conformational traits have
unintentionally turned a primarily non-chondrodystrophic
breed, chondrodystrophic, and subsequently made them
more prone to foreleg bowing?
We found that some of the Havanese we DNA-
tested are chondrodystrophic and some are not. In
our sample, only about 5% of the dogs carry the non-
chondrodystrophic gene variant.
We also found that carriers of the non-
chondrodystrophic gene variant are taller at the
shoulder than other Havanese, with average heights
of 31.3 cm and 26.4 cm, respectively.
Carriers of the non-chondrodystrophic gene variant
are born on average 4.7 years earlier than the other dogs
in our sample. More Havanese are chondrodystrophic
now, compared to two decades ago.
We recommend that Havanese are DNA-tested, to
identify carriers of the non-chondrodystrophic gene vari-
ant. By breeding these dogs, we can prevent the variant
being lost from the breed forever.
Carefully monitored outcrossings to non-chondrodystrophic
individuals in closely related breeds may also be
considered.
If we gradually increase the number of Havanese that
are not chondrodystrophic, the breeds’overall risk of
foreleg problems will reduce, which would benefit the
health and welfare of the breed.
Background
Previous research has shown that foreleg deformities
occur frequently in the Havanese breed [1]. In Norway,
bowed forelegs is a common remark in dog show cri-
tiques and sporadic cases of short ulna syndrome have
been reported [2]. In a survey conducted in the United
States, 44% of Havanese owners replied that their dog
had bowed, shortened or asymmetric forelegs [1].
Starr et al. [1] propose the idea of a breed specific syn-
drome in Havanese, including symptoms like bowed
forelegs, cataracts, liver abnormalities and heart disease.
Moderate heritability estimates were found and a few
candidate genes were suggested [1].
Bowed forelegs in dogs is often a result of some form
of leg shortening. When the growth of the long bones is
stunted, it is often asynchronous as well. Disparity in
length between the radius and ulna cause the shorter
bone to act as a bowstring, which lead to the subsequent
bowing of the longer bone. Stunted growth of the long
bones, may be caused either by trauma to the growth
plate before the dog is fully grown, or by genetic predis-
position [3].
Several forms of hereditary disproportional dwarfism
have been described in dogs [4–10]. A recessive mode of
inheritance is reported in many breeds [4–10] and asso-
ciated genes or possible causative mutations are known
in some of them. A nonsense-mutation in the ITGA10-
gene cause chondrodysplasia in Norwegian elkhounds
and Karelian bear dogs [4]. In Labrador retrievers, a mild
form of chondrodysplasia is associated with a mutation
in the COL11A2-gene [6]. A deletion in the SLC13A1-
gene has been associated with chondrodysplasia in mini-
ature poodles [5].
In addition to breed specific forms of chondrodyspla-
sia, disproportionally short legs also occurs as a desired
and fixed trait in several dog breeds. Chondrodystrophy
is caused by an expressed fibroblast growth factor 4
(FGF4) retrogene on chromosome 18, across dog breeds
[11]. The FGF4-retrogene is responsible for the typical
“short-legged”appearance of chondrodystrophic breeds
like dachshunds, bassets and corgis.
Unlike chondrodysplasia, chondrodystrophy is often
considered an accepted phenotypic variation, rather than
a pathological condition. The trait is, however, still associ-
ated with increased risk of some health issues. Chondro-
dystrophic dogs are more likely to have bowed forelegs,
and 3.5 times more likely to be affected with elbow dis-
ease, than non-chondrodystrophic dogs [12]. Angular limb
deformity and elbow incongruity may cause abnormal
strain on the joints and secondary degenerative joint dis-
ease [3]. In the chondrodystrophic dog breed Skye terrier,
clear association was found between lameness and the de-
gree of elbow incongruity [13].
Additionally, chondrodystrophic dog breeds are at
increased risk of developing intervertebral disc disease
[14], although recent research has shown that a
FGF4-retrogene on CFA12 is of greater importance in
intervertebral disc disease in dogs than the one on
CFA18 [15,16].
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19 Page 2 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
In the research that led to the discovery of the FGF4-
retrogene on CFA18, four breeds (jack russel terrier,
west highland white terrier, Havanese and Sussex span-
iel) were excluded from the initial association analyses
because leg length in these breeds was uncertain or vari-
able. Later, sequencing of the insert revealed that out of
seven Havanese included in the original study, six were
homozygote for chondrodystrophy and one was hetero-
zygote. The authors air the idea that the previously re-
ported “Havanese syndrome”may disguise the absence
of the retrogene and that this could be the reason that
the trait is not fixed [11].
The Havanese breed was created from various small
dogs and anecdotally there was significant conform-
ational variation in the founder dogs that is still evident
[17]. Several reports also show a relatively high degree of
heterozygosity in the breed [18,19]. It is plausible, that
contrary to the situation in most other breeds, both al-
leles of the FGF4-retrogene segregate in this breed. We
hypothesize that the short and bowed forelegs seen in
some Havanese could potentially be a result of chondro-
dystrophy, rather than a breed specific syndrome as pre-
viously suggested.
The prevalence of bowed and shortened forelegs in the
Havanese breed is high [1,2]. Although most cases show
little signs of discomfort or pain, the negative effect on
health and welfare is severe in some cases. If the short-
ened and bowed forelegs seen in Havanese are directly
associated with chondrodystrophy, increasing the popu-
lation frequency of the non-chondrodystrophic allele,
could reduce the breeds overall risk of foreleg pathology.
The aim of this study was to investigate the presence/
absence of the chondrodystrophic genotype in the Nor-
wegian population of Havanese dogs, as well as its effect
on phenotype. We also studied how the population fre-
quency of the wild type and mutant allele has changed
over time.
Results
Prevalence
We genotyped an A/G SNP on chromosome 18
(CFA18), base position 23,432,408 (CanFam2), that has
previously been reported as part of a “chondrodystro-
phy-haplotype”[11], for a random sample of 355 Hava-
nese. We found that although most individuals were
homozygote for the allele associated with chondrody-
strophy (A), 5% of the population carried one copy of
the wild type allele (G). The allele frequencies were
0.975 and 0.025 for the chondrodystrophy-associated al-
lele and the wild type allele, respectively. No dogs were
homozygote wild type.
To verify the linkage disequilibrium between the
marker and the insert, 22 A/A-dogs and 22 A/G-dogs
were assayed for the FGF4 insertion on CFA18. The LD
between the SNP and the causative insert was complete
in our sample (n= 44).
Association
We found significant association between genotype and
shoulder height in Havanese (n= 103). Havanese with
one copy of the beneficial allele (A/G) were on average
4.9 cm taller than risk allele homozygotes (A/A) (p<
0.0001), with an average heights of 31.3 cm and 26.4 cm,
respectively (Fig. 1).
Change in allele frequency over time
To investigate potential changes over time, we geno-
typed a random sample of 285 Havanese with available
information on birth year. Havanese that carried the
wild type allele were born on average 4.7 years earlier
than A/A-homozygotes (p-value < 0.0001). Analysis of
allele frequencies in different birth year groups, show
that there has been a gradual decline in the allele fre-
quency of the wild type allele during the past two de-
cades (Fig. 2).
Discussion
We show that both the wild type and mutant allele of
the FGF4-retrogene segregate in the Norwegian popula-
tion of Havanese dogs and that it is associated with
shoulder height. Our results support that the short and
bowed forelegs seen in some Havanese could potentially
be a result of chondrodystrophy, rather than a breed
specific syndrome as previously suggested.
It should be noted, that the prevalence of the risk al-
lele is high, but the number of severely affected individ-
uals (e.g. those requiring surgery) is low, which means
that modifying genes probably affect the degree of fore-
leg bowing and elbow incongruity in the chondrody-
strophic dogs. Our result does not uncover other
associated genes, but highlight the increasing population
frequency of an unnecessary, underlying risk factor.
For most dogs in the study, we genotyped a very
closely linked variant rather than the causative insert it-
self. The studied SNP is, however, located only 1272
base pairs away from the insert site (~ 0.001 cM), which
means the likelihood of a recombination is very low. We
have verified a complete LD between the variant and the
retrogene in a selection of 44 Havanese with genotypes
A/G (n= 22) and A/A (n= 22). The strong association
between the marker and phenotype also point towards
true variation in the presence/absence of the retrogene.
Shoulder height was selected as a phenotypic marker
for foreleg shortening, because it could be easily and re-
liably measured by the owner. A more standardized
measure, e.g. using radiographs to evaluate the degree of
foreleg bowing or having one person measure all the
dogs, could have improved precision of the
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19 Page 3 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
measurements, but would significantly reduce the
number of dogs we were able to include in the study.
We believe the degree of error in owner measure-
ments is similar in the two genotype-groups and
should therefore not affect the result of our associ-
ation analysis.
The primary aim of the study was to investigate the
frequency of the FGF4 retrogene and discuss potential
effects on the population risk of foreleg pathology. A
thorough clinical evaluation of the dogs, which would be
necessary to accurately classify the degree of foreleg
bowing and give a conclusive description of prevalence,
was beyond the scope of this study. All owner-reported
cases of severe foreleg bowing have been from dogs that
are risk allele homozygotes.
We did not identify any wild type homozygotes. This
is not surprising, given the low population frequency of
the wild type allele. The absence of G/G-individuals pre-
vent us from investigating possible phenotypic differ-
ences between G/G-dogs and heterozygotes.
Traditionally, chondrodystrophy has been considered a
dominant trait in dog, but the significant height differ-
ence we found between A/G- and A/A-individuals show
that at least in this breed, the dominance is incomplete.
Some forms of chondrodysplasia in human, also show
incomplete dominance [20].
Fig. 1 Average and median shoulder height in genotype groups AG and AA
Fig. 2 Allele frequencies for the wild type (G) - and mutant (A) allele, by birth year
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19 Page 4 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
The Fédération Cynologique Internationale (FCI)
breed standard for Havanese [21], states that the height
at the withers should be between 23 cm and 27 cm (tol-
erance 21 cm to 29 cm), which means the average height
of the A/A-dogs is correct. Increasing the number of A/
A- x A/G-matings, would reduce the prevalence of dogs
with disproportionally short legs, with a risk that some
offspring might be too tall according to standard. We
believe that preserving the wild type allele before it is
lost should be of high priority. We therefore suggest
allowing a limited increase in height for the first genera-
tions that may be corrected in succeeding generations
through traditional selection.
A slight increase in the height acceptance in the breed
standard could also be considered. This would allow a
faster change in allele frequency and still leave room to
focus on other traits, because the need to select for
height would decrease. Increasing the height acceptance
to 30 cm, which equals the median height of the A/G-
dogs, would be enough to ensure most A/G-dogs are
still within standard. This is also in accordance with
what some consider to be the original, Cuban standard
[17].
Lastly, it should be noted that the standard lists a
“French front”(pasterns to close and feet turned out-
wards) as an important fault [21].
We show a decline in the population frequency of the
wild type allele during the past two decades, with A/G-
dogs being on average 4.7 older than A/A-dogs. This
finding is supported by statements from breeders, who
indicate that there has been a “trend”of selection for
longer backs and shorter legs in recent years. It is pos-
sible that a selection for certain conformational traits
have unintentionally turned a primarily non-
chondrodystrophic breed, chondrodystrophic.
Chondrodystrophy is associated with increased risk of
angular limb deformity and elbow disease [12]. If the
shortened and bowed forelegs seen in Havanese are dir-
ectly associated with chondrodystrophy, increasing the
prevalence of the non-chondrodystrophic wild type in
the population could reduce the number of dogs with in-
creased risk of foreleg pathology, subsequently reducing
the number of clinically affected individuals. This would
benefit the health and welfare of the breed.
Marker-assisted selection should be implemented to
gradually increase the population frequency of the bene-
ficial allele and ensure that the non-chondrodystrophic
type is not lost. We believe any increase in the frequency
of the wild type allele has the potential to reduce risk of
foreleg pathology and that ideally, the wild type should
eventually become be the predominant variant. However,
it is challenging to obtain a fast change in allele fre-
quency without negatively influencing genetic variation
and/or other traits. The initial goal should therefore be
to recover a sustainable population of non-
chondrodystrophic individuals and avoid that the risk al-
lele becomes fixed.
DNA-testing as many Havanese as possible for the
FGF4-retrogene on CFA18, would be valuable to identify
the rare, wild type carriers for breeding purposes. Litters
from wild type carriers should be tested prior to adop-
tion, to ensure continuation of the breeding program.
To avoid loss of genetic variation through selection for
the low frequency wild type, it may also be worth con-
sidering a limited outcross to wild type carriers in closely
related breeds like the bichon frisé. If done right, such
an outcross could increase the prevalence of the wild
type allele and speed up the reversal process, without
much negative effect on other traits because the breeds
are so similar.
Parallel to breeding for a gradual increase in the popu-
lation frequency of the non-chondrodystrophic geno-
type, efforts should be made to reduce the degree of
foreleg deformities and elbow incongruity among the
chondrodystrophic Havanese. Selection response in
other chondrodystrophic breeds have shown that it is
possible to reduce the degree of foreleg bowing by selec-
tion based simply on visual inspection. A suggested
protocol for classification of elbow incongruity in chon-
drodystrophic breeds [13], could potentially be used to
screen chondrodystrophic Havanese prior to breeding.
Conclusions
Our findings show that leg length in Havanese is
strongly associated with FGF4-retrogene variants, in an
incomplete dominant manner. The allele frequency of
the wild type allele is low and appear to be decreasing.
Efforts should be made to preserve the healthier wild
type allele in the population, increase the prevalence of a
more moderate phenotype and reduce the risk of foreleg
pathology.
Methods
Dogs
Two batches of samples, all collected with owners’con-
sent, were included in the study. The first batch of sam-
ples was recruited specifically for this project, for the
association analysis. Owners were asked to measure the
shoulder height of their dog and send in a cheek swab
for DNA-studies (n= 120). The samples were collected
using Performagene™buccal swabs (DNA Genotek Inc),
administered by the owner. DNA was extracted follow-
ing the manufacturer’s recommendations. The second
batch of samples was originally recruited for a research
project on behaviour [22] and was readily available
through our DNA biobank (n= 235). The second batch
of dogs was only included in the allele frequency calcula-
tion and birth year analyses. The only inclusion criteria
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19 Page 5 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
in both batches were age > 1 year old and that the owner
was willing to participate. DNA was stored at −20 de-
grees Celsius.
Genotyping
An A/G SNP at base position CFA18:23432408 (Can-
Fam2), that has previously been reported as part of a
“chondrodystrophy-haplotype”, was genotyped for 355
Havanese. The SNP is positioned 1272 base pairs down-
stream of the insert [11]. Primers used were forward:
‘TTACCCACAAGGAAGATACAGC’[11] and reverse:
‘TGCAGTGACCCCATCAGTTC’. Primer3plus was
used to create the reverse primer. Sequencing of the
PCR products were performed following a standard
Sanger method on an ABI 3500 XL DNA analyzer (Ap-
plied Biosystems, Life Technologies of Thermo Fisher
Scientific), followed by manual inspection using the
Sequencher software from Gene Codes Corporations.
Linkage disequilibrium between the SNP and the
causative insert was checked and verified in a material of
44 dogs. We amplified the insert site on CFA18 in Hava-
nese with genotypes A/A (n= 22) and A/G (n = 22) (G/
G not available), using allele-specific PCR. Primers used
were: forward: F_flank: ‘TTGGGAATGTCAAACCAC
TG’, F_insert ‘GTCCGTGCGGTGAAATAAAA’and re-
verse: R_flank: ‘GTTCCCTCCATTTCGGTTT’[23].
When no insert was present, the primers F_flank/R_
flank gave a PCR-product~ 388 bp. When an insert was
present, the primers F_insert/R_flank gave a PCR-
product~ 168 bp. Following the PCR reaction, results
were visualized by gel electrophoresis and manual
inspection.
The allele frequencies were calculated using the for-
mula: p=f(AA) + 0.5 f(AG), q = f(GG) + 0.5 f(AG).
Association analyses and statistics
Shoulder height measured by the owner, was selected as
a phenotypic marker for the degree of foreleg shorten-
ing. Shoulder height was defined as the distance from
the ground to the “withers”, i.e. the ridge between the
shoulder blades at the tallest part of the dogs back, near
the base of the neck.
For the association analyses on shoulder height and
birth year, the mean and standard deviation for each
genotype was calculated in Excel (AVERAGE, STDEV.S).
The pooled standard deviation and standard error, as
well as the significance level using the t-test, were calcu-
lated using MedCalc [24].
Acknowledgements
We would like to thank the dog owners who generously provided DNA-
samples and information about their dogs.
Authors’contributions
KB designed the study, organized the collection of samples, obtained
information on phenotype from owners, did the labwork, analyzed the
results and wrote the manuscript. FL gave guidance and input throughout
the project and substantially revised the manuscript. Both authors have read
and approved the final manuscript.
Funding
The project was financed by funds provided by The Research Council of
Norway and the Norwegian Kennel Club. The Havanese Club of Norway
funded some of the cost of cheek swabs.
Availability of data and materials
The dataset analyzed during the current study is not publicly available due
to difficulty in fully anonymizing the individual dogs, but is available from
the corresponding author on reasonable request.
Ethics approval and consent to participate
All dog owners have given their consent to the use of their dogs DNA-
sample in research. DNA-samples were either newly collected using cheek
swabs administered by the owner or from earlier studies (available as DNA
from our biobank).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Received: 18 September 2020 Accepted: 19 November 2020
References
1. Starr AN, Famula TR, Markward NJ, Baldwin JV, Fowler KD, Klumb DE, et al.
Hereditary evaluation of multiple developmental abnormalities in the
Havanese dog breed. J Hered. 2007;98(5):510–7.
2. The Norwegian Havanese Club TNKC. Breed specific breeding strategy -
Havanese (Rasespesifikk avlsstrategi for bichon havanais). 2015.
3. Theresa Welch Fossum CSH, Johnson AL, Schulz KS, Seim HB, Willard MD,
Bahr A, Carroll GL. Small animal surgery. 3rd ed. Missouri: Mosby Elsevier;
2007.
4. Kyöstilä KL, Anu K.; Lohi, Hannes. Canine Chondrodysplasia Caused by a
Truncating Mutation in Collagen-Binding Integrin Alpha Subunit 10. PloS
one. 2013;8(9):e75621.
5. Neff MW, Beck JS, Koeman JM, Boguslawski E, Kefene L, Borgman A, et al.
Partial deletion of the sulfate transporter SLC13A1 is associated with an
osteochondrodysplasia in the Miniature Poodle breed. PloS one. 2012;7(12):
e51917.
6. Frischknecht M, Niehof-Oellers H, Jagannathan V, Owczarek-Lipska M,
Drögemüller C, Dietschi E, et al. A COL11A2 mutation in Labrador retrievers
with mild disproportionate dwarfism. PloS one. 2013;8(3):e60149.
7. Hanssen I, Falck G, Grammeltvedt AT, Haug E, Isaksen CV.
Hypochondroplastic dwarfism in the Irish setter. J Small Anim Pract. 1998;
39(1):10–14.
8. Breur GZ, CA; Slocombe, RF; Padgett, GA; Braden, TD. Clinical, radiographic,
pathologic, and genetic features of osteochondrodysplasia in Scottish
deerhounds. J Am Veterinary Med Assoc. 1989;195(5):606–12.
9. Meyers VJ, PF; Aguirre, GD; Patterson, DF. Short-limbed dwarfism and ocular
defects in the Samoyed dog. J Am Veterinary Med Assoc. 1983;183(9):975–9.
10. Sande RDA, J E; Spencer, G R; Padgett, G A; Davis, W C. Dwarfism in Alaskan
malamutes: a disease resembling metaphyseal dysplasia in human beings.
AmJ Pathol 1982;106(2):224–36.
11. Parker HGVB, Quignon P, et al. An expressed fgf4 retrogene is associated
with breed-defining chondrodysplasia in domestic dogs. Science. 2009;
325(5943):995–8.
12. Knapp JL, Tomlinson JL, Fox DB. Classification of Angular Limb Deformities
Affecting the Canine Radius and Ulna Using the Center of Rotation of
Angulation Method. Vet Surg. 2016;45(3):295–302.
13. Lappalainen AKHT, Junnila J, Laitinen-Vapaavuori O. Radiographic evaluation
of elbow incongruity in Skye terriers. J Small Anim Pract. 2016;57(2)96–9.
14. Hansen H-J. A pathologic-anatomical study on disc degeneration in dog:
with special reference to the so-called Enchondrosis Intervertebralis. Acta
Orthop Scand. 1952;23:1–130.
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19 Page 6 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
15. Brown EA, Dickinson PJ, Mansour T, Sturges BK, Aguilar M, Young AE, et al.
FGF4 retrogene on CFA12 is responsible for chondrodystrophy and
intervertebral disc disease in dogs. Proc Natl Acad Sci U S A. 2017;114(43):
11476–81.
16. Batcher K, Dickinson P, Giuffrida M, Sturges B, Vernau K, Knipe M, et al.
Phenotypic effects of FGF4 Retrogenes on intervertebral disc disease in
dogs. Genes. 2019;10(6)435.
17. Guerra ZP. Bichon Havanese: Interpet publishing; 2003.
18. MyDogDNA. Havanese - genetic diversity. MyDogDNA; 2020. www.
mydogdna.com. Accessed Aug 2020.
19. Huson HJP, Heidi G.; Runstadler, Jonathan; Ostrander, Elaine A. A genetic
dissection of breed composition and performance enhancement in the
Alaskan sled dog. BMC Genetics. 2010;11(1):71.
20. Kong L, Shi, Li, Wang, Wenbo, Zuo, Rongtai, Wang, Mengwei, Kang, Qinglin.
Identification of two novel COL10A1 heterozygous mutations in two
Chinese pedigrees with Schmid-type metaphyseal chondrodysplasia. BMC
Med Genet. 2019;20(1):200.
21. internationale Fc. Havanese (Bichon havanais): FEDERATION CYNOLOGIQUE
INTERNATIONALE 2016 [Available from: http://www.fci.be/nomenclature/
Standards/250g09-en.pdf.
22. Bellamy KKL, Storengen LM, Handegård KW, Arnet EF, Prestrud KW, Overall
KL, et al. DRD2 is associated with fear in some dog breeds. J Veterinary
Behavior Clin Applications Res. 2018;27:67–73.
23. Tellegen AR, Dessing AJ, Houben K, Riemers FM, Creemers LB, Mastbergen
SC, et al. Dog as a Model for Osteoarthritis: The FGF4 Retrogene Insertion
May Matter. J Orthop Res. (JID:8404726) 2019;37(12):2550–2560.
24. MedCalc Statistical Software version 19.5.1 (MedCalc Software bv, Ostend,
Belgium; 2020). 19.5.1 ed2020. https://www.medcalc.org. Accessed Aug
2020.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Bellamy and Lingaas Canine Medicine and Genetics (2020) 7:19 Page 7 of 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
