Alien populations of painted frogs, genus Discoglossus, on the southeastern coast of France: two examples of anthropogenic introduction

Abstract

Introductions of animals and plants by humans permanently restructure the distribution ranges of species and the compositions of communities, a phenomenon which has been intensified in recent decades with globalization. However, it is often difficult to date these introductions or to identify the geographic origin of the introduced individuals. In this study, genetic variation in the mitochondrial gene for cytochrome b was examined in native populations of painted frogs (genus Discoglossus) and introduced individuals discovered at two novel locations in the southeast of France, to determine their specific ranks and origins. The population of Discoglossus sardus identified at Marseille probably originated from Corsica, and that of Discoglossus pictus discovered at Grimaud in the Var Department probably originated from the previously introduced range of the species in the southwestern Mediterranean region of France. These newly discovered populations of painted frogs represent an unresolved conservation issue, as they are allochthonous in the respective regions on one hand, but on the other hand they belong to species which are legally protected in France and Europe. As next steps, assessing their range expansion is important, as is studying the nature of the relationship between these painted frog populations and the native amphibian communities.

Full text

189
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Amphibian & Reptile Conservation
14(3) [General Section]: 189–199 (e266).
Alien populations of painted frogs, genus Discoglossus,
on the southeastern coast of France: two examples of
anthropogenic introduction
1,*Julien Renet, 2Rémi Duguet, 3Mathieu Policain, 4Alison Piquet, 5Vincent Fradet, 6Pauline Priol,
7Grégory Deso, 8François Grimal, 9Giuseppe Sotgiu, and 10Miguel Vences
1Conservatoire d’espaces naturels de Provence-Alpes-Côte d’Azur, Pôle Biodiversité régionale, 18 avenue du Gand, 04200 Sisteron, FRANCE
2Alcedo Faune et Flore, 85 impasse Bas Laval, 07110 Sanilhac, FRANCE 3Association Colinéo, 1 chemin des Grives, 13013 Marseille, FRANCE
424 avenue de Ballancourt, 91760 Itteville, FRANCE 553 chemin Cami Founjut, 34350 Valras Plage, FRANCE 6StatiPop-Scientic Consulting, 4
avenue de Nîmes, 34190 Ganges, FRANCE 7Association herpétologique de Provence Alpes Méditerranée, Maison des associations, 384 route de
Caderousse, 84100 Orange, FRANCE 8Ligue pour la Protection des Oiseaux Provence-Alpes-Côte d’Azur, 6 Avenue Jean Jaurès, 83400 Hyères,
FRANCE 9Zirichiltaggi - Sardinia Wildlife Conservation, Non Prot Association, Sassari, ITALY 10Zoological Institute, Technische Universität
Braunschweig, Mendelssohnstr. 4, 38106 Braunschweig, GERMANY
Abstract.—Introductions of animals and plants by humans permanently restructure the distribution ranges of
species and the compositions of communities, a phenomenon which has been intensied in recent decades
with globalization. However, it is often difcult to date these introductions or to identify the geographic origin
of the introduced individuals. In this study, genetic variation in the mitochondrial gene for cytochrome b was
examined in native populations of painted frogs (genus Discoglossus) and introduced individuals discovered
at two novel locations in the south-east of France, to determine their specic ranks and origins. The population
of Discoglossus sardus identied at Marseille probably originated from Corsica, and that of Discoglossus
pictus discovered at Grimaud in the Var Department probably originated from the previously introduced range
of the species in the southwestern Mediterranean region of France. These newly discovered populations of
painted frogs represent an unresolved conservation issue, as they are allochthonous in the respective regions
on one hand, but on the other hand they belong to species which are legally protected in France and Europe. As
next steps, assessing their range expansion is important, as is studying the nature of the relationship between
these painted frog populations and the native amphibian communities.
Keywords. Anura, biogeography, conservation, human introduction, invasive capacity, native range
Résumé.—Les introductions humaines d’animaux et de plantes restructurent en permanence l’aire de répartition
des espèces et la composition des communautés, phénomène qui s’est intensié ces dernières décennies avec
la mondialisation. Cependant, il est souvent difcile de dater ces introductions et d’identier leurs origines.
Dans cette étude, la variation génétique du gène mitochondrial du cytochrome b a été examinée dans des
populations indigènes de discoglosses (genre Discoglossus) et chez des individus introduits, découverts
sur deux localités inédites dans le sud-est de la France. L’objectif étant de déterminer le rang spécique et
l’origine des discoglosses observés sur ces nouvelles localités. Les analyses témoignent de la présence de
Discoglossus sardus (probablement originaire de Corse) à Marseille et de Discoglossus pictus (provenant
probablement de l’aire d’introduction de l’espèce située dans le sud-ouest de la région méditerranéene
française) à Grimaud dans le département du Var. Ces populations nouvellement découvertes représentent
un problème de conservation non résolu, car elles sont d’une part allochtones dans les localités respectives,
mais d’autre part appartiennent à des espèces légalement protégées en France et en Europe. À l’avenir, il sera
important d’évaluer leur expansion géographique et d’étudier la nature de la relation entre ces populations de
discoglosses et les communautés d’amphibiens indigènes.
Mots clés. Anoure, biogéographie, conservation, introduction humaine, capacité d’invasion, aire de répartition d’origine
Citation: Renet J, Duguet R, Policain M, Piquet A, Fradet V, Priol P, Deso G, Grimal F, Sotgiu G, Vences M. 2020. Alien populations of painted frogs,
genus Discoglossus, on the southeastern coast of France: two examples of anthropogenic introduction. Amphibian & Reptile Conservation 14(3)
[General Section]: 189–199 (e266).
Copyright: © 2020 Renet et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The ofcial and authorized publication credit sources, which will be duly enforced, are
as follows: ofcial journal title Amphibian & Reptile Conservation; ofcial journal website: amphibian-reptile-conservation.org.
Accepted: 19 June 2020; Published: 6 November 2020
Ofcial journal website:
amphibian-reptile-conservation.org
Correspondence. *julien.renet@cen-paca.org

190
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
addition, some indigenous species have been translocated
within France, such as Hyla meridionalis into Hyères
Islands (Knoepfer 1961), Ichthyosaura alpestris on
the limestone plateau of Larzac (Hérault) [Denoël 2005;
Geniez and Cheylan 2012], and Speleomantes strinatii
into a mine in the French Pyrénées (Ariège) [Lunghi et
al. 2018] and a cave near Angles-sur-l’Anglin (Vienne)
[Lucente et al. 2016].
This report documents two additional cases, based on
observations of painted frogs (Discoglossus) between
2011 and 2018 at two continental localities in the south-
east of France, in the city of Marseille (Bouches-du-
Rhône Department), and in a plain and semi-urban zone
in the locality of Grimaud (Var Department) [Table 1,
Fig. 1]. These observations have generated strong interest
because the localities are geographically distant from the
documented ranges of the two species of Discoglossus
known to be present in France (Fig. 1). Discoglossus
sardus is distributed in Sardinia, in the Tuscan
Archipelago and the adjacent Italian coast, and in France
in the eastern part of Hyères Islands (Port-Cros and the
Levant Islands) and Corsica (Delaugerre and Cheylan
1992; Lescure and de Massary 2012). The other species,
Discoglossus pictus, is indigenous to North Africa
(Algeria and Tunisia), Sicily, Malta, and Gozo (Sindaco
et al. 2006). However, since D. pictus was originally
introduced into France in the department of Pyrenees-
Orientales, it has colonized the adjacent departments
of Aude, Hérault (Knoepfer 1962; Fradet and Geniez
2004; Geniez and Cheylan 2012), and the extreme north-
east of Spain (Franch et al. 2007).
Because of the difculty in unambiguously identifying
species of Discoglossus by morphological criteria alone,
molecular phylogenetic analyses were conducted to
assess the species identity and geographic origins of the
observed painted frogs from the two novel locations in
mainland France.
Materials and Methods
Genetic samples. Tissue samples and buccal swabs were
taken on 31 May 2018 and 17 June 2018, respectively,
from nine tadpoles from Marseille; and on 7 November
Introduction
The presence of barriers, both natural (e.g., rivers, sea,
mountains) and articial (e.g., roads, urban centers), often
limits the dispersal of terrestrial vertebrates (Peres et al.
1996; Epps et al. 2005; Riley et al. 2006; Delaney et al.
2010; Chiari et al. 2012). However, by their historic and
contemporary activities, such as transport, international
trade, experiments, agriculture, etc., humans have
caused the introduction of species into territories far
from their original distribution (Pyšek et al. 2010). This
phenomenon has been exacerbated in recent decades
due to globalization, which has intensied terrestrial,
aerial, and sea transport, and increased international
trade (Levine and D’Antonio 2003; Westphal et al. 2008;
Hulme 2009). Many organisms, including amphibians,
are affected by these anthropic introductions (either
accidental or voluntary), which are often characterized
by high potential population growth rates, allowing the
introduced species to become permanently established
(Kraus 2015; Aellen et al. 2017).
In France, numerous non-native amphibian species
have settled successfully. Among the more historical
introductions (i.e., in the early 20th century) are
Discoglossus pictus in Banyuls-sur-Mer (Pyrénées-
Orientales) and probably Triturus carnifex, which was
introduced in Chêne-Bourg (Switzerland) [Lescure and
de Massary 2012] very near the border with France
and is now present in Ain and Haute-Savoie, around
Leman Lake (Arntzen 2001; Dufresnes et al. 2016).
During the mid-20th century, Pelophylax bergeri was
translocated from Central Italy multiple times, resulting
in introgressive hybridization with native populations
of its sister taxon Pelophylax lessonae (Dufresnes et al.
2017). During this time, massive importations of several
other Pelophylax species (e.g., P. bedriagae) for human
consumption also occurred (Pagano et al. 2003).
More recently, Lithobates catesbeianus was
introduced in Arveyres (Gironde), Xenopus laevis in
Bouillé-Saint-Paul (Deux-Sèvres), Bombina bombina in
Albestroff (Moselle), and Eleutherodactylus johnstonei
in the urban zone of Nantes (Loire-Atlantique) [Lescure
and de Massary 2012; Labadesse and Eggert 2018]. In
Species Date Locality Latitude
(N)
Longitude
(E)
Number of
specimens Observers
Discoglossus sardus 17 June 2011 Marseille 43°20’47.3” 5°26’10.9” 3–4 A. Piquet
17 June 2015 Marseille 43°20’46.5” 5°26’22.4” 1 V. Mariani
31 March 2018 Marseille 43°20’20.9” 5°26’32.4” 3 M. Policain
16 April 2018 Marseille 43°21’00.7” 5°26’12.5” 60 M. Policain and F. Grimal
Discoglossus pictus 2016–2017 Grimaud 43°16’32.2” 6°31’52.9” Ind. V. Fradet and A. Dubois
2016–2017 Grimaud 43°16’59.0” 6°30’59.8” Ind. V. Fradet and A. Dubois
2016–2017 Grimaud 43°16’12.7” 6°33’02.6” Ind. V. Fradet and A. Dubois
7 November 2018 Grimaud 43°15’52.6” 6°33’39.1” 3 J. Renet, M. Policain, and M. Marmier
Table 1. Available data on the occurrences of the two introduced species of Discoglossus on the southeastern coast of France. Ind. =
Indeterminate.

191
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Renet et al.
2018 from two adult specimens from Grimaud (Fig. 2C).
The sampled individuals were collected at night along two
small shady streams and in a water-lled moat bordering
a wasteland and a vineyard (Fig. 2B,D). Additional
comparative samples were collected from various sites
in Sardinia, Corsica, and the Hyères Archipelago (Port-
Cros), in the form of either muscle tissue samples from
roadkill specimens or tail tips of tadpoles.
Genetic analyses. Total genomic DNA was extracted
from the buccal swabs and tissue samples using a salt
extraction protocol (Bruford et al. 1992). A fragment of the
mitochondrial gene for cytochrome b (cob) was amplied
using the primers in Zangari et al. (2006): MVZ15-L
(GAACTAATGGCCCACACWWTACGNAA) and
H15149-H (AAACTGCAGCCCCTCAGAATGATATT
TGTCCTCA). As these primers did not reliably
amplify the respective fragment, particularly in D.
sardus, most samples were also amplied using
two newly developed specic primers: Dsard-Fwd
(TGACCTACCTACCCCATCCA) and Dsard-Rev
(GGGCAGTACGTAGCCTACAA). For both primer
pairs, the PCR protocol consisted of an initial step of 90
sec at 94 °C, followed by 35 steps of 94 °C (30 sec),
53 °C (45 sec), 72 °C (90 sec), and a nal elongation
step of 10 min at 72 °C. PCR products were treated
with exonuclease I (New England Biolabs) and shrimp
alkaline phosphatase (Promega) to inactivate remaining
Fig. 1. (A) Map of the ranges of D. sardus (orange: native population range) and D. pictus (purple: original distribution range; pink:
introduced population range). (B) Enlarged view of the area with the newly introduced populations of the two species in southern
France (orange star: D. sardus in Marseille; pink square: D. pictus in Grimaud), which is indicated by the black rectangle in (A).

192
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
primers and dNTPs, and then sent for sequencing to
LGC Genomics (Berlin, Germany). Chromatographs
were checked and obvious errors in automated sequence
reads were corrected using Codon-Code Aligner (v2.0.6,
Codon Code Corporation). All newly determined
sequences were submitted to GenBank (accession
numbers MT569346–MT569387).
The cytochrome b fragment used was chosen to allow
comparisons with the results of Zangari et al. (2006), who
published sequences of D. sardus and all other species
in the genus from various localities. These sequences
were downloaded from GenBank and trimmed to match
the shorter length of the sequences produced using the
specic D. sardus primer pairs listed above. Note that
this fragment is not homologous with the one used by
Martínez-Solano (2004) and Vences et al. (2014), and
therefore direct comparisons with the results of those
studies (which focused on D. galganoi and D. pictus) are
not possible.
Sequences were aligned and phylogenetic analysis
was conducted using MEGA, v. 7 (Kumar et al. 2016).
The sequences were rst aligned using the Clustal
algorithm, then the appropriate substitution model
(Kimura-2-parameter + G) was selected under the
Akaike Information Criterion, phylogenetic trees were
subsequently inferred under the Maximum Likelihood
(ML) optimality criterion with NNI branch swapping, and
node support was assessed with 500 bootstrap replicates.
The tree was rooted with D. montalentii, which represents
the sister species to all other Discoglossus (Zangari et al.
2006; Pabijan et al. 2012; Biton et al. 2013; Dufresnes et
al. 2020).
Results and Discussion
Genetic Identity of the New Discoglossus Populations
The Maximum Likelihood tree reconstructed from the
258 bp cytochrome b segment retained for analysis
(Fig. 3) recovered phylogenetic relationships among
Discoglossus species which were largely similar to those
of more comprehensive, multi-gene studies (Zangari et
al. 2006; Pabijan et al. 2012; Biton et al. 2013; Dufresnes
et al. 2020). However, as expected from such a short
gene fragment, the relationships among most species
were not reliably resolved. All species of Discoglossus
were recovered as monophyletic groups, with bootstrap
supports of 90–99%.
For the new continental French populations that are
the focus of the present study, the tree is unambiguous
in placing the samples from Marseille into the D. sardus
clade, and the samples from Grimaud into the D. pictus
Fig. 2. (A) Adult male Discoglossus sardus from Marseille, 31 May 2018. (B) Discoglossus sardus habitat in the city of Marseille.
(C) Adult Discoglossus pictus from Grimaud, 7 November 2018. (D) Discoglossus pictus habitat in Grimaud. The white arrow
indicates the position of a ditch lled with water, where three individuals were observed. Photos by Mathieu Policain (A–B), Julien
Renet (C), and Google Map/Street View (D).

193
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Renet et al.
Fig. 3. Maximum Likelihood tree of Discoglossus based on a 258 bp fragment of the mitochondrial cytochrome b gene. Numbers
at nodes are bootstrap values (500 pseudoreplicates) in percent. After the locality, sample numbers are given, including GenBank
accession numbers in parentheses for those sequences taken from GenBank. “Z” marks sequences from the work of Zangari et al.
(2006). Samples from the two newly discovered introduced populations are highlighted in bold, red font.

194
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
10 km of the sampling locality), which are known to be
vectors of various species introductions worldwide (e.g.,
anurans, snails, plants; Christy et al. 2007; Bergey et al.
2014).
The two newly detected introductions of Discoglossus
in continental France could have been accidental, or they
could have been deliberate due to a variety of motivations,
such as experimental studies on naturalization conducted
in the past, or the liberation of captive animals. For
instance, D. sardus tadpoles from Port-Cros Island were
introduced into a tributary of la Mole river (Var) as an
experiment in 1955, and this attempt at establishing a
reproducing population is known to have succeeded at
least until 1959 (Knoepper 1962).
The discoveries of these new populations testify
once again that today the natural elements, such as
rivers or oceans, do not represent absolute barriers for
either native or allochthonous species. Invasion success
generally depends more on the ability of a species to
respond to natural selection than on broad physiological
tolerance or plasticity (Lee 2002). In the present case,
considering the ranges of these two species and their
reproductive status, it seems that they can be considered
as successful colonizers. In fact, more comprehensive
phylogeographic studies of D. pictus and D. sardus in
the future should also examine the possibilities of D.
sardus translocations among Corsica and Sardinia (given
the clustering of the one Corsican haplotype among the
Sardinian haplotypes; Fig. 3) and of D. pictus to or from
Sicily (given the presence of highly distinct haplotypes
on this island; Fig. 3).
Conservation Issues
Williamson (1996) considers that a biological invasion
occurs when an organism takes root outside of its
indigenous range. The IUCN Invasive Species Specialist
Group proposes a more specic denition—that a
biological invasion has occurred as soon as an introduced
species is a factor of damage and affects the local
biodiversity. In fact, it is important to distinguish between
an allochthonous species introduced by humans, which
is inoffensive in many cases, and an invasive species,
which, by denition, is not only introduced outside of
is indigenous range but also exerts a negative impact
on biodiversity and more globally on the ecosystem
(Lambertini et al. 2011).
In the urban and sub-optimal ecological context of the
city of Marseille, the population of D. sardus probably
does not represent a threat to the ecosystem, which is
a priori of ‘low ecological value.’ Furthermore, this
population is already threatened by a large-scale urban
development project. Although D. sardus is considered
to be Least Concern in both the IUCN Red List and the
National French Red List (Andreone et al. 2009; UICN
France et al. 2015), the global assessment has determined
a decreasing population trend. This points to an important
clade. All nine D. sardus specimens sequenced from
Marseille had identical sequences, and the same haplotype
was also found in two localities in Corsica. In contrast,
all sequenced specimens from the Hyères Archipelago
and from Sardinia differed by at least three mutations,
suggesting that the Marseille population most likely
originated by the introduction of only a few individuals
from Corsica. Of the two specimens from Grimaud, one
had a haplotype identical to that of a specimen from
Banyuls-sur-Mer, while the second one differed by a
single mutation. This suggests a probable origin of this
population by introduction from the invasive range of D.
pictus in the southwestern French Mediterranean region.
The tree generated here also recapitulates the
surprising nding of Zangari et al. (2006) regarding the
presence of rather distinct mitochondrial haplotypes of
D. pictus in Sicily. It also reveals that D. sardus from
Corsica and Sardinia are not reciprocally monophyletic
based on mitochondrial DNA. In this latter case, the one
Corsican D. sardus (from Col d’Eustache) clustering
among the Sardinian haplotypes was sequenced several
months before the samples from Sardinia were processed,
which excludes the possibility of an artifact due to a
mislabelled sample or contamination.
Geographic Origin and Status of the New Discoglossus
Populations
The results of this analysis shed a new light on the ranges
of the two species of Discoglossus that are present in the
south of France. In the population of D. sardus established
in Marseille represents the second known mainland
population, after the population of Monte Argentario
peninsula (Tuscany, Italy). The genetic similarity of the
Marseille samples with those from the two Corsican
localities allow us to refute the hypothesis of an ancient
relict population naturally occurring in Marseille. In
such a case we would expect genetic relationships with
the individuals from Port-Cros or the Levant islands
(Hyères Archipelago), which are geographically much
closer to Marseille than Corsica. On the contrary, an
introduction from Corsica is consistent with the intensity
of the maritime trafc between Corsica and Marseille,
and the apparent lack of genetic diversity in the Marseille
samples is also in agreement with an introduced origin.
Even if the date of introduction of this species cannot be
determined, its spread over an area of approximately 0.66
km2 suggests that the arrival of D. sardus in Marseille is
not very recent.
With a geographic extension of almost 210 km to
the east (i.e., the distance between the easternmost
population known to date and the recently discovered
population at Grimaud), and its crossing of the Rhone
River, the anthropic introduction of D. pictus is beyond
doubt. Its arrival in Grimaud, along the La Garde river,
could be linked with the trade activities of the many
nurseries and garden stores (12 shops identied within

195
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Renet et al.
and challenging dilemma highlighted by Marchetti and
Engstrom (2016): how to manage allochthonous, or even
invasive species, that are threatened (or may become
threatened in the future) in their native range? Several
authors (e.g., Marris 2014; Heise 2018) have suggested
pragmatic approaches when dealing with non-native
species, especially in urban environments which indeed
could become sanctuaries for many species (native
or not) that are threatened in their original habitat.
Especially with shifting ranges due to climatic change, the
distinctions between native and non-native will become
increasingly vague, and human-aided translocations of
some threatened species are already being discussed
(Egan et al. 2018).
These elements lead us to consider the presence of
these new Discoglossus populations as a high-priority
conservation issue. We can also add that D. sardus is
assessed as Threatened in the Var Department (cat. VU
IUCN Redlist) [Marchand et al. 2017], and as threatened
with extinction at Port-Cros Island, Port-Cros National
Park (Duguet et al. 2019).
Concerning D. pictus, the question of its biological
status requires more scrutiny because other authors have
attributed an invasive nature with a high rate of dispersal
to this species (Montori et al. 2007). Its invasive capacity
does not seem to be related to its adaptive advantages,
but rather to the suitability of local abiotic conditions
(Escoriza et al. 2014). The modeling of its potential
habitat conducted by Escoriza et al. (2014) includes areas
that are geographically near the locality of Grimaud, and
incorporation of the new occurrences should allow an
adjustment of the predictive models. Furthermore, the
potential area of this species should be considered as
wider than suggested by previous models. In any case,
the expansion of D. pictus from a single location in
Banyuls-sur-Mer, Eastern Pyrénées a century ago (see
Wintrebert 1908) is not an artifact; i.e., it represents a
natural range expansion (Pujol-Buxó et al. 2019a) into a
currently occupied area in France and Catalonia of more
than 10,000 km2 (Montori et al. 2009). A negative impact
of this species on co-occurring anurans (e.g., Pelodytes
punctatus and Epidalea calamita) has been suspected
(Escoriza and Boix 2012, 2014; Richter-Boix et al. 2013;
San Sebastián et al. 2015). However, this possibility
requires further study as some have hypothesized that
temporal or evolutionary changes may have moderated
the effects and disturbance of D. pictus on native species
(Pujol-Buxó et al. 2019b).
In any event, according to the actual current French
regulations, all individuals of both species, as well as
their “core” habitat, are strictly protected by a ministerial
order (DEVN0766175A). Although a recent update of
this order would specically exclude D. pictus, we hope
for the continued regulatory protection of D. pictus in
French territory. Given the similarities in biotic features
between the source and recipient communities (Escoriza
and Ruhí 2016), we suspect that Discoglossus species
are probably not harmful to the local French anuran
communities, and we therefore do not recommend the
eradication of their non-native populations.
Lastly, to better manage this situation going forward,
we recommend a monitoring program to: (1) characterize
a predictable range expansion of these two painted
frog species in adjacent localities; and (2) implement
complementary studies in order to better assess the nature
of the relationship between these introduced species and
the native amphibian communities.
Acknowledgements.—Fieldwork and sampling were
permitted by the French Government (permits n° 2017-
68/PJI and by prefect order of the Bouches-du-Rhône).
We warmly thank the two reviewers, Daniel Escoriza
and Sebastiano Salvidio, for providing useful comments.
We also would like to thank Marin Marmier for his eld
assistance, and Giacomo Rosa for the revision of the
English text.
Literature Cited
Aellen WL, Street SE, Capellini I. 2017. Fast life history
traits promote invasion success in amphibians and
reptiles. Ecology Letters 20: 222–230.
Andreone F, Lecis R, Miaud C, Corti C, Sindaco
R, Romano A. 2009. Discoglossus sardus. The
IUCN Red List of Threatened Species 2009:
e.T55271A11265832.
Arntzen JW. 2001. Genetic variation in the Italian
Crested Newt, Triturus carnifex, and the origin of a
non-native population north of the Alps. Biodiversity
and Conservation 10: 971–987.
Bergey EA, Figueroa LL, Mather CH, Martin, RJ, Ray
EJ, Kurien JT, Westrop DR, Suriyawong P. 2014.
Trading in snails: plant nurseries as transport hubs for
non-native species. Biological Invasions 16: 1,441–
1,451.
Biton R, Geffen E, Vences M, Cohen O, Bailon S,
Rabinovich R, Malka Y, Oron T, Boistel R, Brumfeld
V, et al. 2013. The rediscovered Hula Painted Frog is a
living fossil. Nature Communications 4: e1959.
Bruford MW, Hanotte O, Brookeld JFY, Burke T.
1992. Single-locus and multilocus DNA ngerprint.
Pp. 225–270 In: Molecular Genetic Analysis of
Populations: a Practical Approach. Editor, Hoelzel
AR. IRL Press, Oxford, United Kingdom. 445 p.
Chiari Y, van der Meijden A, Mucedda M, Lourenço
JM, Hochkirch A, Veith M. 2012. Phylogeography
of Sardinian cave salamanders (genus Hydromantes)
is mainly determined by geomorphology. PLoS
One 7(3): e32332.
Christy MT, Savidge JA, Rodda GH. 2007. Multiple
pathways for invasion of anurans on a Pacic island.
Diversity and Distributions 13: 598–607.
Delaney KS, Riley SP, Fisher RN. 2010. A rapid, strong,
and convergent genetic response to urban habitat

196
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
fragmentation in four divergent and widespread
vertebrates. PLoS One 5(9): e12767.
Delaugerre M, Cheylan M. 1992. Atlas de répartition des
batraciens et reptiles de Corse. L’Oikéma, Pamplona,
Spain. 128 p.
Denoël M. 2005. Persistance et dispersion d’une
population introduite de Triton alpestre (Triturus
alpestris) dans les causses du Larzac (Sud de la
France). Revue d’Écologie (Terre et Vie) 60: 139–148.
Dufresnes C, Pellet J, Bettinelli-Riccardi S, Thiebaud
J, Perrin N, Fumagalli L. 2016. Massive genetic
introgression in threatened Northern Crested Newts
(Triturus cristatus) by an invasive congener (T.
carnifex) in Western Switzerland. Conservation
Genetics 17: 839–846.
Dufresnes C, Di Santo L, Leuenberger J, Schuerch
J, Mazepa G, Grandjean N, Canestrelli D, Perrin
N, Dubey S. 2017. Cryptic invasion of Italian Pool
Frogs (Pelophylax bergeri) across Western Europe
unraveled by multilocus phylogeography. Biological
Invasions 19: 1,407–1,420.
Dufresnes C, Pribille M, Alard B, Gonçalves H, Amat F,
Crochet PA, Dubey S, Perrin N, Fumagalli L, Vences
M, et al. 2020. Integrating hybrid zone analyses
in species delimitation: lessons from two anuran
radiations of the Western Mediterranean. Heredity
124: 423–438.
Duguet R, Priol P, Deso G, Geoffroy D. 2019. Mise à
jour des connaissances sur le Discoglosse sarde
Discoglossus sardus Tschudi in Otth, 1837 dans l’île
de Port-Cros en 2018: habitats potentiels, état de la
population et mesures de gestion. Scientic Reports of
Port-Cros National Park 33: 101–126.
Egan PA, Bourke D, Thuiller W, Baudraz MEA, Georges
D, Renaud J, Stout JC. 2018. Invasive aliens threatened
with native extinction: examining best practice for
species translocations under climate change. bioRxiv
preprint. Available: https://doi.org/10.1101/429084
[Accessed: 15 March 2020].
Epps CW, Palsbøll PJ, Wehausen JD, Roderick GK,
Ramey RRII, McCullough DR. 2005. Highways
block gene ow and cause a rapid decline in genetic
diversity of desert Bighorn Sheep. Ecology Letters 8:
1,029–1,038.
Escoriza D, Boix D. 2012. Assessing the potential impact
of an invasive species on a Mediterranean amphibian
assemblage: a morphological and ecological approach.
Hydrobiologia 680: 233–245.
Escoriza D, Boix D. 2014. Reproductive habitat
selection in alien and native populations of the genus
Discoglossus. Acta Oecologica 59: 97–103.
Escoriza D, Ben Hassine J, Boix D. 2014. Factors
regulating the invasive success of an alien frog: a
comparison of the ecology of the native and alien
populations. Hydrobiologia 730: 127–138.
Escoriza D, Ruhí A. 2016. Functional distance to recipient
communities may favor invasiveness: insights from
two invasive frogs. Diversity and Distributions 22:
519–533.
Fradet V, Geniez P. 2004. La répartition du Discoglosse
peint Discoglossus pictus Otth, 1837 (Amphibien,
Anoure, Discoglossidés) dans le Sud de la France:
note sur sa présence dans le département de
l’Hérault. Bulletin de la Société Herpétologique de
France 109: 35–41.
Franch M, Llorente GA, Montori A, Richter-Boix
A, Carranza S. 2007. Discovery of an introduced
population of Discoglossus pictus beyond its known
distributional range. Herpetological Review 38: 356–
359.
Geniez P, Cheylan M. 2012. Les Amphibiens et les
Reptiles du Languedoc-Roussillon et régions
limitrophes: atlas biogéographique. Muséum national
d’Histoire naturelle, Paris, France and Biotope, Mèze,
France. 448 p.
Heise UK. 2018. The case for ‘sanctuary cities’ for
endangered species. Available: https://www.citylab.
com/environment/2018/06/the-case-for-sanctuary-
cities-for-endangered-species/562091/ [Accessed: 15
March 2020].
Hulme PE. 2009. Trade, transport, and trouble: managing
invasive species pathways in an era of globalization.
Journal of Applied Ecology 46(1): 10–18.
Knoepfer LP. 1961. Les Batraciens et principalement
le genre Discoglossus dans les îles méditerranéennes.
Colloques internationaux du Centre National de la
Recherche Scientique 94: 159–161.
Knoepfer LP. 1962. Contribution à l’étude du genre
Discoglossus (Amphibiens Anoures). Vie et Milieu
13: 1–94.
Kraus F. 2015. Impacts from invasive reptiles and
amphibians. Annual Review of Ecology, Evolution,
and Systematics 46: 75–97.
Kumar S, Stecher G, Tamura K. 2016. MEGA7:
Molecular Evolutionary Genetics Analysis version 7.0
for bigger datasets. Molecular Biology and Evolution
33(7): 1,870–1,874.
Labadesse M, Eggert C. 2018. La gestion intégrée
des amphibiens exotiques envahissants en France
métropolitaine. Faune Sauvage 321: 58–63.
Lambertini M, Leape J, Marton-Lefèvre J, Mittermeier
RA, Rose M, Robinson JG, Stuart SN, Waldman B,
Genovesi P. 2011. Invasives: a major conservation
threat. Science 333: 404–405.
Lee CE. 2002. Evolutionary genetics of invasive species.
Trends in Ecology and Evolution 17(8): 386–391.
Lescure J, de Massary JC. 2012. Atlas des Amphibiens
et Reptiles de France. Biotope, Mèze, France and
Muséum national d’Histoire naturelle, Paris, France.
272 p.
Levine JM, D’Antonio CM. 2003. Forecasting biological
invasions with increasing international trade.
Conservation Biology 17: 322–326.
Lucente D, Renet J, Gailledrat M, Tillet J, Nascetti G,

197
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Renet et al.
Invasions 21: 1,167–1,177.
Pyšek P, Jarošík V, Hulme PE, Kühn I, Wild J, Arianoutsou
M, Bacher S, Chiron F, Didžiulis V, Essl F, et al. 2010.
Disentangling the role of environmental and human
pressures on biological invasions across Europe.
Proceedings of the National Academy of Sciences of
the United States of America 107(27): 12,157–12,162.
Richter-Boix A, Garriga N, Montori A, Franch M, San
Sebastian O, Villero D, Llorente GA. 2013. Effects of
the non-native amphibian species Discoglossus pictus
on the recipient amphibian community: niche overlap,
competition, and community organization. Biological
Invasions 15: 799–815.
Riley SP, Pollinger JP, Sauvagot RM, York EC, Bromley
C, Fuller TK, Wayne RK. 2006. A southern California
freeway is a physical and social barrier to gene ow in
carnivores. Molecular Ecology 15: 1,733–1,741.
San Sebastian O, Pujol-Buxó E, Garriga N, Richter-
Boix A, Llorente GA. 2015. Differential trophic traits
between invasive and native anuran tadpoles. Aquatic
Invasions 10(4): 475–484.
Sindaco R, Doria G, Razzetti E, Bernini F. 2006. Atlas of
Italian Amphibians and Reptiles - Atlante degli Anbi
e dei Rettili d’Italia. Societas Herpetologica Italica -
Edizioni Polistampa, Firenze, Italy. 789 p.
UICN France, MNHN, SHF. 2015. La Liste rouge des
espèces menacées en France. Chapitre Reptiles
et Amphibiens de France métropolitaine. Union
internationale pour la conservation de la nature
France, Muséum national d’Histoire naturelle, and
Société herpétologique de France, Paris, France. 7 p.
Vences M, de Pous P, Nicolas V, Díaz-Rodríguez J,
Donaire D, Hugemann K, Hauswaldt JS, Amat F,
Barnestein JAM, Bogaerts S, et al. 2014. New insights
on phylogeography and distribution of painted frogs
(Discoglossus) in northern Africa and the Iberian
Peninsula. Amphibia-Reptilia 35: 305–320.
Westphal MI, Browne M, MacKinnon K, Noble I. 2008.
The link between international trade and the global
distribution of invasive alien species. Biological
Invasions 10: 391–398.
Williamson M. 1996. Biological Invasions. Chapman
and Hall, London, United Kingdom. 256 p.
Wintrebert P. 1908. Quinzième Assemblée Générale
Annuelle, Séance du 25 février 1908. Intervention
de M. Wintrebert sur la présence à Banyuls-sur-Mer
(Pyrénées-Orientales) du Discoglossus pictus Otth.
Bulletin de la Société Zoologique de France 33: 54.
Zangari F, Cimmaruta R, Nascetti G. 2006. Genetic
relationships of the western Mediterranean painted
frogs based on allozymes and mitochondrial markers:
evolutionary and taxonomic inferences (Amphibia,
Anura, Discoglossidae). Biological Journal of the
Linnean Society 87: 515–536.
Cimmaruta R. 2016. A new population of European
cave salamanders (genus Hydromantes) from west-
central France: relict or introduction? Herpetological
Bulletin 138: 21–23.
Lunghi E, Guillaume O, Blaimont P, Manenti R. 2018.
The rst ecological study on the oldest allochthonous
population of European cave salamanders
(Hydromantes sp.). Amphibia-Reptilia 39: 113–119.
Marchand MA, Roy C, Renet J, Delauge J, Meyer D,
Hayot C. 2017. Liste rouge régionale des amphibiens
et reptiles de Provence-Alpes-Côte d’Azur.
Conservatoire d’espaces naturels Provence-Alpes-
Côte d’Azur, Aix-en-Provence, France. 14 p.
Marchetti MP, Engstrom T. 2016. The conservation
paradox of endangered and invasive species.
Conservation Biology 30: 434–437.
Marris E. 2014. Opinion: it’s time to stop thinking that
all non-native species are evil. National Geographic
Magazine. Available: http://news.nationalgeographic.
com/news/2014/07/140724-invasive-species-
conservation-biology-extinction-climate-science/
[Accessed: 9 August 2019].
Martínez-Solano I. 2004. Phylogeography of Iberian
Discoglossus (Anura, Discoglossidae). Journal of
Zoological Systematics and Evolutionary Research
42: 298–305.
Montori A, Llorente GA, Richter-Boix A, Geniez P,
Villero D, San Sebastián O, Franch M, Garriga N.
2009. L’expansion de Discoglossus pictus pose
t-elle des problèmes de coexistence pour les autres
amphibiens? Oral presentation at: 37ème Congrès de la
Société herpétologique de France, 8–10 octobre 2009,
Montpellier, France.
Montori A, Llorente GA, Richter-Boix A, Villero D,
Franch M, Garriga N. 2007. Colonización y efectos
potenciales de la especie invasora Discoglossus pictus
sobre las especies nativas. Munibe 25: 14–27.
Pabijan M, Crottini A, Reckwell D, Irisarri I, Hauswaldt
JS, Vences M. 2012. A multigene species tree for
Western Mediterranean painted frogs (Discoglossus).
Molecular Phylogenetics and Evolution 64: 690–696.
Pagano A, Dubois A, Lesbarrères A, Lodé T. 2003. Frog
alien species: a way for genetic invasion? Comptes
Rendus Biologies 326: 85–92.
Peres CA, Patton JL, Nazareth F, da Silva M. 1996.
Riverine barriers and gene ow in Amazonian Saddle-
back Tamarins. Folia Primatologica 67: 113–124.
Pujol-Buxó E, Garcia Cisneros A, Miaud C, Llorente GA.
2019a. Genetic relationships and diversity patterns
within the invasive range of the Mediterranean
Painted Frog. Journal of Zoology 309: 125–132.
Pujol-Buxó E, Riaño GM, Llorente GA. 2019b. Stable
isotopes reveal mild trophic modications in a
native-invasive competitive relationship. Biological

198
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
Julien Renet is a French wildlife biologist at the NGO Conservatoire d’espaces naturels de Provence Alpes
Côte d’Azur (CEN PACA, http://www.cen-paca.org/), where he designs, coordinates, and implements the
conservation programs for several species of herpetofauna (e.g., Pelobates cultripes, Triturus cristatus,
Emys orbicularis, Euleptes europaea) of the Provence-Alps-Côte d’Azur region in France. His work
concerns the general framework of conservation biology, more specically ecology, biogeography,
population dynamics, and assessments of non-invasive individual marking methods. Additional
information about his work is available on his ResearchGate page, at: https://www.researchgate.net/
prole/Julien_Renet/research.
Rémi Duguet is a private consultant for biodiversity assessments and monitoring, and a part-time teacher
of herpetology at the University of Franche-Comté, Besançon, France. Rémi has worked for many years
in amphibian and reptile conservation, especially in France and in the western Indian Ocean islands.
He edited the book Les Amphibiens de France, Belgique et Luxembourg, published in 2003 by Biotope
(Meze, France).
Mathieu Policain is a naturalist who has worked for the NGO Colinéo-Assenemce (Marseille, France,
https://colineo.fr/) for ve years. He has a special interest in the Mediterranean herpetofauna, and is
currently an active volunteer in various efforts to protect amphibians and reptiles.
Alison Piquet is a French herpetologist with a Master’s degree and almost ten years of national and
international experience in the eld. Specializing in reptiles, and snakes in particular, she travels
extensively to conduct inventory eld studies and observe reptiles, amphibians, birds, and spiders in the
wild. As a herpetologist, she joined the Radeau des Cimes international expedition to Laos in 2014, in
order to inventory the herpetofauna in a poorly-known primary forest area. She also spent a few years in
Australia studying and photographing the amazing wildlife of that country.
Vincent Fradet is an amphibian specialist who graduated from the École Pratique des Hautes Études
(Paris-Sorbonne) where he studied Discoglossus pictus phylogeography. Vincent now works in the
service of nature for several environmental NGOs.
Pauline Priol works as scientic consultant in conservation biology, has spent several years managing
conservation programs for endangered species (Emys orbicularis, Pelobates cultripes), and obtained two
graduate degrees from universities in France and Canada. Pauline is now working with eld practitioners,
various stakeholders, and statisticians to develop methods for modeling population dynamics, building
and evaluating monitoring protocols, estimating demographic parameters, evaluating impacts of
perturbations, and evaluating/dening management actions. Her specialty is herpetofauna (e.g., European
pond turtles Emys and Mauremys, crested newts, Discoglossus, spadefoot toads, Mediterranean lizards)
but she also works on birds (stock programs, woodcock), craysh, and insects (dragonies, butteries).
Grégory Deso is a herpetologist who has been active in environmental organizations since 1999 on the
Mascarene Islands, where his work has focused on the distribution and ecology of various native and
introduced species and their interactions linked to human activity. He now resides in mainland France
(Provence Alps Côte d’Azur region) where he founded the NGO Association Herpétologique de Provence
Alpes Méditerranée (https://ahpam.fr/), which works toward the protection of amphibians and reptiles.
Today, Gregory’s work concerns all aspects of the continental and island Mediterranean herpetofauna.

199
Amphib. Reptile Conserv. November 2020 | Volume 14 | Number 3 | e266
Renet et al.
François Grimal is a French wildlife biologist at the NGO Ligue pour la Protection des Oiseaux
(LPO, https://www.lpo.fr/), an afliate of Birdlife International. François designs and coordinates
conservation and monitoring programs for several amphibian populations of the Provence-Alps-
Côte d’Azur region, in particular Epidalea calamita and Pelophylax sp. His work concerns the
ecology, population dynamics, implementation of genetic and bioacoustic studies, and photographic
and individual marking methods.
Giuseppe Sotgiu is an Italian biologist who works as an independent researcher specializing in the
conservation of the insular herpetofauna and ichthyofauna of Sardinia. The species he primarily
studies is the Sardinian Newt, Euproctus platycephalus, one of the most endangered urodeles
in Europe. Giuseppe collaborates with the Department of Zoology of the University of Sassari,
Sardinia, Italy. Since 2007, he has also collaborated with the Institute of Zoology at the Zoological
Society of London, in order to understand the impacts of pathogens such as chytridiomycete fungi
on the amphibian populations in the Mediterranean islands. He is also interested in studying the
impacts of alien species on native endemic species, and developing methods to mitigate the effects
of ecological invasions.
Miguel Vences is a zoologist and evolutionary biologist at Braunschweig University of
Technology, Germany. He leads a long‐standing research program on amphibian and reptile
biology, with investigations spanning classical taxonomy, molecular evolution, diversication
processes, biogeography, and conservation biology. Miguel has worked extensively on the
herpetofauna of Madagascar, and also on numerous taxa in Europe.