Access to this full-text is provided by Frontiers.
Content available from Frontiers in Behavioral Neuroscience
This content is subject to copyright.
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 1
ORIGINAL RESEARCH
published: 06 October 2020
doi: 10.3389/fnbeh.2020.587715
Edited by:
Francisco A. Martin,
Cajal Institute (CSIC), Spain
Reviewed by:
Livia Stocco Sanches Valentin,
University of São Paulo, Brazil
Chengyong Shen,
Zhejiang University, China
*Correspondence:
Xiaobin Wang
wangxiaobin67@163.com
†These authors have contributed
equally to this work
Specialty section:
This article was submitted to
Learning and Memory,
a section of the journal
Frontiers in Behavioral Neuroscience
Received: 27 July 2020
Accepted: 07 September 2020
Published: 06 October 2020
Citation:
Zhou H, Li F, Ye W, Wang M,
Zhou X, Feng J, Liu L and Wang X
(2020) Correlation Between Plasma
CircRNA-089763 and Postoperative
Cognitive Dysfunction in Elderly
Patients Undergoing Non-cardiac
Surgery.
Front. Behav. Neurosci. 14:587715.
doi: 10.3389/fnbeh.2020.587715
Correlation Between Plasma
CircRNA-089763 and Postoperative
Cognitive Dysfunction in Elderly
Patients Undergoing Non-cardiac
Surgery
Hongli Zhou1†, Fuyu Li1†, Wanlin Ye1, Maozhou Wang2, Xian Zhou3, Jianguo Feng4,
Li Liu1and Xiaobin Wang1*
1Department of Anesthesiology, The Affiliated Hospital of Southwest Medical University, Luzhou, China, 2Heart Center
and Beijing Key Laboratory of Hypertension, Beijing Chaoyang Hospital, Capital Medical University, Beijing, China,
3Department of Internal Medicine, The Affiliated Hospital of Southwest Medical University, Luzhou, China, 4Laboratory
of Anesthesiology, The Affiliated Hospital of Southwest Medical University, Luzhou, China
In our previous experiment, we found that there were abnormal levels of circRNA-
089763 in the plasma exosomes of patients with postoperative cognitive dysfunction
(POCD) after cardiac surgery. Therefore, the aim of this study was to further investigate
the relationship between plasma circRNA-089763 level and POCD in elderly patients
after non-cardiac surgery. A prospective cohort study was conducted to select elderly
patients undergoing elective non-cardiac surgery. A total of 72 patients were enrolled
in this study, and cognitive functions were assessed 1 day before and 3 days after
surgery by a series of neuropsychological measurements. Next, patients were divided
into POCD and non-POCD (NPOCD) groups according to the Zscore method. Blood
was collected the day before and 3 days after surgery, and the plasma circRNA-089763
level was detected by quantitative real-time polymerase chain reaction (qRT-PCR). Then,
the difference and correlation in plasma circRNA-089763 levels between the POCD and
NPOCD groups were analyzed. On the third day after surgery, the incidence of POCD
was 30.56%. The relative level of circRNA-089763 in the POCD group was 2.41 times
higher than that in the NPOCD group (t= 4.711, p<0.001), patients in POCD group
had higher age (t= 5.971, p<0.001), higher American Society of Anesthesiologists
classification (χ2= 14.726, p<0.001), less years of education (t= 2.449, p= 0.017),
more intraoperative blood loss (t= 3.196, p= 0.002), and higher visual analog scale
(VAS) scores (t= 10.45, p<0.001). The binary logistic regression analysis showed
that the circRNA-089763 level, age, and intraoperative blood loss were independently
associated with POCD (OR: 2.75, 95% CI: 1.261–5.999, p= 0.011; OR: 1.32, 95%
CI: 1.114–1.565, p= 0.001; OR: 1.017, 95% CI: 1.004–1.03, p= 0.011). These
results demonstrated that the circRNA-089763 plasma level was related to POCD after
non-cardiac surgery in elderly patients.
Keywords: circRNAs, postoperative cognitive dysfunction, qRT-PCR, Zscore method, elderly patients
Frontiers in Behavioral Neuroscience | www.frontiersin.org 1October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 2
Zhou et al. Plasma CircRNA-089763 and POCD
INTRODUCTION
Circular RNAs (CircRNAs) are a novel type of non-coding
RNA with a closed loop structure (Li et al., 2018). CircRNA is
widely present in the eukaryotic transcriptome and can regulate
target gene expression by the competitive endogenous RNA
(ceRNA) mechanism (Tay et al., 2014). In vivo, circRNAs are
predominantly transported in the form of exosomes, which can
enter the blood circulation through the blood–brain barrier
(Li et al., 2015).
Recent studies have found that circRNAs may play crucial
roles in neurological diseases, such as Alzheimer’s disease (AD)
(Zhao et al., 2016;Sekar et al., 2018;Wang et al., 2018;Dube
et al., 2019). Additionally, Zhang et al. (2017) characterized
circRNA-associated ceRNA networks in senescence-accelerated
mouse prone 8 brain and found that these networks could
affect the diagnosis and therapy of AD in the near future. The
dysfunction of the circRNA-miRNA-mRNA regulatory system
seems to represent another important aspect of epigenetic
control of the human central nervous system’s pathogenic
gene expression program. Moreover, postoperative cognitive
dysfunction (POCD) and AD have similar pathogenesis (Hu
et al., 2010;Hua et al., 2014).
POCD is a common complication of neurological diseases in
elderly patients that severely affects quality of life (Rundshagen,
2014). Therefore, early detection, diagnosis, and intervention
in POCD will effectively improve the quality of life of surgical
patients. However, the mechanism of POCD is not yet clear,
and unified clinical criteria to diagnose POCD are still lacking.
Therefore, it is imperative to find reliable and convenient
clinical biomarkers.
In clinical work, peripheral blood samples are easy to collect
compared with other specimens, such as cerebrospinal fluid
(CSF) and brain tissues. Studies have found that brain tissues can
release exosomes, which can carry non-coding RNAs (ncRNAs,
such as microRNAs, long stranded non-coding RNAs, and
circRNAs) and enter the blood circulation through the blood–
brain barrier. In our previous experiment, we found that there
were abnormal levels of circRNA-089763 in plasma exosomes
of POCD patients after cardiac surgery (Wang et al., 2019).
However, we found that it was difficult to collect and extract
exosomes, and the level of total plasma (not only plasma
exosomes) circRNA-089763 in non-cardiac POCD patients is
still unknown. Therefore, this study aims to investigate whether
the level of circRNA-089763 in the plasma of elderly patients
undergoing non-cardiac surgery exhibits the same changes, to
analyze the interaction and to provide novel insights about the
underlying mechanisms of POCD.
MATERIALS AND METHODS
Subjects
The protocol was reviewed and approved by the Ethics
Committee of Clinical Trials in the Affiliated Hospital of
Southwest Medical University (Approval#: 20180306038; Trial
registration: ChiCTR1800016435, registered 1 June 2018).
Written informed consent was obtained from the patients or their
relatives before study enrollment. Patients scheduled to undergo
general anesthesia for non-cardiac surgery in the Affiliated
Hospital of Southwest Medical University from June 2018 to
June 2019 were enrolled in this study. Blood samples were
taken from patients undergoing surgery. To exclude the role
of learning memory and increase the credibility of the POCD
diagnosis, 20 healthy volunteers were recruited as the control
group, and cognitive function assessment was completed only for
the cognitive function scales. The experimental technology route
is shown in Figure 1.
Inclusion criteria included the following: age ≥65 years
old, American Society of Anesthesiologists (ASA) grade I–
III, patient consent, estimated operation time ≥2 h. Patients
were excluded from study participation if they met any
of the following criteria: cognitive impairment characterized
by Mini-Mental State Examination (MMSE) score <24
before surgery, mental disorders, history of dementia, severe
organ dysfunction (respiratory, circulatory, or other system
dysfunction), refusal to phlebotomize, cognitive function scale
assessment difficulty (low-compliance patients, severe hearing
impairment, visual impairment, disability of reading and
understanding), cardiovascular and cerebrovascular accidents
occurring in the past 6 months, serious complications after
surgery, and blood samples not meeting test requirements.
Anesthesia Protocol
Vital signs were monitored once patients came into the
operating room, and the patient received oxygen inhalation
(6 L/min). Induction of anesthesia was as follows: penehyclidine
hydrochloride (0.01 mg/kg), propofol (1.5–2.5 mg/kg), or
etomidate (0.2–0.4 mg/kg), sufentanil (0.2–0.5 mg/kg),
and cisatracurium (0.1–0.2 mg/kg). After anesthesia
induction and tracheal intubation, anesthesia maintenance
included remifentanil (0.1–0.2 µg/kg·min), cisatracurium (1–
2µg/kg·min), and sevoflurane (1.5–3%). Effective circulatory
blood pressure, respiratory index, and appropriate anesthesia
depth were maintained during the operation.
Neuropsychological Assessments and
POCD Judgment Methods
Neuropsychological tests were primarily used to evaluate
attention and executive ability, memory and learning ability,
visual spatial awareness, and language fluency. The series of
scales, including MMSE, Color Trail Test (CTT), Digital Span
Test (DST), Clock Drawing Test (CDT), and Verbal Fluency Test
(VFT), were performed the day before surgery and third day
after surgery. At the same time, 20 healthy volunteers without
operation (age ≥65 years old, matched for education level and
gender) were selected as the control group to determine a normal
reference value of cognitive functions (cognitive functions were
assessed twice at 3-day intervals).
These tests were administered by one experienced research
staff member who received one-on-one training and finished
10 independent assessments before the start of the study. She
was blinded to the surgical procedure and blood samples results.
Frontiers in Behavioral Neuroscience | www.frontiersin.org 2October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 3
Zhou et al. Plasma CircRNA-089763 and POCD
FIGURE 1 | Experiment flow chart.
Patients were first screened with MMSE to exclude severe
cognitive impairment. The MMSE assesses a wide range of
domains, including attention, language, memory, orientation,
and visuospatial proficiency; it requires about 6 to 10 min to
administer. CTT is frequently utilized to assess the capability of
attention conversion; numbers were placed in circles with the
background colors of yellow or red, and subjects were required
to connect the numbers in numerical order. Completion time
was recorded as the index of attention conversion (the longer
the time, the lower the efficiency of attention conversion). DST
was used to assess the ability of focusing the transient memory,
mind, and anti-jamming; the subjects were asked to repeat digits
immediately after the investigator; the number of digits increased,
and the highest number was taken as the score. The CDT includes
an already predrawn circle. The most common administration
instructions are “Please draw a clock face, placing all the numbers
on it. Now set the time to 10 past 11.” VFT evaluates the ability
to form and fluently utter words. The test consists of three parts.
The first two parts consist in listing as many words as possible
in 60 s (usually names of objects). In the third part the objective
is to list in 60 s as many words as possible that belong to a
given phonetic category. In the present study these categories
were names of animals (category 1), names of sharp objects
(category 2), and words beginning with the letter J (category
3). The result of the test is the number of correct words listed
for each of the categories. Participants were given the following
instructions: “Now I want to see how many different animals
you can name. You will have 60 s. When I say, ‘Begin,’ say the
animal names as fast as you can.” Fluency was the total number
of animals named in 60 s.
According to the International Study of Postoperative
Cognitive Dysfunction guidelines (Moller et al., 1998), the
“Z-score method” was applied to determine whether enrolled
patients had POCD. Formula: Z= (1X−1XC)/SD1XC.1Xwas
the difference between preoperative and postoperative cognitive
test scores in the operation group, while 1XC referred to the
average value of the difference in the same scale in the control
group. SD(1XC)was the standard deviation of the difference
between the same scale in the control group. The patients were
considered to have POCD when there were at least two |Z| scales
greater than 1.96, and thus were divided into the POCD group
and non-POCD (NPOCD) group.
Data Collection
Demographic and intraoperative data were collected, such as
age, education time, weight, height, body mass index (BMI),
anesthesia methods, operative time, intraoperative blood loss,
intraoperative rehydration, cognitive function assessment scores
of patients at 1 day before and 3 days after operation, and VAS on
the third day after surgery. All fasting peripheral venous blood
specimens were collected in anticoagulant tubes with EDTA-K2
1 day before surgery and 3 days after surgery. After mixing the
specimens upside down, they were placed at room temperature
for 1–2 h and then centrifuged at 4◦C at 3,000 rpm for 15 min.
The upper plasma sample was gently pipetted with a RNase-Free
pipette, dispensed in a 1.5 ml RNase-Free cryotube, and stored at
−80◦C until further analysis.
Plasma CircRNA Detection
In accordance with the manufacturer’s instructions, the preserved
plasma was thawed at room temperature. Total RNA was
extracted by lysate MZA reagent (TIANGEN, China), after which
900 µl of lysate MZA reagent was added per 200 µl of plasma,
and from each specimen, a total 800 µl of plasma was extracted.
Next, the NanoDrop-2000 was used to detect the quality of
the RNA sample, 260/280 optical density ratios >1.80 (good
quality). Total RNA content ≥1,000 ng indicated that the quality
was acceptable for further experiments. Among the acceptable
plasma samples, the total RNA concentration of three patients
in the POCD group and four patients in the NPOCD group
was too low, and thus their samples were excluded, leaving 46
patients in the NPOCD group and 19 patients in the POCD group
for circRNA-089763 analysis. The random primer method was
used to reverse transcribe cDNA. Using cDNA as a template,
quantitative real-time polymerase chain reaction (qRT-PCR) was
conducted according to the instructions of the SYBR Green PCR
Frontiers in Behavioral Neuroscience | www.frontiersin.org 3October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 4
Zhou et al. Plasma CircRNA-089763 and POCD
TABLE 1 | β-actin and circRNA-089763 primers.
Gene Primer sequence Tm (◦C) GC (%)
β-actin F:50CTCTTCCAGCCTTCCTTCCT3057.45 55
R:50AGCACTGTGTTGGCGTACAG3057.45 55
circRNA-089763 F:50GGTGATGAGGAATAGTGTAAGG3056.26 45
R:50ACCTCCATCATCACCTCAACC3057.80 52
Master Mix Kit (QIAGEN). Reaction system: 2xSYBR Green PCR
Master Mix 10 µl, QN ROX Reference Dye 2 µl, PCR Forward
Primer (10 µM) 1 µl, PCR Reverse Primer (10 µM) 1 µl, 3 µl of
cDNA solution, and enough RNase-free water to reach a total of
20 µl. Reaction conditions: 95.0◦C 10 min 1 cycle; 95.0◦C 15 s,
60.0◦C 1 min, 50 cycles; 95.0◦C 15 s, 60.0◦C 1 min, 1 cycle; and
60.0◦C 30 s, 1 cycle. Taking β-actin as an internal reference, the
Delta-delta Ct method, F (Fold change) = 2−MM Ct , was analyzed
for circRNA expression levels. β-actin and circRNA-089763
primer were designed by primer 5.0 software and synthesized by
the Beijing Genomics Institute (Table 1).
Statistical Methods
Statistical analyses were conducted using SPSS Statistics 17.0
(IBM corp.; Armonk, NY, United States). Patients were split into
POCD and NPOCD groups according to the “Z-score method.”
Normally distributed continuous data were expressed in the form
of mean ±standard deviation, and Student’s t-test (unpaired
t-test with Welch’s correction) was used for data analysis. The
categorical data were expressed as frequencies or percentages
and analyzed by Pearson chi-square (χ2) test or Fisher’s exact
probability test. Binary logistic regression analysis was used
to analyze the influence factors for POCD. All statistical tests
were two-tailed, and p<0.05 indicated that the difference was
statistically significant.
RESULTS
Patient Information
In this study, 72 patients met the inclusion criteria and
participated in the research. Meanwhile, 20 healthy volunteers
who did not undergo operation were recruited as the control
group. As shown in Table 2, there were no statistical differences in
the basic data (gender, age, years of education, and BMI) between
the control and non-cardiac elderly surgery groups (test group)
(unpaired t-test with Welch’s correction or χ2test).
The cognitive function scores of volunteers at intervals of
3 days and SD(1XC)are shown in Table 3. In the volunteers’
two VFT tests, the score of the second test was significantly
increased compared with that of the first test (t= 3.376, p= 0.003).
According to “Z-score method” (Moller et al., 1998), POCD was
defined as the presence of at least two cognitive function scales of
|Z|≥1.96. As shown in Table 4, there were 22 patients meeting
this definition, yielding a POCD incidence of 30.56%.
As illustrated in Table 5, the main demographic characteristics
and intraoperative conditions of the POCD and NPOCD groups
were summarized, and there were significantly older ages
TABLE 2 | The demographics data of the control and test groups.
Demographics of
patients
Control group
(n= 20)
Test group
(n= 72)
P-value
Gender (male/female) 13/7 43/29 0.669
Age (years) 70.45 ±3.15 71.15 ±5.95 0.853
Years of education 6.55 ±2.38 6.53 ±2.75 0.753
BMI (kg·m−2) 23.98 ±2.95 24.31 ±2.94 0.355
MMSE scores 1 day
before surgery
28.70 ±1.03 26.90 ±1.54 0.051
CTT scores 1 day
before surgery
35.90 ±3.46 36.28 ±5.49 0.937
DST scores 1 day
before surgery
7.76 ±1.64 7.71 ±1.46 0.984
CDT scores 1 day
before surgery
3.62 ±0.50 3.19 ±0.57 0.228
VFT scores 1 day
before surgery
26.81 ±3.70 28.82 ±4.22 0.054
BMI, body mass index; MMSE, Mini-Mental State Examination; CTT, Color Trail
Test; DST, Digit Span Test; CDT, Clock Drawing Test; VFT, Verbal Fluency Test.
TABLE 3 | The cognitive function scores of volunteers.
Cognitive assessment Volunteers as control group (n= 20)
1st assessment 2nd assessment SD(1XC)
MMSE 28.70 ±1.03 28.35 ±1.35 0.51
CTT 35.90 ±3.46 34.76 ±4.60 1.15
DST 7.76 ±1.64 8.14 ±1.11 1.04
CDT 3.62 ±0.50 3.48 ±0.51 0.43
VFT 26.81 ±3.79 29.14 ±3.90* 1.03
vs. 1st assessment, *p <0.05.
(t= 5.971, p<0.001), less years of education (t= 2.449, p= 0.017),
higher ASA grades (χ2= 14.726, p<0.001), more intraoperative
blood loss (t= 3.196, p= 0.002), and higher VAS scores (t= 10.45,
p<0.001) in the POCD group than in the NPOCD group. No
differences in gender, BMI, anesthesia time, surgical time, or
intraoperative fluid volume were observed between the POCD
and NPOCD groups (p>0.05).
CircRNA Expression Level
As shown in Figure 2, there was no significant difference in
relative circRNA-089763 plasma level 1 day before the operation
(t= 1.772, p= 0.081), but the relative level of circRNA-089763 in
the POCD group was significantly higher than in the NPOCD
group on the third day after surgery (fold change = 2.41); the
difference was statistically significant (t= 4.711, p<0.001).
As shown in Table 6, the binary logistic regression analysis
used to analyze the independent predictive factors for POCD
showed that age, intraoperative blood loss, and the relative
circRNA-089763 level at postoperative 3 days were independently
associated with POCD (OR: 1.32, 95% CI: 1.114–1.565, p= 0.001;
OR: 1.017, 95% CI: 1.004–1.03, p= 0.011); OR: 2.75, 95% CI:
1.261–5.999, p= 0.011).
Frontiers in Behavioral Neuroscience | www.frontiersin.org 4October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 5
Zhou et al. Plasma CircRNA-089763 and POCD
TABLE 4 | The cognitive function scores in NPOCD and POCD groups.
Cognitive assessments NPOCD (n= 50) POCD (n= 22)
1 day before surgery 3 day after surgery 1 day before surgery 3 day after surgery
MMSE 26.98 ±1.71 25.62 ±1.60*26.73 ±1.12 23.09 ±1.44*#
CTT 36.10 ±5.85 40.84 ±6.93*36.68 ±4.82 43.55 ±6.16*#
DST 7.78 ±1.38 7.32 ±1.27*7.55 ±1.68 6.27 ±1.08*#
CDT 3.12 ±0.59 2.70 ±0.86*3.36 ±0.49 1.95 ±0.72*#
VFT 28.94 ±4.18 27.78 ±4.01 28.36 ±4.24 21.05 ±3.67*#
vs 1 day before surgery, *p <0.05, vs. NPOCD group, #p<0.05.
TABLE 5 | Basic information of NPOCD and POCD groups.
Characteristics of patients NPOCD group (n= 50) POCD group (n= 22) t/χ2-value P-value
Gender (male/female) 29/21 14/8 0.035 0.851
Age (years) 68.86 ±4.52 76.36 ±5.72 5.971 <0.001
Years of education (years) 7.04 ±2.81 5.36 ±2.32 2.449 0.017
BMI (kg·m−2) 24.00 ±2.88 24.99 ±3.11 1.312 0.194
ASA (I/II/III) 18/23/9 2/5/15 14.726 <0.001
Anesthesia time (min) 217.90 ±37.93 222.27 ±35.98 0.458 0.649
Surgical time (min) 189.60 ±36.01 191.41 ±31.42 0.204 0.839
Intraoperative blood loss (ml) 228.80 ±81.68 296.59 ±85.71 3.196 0.002
Intraoperative fluid volume (ml) 1579.00 ±340.25 1488.64 ±253.51 1.115 0.269
VAS scores at postoperative 3 day 1.88 ±0.79 4.14 ±0.92 10.45 <0.001
DISCUSSION
With the rapid development of medical technology, the number
of elderly surgical patients is also increasing (Etzioni et al.,
2003). At the same time, the number of patients with POCD
has gradually increased, and POCD has become a research
hot spot in perioperative medicine (Liu and Leung, 2000).
POCD refers to reduced learning, memory, attention, executive
function, and language fluency after surgery. POCD is different
from postoperative delirium (POD), as POD is accompanied
by a change in consciousness, while POCD is not (O’Brien
et al., 2017). Therefore, the participants were screened for
FIGURE 2 | The relative level of plasma circRNA-089763 in the two groups.
The data are shown as the means ±SD. vs NPOCD in postoperative 3d,
P<0.001 in the legend of Figure 2.
POD according to the standards for POD diagnosis (Confusion
Assessment Method for the Intensive Care Unit scale, CAM-
ICU), and none of the participants met criteria for POD
in our study. At present, the clinical diagnosis of POCD
lacks a unified standard; the International Research Center
ISPOCD (Moller et al., 1998) approved the “Z-score method”
as the best way to judge. In this study, five neuropsychological
scales were used to evaluate cognitive function in terms of
attention, executive ability, memory learning ability, visual spatial
function, and language fluency. During the same period, 20
volunteers were recruited as the control group, and cognitive
function assessment was completed. As shown in Table 3,
in the volunteers’ two VFT tests, the score of the second
test was significantly increased compared with that of the
first test, possibly because the previous memory made the
second vocabulary expression more fluent, which was caused
by the learning effect. Therefore, we recruited volunteers to
evaluate the neuropsychological scale and used their ratings
as the benchmark to exclude the role of learning effect,
thus increasing the credibility of the POCD diagnosis. All
enrolled patients were assessed by cognitive scales; Zscores
TABLE 6 | Results of binary logistic regression analysis.
Parameter OR 95%CI P-value
Age 1.320 1.114–1.565 0.001
Years of education 0.693 0.453–1.061 0.092
Intraoperative blood loss 1.017 1.004–1.030 0.011
The relative level of circRNA-089763 at
postoperative 3 day
2.750 1.261–5.999 0.011
Frontiers in Behavioral Neuroscience | www.frontiersin.org 5October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 6
Zhou et al. Plasma CircRNA-089763 and POCD
were calculated, and when at least two scales of Z≥1.96,
POCD was diagnosed.
There were 22 POCD patients according to the “Z-score
method.” In this study, in accordance with the concept of
enhanced recovery after surgery (ERAS), most patients may be
discharged from the hospital on the seventh day after surgery.
Thus, our study evaluated cognitive function on the third day
after surgery. This may be different from the test time window of
other POCD-related studies, and long-term follow-up of patients
is required in future studies to improve cognitive function
assessment. In the present study, the 30.56% incidence of POCD
on the third day after non-cardiac surgery was lower than in
comparable studies (Li et al., 2012;Jiang et al., 2015). Many
of the findings in this field vary significantly from study to
study, depending on different populations, assessment criteria,
intervening measures, surgery types, and other factors. Age
was found to be related to the occurrence of POCD in this
study, and some studies have also confirmed that age is an
independent risk factor for POCD (Griebe et al., 2014). The
less years of education and knowledge reserve a patient has,
the higher the incidence of POCD (Scott et al., 2017). In the
process of surgery, a large amount of blood loss led to circulatory
fluctuations and insufficient blood supply to the brain, thereby
affecting oxygen supply, brain cell metabolism, and postoperative
cognitive function (Zhang et al., 2019). Postoperative pain was
related to the occurrence of POCD, and while the relevant
mechanism is still unclear at present, it may involve the stress
reaction of the body due to pain, inciting a state of anxiety and
depression. Some studies have confirmed that effective analgesia
can reduce the occurrence of POCD (Wang et al., 2014).
Currently, the occurrence of POCD is related to various
peripheral blood biological markers, such as S-100βprotein,
neuron-specific enolase (NSE), and glial cell line-derived
neurotrophic factor (GDNF), but there is still much controversy
about the relationship of these markers with POCD (McDonagh
et al., 2010;Duan et al., 2018). Therefore, there is still a lack of
sensitive and specific biological markers in clinical practice. In the
human genome, protein-coding genes account for less than 2%,
while non-coding RNAs account for the majority of the genome,
playing an important role in the complexity of higher eukaryotes
and the disease mechanisms (Mattick, 2001). CircRNA is a class
of non-coding RNA with a sponge effect on miRNA, capable
of simultaneously adsorbing multiple miRNAs and releasing the
inhibitory effect of miRNAs on target genes, thus increasing
target gene expression (Hansen et al., 2013). CircRNA is highly
stable, conservative, and specific to cell tissues and widely exists
in brain, liver, and kidney tissues, as well as plasma exosomes,
saliva, and other body fluids. Studies have found that circRNA
is involved in the occurrence and development of neurological
diseases (Chen et al., 2016), and circRNA is expected to become
a new biomarker for neurological diseases, but to our knowledge,
there are currently no reports of circRNAs related to POCD. In
our previous experiment (Wang et al., 2019), circRNA expression
in the plasma exosomes of POCD patients after coronary artery
bypass grafting was screened by circRNA gene microarray
analysis, and the relative level of circRNA-089763 was found
to be significantly increased by qRT-PCR validation. Structural
prediction analysis showed that circRNA-089763 could sponge
10 kinds of miRNAs. CircRNA-miRNA-mRNA network analysis
also found that circRNA-089763 might bind to miR-6769b-3p,
miR-7111-3p, and miR-670-3p at the same time. The three kinds
of microRNAs might jointly regulate insulin-like growth factor
binding protein-5 (IGFBP5) target genes. It has been reported
that the IGFBP5 gene is associated with amyloid-β(Aβ) and
cognitive functions (Barucker et al., 2015). CircRNA-089763
also adsorbs miR-6798-3p and miR-3684, which may commonly
regulate target genes of tyrosine 3-monooxygenase/tryptophan
5-monooxygenase activation protein gamma genes (YWHAG)
and stanniocalcin 1 (STC-1). Research found that STC-1 in the
CSF can be used as a biomarker for the differential diagnosis
of dementia (Shahim et al., 2017). Ramocki et al. (2010) found
that changes in cognitive function and behavioral ability were
associated with abnormal expression of the YWHAG gene.
Therefore, we speculated that the pathogenesis of POCD might
be related to the abnormal circRNA-089763 level caused by
perioperative stimuli.
In our previous experiment, we found that it was difficult
to collect and extract exosomes due to the need for at least
20 ml of whole blood and experimental equipment, but in
clinical work, peripheral blood samples are easy to collect. The
mechanism by which POCD occurs after cardiac and non-
cardiac surgery is basically the same, but there is a difference
in POCD incidence. Exosomes are secreted by most cell types
from small membranous vesicles of endocytic origin and can be
detected in the blood (Li et al., 2015). Exosomes are present in
plasma, and the substances extracted from plasma contain the
circRNA-089763 from exosomes. Therefore, this study aimed to
investigate whether the level of circRNA-089763 in the plasma
(not only exosomes of plasma) of elderly patients undergoing
non-cardiac surgery exhibited the same changes. Our results
showed that patients who developed POCD also had significantly
upregulated circRNA-089763 plasma levels on the third day
after surgery, which was similar to the result of our preliminary
experiment (Wang et al., 2019). We further analyzed and found
that the occurrence of POCD was correlated with the level
of plasma circRNA-089763 on the third day after operation.
Thus, we have reasons to believe that the relative level of
plasma circRNA-089763 is involved in the cognitive function
changes. In Netto Martins Back et al.’s (Netto et al., 2018)
study, the researchers confirmed that damage to mitochondrial
function was associated with POCD. Moreover, the preliminary
experiment found that circRNA-089763 was derived from the
mitochondrial genome. The damaged mitochondrial function is
part of the pathophysiological mechanism of POCD, which will
provide a new direction for the study of POCD. Therefore, in
non-cardiac surgery, the relative level of plasma circRNA-089763
is increased with POCD, but the mechanism involved remains
unclear. It may be related to the effect of circRNA-089763 on
IGFBP5, STC, and YWHAG expression by adsorption of the
corresponding miRNAs, thereby indirectly regulating cognitive
function, a mechanism that needs to be further confirmed in
subsequent studies.
Although the mechanism of POCD is still not clear at
present, many related studies are in progress. Moreover, a large
Frontiers in Behavioral Neuroscience | www.frontiersin.org 6October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 7
Zhou et al. Plasma CircRNA-089763 and POCD
number of studies have explored how circRNA is involved in
the occurrence and development of diseases. In the clinical
setting, large sample, multi-center observational studies can be
undertaken, and further studies at the gene level can be confirmed
in animal and cell-based experiments. It is hoped that this
study can provide new ideas and direction for the discussion of
biomarkers and their mechanisms in POCD in the future.
DATA AVAILABILITY STATEMENT
The raw data supporting the conclusions of this article will be
made available by the authors, without undue reservation.
ETHICS STATEMENT
The studies involving human participants were reviewed and
approved by the protocol was reviewed and approved by
the Ethics Committee of Clinical trial in Affiliated Hospital
of Southwest Medical University. The patients/participants
provided their written informed consent to participate in
this study.
AUTHOR CONTRIBUTIONS
HZ, FL, WY, MW, and XW conceptualized and designed this
study. XZ and MW contributed to data analyses. HZ drafted
this manuscript. All authors contributed to interpret the data,
revised the manuscript, approved the final content, and read and
approved the final manuscript.
FUNDING
This work was supported by the Projects of the National
Natural Science Foundation of China (Grant No. 81271478),
Department of Science and Technology of Sichuan Province
(Grant No. 20YYJC2046).
ACKNOWLEDGMENTS
We thank LetPub (www.letpub.com) for their linguistic
assistance during the preparation of this manuscript.
REFERENCES
Barucker, C., Sommer, A., Beckmann, G., Eravci, M., Harmeier, A., Schipke, C. G.,
et al. (2015). Alzheimer amyloid peptide aβ42 regulates gene expression of
transcription and growth factors. J. Alzheimers Dis. 44, 613–624. doi: 10.3233/
JAD-141902
Chen, B. J., Mills, J. D., Takenaka, K., Bliim, N., Halliday, G. M., and Janitz, M.
(2016). Characterization of circular RNAs landscape in multiple system atrophy
brain. J. Neurochem. 139, 485–496. doi: 10.1111/jnc.13752
Duan, X., Zhu, T., Chen, C., Zhang, G., Zhang, J., and Wang, L. (2018). Serum
glial cell line-derived neurotrophic factor levels and postoperative cognitive
dysfunction after surgery for rheumatic heart disease. J. Thorac. Cardiovasc.
Surg. 155, 958.e1–965.e1. doi: 10.1016/j.jtcvs.2017.07.073
Dube, U., Del-Aguila, J. L., Li, Z., Budde, J. P., Jiang, S., Hsu, S., et al. (2019).
An atlas of cortical circular RNA expression in Alzheimer disease brains
demonstrates clinical and pathological associations. Nat. Neurosci. 22, 1903–
1912. doi: 10.1038/s41593-019- 0501-5
Etzioni, D. A., Liu, J. H., Maggard, M. A., and Ko, C. Y. (2003). The aging
population and its impact on the surgery workforce. Ann. Surg. 238, 170–177.
doi: 10.1097/01.SLA.0000081085.98792.3d
Griebe, M., Amann, M., Hirsch, J. G., Achtnichts, L., Hennerici, M. G., Gass, A.,
et al. (2014). Reduced functional reserve in patients with age-related white
matter changes: a preliminary FMRI study of working memory. PLoS One
9:e103359. doi: 10.1371/journal.pone.0103359
Hansen, T. B., Jensen, T. I., Clausen, B. H., Bramsen, J. B., Finsen,
B., Damgaard, C. K., et al. (2013). Natural RNA circles function as
efficient microRNA sponges. Nature 495, 384–388. doi: 10.1038/nature1
1993
Hu, Z., Ou, Y., Duan, K., and Jiang, X. (2010). Inflammation: a bridge between
postoperative cognitive dysfunction and Alzheimer’s disease. Med. Hypotheses
74, 722–724. doi: 10.1016/j.mehy.2009.10.040
Hua, F., Yang, C., and Zhu, B. (2014). Leptin: new hope for the treatment of post-
operative cognitive dysfunction. Med. Sci. Monit. 20, 866–868. doi: 10.12659/
MSM.890878
Jiang, J., Chen, Z., Liang, B., Yan, J., Zhang, Y., Xu, H., et al. (2015). The change
of circulating insulin like growth factor binding protein 7 levels may correlate
with postoperative cognitive dysfunction. Neurosci. Lett. 588, 125–130. doi:
10.1016/j.neulet.2014.12.046
Li, X., Yang, L., and Chen, L. L. (2018). The biogenesis, functions, and challenges of
circular RNAs. Mol. Cell 71, 428–442. doi: 10.1016/j.molcel.2018.06.034
Li, Y., Zheng, Q., Bao, C., Li, S., Guo, W., Zhao, J., et al. (2015). Circular RNA is
enriched and stable in exosomes: a promising biomarker for cancer diagnosis.
Cell. Res. 25, 981–984. doi: 10.1038/cr.2015.82
Li, Y. C., Xi, C. H., An, Y. F., Dong, W. H., and Zhou, M. (2012). Perioperative
inflammatory response and protein S-100βconcentrations - relationship with
post-operative cognitive dysfunction in elderly patients. Acta Anaesthesiol.
Scand. 56, 595–600. doi: 10.1111/j.1399-6576.2011.02616.x
Liu, L. L., and Leung, J. M. (2000). Predicting adverse postoperative outcomes in
patients aged 80 years or older. J. Am. Geriatr. Soc. 48, 405–412. doi: 10.1111/j.
1532-5415.2000.tb04698.x
Mattick, J. S. (2001). Non-coding RNAs: the architects of eukaryotic complexity.
EMBO Rep. 2, 986–991. doi: 10.1093/embo-reports/kve230
McDonagh, D. L., Mathew, J. P., White, W. D., Phillips-Bute, B., Laskowitz,
D. T., Podgoreanu, M. V., et al. (2010). Cognitive function after major
noncardiac surgery, apolipoprotein E4 genotype, and biomarkers of brain
injury. Anesthesiology 112, 852–859. doi: 10.1097/ALN.0b013e3181d31fd7
Moller, J. T., Cluitmans, P., Rasmussen, L. S., Houx, P., Rasmussen, H., Canet,
J., et al. (1998). Long-term postoperative cognitive dysfunction in the elderly
ISPOCD1 study. ISPOCD investigators. International study of post-operative
cognitive dysfunction. Lancet 351, 857–861. doi: 10.1016/s0140-6736(97)
07382-0
Netto, M. B., de Oliveira Junior, A. N., Goldim, M., Mathias, K., Fileti, M. E.,
da Rosa, N., et al. (2018). Oxidative stress and mitochondrial dysfunction
contributes to postoperative cognitive dysfunction in elderly rats. Brain Behav.
Immun. 73, 661–669. doi: 10.1016/j.bbi.2018.07.016
O’Brien, H., Mohan, H., Hare, C. O., Reynolds, J. V., and Kenny, R. A. (2017). Mind
over matter? The hidden epidemic of cognitive dysfunction in the older surgical
patient. Ann. Surg. 265, 677–691. doi: 10.1097/SLA.0000000000001900
Ramocki, M. B., Bartnik, M., Szafranski, P., Kołodziejska, K. E., Xia, Z., Bravo, J.,
et al. (2010). Recurrent distal 7q11.23 deletion including HIP1 and YWHAG
identified in patients with intellectual disabilities, epilepsy, and neurobehavioral
problems. Am. J. Hum. Genet. 87, 857–865. doi: 10.1016/j.ajhg.2010.10.019
Rundshagen, I. (2014). Postoperative cognitive dysfunction. Dtsch. Arztebl. Int.
111, 119–125. doi: 10.3238/arztebl.2014.0119
Scott, J. E., Mathias, J. L., Kneebone, A. C., and Krishnan, J. (2017). Postoperative
cognitive dysfunction and its relationship to cognitive reserve in elderly total
Frontiers in Behavioral Neuroscience | www.frontiersin.org 7October 2020 | Volume 14 | Article 587715
fnbeh-14-587715 October 3, 2020 Time: 17:30 # 8
Zhou et al. Plasma CircRNA-089763 and POCD
joint replacement patients. J. Clin. Exp. Neuropsychol. 39, 459–472. doi: 10.1080/
13803395.2016.1233940
Sekar, S., Cuyugan, L., Adkins, J., Geiger, P., and Liang, W. S. (2018). Circular RNA
expression and regulatory network prediction in posterior cingulate astrocytes
in elderly subjects. BMC Genomics 19:340. doi: 10.1186/s12864-018-4670-5
Shahim, P., Blennow, K., Johansson, P., Svensson, J., Lista, S., and Hampel, H.
(2017). Cerebrospinal fluid stanniocalcin-1 as a biomarker for Alzheimer’s
disease and other neurodegenerative disorders. Neuromol. Med. 19, 154–160.
doi: 10.1007/s12017-016- 8439-1
Tay, Y., Rinn, J., and Pandolfi, P. P. (2014). The multilayered complexity of ceRNA
crosstalk and competition. Nature 505, 344–352. doi: 10.1038/nature12986
Wang, M., Su, P., Liu, Y., Zhang, X., Yan, J., An, X., et al. (2019). Abnormal
expression of circRNA_089763 in the plasma exosomes of patients with post-
operative cognitive dysfunction after coronary artery bypass grafting. Mol. Med.
Rep. 20, 2549–2562. doi: 10.3892/mmr.2019.10521
Wang, W., Wang, Y., Wu, H., Lei, L., Xu, S., Shen, X., et al. (2014).
Postoperative cognitive dysfunction: current developments in mechanism
and prevention. Med. Sci. Monit. 20, 1908–1912. doi: 10.12659/MSM.89
2485
Wang, Z., Xu, P., Chen, B., Zhang, Z., Zhang, C., Zhan, Q., et al. (2018). Identifying
circRNA-associated-ceRNA networks in the hippocampus of Aβ1-42-induced
Alzheimer’s disease-like rats using microarray analysis. Aging 10, 775–788.
doi: 10.18632/aging.101427
Zhang, J., Liu, G., Zhang, F., Fang, H., Zhang, D., Liu, S., et al. (2019).
Analysis of postoperative cognitive dysfunction and influencing factors of
dexmedetomidine anesthesia in elderly patients with colorectal cancer. Oncol.
Lett. 18, 3058–3064. doi: 10.3892/ol.2019.10611
Zhang, S., Zhu, D., Li, H., Li, H., Feng, C., and Zhang, W. (2017). Characterization
of circRNA-associated-ceRNA networks in a senescence-accelerated mouse
prone 8 brain. Mol. Ther. 25, 2053–2061. doi: 10.1016/j.ymthe.2017.06.009
Zhao, Y., Alexandrov, P. N., Jaber, V., and Lukiw, W. J. (2016). Deficiency in the
ubiquitin conjugating enzyme UBE2A in Alzheimer’s disease (AD) is linked to
deficits in a natural circular miRNA-7 sponge (circRNA; ciRS-7). Genes 7:116.
doi: 10.3390/genes7120116
Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Copyright © 2020 Zhou, Li, Ye, Wang, Zhou, Feng, Liu and Wang. This is an
open-access article distributed under the terms of the Creative Commons Attribution
License (CC BY). The use, distribution or reproduction in other forums is permitted,
provided the original author(s) and the copyright owner(s) are credited and that the
original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.
Frontiers in Behavioral Neuroscience | www.frontiersin.org 8October 2020 | Volume 14 | Article 587715
Available via license: CC BY
Content may be subject to copyright.
