ArticlePDF Available

Unravelling the taxonomy of an interstitial fish radiation: Three new species of Gouania (Teleostei: Gobiesocidae) from the Mediterranean Sea and redescriptions of G. willdenowi and G. pigra

Authors:

Abstract and Figures

The clingfish (Gobiesocidae) genus Gouania (Nardo 1833) is endemic to the Mediterranean Sea and inhabits, unlike any other vertebrate species in Europe, the harsh intertidal environment of gravel beaches. Following up on a previous phylogenetic study, we revise the diversity and taxonomy of this genus, by analysing a comprehensive set of morphological (meristics, morphometrics, micro computed tomography imaging), geographical and genetic (DNA‐barcoding) data. We provide descriptions of three new species, G. adriatica sp. nov., G. orientalis sp. nov., G. hofrichteri sp. nov. as well as re‐descriptions of G. willdenowi (Risso 1810) and G. pigra (Nardo 1827) and assign neotypes for the latter two species. In addition to elucidating the complex taxonomic situation of Gouania, we discuss the potential of this enigmatic clingfish genus for further ecological, evolutionary and biodiversity studies that might unravel even more diversity in this unique Mediterranean fish radiation.
Content may be subject to copyright.
REGULAR PAPER
Unravelling the taxonomy of an interstitial fish radiation: Three
new species of Gouania (Teleostei: Gobiesocidae) from the
Mediterranean Sea and redescriptions of G. willdenowi and
G. pigra
Maximilian Wagner
1,2
| Marcelo Kovacˇi
c
3
| Stephan Koblmüller
1
1
Institute of Biology, University of Graz, Graz,
Austria
2
Department of Biology, University of
Antwerp, Antwerp, Belgium
3
Natural History Museum Rijeka, Rijeka,
Croatia
Correspondence
Maximilian Wagner, Institute of Biology,
University of Graz, Universitätsplatz 2, 8010
Graz, Austria.
Email: maximilian.wagner@uni-graz.at
Stephan Koblmüller, Institute of Biology,
University of Graz, Universitätsplatz 2, 8010
Graz, Austria.
Email: stephan.koblmueller@uni-graz.at
Funding information
Heinrich-Jörg-Foundation (University of Graz);
Hrvatska Zaklada za Znanost (HR), Grant/
Award Number: IP-2016-06-9884; Hrvatska
Zaklada za Znanost (HR), Grant/Award
Number: IP-2016-06-5251; Österreichische
Forschungsgemeinschaft; Österreichischen
Akademie der Wissenschaften; University of
Graz (KUWI); Croatian Science Foundation
Abstract
The clingfish (Gobiesocidae) genus Gouania Nardo, 1833 is endemic to the Mediter-
ranean Sea and inhabits, unlike any other vertebrate species in Europe, the harsh
intertidal environment of gravel beaches. Following up on a previous phylogenetic
study, we revise the diversity and taxonomy of this genus by analysing a comprehen-
sive set of morphological (meristics, morphometrics, microcomputed tomography
imaging), geographical and genetic (DNA-barcoding) data. We provide descriptions of
three new species, G. adriatica sp. nov.,G. orientalis sp. nov. and G. hofrichteri
sp. nov., as well as redescriptions of G. willdenowi (Risso, 1810) and G. pigra (Nardo,
1827) and assign neotypes for the latter two species. In addition to elucidating the
complex taxonomic situation of Gouania, we discuss the potential of this enigmatic
clingfish genus for further ecological, evolutionary and biodiversity studies that
might unravel even more diversity in this unique Mediterranean fish radiation.
KEYWORDS
blunt-snouted clingfish, cryptobenthic fish, DNA-barcoding, intertidal, pebble beach
1|INTRODUCTION
Characterized by a cryptic lifestyle, a small size and a strong associa-
tion to the benthos, cryptobenthic fishes are among the least stud-
ied marine vertebrates on this planet (Brandl et al., 2018). Their
secretive ecology entails major problems for researchers collecting
these fishes (Ackerman & Bellwood, 2000; Smith-Vaniz et al., 2006),
typically confining systematic and taxonomical studies to the investi-
gation of only a few individuals (e.g., Hastings & Conway, 2017).
Above all, many cryptobenthic taxa contain morphologically similar
or, at least at first glance, identical species, such that their overall
biodiversity is drastically underestimated, even in considerably well-
studied groups or geographic regions (e.g., Conway et al., 2014;
Tornabene et al., 2015; Wagner et al., 2019; Winterbottom
et al., 2014). However, the inclusion of molecular methods in classic
taxonomic studies has proven to be particularly effective for over-
coming these obstacles and in recent years genetic data have
become a key tool for resolving phylogenetic relationships among
and within cryptobenthic taxa (e.g., Almada et al., 2008; Conway
et al., 2014; Henriques et al., 2002; Hoban & Williams, 2020;
Kovacˇi
cet al., 2020; Tornabene et al., 2010; Victor, 2013;
Winterbottom et al., 2014).
Received: 19 July 2020 Accepted: 23 September 2020
DOI: 10.1111/jfb.14558
FISH
This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2020 The Authors. Journal of Fish Biology published by John Wiley & Sons Ltd on behalf of Fisheries Society of the British Isles.
64 J Fish Biol. 2021;98:6488.wileyonlinelibrary.com/journal/jfb
This is also true for the family of clingfishes (Gobiesocidae) that
comprises around 180 species in 50 genera worldwide (Fricke
et al., 2020a). Clingfishes possess a thoracic adhesive disc that enables
them to tenaciously cling to even very slimy and rough surfaces
(Ditsche & Summers, 2019; Wainwright et al., 2013). The ability to
stick tight on different substrates can be considered as a prerequisite
for invading empty ecological niches and is a comparatively energy-
efficient way to persist in a high energetic environment, such as
the intertidal zone (Davison, 1985). Still, due to their cryptic ecology,
it is not surprising that the majority of recent genus and species
descriptions are based on the investigation of a few individuals only
(e.g., Conway et al., 2017b). Whereas some of these taxonomical and
systematic studies use more classical approaches (e.g., Fricke, 2014;
Fricke et al., 2010, 2015; Fricke & Wirtz, 2017, 2018; Sparks &
Gruber, 2012), many authors include more comprehensive morpho-
logical (e.g., micro-computed tomography imaging) and/or genetic
(e.g., single locus DNA barcoding) methods, which altogether turn out
to be effective tools for delineating clingfish species (e.g., Almada
et al., 2008; Bileceno
glu et al., 2017; Conway et al., 2014, 2017a
c, 2018, 2019; Fricke et al., 2017; Fujiwara et al., 2018; Fujiwara &
Motomura, 2018a,b, 2019, 2020; Henriques et al., 2002).
From the Mediterranean Sea, nine species in six genera have been
described and almost all of them exclusively inhabit upper littoral eco-
systems (Bileceno
glu et al., 2017; Hofrichter & Patzner, 2000). One of
them, Gouania willdenowi (Risso 1810), the only described species of
the genus Gouania Nardo, 1833, has stenoeciously adapted to life in
the interstitial of Mediterranean intertidal gravel beaches (Hofrichter &
Patzner, 2000; Wagner et al., 2019). The narrow interstitial space of
intertidal gravel beaches is characterized by extreme mechanical
(shearing forces) and tidal stressors (e.g., daily desiccation) and can be
considered as one of the most demanding environments for fishes (see
Supporting Information Video S1 for behavioural observation). Indeed,
among all known fishes, only Gouania and some Pacific gobies of the
genus Luciogobius Gill, 1859 have evolved adaptations to live in this
particular environment (Wagner et al., 2019; Yamada et al., 2009).
Gouania is endemic to the Mediterranean Sea and, compared to other
members of the subfamily Lepadogastrinae, is characterized by unique
morphological modifications (i.e., increased number of vertebrae, small
eyes, blunt snout) that can be linked to its interstitial lifestyle
(Hofrichter, 1995; Wagner et al., 2019). These morphological adapta-
tions include osteological changes of the median fins as well as the
axial skeleton and become particular prominent if directly compared to
the closely related sister genus Lepadogaster (Konstantinidis &
Conway, 2010; Leray, 1961). Despite their high abundance in suitable
habitats (up to 24 individuals/m
2
) (Hofrichter & Patzner, 2000), little is
known about the ecology or biology of the species. Hofrichter (1995)
and his subsequent work (Hofrichter & Patzner, 2000) were the first
studies to focus on the habitat utilization of G. willdenowi and present
important biological observations. For example, Hofrichter (1995) was
the first person to document the spawning behaviour of G. willdenowi
from Messina and rediscovered, after Facciolà (1887), a unique sexual
dimorphism with males showing seemingly perfused finger-like exten-
sions on the edges of the sucking disc. More recently, studies showed
that Gouania likely exhibits passive amphibious emergence behaviour,
an essential prerequisite for survival in the intertidal zone
(Bileceno
glu, 2015; Hofrichter & Patzner, 2000).
Thus far, phylogenetic and population genetic studies about
European clingfishes have been scarce and biased towards the genus
Lepadogaster (e.g., Henriques et al., 2002; Klein et al., 2016; Wagner
et al., 2017). Even though Hofrichter (1995) and Hofrichter and
Patzner (2000) document striking colour differences between
populations, the diversity within G. willdenowi has been overlooked for
more than two decades. In a previous study that included Gouania
from large parts of the Mediterranean Sea, we found two distinct mor-
photypes (stoutand slender) that live in sympatry in the Adriatic
and eastern Mediterranean basin, but five deeply divergent genetic
lineages, implying repeated independent evolution of convergent phe-
notypes within the last 5 million years (Wagner et al., 2019). The tax-
onomy of these genetically distinct lineages, however, remained
unresolved. In general, the taxonomic history within the genus
Gouania and all other Mediterranean clingfishes is complex and char-
acterized by independent descriptions and synonymizations in the
19th century (Briggs, 1955; reviewed by Hofrichter, 1995). Above all,
type material is lacking for G. willdenowi or for junior synonyms, such
as G. pigra, from the previously investigated geographical range.
We provide an integrative taxonomic approach, through combin-
ing morphological, geographical and genetic data, aimed at clarifying
the diversity and taxonomy of the intertidal clingfish genus Gouania.
We deliver descriptions of three new species of the genus and rede-
scriptions (including the designation of neotypes) for G. willdenowi and
the now resurrected G. pigra. Furthermore, we not only elucidate the
complex taxonomic situation of Gouania, but also discuss the potential
for further ecological and evolutionary studies that could unravel even
more diversity and open up thrilling questions regarding this enigmatic
endemic Mediterranean fish radiation.
2|MATERIALS AND METHODS
2.1 |Sampling and assessment of distribution
ranges
Sampling was conducted from 2014 to 2019 at 22 sites across the
Mediterranean Sea (see Figure 1a and Supporting Information
Table S1). Specimens were collected on intertidal pebble beaches by
pulling a bucket through the gravel, and in boulder fields between 0
and 1 m depth by lifting the stones and catching the fish using aquar-
ium nets. The fish were euthanized with an overdose of MS-222.
Species distribution ranges were assessed using already published
(Wagner et al., 2019) and newly generated DNA-barcode sequences,
as well as by morphological investigation of nontype specimens
deposited in the Natural History Museum Rijeka, Rijeka, Croatia (for
voucher numbers see Supporting Information Table S2). Additionally,
historical data on distribution and number of observations of G.
willdenowi were included in the analysis from records summarized by
Hofrichter (1995).
WAGNER ET AL.65
FISH
Ethical statement. Fish collection and euthanasia was carried out
with the approval of the Ethics Committee of the University of Graz
(permit No. GZ. 39/54/63 ex 2019/20), in accordance with the EU-
Directive 2010/63/EU, Annex IV and the Austrian Animal Experimen-
tation Ordinance, §20.
2.2 |Morphological investigation
Morphometric methods, measurements and definitions are modified
from Briggs (1955) to match the unique morphology of Gouania with
reduced dorsal and anal fins and the lack of a caudal peduncle. Stan-
dard length (SL) is measured from the median anterior point of the
upper lip to the base of the caudal fin (posterior end of the hypural
plate). Measurement data are given as a ratio in the text and as per-
centages of SL in Table 1. Other measurements in alphabetic order:
body depth at anus is vertical distance from anus to dorsal edge of
body; body depth at pectoral fins is vertical distance at pectoral-fin
origin from the bottom of the ventral disc to the dorsal edge of the
body; body width at anus is body width at anus in ventral view; body
width at pectoral fins is maximum body width at pectoral-fin origin
including the pectoral fin origin in dorsal view; caudal base depth at
origin of caudal fin is the vertical distance from the dorsal edge of the
body to the ventral edge of the body at the vertical through the mid-
point of origin of the caudal fin; caudal-fin length is the distance from
the base of the caudal fin at the midpoint (posterior end of the
hypural plate) to the most distant ray tip; disc length is the longitudi-
nal distance between the outermost edges of the thin membrane sur-
rounding heavier portions of the disc in ventral view; disc width is the
maximum disc width between the tips of the ventral rays in ventral
view; distance between the posterior margin of sucking disc and anus
is the distance between the outermost edge of the posterior thin
membrane of the disc and the anus in ventral view; head depth at
anterior sucking disc edge is the vertical distance from the dorsal edge
of the head to the ventral edge of the head at the anterior sucking
disc edge; head depth at orbit is the vertical distance from the dorsal
edge of the head to the ventral edge of the head at mideye; head
length is the distance from the median most anterior point of the
upper lip to the most posterior part of the opercular edge in lateral
view; head width at head invagination is the maximum body width at
head invagination in dorsal view; head width at orbit is the maximum
body width at mideye in dorsal view; head width at sucking disc
FIGURE 1 Geographical distribution ranges and ecology. (a) Distribution ranges of single Gouania species. The data shown are based on
genetic, morphological and field observations as well as on historical findings mentioned by Hofrichter (1995) (all his records combined the
species in G. willdenowi described here). Type and location of water currents are based on data provided by El-Geziry and Bryden (2010).
Numbers 123 indicate sampling sites (compare with Supporting Information Table S1). (b) Female Gouania pigra (Nardo, 1827) in the interstitial
of pebbles (photo taken in aquarium); see Supporting Information Video S1 for behaviour. (c) Trstenik (Pelješac, Croatia) a site where G. pigra,G.
adriatica sp. nov. and G. hofrichteri sp. nov. were found in sympatry. Photographs by M. Wagner
66 WAGNER ET AL.
FISH
TABLE 1 Morphometric characters (% SL) of Gouania described/redescribed species
Species G. adriatica sp. nov. G. orientalis sp. nov. G. hofrichteri sp. nov. G. pigra (Nardo, 1827) G. willdenowi (Risso, 1810)
Specimen Holotype Paratypes Holotype Paratypes Holotype Paratypes Neotype
Other
material Neotype
Other
material
Sex Male Males and
females
Male Males and
females
Male Males and
females
Female Males and
females
Male Males and
females
Number of specimens 1 9 1 9 1 9 1 9 1 9
Standard length (SL) in mm 41.41 22.9541.03 32.8 17.0937.53 30.35 20.6236.91 43.12 32.5839.48 46.11 31.1346.11
% standard length
Body depth at anus 15.3 12.916.2 14.0 12.715.2 11.0 9.111.7 12.3 11.313.5 11.3 12.513.8
Body depth at pectoral fins 15.7 11.214.8 13.0 11.614.4 10.1 9.510.9 11.5 10.611.8 12.2 11.413.4
Body width at anus 12.1 9.813.0 11.4 10.812.8 8.6 7.49.1 9.9 8.511.4 8.8 9.611.3
Body width at pectoral fins 16.8 13.716.6 14.5 14.215.7 12.3 10.312.4 11.8 11.513.2 12.9 13.915.8
Caudal base depth 12.6 10.113.5 13.0 11.414.1 9.2 8.210.4 9.5 9.010.8 11.3 11.513.0
Caudal fin length 16.3 13.916.4 15.0 14.217.5 12.1 11.513 11.7 11.112.7 14.2 13.515.5
Disc length 20.1 15.919.0 17.3 14.919.0 12.1 10.213.4 13.5 12.114.6 17.5 17.119.3
Disc width 22.3 16.319.0 18.5 1618.2 15.0 12.416.1 14.7 13.518.5 19.9 17.420.2
Distance between the posterior margin of
sucking disc and anus
25.1 22.726.1 21.9 20.224.2 28.0 2629.6 31.3 25.734.7 20.8 20.223.7
Head depth at anterior sucking disc edge 14.1 11.114.3 13.5 12.114.9 11.4 9.912.2 10.9 11.312.8 13.3 11.314.0
Head depth at orbit 12 8.812.2 10.0 9.410.8 8.7 7.39.3 8.5 8.09.8 11.0 9.412.4
Head length 30 26.229.4 28.8 25.028.9 21.6 18.923.4 19.5 20.122.9 26.8 24.328.8
Head width at head invagination 19.4 15.620.4 17.3 15.017.8 14.1 11.214.3 12.5 12.615.3 17.7 16.119.0
Head width at orbit 20.1 15.819.6 18.9 15.818.4 14.1 11.214.4 12.5 13.715.9 17.8 16.119.5
Head width at sucking disc anterior edge 20.6 17.723.7 20.4 18.321.3 16.0 14.117.3 15.6 14.218.4 19.6 19.021.9
Horizontal eye diameter 3.2 3.03.7 2.9 2.84.2 2.2 2.12.6 2.0 2.02.4 2.5 2.32.9
Interorbital distance 9.2 6.19.3 8.0 5.98.7 6.2 5.16.3 6.5 5.67.3 8.8 7.18.6
Pectoral fin length 10.7 8.711.3 9.0 8.210.3 5.9 5.46.4 5.8 5.67.5 9.2 8.69.3
Postanus length 41.3 38.142.2 43.5 35.543.9 43.4 41.852.6 42.5 42.446.6 39.5 39.942.3
Postorbital distance 18.5 15.118.3 17.5 15.218.1 13.4 1214.5 14.0 12.615.2 15.9 15.117.2
Preanus length 62.3 57.763.5 60.1 55.960.8 55.5 50.857.1 56.1 52.859.4 54.1 55.860.8
Predisc length 18.6 17.119.7 19.8 15.919.4 15.3 14.216.5 15.1 13.216.5 16.9 16.418.4
Preorbital distance 9.4 7.59.7 9.0 7.29.1 7.2 5.77.8 7.1 5.58.0 9.5 8.310.0
Prepectoral-fin length 28.2 25.128.5 27.8 24.728.2 22.1 19.523.7 22.2 19.523.4 26.6 24.428.4
Vertical eye diameter 4.3 3.44.1 3.0 2.54.3 2.6 2.02.7 2.9 2.32.9 3.3 2.63.1
Note: Values for each species in the table presented as holotype/neotype and separately the range for species paratypes/other material. Characters are sorted in alphabetic order.
WAGNER ET AL.67
FISH
anterior edge is the maximum body width at the sucking disc anterior
edge in ventral view; horizontal eye diameter is the maximum horizon-
tal length of the externally visible eye; interorbital distance is the
smallest distance between visible eyes; pectoral-fin length is the
length of the longest ray of the pectoral fin from origin to tip in lateral
view; postanus length is the distance from the vertical of the anus to
the midpoint of the base of the caudal fin (posterior end of the
hypural plate) in lateral view; postorbital distance is the distance from
the posterior edge of the eye to the upper opercular posterior edge in
lateral view; preanus length is the distance from the median most
anterior portion of the lower lip to the anus in ventral view; predisc
length is the distance from the median most anterior portion of the
lower lip to the anterior membranous edge of the disc in ventral view;
preorbital distance is the distance from the median most anterior
point of the upper lip to the anterior edge of the eye in dorsal view;
prepectoral distance is the distance from the median most anterior
point of the upper lip to the upper edge of the pectoral-fin base in
lateral view; vertical eye diameter is the maximum vertical length of
the externally visible eye. Measurements smaller than 20 mm were
taken with interactively selected points in Olympus cellSens Entry
2.2. software using an Olympus SC180 camera with an Olympus U-
TV0.5XC-3 adapter on the stereomicroscope Olympus SZX10, while
those out of this range were taken by a digital calliper. Fin ray
counts follow Briggs (1955) with the caudal principal rays being those
with noticeably free tips. The terminology of the complex system of
cephalic superficial neuromast rows in Gouania was expanded from
Conway et al.'s (2017a) terminology for the reduced system of rows in
Trachelochismus: supralabial row (SR), located medially above the upper
lip; nasal row (NR), located dorsal to nostrils; longitudinal infralateral
row (LIR), located dorsal to the lateral part of the upper lip, along the
lower cheek to preopercle, discontinuous at the vertical level of the
anterior ventral and suborbital transversal rows; suborbital transversal
row (STR), located on the lateral side of the head ventral to the orbit;
postorbital transversal row (POR), located posterior and ventral to the
posterior margin of the orbit; preopercular transversal row (PTR), located
on the skin covering the preopercle; subopercular longitudinal row (SLR),
located along the skin covering the subopercle; mandibular row (MR),
located on the ventral surface of the lower jaw behind the lower lip;
anterior ventral row (AVR), located posterior and ventral to the posterior
angle of the jaws; posterior ventral row (PVR), located on the skin ven-
tral to the preopercle; anterior dorsal row (ADR) located on the nape
behind the interorbital region; posterior dorsal row (PDR), located medi-
ally on the nape behind the anterior dorsal row and distantly from the
interorbital region; hyomandibular row (HR), located on the skin dorsal
to the preopercle; supraopercular row (SR1), located on the skin dorsal
to the posterior opercular edge; suprapectoral row (SR2), located dorsal
to the upper edge of the pectoral-fin base; dorsolateral longitudinal row
(DLR), located on the upper lateral side of the body; ventrolateral longi-
tudinal row (VLR), located on the lower lateral side of the body. The
cephalic sensory pore terminology follows that of Shiogaki and
Dotsu (1983). Granules are small dermal structures visible as small
bumps on the skin surface. Adhesive disc papillae terminology follows
Briggs' (1955) disc regions: A, the anterior part; B, the posterior part; C,
the central part. The type material was reversibly stained in a 2% solu-
tion of Cyanine Blue in distilled water following the method of
Saruwatari et al. (1997) and with our specific protocol: the specimens
were briefly dried in the air and then kept for 60 s in the staining solu-
tion. After examination they were stored in 70% ethanol where they
reached the original state, i.e., completely lost any trace of staining. The
preservative with diluted stain from the specimens was replaced with
freshethanol24hafterstaining.
Osteology was investigated on four to six specimens per species
based on three-dimensional (3D) models from microcomputed tomog-
raphy (microCT) images using a MicroCT 40 device (SCANCO Medi-
cal, Wayne, PA, U.S.A.) with a resolution of 15 or 20 μm. 3D
modelling was conducted in Drishti v.2.6.4 (Limaye, 2012) and the
osteological terminology follows Springer & Frase (1976). Throughout
the text we refer to caniniformsas teeth having a conical, elongated
and recurved shape. All the microCT data are from Wagner et al. (2019)
and therefore not all scans represent type material (mainly due to bad
fixation). However, all investigated structures were verified with
nontype material where scans were available (see Supporting Informa-
tion Table S2 for more information).
All the investigated vouchers and the type material have been
deposited in the Natural History Museum, Rijeka, Croatia (PMR) and
at the Zoological State Museum, Munich, Germany (ZSM).
2.3 |Molecular genetics and comparative methods
Previously published cytochrome-c oxidase subunit I sequences (COI
barcodes) of Gouania and Lepadogaster specimens were downloaded
from GenBank (accession numbers MK873443MK873539,
MF425774, MF425776MF425781, MF544114F544117). All these
sequences were produced in the framework of Wagner et al. (2017,
2019). Additionally, COI barcodes were generated for 27 further indi-
viduals (see Supporting Information Table S2), using the primers
FishF1 (50TCAACCAACCACAAAGACATTGGCAC 30) and FishR1 (50
TAGACTTCTGGGTGGCCAAAGAATCA 30) designed by Ward
et al. (2005). Procedures of amplification and sequencing follow the
protocols in Koblmüller et al. (2011) and Wagner et al. (2019).
Sequences were aligned using MUSCLE (Edgar, 2004) and calculations
of net interspecific evolutionary divergence between groups, using
1000 bootstraps replications and the Kimura 2-parameter model,
were conducted in MEGA v.07 (Kumar et al., 2016). For estimating
the barcoding gap(Hebert et al., 2003) the minimum interspecific
and the maximum intraspecific divergence (in %) were calculated in R
vs. 3.6.0 (R Core Team, 2017) using the functions nonConDistand
maxInDistfrom the R-package SPIDER (Brown et al., 2012). The
phylogenetic relationships between single Gouania lineages are visual-
ized based on a schematic (multilocus) multispecies coalescent tree
inferred by Wagner et al. (2019). All newly generated COI sequence
data were deposited on GenBank under accession numbers
MT299844MT299870 (Supporting Information Table S2).
68 WAGNER ET AL.
FISH
3|RESULTS
3.1 |Taxonomy
3.1.1 |Gouania Nardo, 1833
Gouania Nardo 1833: 548 (type species: Gouania prototypus
Nardo 1833 by original designation. Genus appeared first as Covania,
name corrected by Canestrini, 1864:181).
Diagnosis. The genus diagnosis is based on the genus description
by Briggs (1955) and adjusted to fit the new species: dorsal and anal
fins reduced to low ridges with very weak rays, connected to the cau-
dal fin. Ventral adhesive disc of doubletype, with no papillae in
region A and flattened papillae in regions B and C. Disc small, 5.09.8
in standard length. Body slender and elongated, posteriorly laterally
compressed. Head rounded in dorsal outline; snout not produced.
Upper jaw with outer row of medium-sized caniniforms frontally.
Behind them irregularly scattered small conical inner teeth. Outer row
continues laterally as large caniniforms, followed behind by medium-
sized caniniforms. Lower jaw with outer row of medium-sized
caniniforms frontally. Behind them irregularly scattered small conical
inner teeth. The single row of larger caniniforms continuous laterally.
FIGURE 2 Comparative
morphological overview and
lateral line system. (a) Main
morphological characteristics of
head region of (a) G. adriatica sp.
nov. (PMR VP4618 Holotype),
(b) G. orientalis sp. nov. (PMR
VP4585 Holotype), (c) G.
hofrichteri sp. nov. (PMR VP4595
Holotype) and (d) G. pigra (Nardo
1827) (PMR VP3529 Neotype).
(e) Position of pores (bold) and
neuromasts (italic) shown on the
example of G. willdenowi
(Risso 1810) (PMR VP4574
Neotype) and the main
morphological characteristics in
the head region of this species. (f)
Longitudinal infralateral and
suborbital transversal rows of
superficial neuromasts can be
placed on the well-defined bottom
of a deep (+) or shallow () groove.
U, upper opercular tip;
Abbreviations: L, lower opercular
tip; SR, supralabial row; NR, nasal
row; LIR, longitudinal infralateral;
STR, suborbital transversal row;
POR, postorbital transversal row;
PTR, preopercular transversal row;
SLR, subopercular longitudinal
row; MR, mandibular row; AVR,
anterior ventral row; PVR,
posterior ventral row; ADR,
anterior dorsal row; PDR,
posterior dorsal row; HR,
hyomandibular row; SR1,
supraopercular row; SR2,
suprapectoral row; DLR,
dorsolateral longitudinal row; VLR,
ventrolateral longitudinal row.
Photographs by M. Wagner and
M. Kovacˇi
c
WAGNER ET AL.69
FISH
Vertebrae 3540. The first gill arch with hemibranch, the 2nd to 4th
gill arches with holobranchs. No fleshy pad present on lower pectoral
base. No subopercular spine. Gill membranes attached to isthmus. Six
branchiostegals.
Key to the species of Gouania (Figure 2).
1a. Dorsal head profile concave above eye (Figure 2c,d), caudal-
fin length 11.113.0% of standard length, pectoral-fin length 5.4
7.5% of standard length, slenderspecies of Gouania 2
1b. Dorsal head profile straight above eye (Figure 2a,b,e), caudal-
fin length 13.517.5% of standard length, pectoral-fin length 8.2
11.3% of standard length, stoutspecies of Gouania 3
2a. Posterior angle of jaws extends to, or close to, a vertical line
drawn through the anterior edge of the anterior nostril; longitudinal
infralateral and suborbital transversal rows of superficial neuromasts
placed in the well-defined deep groove (Figure 2d,f); Adriatic Sea
Gouania pigra
2b. Posterior angle of jaws extends to between a vertical line
drawn through posterior edge of anterior nostril and a vertical line
drawn through anterior edge of eye; longitudinal infralateral and sub-
orbital transversal rows of superficial neuromasts placed in shallow
groove disappearing in posterior part of longitudinal infralateral row
(Figure 2c,f); Aegean Sea, rare in the south Adriatic Sea (a single
record from Pelješac, Croatia) Gouania hofrichteri sp. nov.
3a. Posterior opercular edge with pointed upper tip and rounded
lower posterior edge (Figure 2a); Adriatic Sea, northern Ionian Sea
(Island of Corfu) Gouania adriatica sp. nov.
3b. Posterior opercular edge with two equally long tips
(Figure 2b,e) 4
4a. Vertebrae 3738; West Mediterranean to Messina Gouania
willdenowi
4b. Vertebrae 3536; southern Ionian Sea and Aegean Sea
Gouania orientalis sp. nov.
3.1.2 |Gouania adriatica sp. nov.
English name: Adriatic blunt-snouted clingfish
ZooBank LSID: urn:lsid:zoobank.org:act:F054E7C9-604F-41DA-
8068-145DDCCC1FBE
Holotype. PMR VP4618, male, 41.41 + 6.77 mm, Stoja, Pula, Cro-
atia, 4451038.400N, 1349005.000 E, coll. M. Wagner, July 17, 2016
(Figure 3).
Paratypes. ZSM-PIS-047650, male, 41.03 + 5.89 mm Envi beach,
Vlorë, Albania, 4023016.300N, 1928058.200 E, coll. M. Wagner, August
14, 2019; ZSM-PIS-047652, male, 27.3 + 4.27 mm, Trstenik Pelješac,
Croatia, 4254007.700N, 1725047.000 E, coll. M. Wagner, August 18,
2019; ZSM-PIS-047651, male, 34.53 + 5.65 mm, Stara Baška, Krk,
Croatia, 4456045.300N, 1442022.200 E, coll. M. Wagner, September 16,
2019; PMR VP3523, juvenile of unidentified sex, 22.95 + 3.6 mm,
Glavotok, Krk, Croatia, 4505044.900N, 1426032.400 E, coll. M. Wagner,
May 13, 2015; PMR VP3524, male. 26.19 mm, caudal fin damaged
and PMR VP3525, female, 28.4 + 4.23 mm, both from Glavotok, Krk,
Croatia, 4505044.900N, 1426032.400 E, coll. M. Wagner, May 15, 2015;
ZSM-PIS-047653, female, 34.42 + 4.85 mm and ZSM-PIS-047653,
female, 35.23 + 4.9 mm, both from Pe
cine, Rijeka, Croatia,
4518052.400N, 1428011.700 E, coll. M. Wagner, July 12, 2019; PMR
VP4580, female, 34.7 + 4.99 mm, Sv. Marina, Istria, Croatia,
4501042.100N, 1409017.400 E, coll. M. Wagner, July 18, 2015.
Diagnosis.Gouania adriatica sp. nov. differs from its congeners by
the combination of the following characters: (1) dorsal head profile a
straight line from nape above eye to upper lip tip; (2) posterior angle
of jaws extends to between a vertical line drawn through posterior
edge of anterior nostril and a vertical line drawn through anterior edge
of eye; (3) pointed upper and rounded lower posterior opercular edge;
(4) longitudinal infralateral and suborbital transversal rows of superfi-
cial neuromasts placed in the well-defined deep groove; (5) body
cross-section behind pectoral fin base half oval with straight ventral
side; (6) the granules on body shallow and inconspicuous; (7) upper
attachment of gill membrane opposite to 5th to 6th pectoral ray; (8)
principal caudal-fin rays 1213; (9) vertical eye diameter 3.44.3% of
standard length; (10) horizontal eye diameter 3.03.7% of standard
length; (11) head length 26.230.0% of standard length; (12) pectoral-
fin length 8.711.3% of standard length; (13) prepectoral distance
25.128.5% of standard length; (14) ventral adhesive disc length
15.920.1% of standard length; (15) caudal-fin length 13.9%16.4 of
standard length; (16) low number of vertebrae (= 35); (17) pharyngeal
jaws with ceratobranchial 5 small, having several (about 5) small, coni-
cal teeth; (18) nasal bones club-shaped; (19) star-like pigmentation
around eyes, reduced body pigmentation with no visible stripes.
Description.General morphology: Body proportions are given in
Table 1. Body slender and elongated, posteriorly laterally compressed,
body depth at pectoral fins 6.48.9 in SL, body depth at anus
7.710.2 in SL, body depth in width at pectoral fins 1.11.4, body
FIGURE 3 Gouania adriatica sp. nov., PMR VP4618, holotype,
male, 41.41+6.77 mm, Stoja, Pula. Lateral view of specimen preserved
in 4% formaldehyde (top). Lateral, dorsal and ventral view, alive
(below). Photographs by M. Wagner and M. Kovacˇi
c
70 WAGNER ET AL.
FISH
depth in width at anus 0.70.8. Body cross-section behind pectoral
fin base half oval with straight ventral side. Granules on body shallow
and inconspicuous, making skin surface more dotted than granulose.
Head dorsoventrally compressed, head depth in width at orbit
1.51.8, and moderately large, head length 3.33.8 in SL, head wider
than body width maximum, head width at anterior sucking disc edge
0.70.9 in body width at pectoral fins. Dorsal head profile a straight
line from nape above eye to upper lip tip. Head rounded in dorsal
view. Snout large compared to eyes, preorbital distance 2.93.7 in
head length, 0.30.5 in horizontal eye diameter. Snout wide, not pro-
duced, blunt. Internostril space gently convex. Eyes dorsolateral, with
lower eye edge rounded. Eyes small, 7.39.5 in head length, vertical
diameter of the eye 0.81.1 in horizontal eye diameter. Infraorbital
invagination vertical to posterior part of eye or to mideye. Interorbital
distance wide, 0.30.6 in horizontal eye diameter. Centre of eye much
closer to tip of snout than to posterior margin of operculum, preorbital
distance in postorbital distance 1.82.2. Anterior and posterior
nostrils long tubes of about equal length. Nostrils well separated and
posterior nostril located behind and dorsally to the anterior edge of
eyes. Single large lobe at the posterior margin of anterior nostril or
bilobed, longer than nostril. Posterior nostril rim crenate with no
extension. Head lateral line system with canals with pores and with
superficial neuromasts arranged in rows. Head canals reduced and
pores small. Single pore in nasal canal near posterior nostril. Single
pore in postorbital canal close to posterior eye edge. Two pores in
mandibular canal, anterior one close to anterolateral angle of mouth,
posterior pore slightly in front of vertical of posterior angle of jaws,
posterior pore usually more prominent. Lachrymal as well as
preopercular canals and pores absent. Rows of superficial neuromasts
as follows: SR 2, NR 3, LIR 2427, STR 13, POR 34, PTR 2, SLR
45, MR 911, AVR 2, PVR 1, ADR 2, PDR 1, HR 3, SR1 3, SR2 2,
DLR 68, VLR 1012. STR and LIR rows of superficial neuromasts
placed in a well-defined deep groove. DLR row of superficial neu-
romasts anteriorly starts above pectoral fin, continuous dorsolateral
and ends posteriorly downwards at midlateral level above anus or
behind it. VLR anteriorly starts behind pectoral fin base, continuous
ventrolateral and ends posteriorly upwards with last papilla nearly at
midlateral level at caudal fin base. Mouth terminal, upper and lower
lips end about equally, lips fleshy, upper lip larger than the lower lip.
Posterior angle of jaws extends to between vertical line drawn
through posterior edge of anterior nostril and vertical line drawn
through anterior edge of eye. Chin with bilobed or slightly bilobed fold
at anterior edge covering MR row of superficial neuromasts. Gill mem-
brane attached to isthmus, gill opening starting at the base of pectoral
fin, with upper attachment of gill membrane opposite to 5th to 6th
pectoral ray. Pointed upper and rounded lower posterior opercular
edge. No subopercular spine. No fleshy pad present on lower pectoral
base. Urogenital papilla present. Preanus length in postanus length
0.60.7. Anal papillae absent, area around anus only wrinkled.
Fins. Rudimentary dorsal and anal fins located well posteriorly and
short, reduced to low ridges with very weak rays, connected to caudal
fin. Pectoral rays 1517. Caudal fin rounded, principal caudal rays
1213. Ventral adhesive disc (Figure 4a) of doubletype, anterior
margin crenate with large invagination on each lateral side and in
some specimen central invagination at midventral visible; posterior
margin crenate or villous. Disc small, disc length 5.06.3 in SL, its
width slightly larger than its length, width in length 0.91.0. No papil-
lae in region A and flattened papillae in regions B and C. In region B
one or two rows of papillae with total papillae count 1030 and in
region C two rows of papillae with total papillae count 915. No inner
row of papillae on lateral sides of the central part of the anterior disc.
Upper attachment of disc membrane attaching to base of pectoral fin
at 15th17th pectoral ray, i.e., at the ultimate or penultimate ray. In
males, parts of disc region A appear to be perfused (see Figure 3, ven-
tral view).
Colouration. Background colouration in life flesh-coloured to yel-
low, slightly transparent and head pigmentation prominent, with a
star-like pattern around eyes (Figure 3). Body without (especially in
juveniles) or with irregular melanocytes that are decreasing in density
towards the posterior part of body or dotted (e.g., specimens from
Vlorë) in life. Formaldehyde fixed specimens white to yellow and with-
out pigments. In ethanol yellow or skin-coloured with pigments still
present. For more pictures of life colouration see Supporting Informa-
tion File S1.
Dentition and osteology. Upper jaw with outer row of about eight
(one side) medium-sized caniniforms frontally. Behind them inner small
conical teeth irregularly scattered in two separate (left and right) drop-like
patches medially wide about five teeth, becoming narrowed to a single
row of teeth laterally. Outer row continues laterally as two large
caniniforms, followed behind by four or five medium-sized caniniforms.
Lower jaw with outer row of about 15 (one side) medium-sized
caniniforms frontally. Behind them single broad patch of small conical
inner teeth medially wide about 56 teeth, becoming narrowed to a sin-
gle row of teeth laterally. The single rowofabouteightlargercaniniforms
continuous laterally. Pharyngeal jaws with small ceratobranchial 5, having
several (about 5) small, conical teeth (Figure 5a), pharyngobranchial 3
toothplate not visible on 3D models from microCT images. Number of
vertebrae 35, abdominal 15 and caudal 20. The first gill arch with
hemibranch, the 2nd to 4th gill arches with holobranchs. Subopercle indis-
tinguishable from opercle, shaped as its posterior elongated extension,
not forming or having subopercular spine. Six branchiostegals. Maxillary,
premaxillary, nasal and ceratobranchial 5 bones shaped as in Figure 5a.
Nasal bones club-shaped.
Etymology. Named adriatica, meaning belonging to the Adriatic
Sea, Mare Adriaticumor Mare Hadriaticumin Latin, which is the
type locality of this species. The name is an adjective in the nomina-
tive singular (Article 11.9.1.1., ICZN, 1999).
Ecology and geographical distribution (Figure 1a). The geo-
graphic distribution ranges from the northern Adriatic Sea to the
northern Ionian Sea (Island Corfu). In the Adriatic basin, the species is
broadly sympatric with G. pigra. Quantitative data on ecology is largely
lacking. At one site in the Adriatic basin (Pelješac) it was found not just
in sympatry, but even syntopy, also with G. hofrichteri sp. nov.,i.e.,
with both species in the same habitat (Figure 1c). Fish were found in
the intertidal and sometimes syntopic with Lepadogaster lepagaster.
During extreme low tide (late winter and early spring tides are the
WAGNER ET AL.71
FISH
most extreme) this species was also found in layers of pebbles above
the waterline.
Remarks. Gouania adriatica sp. nov. differs from slender-bodied
Gouania species (G. pigra and G. hofrichteri sp. nov.) by a dorsal head pro-
file forming a straight line between nape above eye and upper lip tip (vs.
dorsal head profile in lateral view Scurved, concave above eye and con-
vex at nape in slender-bodied Gouania species), by a low number of verte-
brae (Supporting Information Table S2; 35 vs.3840) and in life a star-like
pigmentation around eyes (vs. no star-like pigmentation around eyes). Ten
morphometric characters, as percentages of standard length, of G.
adriatica sp. nov are nonoverlapping in range with both slender-bodied
Gouania: head length, head width at head invagination, vertical and
horizontal eye diameter, body width at pectoral fins, pectoral-fin length,
prepectoral distance, ventral adhesive disc length, predisc length and
caudal-finlength(valuesintheTable 1). There are also morphometric
characters nonoverlapping in range with only one of the two slender-
bodied Gouania (Table 1). In addition, G. adriatica sp. nov. differs from G.
pigra by the posterior angle of jaws extending to between a vertical line
drawn through the posterior edge of the anterior nostril and a vertical line
drawn through the anterior edge of the eye (vs. posterior angle of jaws
extending to, or close to, a vertical line drawn through the anterior edge
of the anterior nostril) and principal caudal-fin rays 1213 (vs.principal
caudal rays 1011). G. adriatica sp. nov. also differs from G. hofrichteri sp.
nov. by longitudinal infralateral and suborbital transversal rows of superfi-
cial neuromasts placed in a well-defined deep groove (vs. longitudinal
infralateral and suborbital transversal rows of superficial neuromasts
placed in shallow groove disappearing in posterior part of longitudinal
infralateral row), body cross-section behind pectoral fin base half oval
with straight ventral side (vs. body cross-section behind pectoral fin base
triangular with ventral flat and dorsal pointed), upper attachment of gill
membrane opposite to 5th to 6th pectoral ray (vs. opposite to 3rd4th
pectoral ray), the granules on body shallow and inconspicuous (vs.gran-
ules on body, at least on posterior part and nape, large and prominent). G.
adriatica sp. nov. differs from other stout-bodied species (G. orientalis sp.
nov. and G. willdenowi) by a posterior opercular edge with pointed upper
tip and rounded lower edge (vs. posterior opercular edge w-shaped with
two equally long tips) and a reduced pigmentation. In addition, it differs
from G. orientalis sp. nov. by principal caudal-fin rays 1213 (vs.principal
caudal rays 1011) and from G. willdenowi by vertical eye diameter
3.44.3% and horizontal eye diameter 3.03.7% of standard length (vs.
vertical eye diameter 2.63.3% and horizontal eye diameter 2.32.9% of
standard length). G. adriatica sp. nov. is known from the Adriatic Sea as
well as Corfu island and has no overlapping geographic records with
G. orientalis sp. nov. and G. willdenowi.
3.1.3 |Gouania orientalis sp. nov.
English name: Oriental blunt-snouted clingfish
ZooBank LSID: urn:lsid:zoobank.org:act:4E02C972-6907-41E0-
A2B7-0215FDB49319
Holotype. PMR VP4585, male, 32.8 + 4.93 mm, Plakias, Crete,
Greece, 3511040.800N, 2422050.900 E, coll. M. Wagner, August 9,
2016 (Figure 6).
Paratypes. PMR VP4719, male, 37.53 + 5.59 mm, Gulf of Corinth,
Greece, 3810017.000N, 2216026.700E, coll. M. Wagner, August 23,
FIGURE 4 Sucking discs and disc-papillae of Gouania species. (a) G. adriatica sp. nov. (PMR VP4618 Holotype), (b) G. orientalis sp. nov.
(PMR VP4585 Holotype), (c) G. hofrichteri sp. nov. (PMR VP4595 Holotype), (d) G. pigra (Nardo 1827) (ZSM-PIS-047649 Other material) and
(e) G. willdenowi (Risso 1810) (PMR VP4574 Neotype). (f) Males of Gouania can have seemingly perfused prominent finger-like extensions on
sucking disc edge in region A.A, B and C correspond to disc regions. Photographs by M. Wagner
72 WAGNER ET AL.
FISH
2018; PMR VP4584, female, 26.0 + 4.56 mm, Plakias, Crete, Greece,
3511040.800N, 2422050.900E, coll. M. Wagner, August 9, 2016; ZSM-
PIS-047658, female, 30.55 + 5.25 mm and PMR VP4588, juvenile of
unidentified sex, 17.92 + 2.98 mm, both from Vatos, Crete, Greece,
3459041.000N, 2533017.300E, coll. M. Wagner, August 13, 2016; ZSM-
PIS-047659, female, 17.88 + 2.79 mm and PMR VP4596, female, 17.09
+ 2.69 mm, both from Souda Beach, Plakias, Crete, Greece,
3511032.100N, 2422004.900E, coll. M. Wagner, August 17, 2016; ZSM-
PIS-047660, female, 24.87 + 3.56 mm and ZSM-PIS-047660, female,
23.68 + 3.39, mm, both from Chamolia, Greece, 3754058.500N,
2402008.700E, coll. M. Wagner, August 16, 2018; ZSM-PIS-047661,
male, 28.52 + 4.04 mm, Feloti Beach, Kapsáli, Kythira, Greece,
3609016.200N, 2257052.000E, coll. M. Wagner, August 21, 2018.
Diagnosis. Gouania orientalis sp. nov. differs from its congeners
by the combination of the following characters: (1) dorsal head profile
a straight line from nape above eye to upper lip tip; (2) posterior angle
of jaws extends to between a vertical line drawn through anterior
edge of eye and a vertical line drawn through anterior part of eye; (3)
infraorbital invagination vertical to posterior part of eye; (4) posterior
opercular edge w-shaped with two equally long tips; (5) longitudinal
infralateral and suborbital transversal rows of superficial neuromasts
placed in the well-defined deep groove; (6) trunk cross-section behind
pectoral fin base half oval with straight ventral side; (7) granules on
body shallow and inconspicuous; (8) upper attachment of gill mem-
brane opposite to 5th to 6th pectoral ray; (9) pectoral rays 1719;
(10) upper attachment of disc membrane attaching to base of pectoral
fin at 16th18th pectoral ray; (11) principal caudal rays 1011; (12)
head length 25.028.9% of standard length; (13) pectoral fin length
8.210.3% of standard length; (14) prepectoral distance 24.728.2%
of standard length; (15) ventral adhesive disc length 14.919.0% of
standard length; (16) caudal-fin length 14.217.5% of standard length;
(17) low number of vertebrae (Supporting Information Table S2;
3536) (18) pharyngeal jaws with small ceratobranchial 5, having a
few hardly recognizable small conical teeth; (19) nasal bones with
inconspicuous frontal end; (20) in life star-like pigmentation around
eyes, body colouration dark, sometimes marbled or with stripes.
Description. General morphology: Body proportions are given in
Table 1. Body slender and elongated, posteriorly laterally compressed,
FIGURE 5 Head osteology of Gouania species. (a) G. adriatica sp. nov. (PMR VP4618 Holotype), (b) G. orientalis sp. nov. (PMR VP4585
Holotype), (c) G. hofrichteri sp. nov. (ZSM-PIS- 047656 Paratype), (d) G. pigra (Nardo 1827) (PMR VP3531 Other material) and (e) G. willdenowi
(Risso 1810) (ZSM-PIS-0476654 Other material). Red, ceratobranchial 5; orange, premaxillary bone; blue, maxillary bone; green, nasal bone
WAGNER ET AL.73
FISH
body depth at pectoral fins 6.98.6 in SL, body depth at anus 7.89.3
in SL, body depth in width at pectoral fins 1.11.2, body depth in
width at anus 0.80.9. Trunk cross-section behind pectoral fin base
half oval with straight ventral side. Granules on body shallow and
inconspicuous. Head dorsoventrally compressed, head depth in width
at orbit 1.51.9 and moderately large, head length 3.54.0 in SL, head
wider than body width maximum, head width at anterior sucking disc
edge 0.70.8 in body width at pectoral fins. Dorsal head profile
straight between nape above eye and upper lip tip. Head rounded in
dorsal view. Snout large compared to eyes, preorbital distance
3.13.8 in head length, 0.30.5 in horizontal eye diameter. Snout
wide, not produced, blunt. Internostril space gently convex. Eyes dor-
solateral, with lower eye edge rounded. Eyes small, 7.010.1 in head
length, vertical diameter of the eye 0.81.1 in horizontal eye diameter.
Infraorbital invagination vertical to posterior part of eye. Interorbital
distance wide, 0.30.5 in horizontal eye diameter. Centre of eye much
closer to tip of snout than to posterior margin of operculum, preorbital
distance in postorbital distance 1.92.3. Anterior and posterior
nostrils long tubes of about equal length. Nostrils well separated and
posterior nostril located behind and dorsally to anterior edge of eyes.
Single large dermal flap at the posterior margin of anterior nostril leaf
shaped, longer than nostril. Posterior nostril rim slightly crenate with
no extension. Head lateral line system with canals with pores and with
superficial neuromasts arranged in rows. Head canals reduced and
pores small. Single pore in nasal canal near posterior nostril. Single
pore in postorbital canal close to posterior eye edge. Two pores in
mandibular canal, anterior one close to anteriolateral angle of mouth,
posterior pore slightly in front of vertical of posterior angle of jaws,
posterior pore usually more prominent. Lachrymal as well as
preopercular canals and pores absent. Rows of superficial neuromasts
as follows: SR 2, NR 35, LIR 2328, STR 34, POR 34, PTR 2, SLR
5, MR 913, AVR 2, PVR 1, ADR 13, PDR 1, HR 3, SR1 3, SR2 12,
DLR 68, VLR 913. STR and LIR rows of superficial neuromasts
placed in the well-defined deep groove. DLR row of superficial neu-
romasts anteriorly starts above pectoral fin, continuously dorsolateral
and ends posteriorly downwards at midlateral level and variably, verti-
cal to anus or in front of it or behind it. VLR anteriorly starts behind
pectoral fin base, continuous ventrolaterally and ends posteriorly
upwards with last papilla nearly at midlateral level at caudal fin base
or close to it. Mouth terminal, upper and lower lips end about equally,
lips fleshy, upper lip larger than the lower lip. Posterior angle of jaws
extends to between vertical line drawn through anterior edge of eyes
and vertical line drawn through anterior part of eye. Chin with bilobed
or slightly bilobed fold at anterior edge covering MR row of superficial
neuromasts. The gill membrane is attached to isthmus, gill opening
starting at the base of pectoral fin, with the upper attachment of the
gill membrane is opposite to 5th to 6th pectoral ray. Posterior opercu-
lar edge w-shaped with two equally long tips. No subopercular spine.
No fleshy pad present on lower pectoral base. Urogenital papilla pre-
sent. Preanus length in postanus length 0.60.8. Anal papillae absent,
the area around anus wrinkled.
Fins. Rudimentary dorsal and anal fins located well posteriorly and
short, reduced to low ridges with very weak rays, connected to the caudal
fin. Pectoral rays 1719. Caudal fin rounded, principal caudal rays 1011.
Ventral adhesive disc (Figure 4b) of doubletype, anterior margin crenate
with large invagination on each lateral side and central invagination at
midventral; posterior margin slightly crenate. Disc small, disc length 5.3
6.7 in SL, its width slightly larger than its length, width in length 0.91.1.
No papillae in region A and flattened papillae in regions B and C. In region
B two to three rows of papillae with total papillae count 2137 and in
region C two rows of papillae with total papillae count 915. No inner
row of papillae on lateral sides of the central part of the anterior disc.
Upper attachment of disc membrane attaching to base of pectoral fin at
16th18th pectoral ray (i.e., on penultimate ray).
Colouration. Background colour of live specimens bright yellow to
brownish red (Figure 6) and prominent star-like pigmentation around
eyes present. Body pigments reduced (juveniles) or, behind head, with
clearly visible regular stripes (juveniles, e.g., Attica, Crete, Kythira) or
marbled (i.e., irregular pattern; e.g., Gulf of Corinth). Specimens from
Crete, Kythira and the Gulf of Corinth have stronger pigmentation
(see Figure 6), hence, the pigmentation pattern can be less clearly visi-
ble. Formaldehyde fixed specimens white-yellow and without pig-
ments. Ethanol fixed specimens white to skin-coloured, pigmentation
present (also stripes). For more pictures of life colouration see
Supporting Information File S1.
Dentition and osteology. Upper jaw with outer row of about 10 (one
side) medium-sized caniniforms frontally. Behind them inner small conical
teeth irregularly scattered in two separate (left and right) drop-like pat-
ches medially wide about 56 teeth, becoming narrowed to a single row
of teeth laterally. Outer row continues laterally as two large caniniforms,
followed behind by about eight medium-sized caniniforms. Lower jaw
with outer row of about 10 (one side) medium-sized caniniforms frontally.
Behind them single broad patch of small conical inner teeth wide medially
FIGURE 6 Gouania orientalis sp. nov., PMR VP4585, holotype,
male, 32.8+4.93 mm, Plakias, Crete, Greece. Lateral view of specimen
preserved in 4% formaldehyde (top). Lateral, dorsal and ventral view,
alive (below). Photographs by M. Wagner and M. Kovacˇi
c
74 WAGNER ET AL.
FISH
about 56 teeth, becoming narrowed to a single row of teeth laterally.
The single row of about six larger caniniforms continuous laterally. Pha-
ryngeal jaws with small ceratobranchial 5, having a few (12) poorly rec-
ognizable small conical teeth (Figure 5b), pharyngobranchial 3 toothplate
not visible on 3D models from microCT images. Number of vertebrae
3536, abdominal 16 and caudal 21 (Supporting Information Table S2).
The first gill arch with hemibranch, the 2nd to 4th gill arches with hol-
obranchs. Subopercle indistinguishable from opercle, shaped as its poste-
rior elongated extension, not forming or having subopercular spine. Six
branchiostegals. Nasal bones with inconspicuous frontal end. Maxillary,
premaxillary, nasal and ceratobranchial 5 bones shaped as on Figure 5b.
Etymology. Named orientalis, from the Latin word oriensfor
east, which describes the distribution range of the species that is
restricted to the oriental Mediterranean basin. The name is an adjec-
tive in the nominative singular (Article 11.9.1.1., ICZN, 1999).
Ecology and geographical distribution (Figure 1a). The known
species distribution range encompasses the Gulf of Corinth, the
Aegean Sea (Attica) and on the islands Crete and Kythira. Quantitative
data on ecology is largely lacking. Gouania orientalis sp. nov. occurs in
sympatry or even syntopy with G. hofrichteri sp. nov. throughout its
distribution range. The species inhabits intertidal and subtidal pebble
and boulder beaches.
Remarks. Gouania orientalis sp. nov. differs from slender-bodied
Gouania species (G. pigra and G. hofrichteri sp. nov.) by a dorsal head
profile that forms a straight line between nape above eye and upper
lip tip (vs. dorsal head profile in lateral view Scurved, concave above
eye and convex at nape), an infraorbital invagination vertical to poste-
rior part of eye (vs. infraorbital invagination below anterior half of eye
or below mideye), lower number of vertebrae (Supporting Information
Table S2; 3536 vs.3840) and a star-like pigmentation around eyes
(vs. no star-like pigmentation around eyes). Nine morphometric char-
acters as percentages of standard length of G. orientalis sp. nov. are
nonoverlapping in range with both slender-bodied Gouania: head
length, horizontal eye diameter, body width at pectoral fins, pectoral-
fin length, prepectoral distance, ventral adhesive disc length, distance
between the posterior margin of sucking disc and anus, caudal base
depth and caudal-fin length (values in Table 1). There are also mor-
phometric characters nonoverlapping in range with only one of the
two slender-bodied Gouania (Table 1). In addition, G. orientalis sp. nov.
differs from G. pigra by a posterior angle of jaws extending to
between vertical line drawn through anterior edge of eye and vertical
line drawn through anterior part of eye (vs. posterior angle of jaws
extending to, or close to, a vertical line drawn through the anterior
edge of the anterior nostril), pectoral rays 1719 (vs. pectoral rays
1316) and upper attachment of disc membrane attaching to base of
pectoral fin at 16th18th pectoral ray (vs. upper attachment of disc
membrane attaching to base of pectoral fin at 12th15th pectoral
ray). G. orientalis sp. nov. is also different from G. hofrichteri sp. nov.
by posterior opercular edge w-shaped with two equally long tips (vs.
pointed upper tip and rounded lower posterior opercular edge), longi-
tudinal infralateral and suborbital transversal rows of superficial neu-
romasts placed in the well-defined deep groove (vs. longitudinal
infralateral and suborbital transversal rows of superficial neuromasts
placed in shallow groove disappearing in posterior part of longitudinal
infralateral row), body cross-section behind pectoral fin base half oval
with straight ventral side (vs. trunk cross-section behind pectoral fin
base triangular with ventral flat and dorsal pointed), granules on body
shallow and inconspicuous (vs. granules on body, at least on posterior
part and nape, large and prominent) and upper attachment of gill
membrane opposite to 5th6th pectoral ray (vs. the upper attachment
of the gill membrane opposite to 3rd4th pectoral ray). G. orientalis
sp. nov. differs from the stout-bodied species G. adriatica sp. nov. in
posterior opercular edge w-shaped with two equally long tips (vs. pos-
terior opercular edge with pointed upper tip and rounded lower edge),
principal caudal rays 1011 (vs. principal caudal-fin rays 1213) and
pattern of pigmentation (stripes, marbles vs. reduced pigmentation). G.
orientalis sp. nov. has no nonoverlapping external morphological dif-
ferences to G. willdenowi but differs by its low number of vertebrae
(Supporting Information Table S2; 3536 vs.3738). G. orientalis sp.
nov. is known from Aegean and Ionian Sea and has nonoverlapping
geographic distribution with G. adriatica sp. nov.,G. pigra and G.
willdenowi.
3.1.4 |Gouania hofrichteri sp. nov.
English name: Hofrichter's clingfish
ZooBank LSID: urn:lsid:zoobank.org:act:3894FA6B-E67C-4905-
A31C-F6FD1EF4F2A8
Holotype. PMR VP4595, male, 30.35 + 3.67 mm, Souda Beach,
Plakias, Crete, Greece, 3511032.100N, 2422004.900 E, coll. M. Wagner,
August 17, 2016 (Figure 7).
Paratypes. PMR VP4591, female, 21.42 + 2.62 mm, Mades,
Crete, Greece, 3524001.100N, 2502001.600 E, coll. M. Wagner, August
15, 2016; PMR VP4599, female, 26.8 + 3.23 mm and PMR VP4600,
male, 29.75 + 3.49 mm, both from Souda Beach, Plakias, Crete,
Greece, 3511032.100N, 2422004.900E, coll. M. Wagner, August 17,
2016; PMR VP4605, juvenile of unidentified sex, 20.62 + 2.63 mm,
Saronida, Greece, 3743012.200N, 2355041.000 E, coll. M. Wagner,
August 2, 2016; PMR VP4606, female, 29.47 + 3.41 mm, ZSM-PIS-
047656, female, 35.86 + 4.49 mm and PMR VP4608, female, 26.69
+ 3.32 mm, all from Chamolia, Greece, 3754058.500N, 2402008.700 E,
coll. M. Wagner, August 4, 2016; ZSM-PIS-047657, male, 36.91
+ 4.24 mm and ZSM-PIS-047657, male, 33.27 + 4.31, mm, both from
Chamolia, Greece, 3754058.500N, 2402008.700 E, coll. M. Wagner,
August 16, 2018.
Diagnosis. Gouania hofrichteri sp. nov. differs from congeneric
species by the combination of the following characters: (1) dorsal head
profile in lateral view Scurved, concave above eye and convex at
nape; (2) posterior angle of jaws extends to between vertical line
drawn through posterior edge of anterior nostril and vertical line
drawn through anterior edge of eye; (3) infraorbital invagination
below anterior half of eye or below mideye; (4) posterior opercular
edge with pointed upper tip and rounded lower edge; (5) longitudinal
infralateral and suborbital transversal rows of superficial neuromasts
placed in shallow groove disappearing in posterior part of longitudinal
WAGNER ET AL.75
FISH
infralateral row; (6) body cross-section behind pectoral fin base triangular
with ventral flat and dorsal pointed; (7) granules on body, at least on pos-
terior part and nape, large and prominent; (8) upper attachment of gill
membrane opposite to 3rd4th pectoral ray; (9) vertical eye diameter
2.02.7% of standard length; (10) head length 18.923.4% of standard
length; (11) pectoral-fin length 5.46.4% of standard length; (12) pre-
pectoral distance 19.523.7% of standard length; (13) ventral adhesive
disc length 10.213.4% of standard length; (14) caudal-fin length
11.513.4% of standard length; (15) high total number of vertebrae
(Supporting Information Table S2; 3840); (16) pharyngeal jaws with
ceratobranchial 5 elongated, having several larger elongated conical teeth;
(17) nasal bones hook-shaped; (18) star-like pigmentation around eyes
absent, body pigmentation striped or marbled, small iridophores visible.
Description. General morphology: Body proportions are given in
Table 1. Body very slender and elongated, posteriorly laterally com-
pressed, body depth at pectoral fins 9.210.5 in SL, body depth at
anus 11.013.5 in SL, body depth in width at pectoral fins 1.01.0,
body depth in width at anus 0.70.9. Body cross-section behind pec-
toral fin base triangular with ventral flat and dorsal pointed. Granules
on body, at least on posterior part and nape, large and prominent.
Head dorsoventrally compressed, head depth in width at orbit
1.51.8, and moderately small, head length 4.35.3 in SL, head wider
than body width maximum, head width at anterior sucking disc edge
0.70.8 in body width at pectoral fins. Dorsal head profile Scurved,
concave above eye and convex at nape. Head rounded in dorsal view.
Snout large compared to eyes, preorbital distance 2.83.7 in head
length, 0.30.5 in horizontal eye diameter. Snout wide, not produced,
blunt. Internostril space almost triangular in cross-section, with ridge
top, conspicuously convex. Eyes dorsolateral, with lower eye edge
rounded. Eyes small, 7.710.7 in head length, vertical diameter of the
eye 0.81.1 in horizontal eye diameter. Infraorbital invagination below
anterior half of eye or below mideye. Interorbital distance wide,
0.30.5 in horizontal eye diameter. Centre of eye much closer to tip
of snout than to posterior margin of operculum, preorbital distance in
postorbital distance 1.72.3. Anterior and posterior nostrils long tubes
of about equal length. Nostrils well separated and posterior nostril
located behind and dorsally to the anterior edge of eyes. Single large
dermal flap at the posterior margin of anterior nostril leaf shaped, lon-
ger than nostril. Posterior nostril rim crenate with no extension. Head
lateral line system with canals with pores and with superficial neu-
romasts arranged in rows. Head canals reduced and pores small. Single
pore in nasal canal near posterior nostril. Single pore in postorbital
canal close to posterior eye edge. Two pores in mandibular canal,
anterior one close to anteriolateral angle of mouth, posterior pore
slightly in front of vertical of posterior angle of jaws, posterior pore
usually more prominent. Lachrymal as well as preopercular canals and
pores absent. Rows of superficial neuromasts as follows: SR 2, NR 3,
LIR 2229, STR 24, POR 3, PTR 2, SLR 45, MR 911, AVR 2, PVR
1, ADR 23, PDR 1, HR 34, SR1 34, SR2 12, DLR 58, VLR
1013. STR and LIR rows of superficial neuromasts placed in shallow
groove disappearing in posterior part of LIR. DLR row of superficial
neuromasts anteriorly starts above pectoral fin, continuously dorsolat-
eral and ends posteriorly downwards at or above midlateral level ver-
tical to anus. VLR anteriorly starts behind pectoral fin base,
continuous ventrolaterally and ends posteriorly upwards with last
papilla near or at midlateral level at or close to caudal-fin base. Mouth
terminal, upper and lower lips ends about equally, lips fleshy, upper lip
larger than the lower lip. Posterior angle of jaws extends to between
vertical line drawn through posterior edge of anterior nostril and verti-
cal line drawn through anterior edge of eye. Chin with bilobed or sin-
gle lobe fold at anterior edge not covering MR row of superficial
neuromasts. The gill membrane is attached to isthmus, gill opening
starting at the base of pectoral fin, with the upper attachment of the
gill membrane is opposite to 3rd4th pectoral ray. Posterior opercular
edge with pointed upper tip and rounded lower edge. No
subopercular spine. No fleshy pad present on lower pectoral base.
Urogenital papilla present. Preanus length in postanus length 0.71.0.
Anal papillae absent, the area around anus wrinkled.
Fins. Rudimentary dorsal and anal fins located well posteriorly and
short, reduced to low ridges with the very weak rays, connected to the
caudal fin. Pectoral rays 1416. Caudal fin rounded, principal caudal rays
1012. Ventral adhesive disc (Figure 4c) of doubletype, anterior margin
crenate with large invagination on each lateral side and central invagina-
tion at midventral; posterior margin crenate. Disc very small, disc length
7.59.8 in SL, its width slightly larger than its length, width in length
0.80.9. No papillae in region A and flattened papillae in regions B and C.
In region B one or two rows of papillae with total papillae count 1230
and in region C one or two rows of papillae with total papillae count
414. No inner row of papillae on lateral sides of the central part of the
anterior disc. Upper attachment of disc membrane attaching to base of
pectoral fin at 14th16th pectoral ray (i.e., at ultimate or penultimate ray).
Males can have two prominent seemingly perfused finger-like extensions
on each site of sucking disc that are of equal size or exceeding length of
disc region A (Figure 4f).
FIGURE 7 Gouania hofrichteri sp. nov., PMR VP4595, holotype,
male, 30.35+3.67 mm, Souda Beach, Plakias, Crete, Greece. Lateral
view of specimen preserved in 4% formaldehyde (top). Lateral, dorsal
and ventral view, alive (below). Photographs by M. Wagner and M.
Kovacˇi
c
76 WAGNER ET AL.
FISH
Colouration. Background colour of live specimens bright to skin-
coloured (Figure 7). Pigmentation behind head region sometimes with
a clearly visible striped or marbled (i.e., irregularly distributed patches
of pigments) pattern. Sometimes small evenly distributed iridophores
visible in lateral view (Figure 7) in life. No star-like pigmentation
around the eyes visible. Formaldehyde fixed specimens white-yellow
and without pigments. Ethanol fixed specimens white to skin
coloured, striped or marbled pigmentation visible. For more pictures
of live colouration see Supporting Information File S1.
Dentition and osteology. Upper jaw with outer row of about eight
(one side) medium-sized caniniforms frontally. Behind them inner
small conical teeth irregularly scattered in two separate (left and right)
drop-like patches medially wide about 56 teeth, becoming narrowed
to a single row of teeth laterally. Outer row continues laterally later-
ally as four large caniniforms of variable size, followed behind by
about six medium-sized caniniforms. Lower jaw with outer row of
eight to 10 (one side) medium-sized caniniforms frontally. Behind
them single broad patch of small conical inner teeth medially wide
about 56 teeth, becoming narrowed to a single row of teeth laterally.
The single row of about five larger caniniforms continuous laterally.
Pharyngeal jaws with elongated ceratobranchial 5, having several
(about 5) larger elongated conical teeth (Figure 5c), pharyngobranchial
3 toothplate not visible on 3D models from micro-computed tomogra-
phy (microCT) images. Number of vertebrae 3840, abdominal 17 and
caudal 2122 (Supporting Information Table S2). The first gill arch
with hemibranch, the 2nd to 4th gill arches with holobranchs. Sub-
opercle indistinguishable from opercle, shaped as its posterior elon-
gated extension, not forming or having subopercular spine. Six
branchiostegals. Hook-shaped nasal bones. Maxillary and premaxillary
bones shaped as on Figure 5c.
Etymology. Named hofrichteri, in honour of Robert Hofrichter,
whose work on European clingfishes sparked our interest in these
enigmatic fishes. The species epithet was formed from the personal
name, as the noun in the genitive case, with iadded to the stem of
the name (Article 31.1.2., ICZN, 1999).
Ecology and geographical distribution (Figure 1a). Species wide-
spread in the eastern Mediterranean Sea with a single record from the
Adriatic Sea (Pelješac; Figure 1c). G. hofrichteri sp. nov. is very abundant in
the northern and southern Ionian Sea (Corfu, Stomio), the Gulf of Corinth,
the islands of Kythira and Crete and the Aegean Sea (Attica). Quantitative
data on ecology is largely lacking. The species inhabits intertidal pebble
beaches and probably shows passive emergence behaviour (compare with
Bileceno
glu, 2015). Throughout its distribution range this species occurs
in sympatry with G. orientalis sp. nov. and on the island Corfu with G.
adriatica sp. nov. There is a single record of the species inside the Adriatic
basin from Pelješac, where it occurs in low densities together with G. pigra
and G. adriatica sp. nov.
Remarks. Gouania hofrichteri sp. nov. differs from all other Gouania
species by longitudinal infralateral and suborbital transversal rows of super-
ficial neuromasts placed in shallow groove disappearing in posterior part of
longitudinal infralateral row (vs. longitudinal infralateral and suborbital
transversal rows of superficial neuromasts placed in the well-defined deep
groove in all other Gouania species); body cross-section behind pectoral fin
base triangular with ventral flat and dorsal pointed (vs. body cross-section
behind pectoral fin base half oval to pentagonal (pentagonal only in G.
pigra) with straight ventral side in all other Gouania species); granules on
body, at least on posterior part and nape, large and prominent (vs.the
granules on body shallow and inconspicuous in all other Gouania species)
and hook-like nasal bones. G. hofrichteri sp. nov. differs from three stout-
bodied Gouania species (G. adriatica sp. nov.,G. orientalis sp. nov. and G.
willdenowi) by dorsal head profile in lateral view Scurved, concave above
eye and convex at nape (vs. dorsal head profile straight between nape
above eye and upper lip tip), absence of star-like pigmentation around eyes
and large number of vertebrae (Supporting Information Table S2; 3840
vs.3538). Eleven morphometric characters as percentages of standard
length of G. hofrichteri sp. nov. are nonoverlapping in range with all three
stout-bodied Gouania: vertical eye diameter, head length, postorbital dis-
tance, all three head widths, body width at pectoral fins, pectoral-fin
length, prepectoral distance, ventral adhesive disc length and caudal-fin
length (values in the Table 1). In addition, there are numerous morphomet-
ric characters nonoverlapping in range with one or two out of three stout-
bodied Gouania species (Table 1). G. hofrichteri sp. nov. differs from G.
adriatica sp. nov. and G. orientalis sp. nov. by the upper attachment of the
gill membrane opposite to 3rd4th pectoral ray (vs. upper attachment of
thegillmembraneoppositeto5th6th pectoral ray) and from G. orientalis
sp. nov. and G. willdenowi by the infraorbital invagination below anterior
half of eye or below mideye (vs. infraorbital invagination vertical to poste-
rior part of eye) and by posterior opercular edge with pointed upper tip
and rounded lower edge (vs. posterior opercular edge w-shaped with two
equally long tips). G. hofrichteri sp. nov. differs from other slender-bodied
species, G. pigra, by the posterior angle of jaws extending to between ver-
tical line drawn through posterior edge of anterior nostril and vertical line
drawn through anterior edge of eye (vs. posterior angle of jaws extending
to, or close to, vertical line drawn through anterior edge of anterior nostril)
and by posterior opercular edge with pointed upper tip and rounded lower
edge (vs. posterior opercular edge with two tips, upper longer or equal to
lower). G. hofrichteri sp. nov. is known from the Adriatic (single findings
from Pelješac), Aegean and Ionian Sea and has nonoverlapping geographic
distribution only with G. willdenowi.
3.1.5 |Gouania pigra (Nardo 1827)
English name: Piglet sucker
Neotype. PMR VP3529, female, 43.12 + 5.03 mm, Glavotok, Krk,
Croatia, 4505044.900N, 1426032.400 E, coll. M. Wagner, May 16, 2015
(Figure 8).
Additional material examined. ZSM-PIS-047648, male, 37.71
+ 4.36 mm, ZSM-PIS-047648, male, 37.2 + 4.31 mm and ZSM-PIS-
047648, female, 32.58 + 3.94 mm, all from Stara Baška, Krk, Croatia,
4456045.300N, 1442022.200 E, coll. M. Wagner, September 16, 2019;
PMR VP3531, male, 39.48 + 4.4 mm, Glavotok, Krk. Croatia,
4505044.900N, 1426032.400 E, coll. M. Wagner, May 16, 2015; PMR
VP4619, female, 35.86 + 4.14 mm, Stoja, Pula, Croatia, 4451038.400 N,
1349005.000E, coll. M. Wagner, July 17, 2016; ZSM-PIS-047649,
female, 35.14 + 4.03 mm and ZSM-PIS-047649, male, 37.07
WAGNER ET AL.77
FISH
+ 4.51 mm, both from Pe
cine, Rijeka, Croatia, 4518052.400N,
1428011.700E, coll. M. Wagner, July 12, 2019; PMR VP4581, male,
38.67 + 4.91 mm and PMR VP4583, male, 36.87 + 4.08 mm, Sv.
Marina, Istria, Croatia, 4501042.100N, 1409017.400 E, coll. M. Wagner,
July 18, 2015.
Synonyms. Lepadogaster piger Nardo 1827: 9 (original description;
type locality: Rovinj; holotype: unknown); Gouania prototypus Nardo
1833: 548 (original description; type locality: Rovinj?; holotype:
unknown), Gouania piger Bonaparte 1846: 64 (original description;
type locality: unknown; holotype: unknown); Leptopterygius piger Gün-
ther 1861: 515 (original description; type locality: unknown; holotype:
unknown).
Diagnosis. Gouania pigra differs from the congeneric species by
the combination of the following characters: (1) dorsal head profile in
lateral view Scurved, concave above eye and convex at nape; (2)
posterior angle of jaws extends to, or close to, vertical line drawn
through anterior edge of anterior nostril; (3) infraorbital invagination
below anterior half of eye or below mideye; (4) posterior opercular
edge with two tips, upper longer or equal to lower; (5) longitudinal
infralateral and suborbital transversal rows of superficial neuromasts
placed in the well-defined deep groove; (6) body cross-section behind
pectoral fin base half oval to pentagonal with straight ventral side; (7)
granules on body shallow and inconspicuous; (8) pectoral rays 1316;
(9) upper attachment of disc membrane attaching to base of pectoral
fin at 12th15th pectoral ray; (10) principal caudal rays 1011; (11)
head length 19.522.9% of standard length; (12) pectoral-fin length
5.67.5% of standard length; (13) prepectoral distance 19.523.4% of
standard length; (14) ventral adhesive disc length, 12.114.6% of
standard length; (15) caudal-fin length 11.112.7% of standard length;
(16) large total number of vertebrae (Supporting Information Table S2;
3940); (17) pharyngeal jaws with elongated ceratobranchial 5, having
several larger elongated conical teeth; (18) nasal bones hook-shaped;
(19) no star-like pigmentation around eyes, pigmentation generally
reduced.
Description. General morphology: Body proportions are given in
Table 1. Body very slender and elongated, posteriorly laterally com-
pressed, body depth at pectoral fins 8.59.4 in SL, body depth at anus
8.811.8 in SL, body depth in width at pectoral fins 1.01.2, body
depth in width at anus 0.70.9. Body cross-section behind pectoral
fin base half oval to pentagonal with straight ventral side. Granules on
body shallow and inconspicuous. Head dorsoventrally compressed,
head depth in width at orbit 1.51.9, and moderately small, head
length 4.45.1 in SL, head wider than body width maximum, head
width at anterior sucking disc edge 0.70.8 in body width at pectoral
fins. Dorsal head profile Scurved, concave above eye and convex at
nape. Head rounded in dorsal view. Snout large compared to eyes,
preorbital distance 2.73.6 in head length, 0.30.4 in horizontal eye
diameter. Snout wide, not produced, blunt. Internostril space convex
to gently convex. Eyes dorsolateral, rounded or drop-like with slightly
pointed lower eye edge. Eyes small, 9.111.2 in head length, vertical
diameter of the eye 0.70.9 in horizontal eye diameter. Infraorbital
invagination below anterior half of eye or below mideye. Interorbital
distance wide, 0.30.4 in horizontal eye diameter. Centre of eye much
closer to tip of snout than to posterior margin of operculum, preorbital
distance in postorbital distance 1.82.4. Anterior and posterior
nostrils long tubes of about equal length. Nostrils well separated and
posterior nostril located behind and dorsally to the anterior edge of
eyes. Single large dermal flap of leaf shape at the posterior margin of
anterior nostril, longer than nostril. Posterior nostril rim crenate or
villose with no extension. Head lateral line system with canals with
pores and with superficial neuromasts arranged in rows. Head canals
reduced and pores small. Single pore in nasal canal near posterior nos-
tril. Single pore in postorbital canal close to posterior eye edge. Two
pores in mandibular canal, anterior one close to anteriolateral angle of
mouth, posterior pore slightly in front of vertical of posterior angle of
jaws, posterior pore usually more prominent. Lachrymal as well as
preopercular canals and pores absent. Rows of superficial neuromasts
as follows: SR 2, NR 3, LIR 2126, STR 23, POR 23, PTR 2, SLR 5,
MR 812, AVR 2, PVR 1, ADR 3, PDR 12, HR 3, SR1 3, SR2 12,
DLR 610, VLR 1216. STR and LIR rows of superficial neuromasts
placed in the well-defined deep groove. DLR row of superficial neu-
romasts anteriorly starts above pectoral fin, continuously dorsolateral
and ends posteriorly variably: downwards at midlateral level or above
it, at vertical from anus, or in front or behind it. VLR anteriorly starts
behind pectoral fin base, continuously ventrolateral and ends posteri-
orly upwards with last papilla nearly at midlateral level at caudal fin
base or more distant from it. Mouth terminal, upper and lower lips
end about equally, lips fleshy, upper lip larger than the lower lip. Pos-
terior angle of jaws extends to, or close to, a vertical line drawn
through the anterior edge of the anterior nostril. Chin with bilobed or
single lobed fold at anterior edge covering MR row of superficial neu-
romasts. Gill membrane is attached to isthmus, gill opening starting at
base of pectoral fin, with upper attachment of gill membrane opposite
FIGURE 8 Gouania pigra (Nardo, 1827), PMR VP3529, neotype,
female, 43.12+5.03 mm, Glavotok, Krk, Croatia. Lateral view of
specimen preserved in 4% formaldehyde (top). Lateral, dorsal and
ventral view, alive (below). Photographs by M. Wagner and M.
Kovacˇi
c
78 WAGNER ET AL.
FISH
to 3rd to 5th pectoral ray. Posterior opercular edge with two tips,
upper longer or equal to lower. No subopercular spine. No fleshy pad
present on lower pectoral base. Urogenital papilla present. Preanus
length in postanus length 0.70.9. Anal papillae absent, the area
around anus wrinkled.
Fins. Rudimentary dorsal and anal fins located well posteriorly and
short, reduced to low ridges with very weak rays, connected to caudal
fin. Pectoral rays 1316. Caudal fin rounded, principal caudal rays
1011. Ventral adhesive disc (Figure 4d) of doubletype, anterior
margin crenate or straight with large invagination on each lateral side
and central invagination at midventral; posterior margin crenate or
straight. Disc very small, disc length 6.98.3 in SL, its width slightly
larger than its length, width in length 0.81.0. No papillae in region A
and flattened papillae in regions B and C. In region B one or two rows
of papillae with total papillae count 1123 and in region C one or two
rows of papillae with total papillae count 411. No inner row of papil-
lae on lateral sides of the central part of the anterior disc. Upper
attachment of disc membrane attaching to base of pectoral fin at
12th15th pectoral ray, i.e., at ultimate or penultimate ray. Males can
have two prominent seemingly perfused finger-like extensions on
each site of sucking disc that sometimes equal or exceed length of
disc region A (Figure 4f).
Colouration. Background colouration of live specimens white to
flesh-coloured, slightly transparent (Figures 1b and 8) and no star-
shaped pigmentation around eyes. In life body almost pigmentless or
with very small pigments, leading to an irregular marbled pattern, but
never as strong as in other Gouania species (Supporting Information
File S1). Formaldehyde fixed specimens white-yellow and without pig-
ments. Ethanol fixed specimens white to skin-coloured pigmentation
reduced. For more pictures of life colouration see Supporting Informa-
tion File S1.
Dentition and osteology. Upper jaw with outer row of about eight
(one side) medium-sized caniniforms frontally. Behind them inner
small conical teeth irregularly scattered in two separate (left and right)
drop-like patches medially wide about 56 teeth, becoming narrowed
to a single row of teeth laterally. Outer row continues laterally as four
large caniniforms of variable size, followed behind by four to five
medium-sized caniniforms. Lower jaw with outer row of 10 to 12 (one
side) medium-sized caniniforms frontally. Behind them single broad
patch of small conical inner teeth medially wide about 56 teeth,
becoming narrowed to a single row of teeth laterally. The single row of
about six larger caniniforms continuous laterally. Pharyngeal jaws with
elongated ceratobranchial 5, having several (about 45) larger elongated
conical teeth (Figure 5d), pharyngobranchial 3 toothplate not visible on
3D models from microcomputed tomography (microCT) images. Num-
ber of vertebrae 3940, abdominal 17 and caudal 2223 (Supporting
Information Table S2). The first gill arch with hemibranch, the 2nd4th
gill arches with holobranchs. Six small, pointed rakers on third gill arch.
The subopercular element is present/absent as the terminal bone poste-
riorly. Subopercle indistinguishable from opercle, shaped as its posterior
elongated extension, not forming or having subopercular spine. Six
branchiostegals. Nasal bones hook-shaped. Maxillary, premaxillary, nasal
and ceratobranchial 5 bones shaped as on Figure 5d.
Etymology. The Latin adjective masculine singular nominative
pigerin Lepadogaster piger Nardo 1827, meaning slow-moving, was
changed to pigrain Gouania pigra which is an adjective feminine sin-
gular nominative, following the necessity of agreement in gender
(Article 31.2, ICZN, 1999).
Ecology and geographical distribution (Figure 1a). Gouania pigra
is endemic to the Adriatic Sea and hence the only purely marine endemic
fish known for this basin. The southernmost record is from Vlorë (Albany)
and it was (so far) not found on Corfu. Quantitative data on ecology is
largely lacking. Throughout its distribution range the species occurs in
sympatry with G. adriatica sp. nov. Sympatric and syntopic occurrence
with both G. adriatica sp. nov. and G. hofrichteri sp. nov. is only known
from Pelješac (Figure 1c). The species inhabits intertidal pebble beaches,
where it might be found even above the waterline during low tide, and
only rarely occurs in fields of larger boulders. See Supporting Information
Video S1 for locomotion behaviour.
Remarks. G. pigra (Nardo 1827) differs from all other Gouania
species by the posterior angle of jaws extending to, or close to, a ver-
tical line drawn through the anterior edge of the anterior nostril (vs.
posterior angle of jaws extending to between a vertical line drawn
through the posterior edge of the anterior nostril and a vertical line
drawn through the anterior edge of the eye in three other Gouania
species or even to below the anterior edge of the eyes to the anterior
part of the eye in G. orientalis sp. nov.). G. pigra differs from all other
congeneric species also by its overall reduced pigmentation. G. pigra
differs from the three stout-bodied Gouania species (G. adriatica sp.
nov.,G. orientalis sp. nov. and G. willdenowi) by dorsal head profile S
curved, concave above eye and convex at nape (vs. dorsal head profile
straight between nape above eye and upper lip tip), the absence of
star-like pigmentation around eyes (vs. no pigmentation around eyes)
and a large number of vertebrae (Supporting Information Table S2;
3940 vs.3538). Five morphometric characters as percentages of
standard length of G. pigra are nonoverlapping in range with all three
stout-bodied Gouania: head length, pectoral-fin length, prepectoral
distance, ventral adhesive disc length and caudal fin-length (values in
the Table 1). There are also morphometric characters nonoverlapping
in range with one or two out of three stout-bodied Gouania species
(Table 1). In addition, it differs from G. willdenowi by infraorbital invag-
ination below anterior half of eye or below mideye (vs. infraorbital
invagination vertical to posterior part of eye); from G. orientalis sp.
nov. by pectoral rays 1316 (vs. pectoral rays 1719), upper attach-
ment of disc membrane attaching to base of pectoral fin at 12th15th
pectoral ray (vs. upper attachment of disc membrane attaching to base
of pectoral fin at 16th18th pectoral ray), infraorbital invagination
below anterior half of eye or below mideye (vs. infraorbital invagina-
tion vertical to posterior part of eye); and from G. adriatica sp. nov. by
posterior opercular edge with two tips, upper longer or equal to lower
(vs. posterior opercular edge with pointed upper tip and rounded
lower edge) and principal caudal rays 1011 (vs. principal caudal-fin
rays 1213). Gouania pigra differs from another slender-bodied species,
G. hofrichteri sp. nov., by posterior opercular edge with two tips, upper
longer or equal to lower (vs. posterior opercular edge with pointed
upper tip and rounded lower edge), longitudinal infralateral and
WAGNER ET AL.79
FISH
suborbital transversal rows of superficial neuromasts placed in the well-
defined deep groove (vs. longitudinal infralateral and suborbital trans-
versal rows of superficial neuromasts placed in shallow groove dis-
appearing in posterior part of longitudinal infralateral row), body cross-
section behind pectoral fin base half oval to pentagonal with straight
ventral side (vs. body cross-section behind pectoral fin base triangular
with ventral flat and dorsal pointed), and the granules on body shallow
and inconspicuous (vs. granules on body, at least on posterior part and
nape, large and prominent). It is known from the Adriatic Sea and has a
nonoverlapping geographic distribution range with G. orientalis sp. nov.,
and G. willdenowi. Based on the distributional data presented here, dif-
ferential morphological and genetic characters as well as the taxonomic
positioning of the species G. pigra (see Discussion, Taxonomical and sys-
tematic considerations below) and the fact that no original types (holo-,
lectotypes) exist we designate a neotype for this species. The desig-
nated neotype was collected on the island of Krk, close to the original
locus typicus (Rovinj, northern Adriatic Sea) and is accessible at the
voucher numbers PMR VP3529 at the PMR.
Neotype designation. We designated a neotype for G. pigra, ful-
filling the qualifying conditions (Article 75.3, ICZN, 1999). We are pos-
itive that no name-bearing type specimens exist for G. pigra (Fricke
et al., 2020b; Article 75.3.4, ICZN, 1999). The genus Gouania repre-
sents a complex zoological problem (Article 75.2, ICZN, 1999) of mor-
phologically very similar congenerics. The redescription of G.
willdenowi, resurrection of G. pigra and description of three new spe-
cies of Gouania in the hitherto monotypic genus thus represented an
exceptional need for designation of a neotype for G. pigra (Article
75.3, ICZN, 1999). The situation could become even more compli-
cated if more Gouania linages were to be found around the Mediterra-
nean. In that case, the name-bearing material of the present species,
holotypes and neotypes, should be available for comparison with
potential new material. The diagnostic characters are stated in the
species redescription (Article 75.3.1, ICZN, 1999), which is sufficient
to ensure the recognition of the species (Article 75.3.3, ICZN, 1999).
The neotype fits the original species descriptions of G. pigra
(Nardo, 1827a and Nardo, 1827b; Article 75.3.5, ICZN, 1999) and the
neotype were collected close to the original type localities (Article
75.3.6, ICZN, 1999). The neotype is stored in a scientific museum col-
lection (Article 75.3.7, ICZN, 1999).
3.1.6 |Gouania willdenowi (Risso 1810)
English name: Blunt-snouted clingfish
Neotype. PMR VP4574, male, 46.11 + 6.56 mm, Cagnes-sur-mer,
Nice, France, 4339022.100N, 710025.300 E, coll. M. Wagner, October 9,
2016 (Figure 9).
Additional material examined. PMR VP4568, female, 36.2
+ 5.18 mm, PMR VP4569, female, 33.65 + 4.93 mm and PMR
VP4570, male, 31.13 + 4.36 mm, all from Banyuls-sur-mer, France,
4229018.600N, 307043.900 E, coll. M. Wagner, October 11, 2016;
ZSM-PIS-047654, female, 40.03 + 5.41 mm, Cagnes-sur-mer, Nice,
France, 4339022.100N, 710025.300 E, coll. M. Wagner, October 9,
2016; PMR VP4575, male, 42.34 + 6.01 mm, PMR VP4576, female,
40.5 + 5.58 mm and ZSM-PIS-047655, male, 28.42 + 5.94 mm, all
from Cagnes-sur-mer, Nice, France, 4339022.100N, 710025.300 E, coll.
M. Wagner, October 10, 2016; PMR VP4577, female, 39.59
+ 5.63 mm and PMR VP4578, female, 36.82 + 5.4 mm, both from Le
Port d'Alon, Toulon, France, 4308047.800N, 542027.200 E, coll. M. Wag-
ner, October 16, 2016.
Synonyms. Lepadogaster willdenowi Risso, 1810: 75 (original
description; type locality: Nice; holotype: unknown); Rupisuga nicensis
Swainson 1839: 339 (original description; type locality: Nice?; holo-
type: unknown), Lepadogaster latirostris Costa 1850: 4 (original
description; type locality: Naples; holotype: unknown); Leptopterygius
wildenowi Troschel, 1860: 206 (original description; type locality: Nice;
holotype: unknown); Leptopterygius coccoi Troschel, 1860: 207 (origi-
nal description; type locality: Messina; holotype: unknown).
Diagnosis. Gouania willdenowi differs from congeneric species by
the combination of the following characters: (1) dorsal head profile
straight between nape above eye and upper lip tip; (2) posterior angle
of jaws extends to between a vertical line drawn through the poste-
rior edge of the anterior nostril and a vertical line drawn through the
anterior edge of the eye; (3) infraorbital invagination vertical to poste-
rior part of eye; (4) posterior opercular edge w-shaped with two
equally long tips; (5) longitudinal infralateral and suborbital transversal
rows of superficial neuromasts placed in the well-defined deep
groove; (6) trunk cross-section behind pectoral fin base half oval with
straight ventral side; (7) granules on body shallow and inconspicuous;
(8) vertical eye diameter 2.63.3% of standard length; (9) horizontal
eye diameter 2.32.9% of standard length; (10) head length
24.328.8% of standard length; (11) pectoral-fin length 8.69.3% of
standard length; (12) prepectoral distance 24.428.4% of standard
FIGURE 9 Gouania willdenowi (Risso 1810), PMR VP4574,
neotype, male, 46.11+6.56 mm, Cagnes-sur-mer, Nice, France. Lateral
view of specimen preserved in 4% formaldehyde (top). Lateral, dorsal
and ventral view, alive (below). Photographs by M. Wagner and M.
Kovacˇi
c
80 WAGNER ET AL.
FISH
length; (13) ventral adhesive disc length 17.119.3% of standard
length; (14) caudal-fin length 13.515.5% of standard length; (15)
moderate number of vertebrae for the genus (Supporting Information
Table S2; 3738); (16) pharyngeal jaws with small ceratobranchial 5,
having several small conical teeth; (17) nasal bones club-shaped; (18)
star-like pigmentation around eyes, in life body colouration dark with
clear stripes visible in less pigmented specimens; (19) distribution
range restricted to the western Mediterranean.
Description. General morphology: Body proportions are given in
Table 1. Body slender and elongated, posteriorly laterally compressed,
body depth at pectoral fins 7.58.8 in SL, body depth at anus
8.811.4 in SL, body depth in width at pectoral fins 1.11.3, body
depth in width at anus 0.80.9. Body cross-section behind pectoral
fin base half oval with straight ventral side. Granules on body shallow
and inconspicuous. Head dorsoventrally compressed, head depth in
width at orbit 1.51.9, and moderately large, head length 3.54.1 in
SL, head wider than body width maximum, head width at anterior
sucking disc edge 0.70.8 in body width at pectoral fins. Dorsal head
profile straight between nape above eye and upper lip tip. Head
rounded in dorsal view. Snout large compared to eyes, preorbital dis-
tance 2.83.5 in head length, 0.3 in horizontal eye diameter. Snout
wide, not produced, blunt. Internostril space gently convex. Eyes dor-
solateral, with lower eye edge rounded. Eyes small, 9.111.0 in head
length, vertical diameter of the eye 0.81.0 in horizontal eye diameter.
Infraorbital invagination vertical to posterior part of eye. Interorbital
distance wide, 0.30.4 in horizontal eye diameter. Centre of eye much
closer to tip of snout than to posterior margin of operculum, preorbital
distance in postorbital distance 1.72.3. Anterior and posterior
nostrils long tubes of about equal length. Nostrils well separated and
posterior nostril located behind and dorsally to the anterior edge of
eyes. Single large dermal flap of leaf shape at the posterior margin of
anterior nostril, longer than nostril. Posterior nostril rim crenate with
no extension. Skin with small granules. Head lateral line system with
canals with pores and with superficial neuromasts arranged in rows.
Head canals reduced and pores small. Single pore in nasal canal near
posterior nostril. Single pore in postorbital canal close to posterior eye
edge. Two pores in mandibular canal, anterior one close to
anteriolateral angle of mouth, posterior pore slightly in front of verti-
cal of posterior angle of jaws, posterior pore usually more prominent.
Lachrymal as well as preopercular canals and pores absent. Rows of
superficial neuromasts as follows: SR 2, NR 3, LIR 2428, STR 34,
POR 34, PTR 23, SLR 56, MR 1011, AVR 2, PVR 1, ADR 23,
PDR 01, HR 34, SR1 34, SR2 12, DLR 69, VLR 1114. STR and
LIR rows of superficial neuromasts placed in the well-defined deep
groove. DLR row of superficial neuromasts anteriorly starts above
pectoral fin, continuously dorsolateral and ends posteriorly down-
wards at midlateral level above anus. VLR anteriorly starts
behindpectoral fin base, continuous ventrolaterally and ends posteri-
orly upwards with last papilla nearly at midlateral level at caudal-fin
base. Mouth terminal, upper and lower lips ends about equally, lips
fleshy, upper lip larger than the lower lip. Posterior angle of jaws
extends to between vertical line drawn through posterior edge of
anterior nostril and vertical line drawn through anterior edge of eye.
Chin with bilobed fold at anterior edge covering MR row of superficial
neuromasts. The gill membrane is attached to isthmus, gill opening
starting at the base of pectoral fin, with the upper attachment of the
gill membrane is opposite to 4th6th pectoral ray. Posterior opercular
edge w-shaped with two equally long tips. No subopercular spine. No
fleshy pad present on lower pectoral base. Urogenital papilla present.
Preanus length in postanus length 0.70.8. Anal papillae absent, the
area around anus wrinkled.
Fins. Rudimentary dorsal and anal fins located well posteriorly and
short, reduced to low ridges with very weak rays, connected to the
caudal fin. Pectoral rays 1619. Caudal fin rounded, principal caudal
rays 1112. Ventral adhesive disc (Figure 4e) of doubletype, ante-
rior margin crenate with large invagination on each lateral side; poste-
rior margin crenate. Disc small, disc length 5.25.9 in SL, its width
slightly larger than its length, width in length 0.91.0. No papillae in
region A and flattened papillae in regions B and C. In region B two
rows of papillae with total papillae count 1728 and in region C two
rows of papillae with total papillae count 914. No inner row of papil-
lae on lateral sides of the central part of the anterior disc. Upper
attachment of disc membrane attaching to base of pectoral fin at
15th18th pectoral ray, i.e., penultimate ray. Males can have two
prominent seemingly perfused finger-like extensions on each site of
sucking disc that sometimes equal or exceed length of disc region A
(Figure 4f) (Hofrichter, 1995; Hofrichter & Patzner, 2000).
Colouration. Background colouration of live specimens flesh-
coloured, orange or yellow (Figure 9) and star-like pigmentation
around eyes present. In life body coloration with dark clear stripes vis-
ible in less pigmented specimens (e.g., Messina), other specimens with
irregular marbled pattern. Formaldehyde fixed specimens white-
yellow and without pigments. Ethanol fixed specimens white to skin
coloured, striped pigmentation visible. For more pictures of life
colouration see Supporting Information File S1.
Dentition and osteology. Upper jaw with outer row four (one side)
medium-sized caniniforms frontally, two median teeth larger. Behind
them inner small conical teeth irregularly scattered in two separate
(left and right) droplike patches medially wide about 45 teeth,
becoming narrowed to a single row of teeth laterally. Outer row con-
tinues laterally as single large caniniform, followed behind by three
medium-sized caniniforms. Lower jaw with outer row of eight10
(one side) medium-sized caniniforms frontally. Behind them single
broad patch of small conical inner teeth medially wide about 34
teeth, becoming narrowed to a single row of teeth laterally. The single
row of four larger caniniforms continuous laterally. Pharyngeal jaws
with small ceratobranchial 5 having several (67) small conical teeth
(Figure 5e), pharyngobranchial 3 toothplate not visible on 3D models
from microcomputed tomography (microCT) images. Number of verte-
brae 3738, abdominal 16 and caudal 2122 (Supporting Information
Table S2). The first gill arch with hemibranch, the 2nd4th gill arches
with holobranchs. Subopercle indistinguishable from opercle, shaped
as its posterior elongated extension, not forming or having
subopercular spine. Six branchiostegals. Club-shaped nasal bones.
Maxillary, premaxillary, nasal and ceratobranchial 5 bones shaped as
on Figure 5e.
WAGNER ET AL.81
FISH
Etymology. Risso (1810) formed the name from a personal name,
as the noun in the genitive case, with iadded to the stem of the
name (presently under Article 31.1.2., ICZN, 1999). We followed the
spelling of the species as recommended by Fricke et al. (2020b), G.
willdenowi. In the text of the original description it appeared as 4. L.
Willdenow. N. L. Willdenowi. So we concluded that Wildenowiiin
the index represents a case of misspelling (Risso, 1810). We think that
the name was given in honour of Carl Ludwig Willdenow, even though
this is not explicitely stated in Risso (1810). Hence, L. willdenowi
would be the correct spelling of the name.
Ecology and geographical distribution (Figure 1a). The distribu-
tion range of G. willdenowi is restricted to the western Mediterranean
basin with an easternmost record from Messina (Sicily). The species
reaches highest abundances in pebble and boulder beaches of less
than 0.5 m depth (24 individuals/m
2
in Messina), but can be found
down to 2 m of water depth (Hofrichter & Patzner, 2000;
Patzner, 1999). Gouania willdenowi can be sometimes found in sym-
patry with Lepadogaster lepadogaster and males build and guard nests
under boulders during spawning season (Hofrichter, 1995; own
observations).
Remarks. Gouania willdenowi differs from known congeners by
various characters among which the most useful were selected for
diagnosis and are elaborated on here. Some of the characters differing
among (some) species and that are not used in the species diagnosis
are nonetheless mentioned here as they are interesting for compari-
son. G. willdenowi differs from slender-bodied Gouania species (G.
pigra and G. hofrichteri sp. nov.) by a straight dorsal head profile
between nape above eye and upper lip tip (vs. dorsal head profile in
lateral view Scurved, concave above eye and convex at nape),
infraorbital invagination vertical to posterior part of eye (vs.
infraorbital invagination below anterior half of eye or below mideye)
and a star-like pigmentation around eyes (vs. no pigmentation around
eyes). Eleven morphometric characters as percentages of standard
length of G. willdenowi are nonoverlapping in range with both slender-
bodied Gouania: head length, all three head width measures, preorbital
distance, pectoral-fin length, prepectoral distance, ventral adhesive
disc length, distance between the posterior margin of sucking disc and
anus, caudal base depth and caudal-fin length (values in the Table 1).
There are also morphometric characters nonoverlapping in range with
only one of the two slender-bodied Gouania (Table 1). In addition, G.
willdenowi differs from G. pigra by a posterior angle of jaws which
extending to between vertical line drawn through posterior edge of
anterior nostril and vertical line drawn through anterior edge of eye
(vs. posterior angle of jaws extending at, or close to, vertical line
drawn through anterior edge of anterior nostril). G. willdenowi also dif-
fers from G. hofrichteri sp. nov. by posterior opercular edge w-shaped
with two equally long tips (vs. posterior opercular edge with pointed
upper tip and rounded lower edge), longitudinal infralateral and subor-
bital transversal rows of superficial neuromasts placed in the well-
defined deep groove (vs. longitudinal infralateral and suborbital trans-
versal rows of superficial neuromasts placed in shallow groove dis-
appearing in posterior part of longitudinal infralateral row), body
cross-section behind pectoral fin base half oval with straight ventral
side (vs. trunk cross-section behind pectoral fin base triangular with
ventral flat and dorsal pointed) and the granules on body shallow and
inconspicuous (vs. granules on body, at least on posterior part and
nape, large and prominent). G. willdenowi differs from the stout-bodied
species G. adriatica sp. nov. by posterior opercular edge w-shaped
with two equally long tips (vs. posterior opercular edge with pointed
upper tip and rounded lower edge) and by vertical eye diameter
2.63.3% and horizontal eye diameter 2.32.9% of standard length
(vs. vertical eye diameter 3.44.3% and horizontal eye diameter
3.03.7% of standard length). G. willdenowi has no nonoverlapping
external morphological differences to G. orientalis sp. nov. but differs
by its larger number of vertebrae (Supporting Information Table S2;
3738 vs.3536). G. willdenowi is only known from the Western Med-
iterranean and has nonoverlapping geographic distribution with all
other Gouania species. Based on the distributional data presented
here, morphological and genetic data as well as the taxonomic posi-
tioning of the species G. willdenowi (see Discussion, Taxonomical and
systematic considerations below) and the fact that no original types
(holo-, lectotypes) exist we designate a neotype for this species. The
designated neotype was collected close to the original locus typicus
(Nice, France) and is accessible as the voucher number PMR
VP4574 at the PMR.
Neotype designation. We designated a neotype for G.
willdenowi, fulfilling the qualifying conditions (Article 75.3,
ICZN, 1999). We are positive that no name-bearing type specimens
exist for G. willdenowi (Fricke et al., 2020b; Article 75.3.4,
ICZN, 1999). The genus Gouania represents a complex zoological
problem (Article 75.2, ICZN, 1999) of morphologically very similar
congenerics. The redescription of G. willdenowi,resurrectionofG.
pigra and description of three new species of Gouania in the hitherto
monotypic genus thus represented an exceptional need for designa-
tion of a neotype for G. willdenowi (Article 75.3, ICZN, 1999). The
situation could become even more complicated if more Gouania lin-
ages were to be found around the Mediterranean, which is not at all
unlikely. In that case, the name-bearing material of the present spe-
cies, holotypes and neotypes, should be available for comparison
with potential new material. The diagnostic characters are stated in
the species redescription (Article 75.3.1, ICZN, 1999), which is suffi-
cient to ensure the recognition of the species (Article 75.3.3,
ICZN, 1999). The neotype fits the original species descriptions of G.
willdenowi (Risso, 1810; Article 75.3.5, ICZN, 1999) and the neotype
were collected close to the original type localities (Article 75.3.6,
ICZN, 1999). The neotype is stored in a scientific museum collection
(Article 75.3.7, ICZN, 1999).
3.2 |Genetics
Based on COI sequence data, the genus Gouania can be divided into
five major lineages with net divergences (Kimura-2 paramter model)
between groups ranging from 7.69% to 15.12% (Figure 10a). These
genetic clusters are also supported by previous multilocus phyloge-
netic analyses (Wagner et al., 2019). Using clingfish specific
82 WAGNER ET AL.
FISH
substitution rates following Conway et al. (2017a), the onset of the
Gouania radiation was dated to 3.18 (95% highes posterior density
interval, 2.065.57) million years ago (Wagner et al., 2019). Further-
more, this phylogeny places G. orientalis sp. nov. as the sister group of
G. adriatica sp. nov.. The investigation of minimum interspecific versus
maximum intraspecific divergence (in %) revealed a clear gap
(barcoding gap) between these two values for all the Gouania spe-
cies (Figure 10b). Nonetheless, we found high maximum intraspecific
values for the eastern Mediterranean clades G. hofrichteri sp. nov.
(2.443.02%) and even larger ones for G. orientalis sp. nov.
(4.005.38%), which suggests strong phylogeographic/population
genetic structure within these clades.
4|DISCUSSION
4.1 |Taxonomic considerations
In this work, based on genetic, morphological and biogeographic evi-
dence, and building upon our previous phylogenetic study (Wagner
et al., 2019), we describe three new species of the genus Gouania
(Nardo 1833) for the Mediterranean Sea and provide redescriptions
and designation of neotypes for G. willdenowi and G. pigra. Generally,
the systematics and taxonomy of European clingfishes is complex and
highly influenced by descriptions of the 19th century (Briggs, 1955;
Hofrichter, 1995). This is also true for Gouania, with the first
FIGURE 10 Results of DNA-barcoding analyses. (a) Net between-group mean distances (mean and S.E.). The phylogeny shown in this figure
is based on Wagner et al. (2019). (b) DNA-barcoding gap represented by boxplots showing maximum intraspecific and minimum interspecific
divergences in %
WAGNER ET AL.83
FISH
uncertainties arising already with the description of G. willdenowi.
Risso (1810) delivered a very poor drawing alongside a partly fanciful
description (due to the typical writing style in those days), which was
later criticized by many authors (Canestrini, 1864; De Filippe, 1861;
Troschel, 1860) and could be responsible for the overall taxonomic
confusion in the genus (Hofrichter, 1995). Because Risso's description
was not discriminative for any of our five species of Gouania and
because the type material of the original description is not available
anymore (Fricke et al., 2020a,b), we designated the only Gouania spe-
cies occurring at the original type locality (Nice), and the western
Mediterranean basin, as G. willdenowi (with a neotype), according to
Article 75.3 of the ICZN. Briggs (1955) and Hofrichter (1995) listed
several synonyms, four of which, Rupisuga nicensis Swainson1839,
Lepadogaster latirostris Costa 1850, Leptopterygius wildenowi
Troschel 1860 and Leptopterygius coccoi Troschel 1860, can be geo-
graphically and/or morphologically linked to G. willdenowi.
Whereas no species were described from the eastern Mediterra-
nean basin, two further Gouania descriptions from the Adriatic Sea
(Rovinj) are known, Lepadogaster piger Nardo 1827 (Nardo, 1827a,
which he repeated in Nardo, 1827b), and Gouania prototypus Nardo
1833. In general, Nardo's descriptions are more accurate than the one
by Risso (1810), but there is evidence that G. prototypus is a junior
synonym of G. pigra. In Nardo's original description of Gouania he
directly refers twice to the species L. piger (Nardo, 1833: 548: ()
Eine neue Art von Lepadogaster,welcher Rücken und Afterflosse fehlen,
und die er Lepadogaster piger nennt.()Lepadogaster piger Nardo Prod.
(), hat ein Merkmal,welches wichtig genug ißt,um sie zu einer eigenen
Sippe zu erheben,welche er Covania (), nennen will mit dem Spezies
Namen prototypus), which he elevates to the new genus and gives
(for unknowable reasons) a new species epithet prototypus. The fact
that Nardo (1860:79) himself only mentions G. pigra in his later work
and Steindachner (1868:687), listed G. pigra s. prototypus Nardo as a
synonym of G. willdenowi supports this hypothesis. We therefore
regard prototypus as a synonym of pigra. Due to a change in the genus
name (from Lepadogaster to Gouania), in accordance with Article 31.2,
ICZN, 1999, the species epithet piger was changed to pigra, to avoid
misspelling. The putative locus typicus of G. pigra (Rovinj, northern
Adriatic Sea) as well as all characters mentioned in Nardo's descrip-
tions (Nardo, 1827a:102, Nardo, 1833:548) would match, except for
the pectoral fin ray count, both Adriatic species, Adriatic slenderand
Adriatic stout(according to the terminology of Wagner et al., 2019).
In the description, Nardo (1833:548) mentions a total pectoral fin ray
count of 12 for G. pigra s. prototypus. Albeit not matching the fin ray
count of either species, this is quite far from the known Adriatic
stoutpectoral ray count, which is 1517, and the most parsimonious
explanation is that these pectoral counts are not present in this spe-
cies. Our Adriatic slenderspecimens, however, have a pectoral ray
count of 1316, which might indicate that either Nardo miscounted
pectoral rays by one ray or that the true range in G. pigra population
for the pectoral fin ray count is indeed 1216, slightly larger than
established on the present material. Therefore, we assigned the
Adriatic slendermorphotype presented in Wagner et al. (2019) to G.
pigra and designated a neotype from the type locality. The taxonomic
revision of Gouania, including a single valid species (G. willdenowi), one
resurrected species (G. pigra) and three newly described species (G.
adriatica,G. orientalis and G. hofrichteri), forms the necessary founda-
tion for further biological, ecological and evolutionary investigations
of this genus.
4.2 |The Gouania radiation in the Mediterranean
Sea: an eco-evolutionary outlook
Tiny cryptic fishes, or in a broader sense cryptobenthic fishes, are
among the most diverse groups of vertebrates on this planet, which
can be linked to their biology and ecology (reviewed by Brandl
et al., 2018). First, their small body size enables them to invade a vari-
ety of niches, inaccessible for large reef fishes, and allows coexisting
competing species to partition niches between them (e.g., Ahmadia
et al., 2018; Brandl et al., 2020; Goatley et al., 2016; Herler, 2007;
Kovacˇi
cet al., 2012; Rüber et al., 2003; Tornabene et al., 2013). Sec-
ond, due to their rather stationary benthic lifestyle and limited active
dispersal abilities, they are particularly prone to diversify in the face of
spatial reproductive isolation (e.g., Colin, 2010; Tornabene
et al., 2015; Winterbottom et al., 2014).
This is also true for the genus Gouania, which inhabits the narrow
interstitial space of intertidal pebble beaches (Hofrichter &
Patzner, 2000). Beyond their small size (typically <50 mm SL), they
evolved remarkable morphological and behavioural adaptations that
foster their survival in an otherwise hostile environment. Hence,
Gouania has the largest number of vertebrae compared to all other
European clingfishes (Briggs, 1955), which promotes an increased
body flexibility and could be the decisive evolutionary factor for
invading this particular habitat (Wagner et al., 2019; Yamada
et al., 2009). Furthermore, studies showed that, during low tide,
Gouania can endure for hours in moist parts of pebble layers without
being harmed (Bileceno
glu, 2015). This amphibious emergence behav-
iour is considered passive rather than active and is most likely linked
to tidal changes (Hofrichter & Patzner, 2000; Bileceno
glu, 2015; own
observations). Yet, general knowledge about biology, ecology or
behaviour of the genus Gouania remains scarce. Compared to numer-
ous studies that have been conducted on the sister genus
Lepadogaster (e.g., Faria & Gonçalves, 2010; Gonçalves et al., 1996,
1998; Hofrichter & Patzner, 2000; Tojeira et al., 2012; Trkov &
Lipej, 2019), only a few ecological studies mention Gouania
(Hofrichter, 1995; Hofrichter & Patzner, 2000; Kovacˇi
c, 1997;
Patzner, 1999). Apart from the studies performed in the western
Mediterranean, which deliver important insights into the microhabitat
characteristics of G. willdenowi, it is impossible to relate these data to
any of the (re)described Gouania species. Nonetheless, the taxonomic
revision of the genus Gouania opens up new opportunities to investi-
gate putative ecological aspects that triggered macroevolutionary
changes in the Gouania radiation. Niche partitioning is a crucial driver
in cryptobenthic fish diversification (Brandl et al., 2018) and could be
a key factor for explaining the independent evolution of sympatrically
occurring Gouania morphotypes stout(G. willdenowi,G. adriatica sp.
84 WAGNER ET AL.
FISH
nov. &G. orientalis sp. nov.) and slender(G. pigra,G. hofrichteri sp.
nov.) in the Adriatic and eastern Mediterranean basin. We discussed
previously that due to their increased number of vertebrae (>38), the
slendermorphs could be better adapted to a life in finer gravel than
the congeneric stoutspecies (Wagner et al., 2019). This association
between increased body flexibility and microhabitat choice has been
previously reported for interstitial gobies (Yamada et al., 2009). So far,
few quantitative studies have been conducted on Mediterranean
cryptobenthic fish assemblages in general (e.g., Glavicˇi
cet al., 2016,
2020; Kovacˇi
cet al., 2012; Santin & Willis, 2007; Thiriet et al., 2016)
and knowledge about basic life history traits (e.g., reproductive biol-
ogy, larval behaviour and ontogeny) is lacking for many species. Con-
sidering the crucial global role of cryptobenthic fishes for near-shore
ecosystem functioning (Brandl et al., 2019; Depczynski &
Bellwood, 2003), however, such data are invaluable, particularly
because these traits are often linked to population connectivity and
diversification patterns in many marine littoral species (e.g., Ahmadia
et al., 2018; Galarza et al., 2009; Palumbi, 1994; Riginos et al., 2011).
In accordance with their stationary biology (i.e., benthic breeding,
cryptic behaviour, poor swimming), most cryptobenthic fishes have
limited dispersal abilities as adults and the extent of dispersion
depends on a temporary pelagic larval phase, which is often used as a
proxy for estimating marine population connectivity (reviewed by
Selkoe & Toonen, 2011). Since the pelagic larval duration (PLD) is
comparatively short in cryptobenthic fishes (Beldade et al., 2007;
Macpherson & Raventos, 2006), it is assumed that the majority of
these taxa show a fine-scale geographic structure. Indeed,
cryptobenthic taxa, including clingfishes, comprise many endemic spe-
cies and genera (Briggs, 1955; Conway et al., 2017c). This is particu-
larly true for the genus Gouania, which is endemic to the
Mediterranean ecoregion and includes species that are exclusively
confined to main basins (Figure 1a). Among truly marine Mediterra-
nean fishes, the small geographic distribution ranges of the various
Gouania species are considered to be exceptional, especially compared
to the sister genus Lepadogaster, which shows, despite its much wider
distribution range (north-eastern Atlantic to Mediterranean), almost
no phylogeographic structure in the Mediterranean basin (Wagner
et al., 2017). Additionally, the high values of intraspecific divergences
(Figure 10b) in the eastern Mediterranean species, G. orientalis sp.
nov. and G. hofrichteri sp. nov., suggest further population sub-
structuring on an even smaller scale. Oceanic currents and fronts
(Figure 1a) have been shown to play an important role for shaping
population differentiation in several benthic Mediterranean fishes (e.
g., Galarza et al., 2009; Schunter et al., 2011; Koblmüller et al., 2015;
Sefc et al., 2020) and also in Gobiesocidae (Klein et al., 2016). How-
ever, to what extent this is true for cryptobenthic fishes in general
and clingfishes in particular remains questionable, since most larvae
and juveniles stay nearshore (Beldade et al., 2006; Brandl et al., 2019;
Macpherson & Raventos, 2006; Sefc et al., 2020). Larvae of Gouania
are considered to drift close to shores and unlikely to transcend into
larger circulation systems, which would be crucial for long distance
dispersal (Macpherson & Raventos, 2006; Wagner et al., 2019). Thus,
population patterns in Gouania might be rather linked to local (e.g.,
winds) and temporal (e.g., seasons) factors, similar to the sister genus
Lepadogaster (Klein et al., 2016). Furthermore, studies showed that
even congeneric species of Lepadogaster can have a different pace
and pattern of larval development, which impacts the duration of the
planktonic larval stage (Faria & Gonçalves, 2010; Tojeira et al., 2012).
Warm temperate seas, like the Mediterranean, seasonally fluctuate in
water temperature and local current structure, which could impact the
development and distribution of Gouania larvae (Figure 1a; El-Geziry &
Bryden, 2010). Nonetheless, active behaviour of larvae could influ-
ence population differentiation in Gouania. Keeping recruits close to
natal sites is common among cryptobenthic fishes (Milá et al., 2017;
Rüber et al., 2003) and could be, especially in remote areas (e.g.,
islands), an effective strategy for sustaining populations (Brandl
et al., 2019). Thus far, ontogenetic studies on Gouania are lacking, but
studies on Lepadogaster clearly showed that after hatching larvae are
already very well developed and good swimmers (Faria &
Gonçalves, 2010; Guitel, 1888; Tojeira et al., 2012), and juveniles of
Apletodon are able to actively seek suitable microhabitats when they
switch to the benthic lifestyle (Gonçalves et al., 2002). Extrapolating
from this, it is very likely that Gouania larvae are already equipped
with sensory organs that could allow them to actively return to natal
sites (Gerlach et al., 2007). Suitable microhabitats for Gouania inter-
tidal pebble beaches are rare compared to long stretches of bedrock
coast at tidal level, resulting in a dotted presence of this habitat (e.g.,
all along the Eastern Adriatic Sea). This additionally increases the need
for an active return to natal sites for Gouania species, as compared to
other clingfish species that typically occur somewhat deeper than
Gouania. Altogether, this could explain the micro-allopatric patterns
observed in the Gouania radiation (also see Wagner et al., 2019) and
raises the question of whether there is even more unexplored diver-
sity in the genus, particularly in remote areas and locations where
Gouania was recorded in the past (see records of Hofrichter (1995) in
Figure 1a).
To sum up, the Gouania radiation is most likely a product of bio-
geographic and ecological factors and bears high potential for future
research. Future studies on the sympatric species pairs of the Adriatic
and eastern Mediterranean will unravel the role of adaptive ecological
drivers in the early stages of the radiation. Additionally, population
genetic studies in combination with oceanographic modelling might
illuminate thrilling microevolutionary patterns and more hidden diver-
sity in this enigmatic fish radiation.
ACKNOWLEDGEMENTS
We want to thank Sandra Bracˇun, Robert Hofrichter, Samuel P.
Iglesias, Enerit Sacdanaku and Stamatis Zogaris for their help with
sampling and/or obtaining sampling permits. Furthermore, the authors
thank Kevin Conway for the valuable discussions considering the
complex taxonomic situation and the anonymous reviewers for their
valuable suggestions that helped to improve the manuscript. This
work was supported in part by the Austrian Research Association
(ÖFG; to M.W.), the University of Graz (KUWI stipend & Heinrich-
Jörg Foundation; to M.W.) and the Austrian Academy of Science
(ÖAW DOC Scholarship; to M.W.). Additionally, M.K. was supported
WAGNER ET AL.85
FISH
by grants of the Croatian Science Foundation (projects IP-
2016-06-9884 and IP-2016-06-5251). We further acknowledge the
financial suppoprt by the University of Graz for covering the open
access publication costs.
CONTRIBUTIONS
M.W. was responsible for the study design, field work, fish identifica-
tion, generation and analysis of the data, and wrote the manuscript.
M.K. participated in some field work, generated and analysed morpho-
logical/morphometric data and contributed to manuscript writing. S.K.
participated in some fieldwork, supervised the research and data
interpretation and contributed to manuscript writing. All authors read
the manuscript and approved the final version.
ORCID
Maximilian Wagner https://orcid.org/0000-0002-0949-8410
Marcelo Kovacˇi
chttps://orcid.org/0000-0002-4049-9366
Stephan Koblmüller https://orcid.org/0000-0002-1024-3220
REFERENCES
Ackerman, J. L., & Bellwood, D. R. (2000). Reef fish assemblages: A re-
evaluation using enclosed rotenone stations. Marine Ecology Progress
Series,206, 227237.
Ahmadia, G. N., Tornabene, L., Smith, D. J., & Pezold, F. L. (2018). The rela-
tive importance of regional, local, and evolutionary factors structuring
cryptobenthic coral-reef assemblages. Coral Reefs,37, 279293.
Almada, F., Henriques, M., Levy, A., Pereira, A., Robalo, J., & Almada, V. C.
(2008). Reclassification of Lepadogaster candollei based on molecular
and meristic evidence with a redefinition of the genus Lepadogaster.
Molecular Phylogenetics and Evolution,46, 11511156.
Beldade, R., Borges, R., & Gonçalves, E. J. (2006). Depth distribution of
nearshore temperate fish larval assemblages near rocky substrates.
Journal of Plankton Research,28, 10031013.
Beldade,R.,Pedro,T.,&Gonçalves,E.J.(2007).Pelagiclarvaldurationof
10 temperate cryptobenthic fishes. Journal of Fish Biology,71,376382.
Bileceno
glu, M. (2015). First observation of the amphibious behaviour of
Gouania willdenowi (Gobiesocidae) in the eastern Mediterranean Sea.
New Mediterranean Biodiversity Records,16, 270.
Bileceno
glu, M., Yokes¸, M. B., & Kovacˇi
c, M. (2017). A new species of Dip-
lecogaster (Actinopterygii: Gobiesocidae) from the Mediterranean Sea.
Zoology in the Middle East,63, 210218.
Brandl, S. J., Casey, J. M., & Meyer, C. P. (2020). Dietary and habitat niche
partitioning in congeneric cryptobenthic reef fish species. Coral Reefs,
39, 305317.
Brandl, S. J., Goatley, C. H. R., Bellwood, D. R., & Tornabene, L. (2018). The
hidden half: Ecology and evolution of cryptobenthic fishes on coral
reefs. Biological Reviews,93, 18461873.
Brandl, S. J., Tornabene, L., Goatley, C. H. R., Casey, J. M., Morais, R. A.,
Côté, I. M., Bellwood, D. R. (2019). Demographic dynamics of the
smallest marine vertebrates fuel coral-reef ecosystem functioning. Sci-
ence,364, 11891192.
Briggs, J. C. (1955). A monograph of the clingfishes (order Xenopterygii).
Stanford, CA: Stanford Ichthyological Bulletin.
Brown, S. D. J., Collins, R. A., Boyer, S., Lefort, M.-C., Malumbres-
Olarte,J.,Vink,C.J.,&Cruickshank,R.H.(2012).SPIDER:AnR
package for the analysis of species identity and evolution, with par-
ticular reference to DNA barcoding. Molecular Ecology Resources,12,
562565.
Canestrini, G. (1864). Studi sui Lepadogaster del Mediterraneo. Archivo per
la Zoologia, l'anatomia e la Fisiologia,3, 177196.
Colin, P. L. (2010). Fishes as living tracers of connectivity in the tropical
western North Atlantic: I. Distribution of the neon gobies, genus
Elacatinus (Pisces: Gobiidae). Zootaxa,2370,3652.
Conway, K. W., Baldwin, C., & White, M. D. (2014). Cryptic diversity and
venom glands in western Atlantic clingfishes of the genus Acyrtus
(Teleostei: Gobiesocidae). PLoS One,9, e97664.
Conway, K. W., Kim, D., Rüber, L., Espinosa Pérez, H. S., & Hastings, P. A.
(2017a). Molecular systematics of the New World clingfish genus
Gobiesox (Teleostei: Gobiesocidae) and the origin of a freshwater
clade. Molecular Phylogenetics and Evolution,112, 138147.
Conway, K. W., Moore, G. I., & Summers, A. P. (2017b). A new genus and
species of clingfish (Teleostei: Gobiesocidae) from Western Australia.
Copeia,105, 128140.
Conway, K. W., Moore, G. I., & Summers, A. P. (2019). A new genus and
two new species of miniature clingfishes from temperate southern
Australia (Teleostei, Gobiesocidae). ZooKeys,2019,3565.
Conway, K. W., Stewart, A. L., & King, C. (2017c). A new species of the
clingfish genus Trachelochismus from bay and estuarine areas of
New Zealand (Teleostei: Gobiesocidae). Zootaxa,4319, 531549.
Conway, K. W., Stewart, A. L., & Summers, A. P. (2018). A new species of
sea urchin associating clingfish of the genus Dellichthys from
New Zealand (Teleostei, Gobiesocidae). ZooKeys,740,7795.
Davison, W. (1985). Swimming against the tide: Adaptations of three spe-
cies of fish for life in the intertidal zone. Mauri Ora,12,95104.
De Filippe, F. (1861). Nota sopra il genere L'eptopterygius di Troschel.
Note Zoologiche: Archivio per la Zoologia I'Anatomia e la Fisiologia, 1.
Depczynski, M., & Bellwood, D. R. (2003). The role of cryptobenthic reef
fishes in coral reef trophodynamics. Marine Ecology Progress Series,
256, 183191.
Ditsche, P., & Summers, A. (2019). Learning from northern clingfish
(Gobiesox maeandricus): Bioinspired suction cups attach to rough sur-
faces. Philosophical Transactions of the Royal Society B: Biological Sci-
ences,374, 20190204.
Edgar, R. C. (2004). MUSCLE: Multiple sequence alignment with high accu-
racy and high throughput. Nucleic Acids Research,32, 17921797.
El-Geziry, T. M., & Bryden, I. G. (2010). The circulation pattern in the Med-
iterranean Sea: Issues for modeller consideration. Journal of Opera-
tional Oceanography,3,3946.
Facciolà, L. (1887). Intorno a due Lepadogastrini ed un nouvo Nettastoma
del mare di Sicilia. Lettera al Ch. Dott. Cristiforo Bellotti Nat Sicil,6,
163167.
Faria, A. M., & Gonçalves, E. J. (2010). Ontogeny of swimming behaviour
of two temperate clingfishes, Lepadogaster lepadogaster and L.
purpurea (Gobiesocidae). Marine Ecology Progress Series,414, 237248.
Fricke, R. (2014). Unguitrema nigrum, a new genus and species of clingfish
(Teleostei: Gobiesocidae) from Madang, Papua New Guinea. Journal of
the Ocean Science Foundation,3,3542.
Fricke, R., Chen, J. N., & Chen, W. J. (2017). New case of lateral asymmetry
in fishes: A new subfamily, genus and species of deep water clingfishes
from Papua New Guinea, western Pacific Ocean. Comptes Rendus -
Biologies,340,4762.
Fricke, R., Eschmeyer, W. N. & Fong, J. D. (2020a). Eschmeyer's catalog of
fishes: Species by family/subfamily. Retrieved from http://
researcharchive.calacademy.org/research/ichthyology/catalog/
SpeciesByFamily.asp
Fricke, R., Eschmeyer, W. N. & Van der Laan, R. (eds) (2020b). Eschmeyer's
catalog of fishes: Genera, species, references. Retrieved from http://
researcharchive.calacademy.org/research/ichthyology/catalog/
fishcatmain.asp
Fricke, R., & Wirtz, P. (2017). Lecanogaster gorgoniphila, a new species of
clingfish (Teleostei: Gobiesocidae) from S~
ao Tomé and Principe, east-
ern Atlantic Ocean. Arquipélago,35,110.
Fricke, R., & Wirtz, P. (2018). Apletodon gabonensis, a new species of
clingfish (Teleostei: Gobiesocidae) from Gabon, eastern Atlantic
Ocean. Arquipélago,36,18.
86 WAGNER ET AL.
FISH
Fricke, R., Wirtz, P., & Brito, A. (2010). A new species of the clingfish genus
Apletodon (Teleostei: Gobiesocidae) from the Cape Verde Islands, east-
ern Central Atlantic. Ichthyological Research,57,9197.
Fricke, R., Wirtz, P., & Brito, A. (2015). Diplecogaster tonstricula, a new spe-
cies of cleaning clingfish (Teleostei: Gobiesocidae) from the Canary
Islands and Senegal, eastern Atlantic Ocean, with a review of the Dip-
lecogaster-ctenocrypta species-group. Journal of Natural History,50,
731748.
Fujiwara, K., & Motomura, H. (2018a). A new species, Propherallodus
longipterus, from The Philippines and redescription of P. briggsi
Shiogaki and Dotsu 1983 (Gobiesocidae: Diplocrepinae). Ichthyological
Research,66,3548.
Fujiwara, K., & Motomura, H. (2018b). Revised diagnosis and first northern
hemisphere records of the rare clingfish Lepadichthys akiko
(Gobiesocidae: Diademichthyinae). Species Diversity,23,8793.
Fujiwara, K., & Motomura, H. (2019). Validity of Lepadichthys misakius
(Tanaka 1908) and redescription of Lepadichthys frenatus Waite 1904
(Gobiesocidae: Diademichthyinae). Zootaxa,4551, 275298.
Fujiwara, K., & Motomura, H. (2020). Kopua minima (Döderlein 1887), a
senior synonym of K. japonica Moore, Hutchins and Okamoto 2012,
and description of a new species of Aspasma (Gobiesocidae). Ichthyo-
logical Research,67,5067.
Fujiwara, K., Okamoto, M., & Motomura, H. (2018). Review of the clingfish
genus Kopua (Gobiesocidae: Trachelochisminae) in Japan, with descrip-
tion of a new species. Ichthyological Research,65, 433453.
Galarza, J. A., Carreras-Carbonell, J., Macpherson, E., Pascual, M.,
Roques, S., Turner, G. F., & Rico, C. (2009). The influence of oceano-
graphic fronts and early-life-history traits on connectivity among litto-
ral fish species. Proceedings of the National Academy of Sciences,106,
14731478.
Gerlach, G., Atema, J., Kingsford, M. J., Black, K. P., & Miller-Sims, V.
(2007). Smelling home can prevent dispersal of reef fish larvae. Pro-
ceedings of the National Academy of Sciences of the United States of
America,104, 858863.
Glavicˇi
c, I., Kovacˇi
c, M., Soldo, A., & Schliewen, U. (2020). A quantitative
assessment of the diel influence on the cryptobenthic fish assemblage
of the shallow mediterranean infralittoral zone. Scientia Marina,84,
4957.
Glavicˇi
c, I., Paliska, D., Soldo, A., & Kovacˇi
c, M. (2016). A quantitative
assessment of the cryptobenthic fish assemblage at deep littoral cliffs
in the Mediterranean. Scientia Marina,80, 329337.
Goatley, C. H. R., González-Cabello, A., & Bellwood, D. R. (2016). Reef-
scale partitioning of cryptobenthic fish assemblages across the great
barrier reef, Australia. Marine Ecology Progress Series,544, 271280.
Gonçalves, D. M., Gonçalves, E. J., Almada, V. C., & Almeida, S. P. (1998).
Comparative behaviour of two species of Lepadogaster (Pisces:
Gobiesocidae) living at different depths. Journal of Fish Biology,53,
447450.
Gonçalves, E. J., Almada, V. C., Almeida, S. P., Gonçalves, D. M.,
Repas, M., & Simoes, N. (1996). Observations on the agonistic behav-
iour of Lepadogaster lepadogaster purpurea (Pisces: Gobiesocidae). Jour-
nal of Fish Biology,49, 367369.
Gonçalves, E. J., Barbosa, M., Cabral, H. N., & Henriques, M. (2002). Onto-
genetic shifts in patterns of microhabitat utilization in the small-
headed clingfish, Apletodon dentatus (Gobiesocidae). Environmental
Biology of Fishes,63, 333339.
Guitel, F. (1888). Recherches sur les Lepadogasters. Archives de Zoologie
Expérimentale et Générale,2, 423480.
Hastings, P. A., & Conway, K. W. (2017). Gobiesox lanceolatus, a new spe-
cies of clingfish (Teleostei: Gobiesocidae) from Los Frailes submarine
canyon, gulf of California, Mexico. Zootaxa,4221, 393400.
Hebert, P. D. N., Ratnasingham, S., & de Waard, J. R. (2003). Barcoding ani-
mal life: Cytochrome c oxidase subunit 1 divergences among closely
related species. Proceedings of the Royal Society B: Biological Sciences,
270,9699.
Henriques, M., Lourenço, R., Almada, F., Calado, G., Gonçalves, D.,
Guillemaud, T., Almada, V. C. (2002). A revision of the status of
Lepadogaster lepadogaster (Teleostei: Gobiesocidae): Sympatric sub-
species or a long misunderstood blend of species? Biological Journal of
the Linnean Society,76, 327338.
Herler, J. (2007). Microhabitats and ecomorphology of coral- and coral
rock-associated gobiid fish (Teleostei: Gobiidae) in the northern Red
Sea. Marine Ecology,28,8294.
Hoban, M. L., & Williams, J. T. (2020). Cirripectes matatakaro, a new species
of combtooth blenny from the Central Pacific, illuminates the origins
of the Hawaiian fish fauna. PeerJ,8, e8852.
Hofrichter, R. (1995). Taxonomie,Verbreitung und Ökologie von Schildfischen
der Unterfamilie Lepadogastrinae (Gobiesocidae,Teleostei) (Doctoral the-
sis, Paris Lodron University Salzburg, AUT).
Hofrichter, R., & Patzner, R. A. (2000). Habitat and microhabitat of Medi-
terranean clingfishes (Teleostei: Gobiesociformes: Gobiesocidae).
Marine Ecology,21,4153.
ICZN (International Commission on Zoological Nomenclature). (1999).
International code of zoological nomenclature (4th ed.). London, UK:
International Trust for Zoological Nomenclature.
Klein, M., Teixeira, S., Assis, J., Serr~
ao, E. A., Gonçalves, E. J., & Borges, R.
(2016). High interannual variability in connectivity and genetic pool of
a temperate clingfish matches oceanographic transport predictions.
PLoS One,11, e0165881.
Koblmüller, S., Salzburger, W., Obermüller, B., Eigner, E., Sturmbauer, C., &
Sefc, K. M. (2011). Separated by sand, fused by dropping water: Habitat
barriers and fluctuating water levels steer the evolution of rock-dwelling
cichlid populations in Lake Tanganyika. Molecular Ecology,20, 22722290.
Koblmüller, S., Steinwender, B., Weiß, S., & Sefc, K. M. (2015). Gene flow,
population growth and a novel substitution rate estimate in a subtidal
rock specialist, the black-faced blenny Tripterygion delaisi (Perciformes,
Blennioidei, Tripterygiidae) from the Adriatic Sea. Journal of Zoological
Systematics and Evolutionary Research,53, 291299.
Konstantinidis, P., & Conway, K. W. (2010). The median fin skeleton of the
eastern Atlantic and Mediterranean clingfishes Lepadogaster
lepadogaster (Bonnaterre) and Gouania wildenowi (Risso) (Teleostei:
Gobiesocidae). Journal of Morphology,271, 215224.
Kovacˇi
c, M. (1997). Cryptobenthic gobies (Pisces, Perficormes, Gobiidae)
and clingfishes (Pisces, Gobiesociformes, Gobiesocidae) in the Kvarner
area, Adriatic Sea. Natura Croatica,6, 423435.
Kovacˇi
c, M., Patzner, R. A., & Schliewen, U. (2012). A first quantitative
assessment of the ecology of cryptobenthic fishes in the Mediterra-
nean Sea. Marine Biology,159, 27312742.
Kovacˇi
c, M., Sadeghi, R., & Esmaeili, H. R. (2020). New species of Sil-
houettea (Teleostei: Gobiidae) from Qeshm Island, Iran and the DNA
barcoding of the Persian Gulf and Oman Sea gobies. Zootaxa,4750,
4966.
Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular evolution-
ary genetics analysis version 7.0 for bigger datasets. Molecular Biology
and Evolution,33, 18701874.
Leray, C. (1961). Contribution a l'etude osteologique de Gouania wildenowi
Risso (Teleosteens) (squelette cephalique et ceintures). Cahiers de Bio-
logie Marine,2,4152.
Limaye, A. (2012). Drishti: A volume exploration and presentation tool.
Developments in X-Ray Tomography,8, 85060X.
Macpherson, E., & Raventos, N. (2006). Relationship between pelagic lar-
val duration and geographic distribution of Mediterranean littoral
fishes. Marine Ecology Progress Series,327, 257265.
Milá, B., Van Tassell, J. L., Calderón, J. A., Rüber, L., & Zardoya, R. (2017).
Cryptic lineage divergence in marine environments: Genetic differenti-
ation at multiple spatial and temporal scales in the widespread inter-
tidal goby Gobiosoma bosc.Ecology and Evolution,7, 55145523.
Nardo, G. D. (1827a). Estratto da una memoria ittiologica inedita. Giornale
di fisica, chimica, storia naturale, medicina ed arti (series 2),10,
102105.
WAGNER ET AL.87
FISH
Nardo, G. D. (1827b). Prodromus observationum et disquisitionum
Adriaticae ichthyologiae. Giornale di fisica, chimica e storia naturale,
medicina ed arti (series 2),10,2240.
Nardo, G. D. (1833). Eine neue Art von Lepadogaster (L. piger). Isis (Oken),
26, 548549.
Nardo, G. D. (1860). Prospetti systematici degli animali delle provincie Venete
et del Mare Adriatico. Venice, Italy. Privil. Stabilim. di G. Antonelli.
Palumbi, S. R. (1994). Genetic divergence, reproductive isolation, and
marine speciation. Annual Review of Ecology and Systematics,25,
547572.
Patzner, R. A. (1999). Habitat utilization and depth distribution of small
cryptobenthic fishes (Blenniidae, Gobiidae, Trypyterigiidae) in Ibiza
(western Mediterranean Sea). Environmental Biology of Fishes,55,
207214.
R Core Team. (2017). R: A language and environment for statistical comput-
ing. Vienna, Austria: R Foundation for Statistical Computing.
Riginos, C., Douglas, K. E., Jin, Y., Shanahan, D. F., & Treml, E. A. (2011).
Effects of geography and life history traits on genetic differentiation in
benthic marine fishes. Ecography,34, 566575.
Risso, A. (1810). Ichthyologie de Nice, ou histoire naturelle des poissons du
Département des Alpes Maritimes. Paris, France: F. Schoell.
Rüber, L., Van Tassell, J. L., & Zardoya, R. (2003). Rapid speciation and eco-
logical divergence in the American seven spined gobies (Gobiidae,
Bogiosomatini) inferred from a molecular phylogeny. Evolution,57,
15841598.
Santin, S., & Willis, T. J. (2007). Direct versus indirect effects of wave
exposure as a structuring force on temperate cryptobenthic fish
assemblages. Marine Biology,151, 16831694.
Saruwatari, T., López, J. A., & Pietsch, T. W. (1997). Cyanine blue: A versa-
tile and harmless stain for specimen observation. Copeia,4, 840841.
Schunter, C., Carreras-Carbonell, J., Macpherson, E., TintorÉ, J., Vidal-
Vijande, E., Pascual, A., Pascual, M. (2011). Matching genetics with
oceanography: Directional gene flow in a Mediterranean fish species.
Molecular Ecology,20, 51675181.
Sefc, K. M., Wagner, M., Hahn, C., Zangl, L., Weiß, S., Steinwender, B.,
Koblmüller, S. (2020). Phylogeographic structure and population con-
nectivity of a small benthic fish (Tripterygion tripteronotum) in the
Adriatic Sea. Journal of Biogeography, in press.
Selkoe, K. A., & Toonen, R. J. (2011). Marine connectivity: A new look at
pelagic larval duration and genetic metrics of dispersal. Marine Ecology
Progress Series,436, 291305.
Shiogaki, M., & Dotsu, Y. (1983). Two new genera and two new species of
clingfishes from Japan, with comments on head sensory canals of the
Gobiesocidae. Japanese Journal of Ichthyology,30, 111121.
Smith-Vaniz, W. F., Jelks, H. L., & Rocha, L. A. (2006). Relevance of cryptic
fishes in biodiversity assessments: A case study at Buck Island reef
National Monument, St. Croix. Bulletin of Marine Science,79,1748.
Sparks, J. S., & Gruber, D. F. (2012). A new mesophotic clingfish (Teleostei:
Gobiesocidae) from The Bahamas. Copeia,2012, 251256.
Springer, V. G., & Fraser, T. H. (1976). Synonymy of the fish families
Cheilobranchidae (=Alabetidae) and Gobiesocidae: With descriptions
of two new species of Alabes.Smithsonian Contributions to Zoology,
234,123.
Steindachner, F. (1868). lchthyologischer Bericht über eine nach Spanien
und Portugal unternommene Reise. Sechste Fortsetzung. Übersicht
der Meerestische an den Küsten Spaniens und Portugals. Sit-
zungsberichte der Kaiserlichen Akademie der Wissenschaften.
Mathematisch-Naturwissenschaftliche Classe,57, 351424.
Thiriet, P. D., Di Franco, A., Cheminée, A., Guidetti, P., Bianchimani, O.,
Basthard-Bogain, S., Mangialajo, L. (2016). Abundance and diversity
of crypto- and necto-benthiccoastal fish are higher in marine forests
than in structurally less complex macroalgal assemblages. PLoS One,
11,124.
Tojeira, I., Faria, A. M., Henriques, S., Faria, C., & Gonçalves, E. J. (2012).
Early development and larval behaviour of two clingfishes,
Lepadogaster purpurea and Lepadogaster lepadogaster (Pisces:
Gobiesocidae). Environmental Biology of Fishes,93, 449459.
Tornabene, L., Ahmadia, G. N., Berumen, M. L., Smith, D. J., Jompa, J., &
Pezold, F. (2013). Evolution of microhabitat association and morphol-
ogy in a diverse group of cryptobenthic coral reef fishes (Teleostei:
Gobiidae: Eviota). Molecular Phylogenetics and Evolution,66, 391400.
Tornabene, L., Baldwin, C. C., Weigt, L. A., & Pezold, F. L. (2010). Exploring
the diversity of western Atlantic Bathygobius (Teleostei: Gobiidae) with
cytochrome c oxidase-I, with descriptions of two new species. Aqua,
Journal of Ichthyology and Aquatic Biology,16, 141170.
Tornabene, L., Valdez, S., Erdmann, M., & Pezold, F. (2015). Support for a
Center of Originin the coral triangle: Cryptic diversity, recent specia-
tion, and local endemism in a diverse lineage of reef fishes (Gobiidae:
Eviota). Molecular Phylogenetics and Evolution,82, 200210.
Trkov, D., & Lipej, L. (2019). A non-destructive method for assessing the feed-
ing habits of coastal fish. Mediterranean Marine Science,20,453459.
Troschel, F. H. (1860). Leptopterygius, neue Gattung der Discoboli. Archiv
für Naturgeschichte,26, 205209.
Victor, B. C. (2013). The Caribbean Roughhead Triplefin (Enneanectes
boehlkei): DNA barcoding reveals a complex of four west Indian sym-
patric cryptic species (Teleostei: Blennioidei: Tripterygiidae). Journal of
the Ocean Science Foundation,7,4473.
Wagner, M., Bracˇun, S., Kovacˇi
c, M., Iglésias, S. P., Sellos, D. Y.,
Zogaris, S., & Koblmüller, S. (2017). Lepadogaster purpurea
(Actinopterygii: Gobiesociformes: Gobiesocidae) from the eastern
mediterranean sea: Significantly extended distribution range. Acta
Ichthyologica et Piscatoria,47, 417421.
Wagner, M., Bracˇun, S., Skofitsch, G., Kovacˇi
c, M., Zogaris, S., Iglésias, S. P.,
Koblmüller, S. (2019). Diversification in gravel beaches: A radiation of
interstitial clingfish (Gouania, Gobiesocidae) in the Mediterranean Sea.
Molecular Phylogenetics and Evolution,139, 106525.
Wainwright, D. K., Kleinteich, T., Kleinteich, A., Gorb, S. N., &
Summers, A. P. (2013). Stick tight: Suction adhesion on irregular sur-
faces in the northern clingfish. Biology Letters,9, 20130234.
Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. N.
(2005). DNA barcoding Australia's fish species. Philosophical Transac-
tions of the Royal Society of London. Series B, Biological Sciences,360,
18471857.
Winterbottom, R., Hanner, R. H., Burridge, M., & Zur, M. (2014). A cornu-
copia of cryptic species - a DNA barcode analysis of the gobiid fish
genus Trimma (Percomorpha, Gobiiformes). ZooKeys,381,79111.
Yamada, T., Sugiyama, T., Tamaki, N., Kawakita, A., & Kato, M. (2009).
Adaptive radiation of gobies in the interstitial habitats of gravel
beaches accompanied by body elongation and excessive vertebral seg-
mentation. BMC Evolutionary Biology,9,114.
SUPPORTING INFORMATION
Additional supporting information may be found online in the
Supporting Information section.
How to cite this article: Wagner M, Kovacˇi
c M, Koblmüller S.
Unravelling the taxonomy of an interstitial fish radiation:
Three new species of Gouania (Teleostei: Gobiesocidae) from
the Mediterranean Sea and redescriptions of G. willdenowi and
G. pigra.J Fish Biol. 2021;98:6488. https://doi.org/10.1111/
jfb.14558
88 WAGNER ET AL.
FISH
... The term itself derives from the fact that they attach themselves to the substrate by means of a ventrally located adhesive disc (Briggs, 1955;Conway et al., 2017Conway et al., , 2019. Their unusual lifestyle and small body size explain why they are generally considered as cryptobenthic, which in turn suggests that clingfish biodiversity has been underestimated (Brandl et al., 2018;Wagner et al., 2019Wagner et al., , 2020. Within the Gobiesocidae, this applies in particular to the genus Gouania Risso 1810, which originally included only the species Gouania willdenowi. ...
... Within the Gobiesocidae, this applies in particular to the genus Gouania Risso 1810, which originally included only the species Gouania willdenowi. Nevertheless, recent results from molecular and morphometric analyses suggested that this endemic Mediterranean genus comprises four additional species (Wagner et al., 2019) and led to the taxonomic revision of the genus (Wagner et al., 2020). Accordingly, (a) the species name Wagner et al., 2020). ...
... Nevertheless, recent results from molecular and morphometric analyses suggested that this endemic Mediterranean genus comprises four additional species (Wagner et al., 2019) and led to the taxonomic revision of the genus (Wagner et al., 2020). Accordingly, (a) the species name Wagner et al., 2020). Notably, in both the latter regions, the two species are congruent with two morphotypesone slender bodied with a small head and the other stout bodied with a larger headwhich suggests convergent evolution (Wagner et al., 2019). ...
Article
Full-text available
Otolith morphology is a widely accepted tool for species identification in teleost fish, but whether this holds true for very small species remains to be explored. Here, the saccular otoliths of the cryptobenthic Mediterranean clingfish Gouania (Gobiesocidae) are described for the first time. Our new data, although preliminary, indicate that otolith morphology and morphometry support the recognition of the recently differentiated five species of Gouania in the Mediterranean Sea. Furthermore, otoliths of phylogenetically closely related Gouania species resemble each other more than do those of the more distantly related species. This article is protected by copyright. All rights reserved.
... To date, the total number of known fish species recorded in the Adriatic is 449, according to Kovačić et al. [13], later published descriptions of new species [32,33], and new Adriatic records [34][35][36] (Figure 2) (Supplementary Material). The Adriatic Sea can be considered as a well-studied Mediterranean area with centennial tradition in ichthyology [7]. ...
... Excluding two species reported before 2010, but missed by Lipej and Dulčić [2], 21 records of new species for the period were summarized in Kovačić et al. [13]. By adding the recently described species [32,33] and the species recently recorded in the Adriatic Sea [34][35][36], 26 new Adriatic fish species were reported from 2010 to 2021, which represents an annual average addition of 2.1 species (Table 3). The annual average increase from Jardas [15] to Lipej and Dulčić [2] was 2.4 species and annual average increase from Šoljan [43] to Jardas [15,44] was 0.9 species. ...
Article
Full-text available
The paper presents an analysis of biogeographic and habitat distribution patterns, and the conservation status data of Adriatic fishes, based on the last published checklist and evidence-based critical analyses of species presence. The total number of species recorded in the Adriatic is 449. The Adriatic has 58.8% of Mediterranean species richness, 76.1% of its families, and 87.8% of its orders. Among species discovered in the Adriatic after 2010, twelve species were attributed to biological invasion, mostly Atlantic immigrants or alien species, and ten species were attributed to improved research on the native ichthyofauna of the Adriatic area. About 58% of species are native species of Atlanto-Mediterranean origin, 21% are native species of wider global occurrence, 15% are Mediterranean or Mediterranean and Black Sea endemics and 5% originated outside Mediterranean Sea. The majority of species inhabit the benthic environment (71.9%), while others occur in the pelagic environment (20.7%) or are euryhaline (7.3%). The benthic littoral species are the most numerous Adriatic fishes, representing 40% of all species richness, whereas pelagic fishes are mainly eurybathic or epipelagic; only 3.6% of species are deep pelagic species. A Red Book of marine fishes of the Adriatic Sea is urgently needed to assess their conservation status, covering the entire Adriatic Sea and reviewing all fish species to assess their conservation status.
... In the Adriatic intertidal zone, contrary to oceans and many seas, the small tide and mostly soft sediment or steep bedrock bottoms in the tidal zones rarely shape mediolittoral basins during low tide, so, unlike the coasts with large tides, only a few Adriatic fish species are present in the mediolittoral zone by surviving limited time above the water surface on an exposed rock or under the gravel or boulders. That has been known only for two amphibious blennies on rocks and for Gouania clingfishes living in the intertidal gravel (Wagner et al. 2021). The habitat of Z. pallaoroi collected in Split indicates that Z. pallaoroi, with some other fishes, also occurring in shallow infralittoral of 0-1 m depth inside the boulders or cobbles fields (e.g., Chromogobius quadrivittatus (Steindachner, 1863) and Lepadogaster lepadogaster (Bonnaterre, 1788) (see Patzner 1999Patzner , 2021), could have its upper depth limit expanded to the mediolittoral zone and perhaps could be able to survive diurnal dried periods above water level at low tide. ...
Article
Full-text available
The family Gobiidae represents the species-richest family of fishes in the Mediterranean Sea. However, many Mediterranean gobiid species are poorly known with just one or few species records in total. Among those species, the recently described Zebrus pallaoroi Kovačić, Šanda et Vukić, 2021 has been known only from the localities in the species description: the southern Adriatic, northern Ionian, and northern and western Aegean seas. The additional specimens of this species were collected in central and northern Adriatic Sea. The identification was confirmed by morphological and genetic methods. The morphological and preserved coloration characters were compared with the data from the limited type material and the alternative preserved coloration diagnostic character was suggested. The first data on alive and freshly dead coloration are reported. The phylogenetic analysis was performed on sequenced COI , cytochrome b, and rhodopsin genes. The analyzed molecular markers placed Z. pallaoroi in a distinct clade within Zebrus – Millerigobius group. The preference of this species for the very shallow habitat is confirmed and discussed.
... Hebert et al., 2004;Smith et al., 2006;Vasconcelos et al., 2016;Lavinia et al., 2017), but only those collaborating with taxonomic specialists unraveled the complex nature of these cases (e.g. Hebert et al., 2004;Van Ginneken et al., 2017;Wagner et al., 2021). ...
Article
Full-text available
There has been a long controversy about what defines a species and how to delimitate them which resulted in the existence of more than two dozen different species concepts. Recent research on so-called "cryptic species" heated up this debate as some scientists argue that these cryptic species are only a result of incompatible species concepts. While this may be true, we should keep in mind that all concepts are nothing more than human constructs and that the phenomenon of high phenotypic similarity despite reproductive isolation is real. To investigate and understand this phenomenon it is important to classify and name cryptic species as it allows to communicate them with other fields of science that use Linnaean binomials. To provide a common framework for the description of cryptic species, we propose a possible protocol of how to formally name and describe these taxa in practice. The most important point of this protocol is to explain which species concept was used to delimitate the cryptic taxon. As a model, we present the case of the allegedly widespread Caribbean intertidal mite Thalassozetes barbara, which in fact consists of seven phenotypically very similar but genetically distinct species. All species are island or short-range endemics with poor dispersal abilities that have evolved in geographic isolation. Stabilizing selection caused by the extreme conditions of the intertidal environment is suggested to be responsible for the morphological stasis of this cryptic species complex.
Article
Various bioinspired adhesives have been used to develop adhesive medical patches capable of robust and comfortable attachment to dry and wet skin for healthcare applications. However, it is challenging to maintain adhesion on the application of shear and pulling forces, especially on rough, curved, and wet surfaces, such those of the human body. Here, highly biocompatible adhesive patch with wrinkled mushroom-shaped structures having suction-cup-like microcavities is presented for enhanced wet adhesion and biosignal monitoring. Inspired by the unique structures on the foreleg of male diving-beetles, the adhesive patch with microwrinkle structure shows enhanced multidirectional adhesion (i.e., normal and shear directions), as well as high water/air permeability when applied to rough skin under dry and wet conditions with minimal skin irritation. Based on the structural features of insect-inspired adhesives, a simple model was proposed to understand the enhanced wet adhesion in both the normal and shear directions due to the synergistic effect of suction and capillarity, resulting from microcavities and tiny wrinkles. In addition, to demonstrate the potential in wearable medical devices, we employed our bio-inspired patches as the interface material for the electrodes, which enabled direct electrocardiogram measurements on both wet and dry skin with minimal discomfort and signal noise.
Article
An updated and evidence-based checklist of Mediterranean Sea fishes is provided. Each of the fish species in the Mediterranean Sea listed here was either listed in the last published checklist of the Mediterranean fishes or in other, reports or new records, and the checklist is critically assessed. Out of the assessed 791 species previously reported from the Mediterranean, the presence of 759 species is confirmed while 32 species are excluded from the new checklist, by lacking evidence of presence or representing obvious taxonomic confusions. The net increase in known Mediterranean fish species richness since the last checklist is 11%. The non-native Mediterranean species now represent 22.1% (168 species) of the known Mediterranean fish diversity. The evidence-based protocol applied here provides a reliable checklist of marine fishes, for which each of the included species has indeed been recorded at least once within the discussed geographic area in the Mediterranean Sea.