ArticlePDF Available

Retinoprotective Effect of Wild Olive (Acebuche) Oil- Enriched Diet against Ocular Oxidative Stress Induced by Arterial Hypertension

Authors:

Abstract and Figures

Oxidative stress plays an important role in the pathogenesis of ocular diseases, including hypertensive eye diseases. The beneficial effects of olive oil on cardiovascular diseases might rely on minor constituents. Currently, very little is known about the chemical composition and/or therapeutic effects of the cultivated olive tree's counterpart, wild olive (also known in Spain as acebuche-ACE). Here, we aimed to analyze the antioxidant and retinoprotective effects of ACE oil on the eye of hypertensive mice made hypertensive via administration of NG-nitro-L-arginine-methyl-ester (L-NAME), which were subjected to a dietary supplementation with either ACE oil or extra virgin olive oil (EVOO) for comparison purposes. Deep analyses of major and minor compounds present in both oils was accompanied by blood pressure monitoring, morphometric analyses, as well as different determinations of oxidative stress-related parameters in retinal layers. Aside from its antihypertensive effect, an ACE oil-enriched diet reduced NADPH (nicotinamide adenine dinucleotide phosphate) oxidase activity/gene/protein expression (with a major implication of NADPH oxidase (NOX)2 isoform) in the retinas of hypertensive mice. Supplementation with ACE oil in hypertensive animals also improved alterations in nitric oxide bioavailability and in antioxidant enzyme profile. Interestingly, our findings show that the use of ACE oil resulted in better outcomes, compared with reference EVOO, against hypertension-related oxidative retinal damage.
Content may be subject to copyright.
Antioxidants2020,9,885;doi:10.3390/antiox9090885www.mdpi.com/journal/antioxidants
Article
RetinoprotectiveEffectofWildOlive(Acebuche)Oil
EnrichedDietagainstOcularOxidativeStress
InducedbyArterialHypertension
ÁlvaroSantanaGarrido
1,2
,ClaudiaReyesGoya
1
,M.CarmenPérezCamino
3
,HelderAndré
4
,
AlfonsoMate
1,2,
*andCarmenM.Vázquez
1,2
1
DepartamentodeFisiología,FacultaddeFarmacia,UniversidaddeSevilla,E41012Sevilla,Spain;
asgarrido@us.es(A.S.G.);crgoya@us.es(C.R.G.);vazquez@us.es(C.M.V.)
2
EpidemiologíaClínicayRiesgoCardiovascular,InstitutodeBiomedicinadeSevilla(IBIS),Hospital
UniversitarioVirgendelRocío/ConsejoSuperiordeInvestigacionesCientíficas/UniversidaddeSevilla,
E41013Sevilla,Spain
3
DepartamentodeCaracterizaciónyCalidaddelípidos,InstitutodelaGrasaCSIC,E41013Sevilla,Spain
mcperezcamino@ig.csic.es
4
DepartmentofClinicalNeuroscience,St.ErikEyeHospital,KarolinskaInstitutet,
11282Stockholm,Sweden;helder.andre@ki.se
*Correspondence:mate@us.es;Tel.:+34954556518
Received:20August2020;Accepted:15September2020;Published:18September2020
Abstract:Oxidativestressplaysanimportantroleinthepathogenesisofoculardiseases,including
hypertensiveeyediseases.Thebeneficialeffectsofoliveoiloncardiovasculardiseasesmightrely
onminorconstituents.Currently,verylittleisknownaboutthechemicalcompositionand/or
therapeuticeffectsofthecultivatedolivetree’scounterpart,wildolive(alsoknowninSpainas
acebuche—ACE).Here,weaimedtoanalyzetheantioxidantandretinoprotectiveeffectsofACEoil
ontheeyeofhypertensivemicemadehypertensiveviaadministrationofNGnitroLarginine
methylester(LNAME),whichweresubjectedtoadietarysupplementationwitheitherACEoilor
extravirginoliveoil(EVOO)forcomparisonpurposes.Deepanalysesofmajorandminor
compoundspresentinbothoilswasaccompaniedbybloodpressuremonitoring,morphometric
analyses,aswellasdifferentdeterminationsofoxidativestressrelatedparametersinretinallayers.
Asidefromitsantihypertensiveeffect,anACEoilenricheddietreducedNADPH(nicotinamide
adeninedinucleotidephosphate)oxidaseactivity/gene/proteinexpression(withamajorimplication
ofNADPHoxidase(NOX)2isoform)intheretinasofhypertensivemice.Supplementationwith
ACEoilinhypertensiveanimalsalsoimprovedalterationsinnitricoxidebioavailabilityandin
antioxidantenzymeprofile.Interestingly,ourfindingsshowthattheuseofACEoilresultedin
betteroutcomes,comparedwithreferenceEVOO,againsthypertensionrelatedoxidativeretinal
damage.
Keywords:acebuche;arterialhypertension;NADPH(nicotinamideadeninedinucleotide
phosphate)oxidase;nitricoxide;oxidativestress;retina;wildoliveoil
1.Introduction
Mediterraneancountriesaccountforapproximately70%ofallglobaloliveoil(OO)production,
whichismainlyundertakenbySpain,Turkey,Greece,Italy,Morocco,andTunisia[1].Notonlyhave
thebeneficialeffectsofOO(OleaeuropaeaL.)beenevaluatedinthecontextofthesocalled
Mediterraneandiet[2]butalsoduetoitslargelyrecognizedbioactivity[3].Thus,theregular
consumptionofOOiscurrentlyassociatedwithbeneficialeffectsonhealthduetoitsspecifically
nutritionalcomponents.
Antioxidants2020,9,8852of33
Alargenumberofphysical,chemicalandorganolepticcharacteristicsisroutinelyusedtodefine
andclassifyanoliveoilindifferentcategories,followingEuropeanCommissionRegulation(ECC)
No.2568/91[4].Despiteallthepossibleparameterstoclassifyoliveoils,theconsensusisbasedon
themaximumpercentagevaluesoffreeacidity,thusdistinguishingbetweenextravirginoliveoil
(EVOO,≤0,8%),virginoliveoil(VOO,≤2%)andordinaryoliveoil(OO,>2%)[5,6].
AmongthehealthbenefitsofEVOO,antioxidant,antitumoralandantiinflammatoryproperties
havebeenattributedtodifferentcomponents.TriacylglycerolsarethemainconstituentsofEVOO,
followedbyfreefattyacids,glycerol,phosphatides,pigments,flavorcompoundsandsterols.In
addition,thehighproportionofunsaturatedfats,mainlymonounsaturated,incontrasttoalow
proportionofsaturatedfats,designsitscharacteristicbiochemicalprofile[7].Inthisway,oleicacid
(C18:1)isthemostabundantmonounsaturatedfattyacid(70–80%),andoneofthemoststudiedin
termsofhealthyeffects[8].Between4%and20%ofpolyunsaturatedfattyacids(PUFAs)are
representedbylinoleic(C18:2)andαlinolenic(C18:3)acids,whilesaturatedfattyacids(SFA)only
accountfor8–14%[9].However,significantdifferencesinminorcomponentsalsoresultindiverse
varietiesofoliveoils,whichdifferinqualityandnutritionalattributes.
Concerningminorconstituents,triterpenicandphenoliccompounds,tocopherolsandsterols
containedinEVOOhavebeeninvolvedinavarietyofbiologicalactivities,includingtheactivation
ofdifferentsignalingpathwaysrelatedtoredoxstate,homeostasis,inflammation[10,11]and
epigeneticsmodificationsofthechromatin[12,13].Asaconsequence,thesecompoundsisolatedfrom
oliveoilhavebeenrecognizedaspowerfulnutraceuticaltoolsforthepreventionandmanagement
ofcardiovascular,canceranddegenerativediseases[14,15];specifically,hydroxytyrosol(HT)andits
derivates,tyrosol,oleocanthalandoleuropein,havebeenprovenasthemoreremarkablecompounds
inthisregard[16].Otherauthorsclaimthatadditionalminorcomponentswithstillunknown
bioactivitymightcontributetothebeneficialeffectsofthesephenoliccompounds.
ThewellknownPREDIMEDstudy,arandomizedcontrolledtrial,showedtheimportanceof
EVOOintheMediterraneandietforreducingtheriskofcardiovasculardiseaseandcardiovascular
mortality,incomparisonwithastandarddiet[17].Moreover,neurodegenerativediseases[18]and
cancer[19]presentedwithlowerincidenceinthecontextoftheMediterraneandiet,whichwasin
partattributedtotheregularconsumptionofEVOO.
Unfortunately,reportsonthebeneficialeffectsofEVOOconsumptionagainstoculardiseases
arestillscarce.TherichfattyacidcompositionofoculartissuesindicatesEVOOasanadequate
supplementforthetreatmentofeyediseases.TheMediterraneandiethasbeenlinkedtoalower
onsetandprogressionofagerelatedmaculardegeneration(AMD)[20,21],whereEVOOmighthave
animportantrole.Inthissense,theAlienorstudy,apopulationstudybasedoneyediseasesinthe
elderly,suggestedaprotectiveroleforEVOOinAMD[22],andinvitrostudiesshowedthatHT
mightbeoneoftheactorsresponsibleforthisbeneficialeffect[23,24].Inaddition,studiesinrats
demonstratedtheneuroprotectiveeffectofHTinthecontextofdiabeticretinopathy(DR)[25].
Interestingly,neuroprotectivepropertiesofEVOOinDRhavealsobeenrecentlyassociatedwith
othercomponentsofEVOO,suchasoleuropein[26].Nonetheless,theuncertainmechanismsrelated
tothebeneficialpropertiesofEVOOconsumptioninocularpathologiescertainlywarrantsfurther
researchonthistopic.
Thewildolivetree(Oleaeuropaeavar.sylvestris)—alsoknownasacebuche(ACE)when
referringtotheSpanishancientspecimens—isavarietyofcultivatedolivetree(Oleaeuropaeavar.
europaea)mainlyrestrictedtoMediterraneancountries,withremarkablepresenceinareassuchas
AndalusiainSouthernSpain.Inspiteofthecopiousevidenceregardingthecompositionand
beneficialeffectsofEVOO,verylittleisknownaboutthechemicalcompositionand/ortherapeutic
effectsofACEoil.LowerantigenicandallergeniccapacitieshavebeenattributedtoACEin
comparisonwithitscultivatedcounterpart,andpreliminarystudieshaveshownthatACEoilhasa
higherproportionoftocopherols(vitaminE)andsterolsthanEVOO[27,28].
Atpresent,aconsensusexistsontheimportantroleofoxidativestressinthepathogenesisof
varioussystemicandretinaldiseases,includingAMD[29],glaucoma,retinitispigmentosa[30]and
differenttypesofretinopathiessuchasDR[31]orhypertensiveretinopathy[32].Inthissense,arterial
Antioxidants2020,9,8853of33
hypertension(AH)hasbeenassociatedwiththeexcessivereleaseofreactiveoxygenspecies(ROS)
throughdiversemolecularmechanisms,wheretheNADPHoxidasesystemandsuperoxideanions
(O2)seemtobethepivotalagents[33,34].SevenisoformsoftheNADPHoxidase(NOX)system
(namelyNOX15andDuox12)havebeencharacterizedsofar,althoughthepredominantNOXesin
vascularcellswiththehighestrelevanceinAHdevelopmentareNOX1,2,4and5[35].
Nitricoxide(NO)metabolismiscloselyrelatedtotheNADPHsystembecauseexcessO2
productioncaninduceuncouplingofendothelialnitricoxidesynthase(eNOS);thismightresultin
endothelialdysfunctionandneovascularizationeventually,sinceNOhelpsmaintainocular
hemodynamicsbyprotectingtheendothelialcellsofvascularbedsandnervefibersagainst
pathogenicprocesses,e.g.,diabetesandglaucoma[36,37].ConsideringthatNOisakeymediatorin
bloodpressureregulationandthatNOdeficiencyresultsinAH,itseemsplausiblethatthissystem
participatesinthedevelopmentofoxidativeimbalanceinhypertensiveretinas.However,and
despitethereportedrelationshipbetweenAHandretinaldamage[38],theprecisemechanisms
involvedinthisregardremainunclear.
Theaimofthisstudywastoexplorethebeneficial,antioxidanteffectsofadietenrichedwith
ACEoil,baseduponitscapacitytocounteractocular(retina/choroid)damage,inarodentmodelof
AHinducedwithNGnitroLargininemethylester(LNAME).Tothisend,bloodpressure
monitoringandmorphometricanalyseswerecarriedoutinhypertensivemiceunderACEoil‐ or
EVOOenricheddiets(forcomparisonpurposes).Determinationsofoxidativestressrelated
parametersinocularlayersincluded:estimationofreactiveoxygenspecies(ROS)levelsby
dihydroethidiumfluorescence;H2O2,nitrotyrosineandNOlevels;activity,gene/proteinexpression
andimmunohistofluorescenceofNADPHoxidaseisoforms;eNOSactivationandeNOS/inducible
(iNOS)/arginase12expression;andquantificationofantioxidantenzymes.Inaddition,glial
fibrillaryacidicprotein(GFAP,asanoxidative/inflammatorymarkerofgliosis)andtranscription
factorsnuclearfactorkappaB(NFkB)andnuclearfactorerythroid2(Nrf2)(relatedtooxidative
stresspathways)werealsoquantified.
2.MaterialsandMethods
2.1.StudyDesign
TheexperimentaldesignwasconductedinaccordancewiththeEuropeanUnion(EU)Directive
2010/63/EUandthenational(RD53/2013)guidelinesforthecareanduseoflaboratoryanimals,and
wasapprovedbythecompetentInstitutionalAnimalCareandUseCommittee(approvalreference
#13/03/2019/031,issuedbyJuntadeAndalucía,DirecciónGeneraldeProducciónAgrícolay
Ganadería).MaleC57B/6Jmiceaged10–12weekswereobtainedfromtheCenterforAnimal
ProductionandExperimentationattheUniversityofSeville(Spain).Micewererandomlyassigned
intosixgroupsof12animalseach:(1)normotensivemicefedacommercialdiet(controlgroup),(2)
normotensivemicefedacommercialdietsupplementedwith12%(w/w)ofwildoliveoil(ACE
group),(3)normotensivemicesupplementedwith12%ofextravirginoliveoil(EVOOgroup),(4)
hypertensivemice(viaadministrationof45mgLNAME/kgbodyweight/day)fedastandardpellet
diet(LNAMEgroup),(5)LNAMEinducedhypertensivemicesupplementedwith12%ofACEoil
(LN+ACEgroup);and(6)LNAMEinducedhypertensivemicesupplementedwith12%ofEVOO
(LN+EVOOgroup).Alltreatmentsweremaintainedforsixweeks;duringthisperiod,foodandwater
intakewerecontinuouslymonitored.Allanimalswerehousedinaregulatedenvironmentunder
standardconditions(23±1°C,12h/12hlight/darkcycles).Uponharvesting,animalsampleswere
collectedasdescribedbelowandassignedtodifferentexperiments,asspecifiedinFigurecaptions.
2.2.DietarySupplementation
Animalswerefedadietarypelletcomposition(ROD14IRR,SodispanResearch,Altromin,
Germany)supplemented,whereapplicable,with12%ofACEoilorEVOO,asspecifiedinSection
2.1.ThechemicalcompositionofACEoilandEVOO,includingmajorandminorconstituents,is
detailedinTable1.
Antioxidants2020,9,8854of33
Topreparetheanimalfeed,pelletswerecrushedinpowderform,thenmixedwiththe
correspondingoils,asappropriate,uptoafinal12%(w/w)ofoilcontent,ensuringahomogenateoil
spreadinthepowder.Thispowderoilmixturewasusedtocreatenewfeedpellets,whichwerekept
freshandlightprotecteduntiluse.ACEoilandEVOOwereobtainedfromthesamegeographicarea
(SierradelasNieves,Málaga,Spain)andsubjectedtosimilarextractionmethodsfromthe
correspondingfruits,accordingtothestandardprotocolstocomplywithextravirginoildefinition.
Inturn,theconcentrationofLNAMEinthedrinkingwaterwasweeklycalculatedconsideringthe
evolutionofbodyweightandwaterintake,andthedosagewaschoseninagreementwithprevious
studiesinrodentscarriedoutinourlaboratory.
Table1.Contentoffattyacids,sterols,tocopherols,pentacyclictriterpenesandpolyphenolsinextra
virginoliveoil(EVOO)andacebuche(ACE)oil.
ClassCompoundExtraVirginOliveOil
(EVOO)
AcebuchinaOil
(ACEOil)
Fattyacids(%)Myristicacid.C14:0<LOD1<LOD
Palmiticacid.C16:010.5612.90
 Palmitoleicacid.C16:10.791.25
Margaricacid.C17:00.110.09
Margaroleicacid.C17:10.170.16
Stearicacid.C18:02.972.36
Oleicacid.C18:176.6174.42
Linoleicacid.C18:27.187.34
Arachidonicacid.C20:00.440.39
Linolenicacid.C18:30.770.70
Gondoicacid.C20:10.310.29
Behenicacid.C22:00.110.12
Lignocericacid.C24:0<LOD<LOD
Total(%)100.0100.0
Acidity(%C18:1)≤0.80.14

Sterols(%)Cholesterol0.360.37
Bassicasterol<LOD<LOD
24Methylenecholesterol<LOD<LOD
Campesterol3.063.59
Campestanol<LOD<LOD
Stigmasterol0.590.96
7Campesterol<LOD<LOD
5,23Stigmastadienol<LOD<LOD
Clerosterol1.071.02
Sitosterol84.6085.89
Sitostanol1.461.1
5Avenasterol7.447.89
5,24Stigmastadienol0.370.64
7Stigmastenol0.310.25
7Avenasterol0.490.46
Total(mg/kg)1531.41735

Tocopherols(%)αTocopherol94.6097.2
βTocopherol2.40.8
γTocopherol3.02.1
δTocopherol<LOD<LOD
Total(mg/kg)221.76343.8
Antioxidants2020,9,8855of33
Pentacyclictriterpenes  
Triterpeneacids(%)Oleanolicacid27.0334.5
Ursolicacid37.9324.9
Maslinicacid34.4640.6
Total(mg/kg)153.12340.3
TriterpenealcoholsErythrodiol+Uvaol3745.6
(mg/kg) 
PolyphenolsOrtodiphenols12586.7
(mg/kg)Secoiridoids83147.8
Total(mg/kg)250261.8
Total(mg/kginTyrosol)162170
1LOD,limitofdetection.
2.3.DeterminationofACEOilandEVOOChemicalComposition
ACEoilandEVOOcompositionweredeterminedaspreviouslyreported[39,40].Fattyacidsand
tocopherolsweredeterminedaccordingtotheInternationalUnionofPureandAppliedChemistry
(IUPAC)StandardMethods2.301and2.432,respectively.Phenolsweredetermined,startingfroma
2.5goilsample.Thephenolfractionwasisolatedbysolidphaseextraction(SPE)usingadiolphase
cartridge,andtheextractwasanalyzedbyreversedphasehighperformanceliquidchromatography
(HPLC;HewlettPackard1050seriespumpingcomponent,AgilentTechnologies,Waldbronn,
Germany)coupledwithdiodearrayUVdetection(RF10AXLShimadzufluorescencedetector,
Shimadzu,Kyoto,Japan).Todeterminetriterpenicacids,theacidicfractionoftheoliveoilswas
isolatedbysolidphaseextractionusingbondedaminopropylcartridges,andtheextractwassilylated
andanalyzedbygaschromatography.Sterolsandtriterpenicdialcoholfractionswereisolatedfrom
theunsaponifiablematterbythinlayerchromatographyonabasicsilicagelplate,transformedinto
trimethylsilylethersandanalyzedbycapillarycolumngaschromatography(EUReg.2019/1604)
“OfficialJournaloftheEuropeanUnion.CommissionDelegatedRegulation(EU)No2019/1604of27
September2019amendingRegulation(EEC)No2568/91ontheCharacteristicsofOliveOilandOlive
ResidueOilandontheRelevantMethodsofAnalysis;OfficialJournaloftheEuropeanUnion:
Brussels,Belgium,2019;VolumeL250,pp.14–48”.ThechemicalanalysisofACEandEVOoilextracts
wasperformedusingthreesamplesfromeachoiltype,andeachdatumcamefromtriplicate
measurements.
2.4.AnimalCharacteristics
Weightgainandfood/waterintakewereregisteredonadailybasis.Systolicanddiastolicblood
pressures(BP)weremeasuredweeklybytheindirectmethodoftail–cuffocclusioninconscious
animalsusingaNiprem645pressurerecorder(CIBERTEC,Barcelona,Spain).BPvalueswere
calculatedastheaverageofthreetofoursuccessivemeasurements.
2.5.HistomorphometricStudies
Paraffinsectionsof5μmwereobtainedfollowingadministrationof4%paraformaldehyde
(PFA)inphosphatebufferedsaline(PBS)byintravitrealinjection;then,eyeswerepostfixedin4%
PFAfor24h.Thesesectionswereusedformorphometricanalysis,dihydroethidium(DHE)staining
andimmunohistochemistry,asdescribedbelow.Formorphometricanalysis,imagesof
hematoxylin/eosinstainedsectionswereacquiredusinganOlympusBX41microscopecoupledtoan
OlympusDP73camera.Thethicknessofretinallayerswasmeasuredaspreviouslydescribed[41],
usingImageJNIHfreeware(v.2.0.0)(https://imagej.nih.gov/).
2.6.TissueIsolationandHomogenization
Miceweredeeplyanesthetizedwithamixofketamine(75mg/Kgi.p.)anddiazepam(10mg
mg/Kgi.p.)andeuthanizedbycervicaldislocation.Retinasandretinalpigmentepithelium
Antioxidants2020,9,8856of33
(RPE)/choroidcomplexeswererapidlydissectedunderabinocularstereoscopicmicroscope,snap
frozeninliquidnitrogenandstoredat−80°Cuntiluseformolecularanalyses.Bothretinaand
RPE/choroidhomogenateswereobtainedin50mMPBS(pH7.4)withproteaseinhibitors(Sigma
AldrichRoche,Madrid,Spain)usingaPotter–Elvehjemtissuegrinder.Homogenateswere
centrifugedfor10minat10,000×gandthesupernatantswererecoveredtodeterminetheprotein
concentrationbytheBradfordmethod[42].
2.7.NADPHOxidaseActivityMeasurements
NADPHoxidaseactivitywasmeasuredbothinretinaandRPE/choroidhomogenatesby
lucigeninenhancedchemiluminescence,followingroutineprotocolsinourlaboratory[43].To
confirmthesource(s)ofsuperoxideanion(O2),homogenatesampleswerepreincubatedfor5min
at37°Cwiththefollowinginhibitorsat0.1mmol/L:diphenyleneiodonium,DPI(inhibitorof
flavoproteins;SigmaAldrich,Madrid,Spain);oxypurinol(inhibitorofxanthineoxidase;Sigma
Aldrich,Madrid,Spain);androtenone(mitochondrialchaininhibitorofelectrontransport;Sigma
Aldrich,Madrid,Spain).Followingthesameprotocol,theinhibitorofNOX1/4(0.1μmol/L
GKT136901;SigmaAldrich,Madrid,Spain,492000),specificNOX1inhibitor(0.5μmol/LML171;
SigmaAldrich,Madrid,Spain,175226)andthepanNADPHoxidaseinhibitor(10μmol/LVAS2870;
SigmaAldrich,Madrid,Spain,5340320001)wereusedtoexploretherelativecontributionofeach
NOXisoforminO2production[35].Hydrogenperoxide(H2O2)levelsweremeasuredinretina
homogenatesbyAmplexTMRedhydrogenperoxide/peroxidaseassaykit(A22188,ThermoFisher
Scientific,Invitrogen,Spain)followingthemanufacturer’sinstructions.Absorbancereadingswere
obtainedin96wellplatesat560nm.Allmeasurementsreferredtothesamples’proteincontent,and
resultswerealwaysexpressedasrelativetothecontrolgroup.
2.8.RetinalandChoroidalROSMeasurement
Paraffinsections(5μm)wereusedtomeasureretinalandchoroidalROSproductionusinga
fluorescentdyewithdihydroethidium(DHE;MedChemExpress,Madrid,Spain,Cat.No.HY
D0079),asdescribedSasakietal.,2010[44].ToconfirmthespecificityofDHEstaining,eyeslides
werepreincubatedwith100U/mLpolyethyleneglycolconjugatedsuperoxidedismutase(PEGSOD;
SigmaAldrich,S9549)for30minat37°C.Followingthesameprotocol,specificNOXinhibitors
VAS2870,GKT136901andML171werepreincubatedinretinalsections.4,6diamidino2
phenylindole(DAPI)FluoromountG®(SouternBiotechAssociates,Inc,Birmingham,AL;Cat.No.
010020)wasusedtomountdeparaffinizedsectionsincubatedwithDHEfor20minat37°C.An
OlympusDP73fluorescencemicroscope(Tokyo,Japan)andImageJNIHfreeware(v.2.0.0)were
usedtomeasuretheintensityofthestaining.Theresultswereexpressedasrelativetothecontrol
group.
2.9.Immunohistofluorescence
ThelocalizationandexpressionofNOXisoformsandGFAPwereevaluatedby
immunohistofluorescencestainingontheretinaandchoroidindeparaffinizedeyesections.Antigen
retrievalcompoundDivaDecloaker(BiocareMedical,LLC,Pacheco,CA,USA)andprimary
antibodieslistedinTable2wereusedforimmunostaining.GoatantirabbitAlexaFluor®555
(CohesionBiosciencesLtd.,London,UK;Cat.No.CSA3411),goatantirabbitAlexaFluor®488(Cat.
No.CSA3211)andgoatantimouseAlexaFluor®647(Cat.No.CSA3808)wereusedasfluorescent
secondaryantibodies,whereappropriate,andsectionsweremountedwithDAPIFluoromountG®.
Table2.Antibodiesusedforimmunofluorescencestudies.
PrimaryAntibodyOriginDilutionReference
AntiNOX1Mousemonoclonal1:200SantaCruzBiotechnology,SantaCruz,CA,USA
AntiNOX2Rabbitmonoclonal1:100EpitomicsAbcam,Burlingame,CA
,
USA
AntiNOX4Rabbitmonoclonal1:500EpitomicsAbcam
Antioxidants2020,9,8857of33
AntiGFAPMousemonoclonal1:500SantaCruzBiotechnology
AntiArginase1Mousemonoclonal1:100SantaCruzBiotechnology
AntiArginase2Mousemonoclonal1:100SantaCruzBiotechnology
AntiCD31Rabbitmonoclonal1:200RocklandImmunochemicals,Limerick,PA
2.10.WesternBlottingAnalyses
Aliquotsofretinalhomogenatescontainingequalamountsofproteins(40μg)weremixedwith
samplebuffer,subjectedtosodiumdodecylsulfate‐polyacrylamidegelelectrophoresis(SDSPAGE)
electrophoresisandimmunoblottedwithspecificantibodieslistedinTable3,aspreviouslydescribed
[45].Quantitativeanalysiswasperformedbyopticaldensitometry(CytivaEuropeGmbH,Barcelona,
Spain)usingβ‐actinasaloadingcontrolinthesamemembranes.
Table3.AntibodiesusedforWesternblottinganalysis.
PrimaryAntibodyOriginDilutionSecondary
AntibodyDilutionReference
AntiNOX1Mousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology,
CA,USA
AntiNOX2Rabbitmonoclonal1:8000GoatAnti
Rabbit1:9000EpitomicsAbcam,
Burlingame,CA,USA
AntiNOX4Rabbitmonoclonal1:7000GoatAnti
Rabbit1:8000EpitomicsAbcam
AntiTeNOSMousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntipeNOSSer1177Mousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntipeNOSThr495Mousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntiiNOSMousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntiNitrotyrosineMouseMonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntiGFAPMousemonoclonal1:2000GoatAnti
Mouse1:4000SantaCruzBiotechnology
AntiGSHPx1/2Mousemonoclonal1:1000GoatAnti
Mouse1:4000SantaCruzBiotechnology
AntiGSHRedRabbitpolyclonal1:5000GoatAnti
Rabbit1:8000SantaCruzBiotechnology
AntiSOD1Mousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntiArginase1Mousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
AntiArginase2Mousemonoclonal1:1000GoatAnti
Mouse1:2000SantaCruzBiotechnology
Anti‐β‐ActinMousemonoclonal1:20,000GoatAnti
Mouse1:30,000SantaCruzBiotechnology
2.11.RealTimePCR
FollowingtheTRIzol®RNAisolationmethod(ThermoFisherScientific,Madrid,Spain)inretina
samples,areversetranscriptionreactionwasperformedaspreviouslydescribed[46];specificprimers
(listedinTable4)werethenusedfortheamplificationofgeneproductsinaCFX96realtimePCR
system(BioRad,Madrid,Spain).Glyceraldehyde3phosphatedehydrogenase(GAPDH)wasused
asahousekeepinggenetoquantifytherelativechangesinmRNAexpressionfollowingthe2Ct
method[47].
Table4.PrimersusedforrealtimePCR.
Antioxidants2020,9,8858of33
GeneForwardPrimer(53)ReversePrimer(53)Accesion
Number
NOX1TTCACCAATTCCCAGGATTGAAGTGGAT
GGTC
GACCTGTCACGATGTCAGTGGCCTTG
TCAA
AY174116.1
NOX2CCCTTTGGTACAGCCAGTGAAGATCAATCCCACGTCCCACTAACATCAFJ168469.1
NOX4ATCACAGAAGGTCCCTAGCATAACCATGAGGAACAATACCACAF276957.1
eNOSAACTCCTGTCTTCCATCAAGAGTTCACTGCATTGGCTACTTCCU53142.1
iNOSTTTGTGCGAAGTGTCAGTGGCCTCCTTTGAGCCCTTTGTGBC062378.1
GSH
Px1/2GGAGAATGGCAAGAATGAAGACCGCAGGAAGGTAAAGAGNM00132952
8.1
GSHRedCACCTCTTCCTTCGACTACCGCTTGATGACATGCCAACTGBC056358.1
SOD1CGTCATTCACTTCGAGCAGAAGGGTCTGAGACTCAGACCACATAAF223251.1
NF‐κBCCCTAAAGATTGTGCCAAGAGGAAAGAGGTTATCCTGAAATCCCBC138535.1
Nrf2ACATTCCCAAACAAGATGCCGGTATTAAGACACTGTAATTCGGGBC026943.1
GAPDHGCCAAAAGGGTCATCATCTCCGCGGATGACCTTGCCCACAGCCTTGXM017321385
.2
2.12.NitricOxide(NO)Concentration
NOconcentrationinretinahomogenateswasestimatedfromnitriteandnitrate(NOx)levelsby
theGriessmethod[48].NOconcentrationswerenormalizedtotheproteincontentofeachsample,
andresultswereexpressedasrelativetoNOconcentrationinthecontrolgroup.
2.13.StatisticalAnalyses
AllresultsarepresentedasmeansSEM.OnewayANOVAfollowedbyaposthocTukey’s
multiplecomparisontestwereperformedwithGraphPadInStatSoftware(SanDiego,CA,USA,v.
3.10),anddifferenceswereconsideredstatisticallydifferentatp<0.05.Basedonthestabilityofthe
valuesofthevariablesconsideredinthisstudy,eachoneofthesamplesissufficientlyrepresentative
ofthepopulationofthegrouptowhichitbelongs.Accordingly,theapplicationoftheCentralLimit
TheoremguaranteesthenonviolabilityofthehypothesespriortotheapplicationoftheANOVAand
posthoctestsforthecomparisonofmeans.
3.Results
3.1.OilCompositionAnalyses
Overall,thefattyacidcompositionofACEoilwassimilartothatofEVOO,althoughtheformer
hadahighercontentofpalmitic(C16:0)andpalmitoleicacid(C16:1;seeTable1).TheacidityofACE
oil(measuredaspercentageofoleicacid)fallswithinthecategoryofextravirginoils.Interestingly,
thequantificationofminorcompoundsfromunsaponifiablefractionsshowedimportantdifferences
betweenACEoilandEVOO.Thus,ACEoilseemsricherintotalsterolsandtocopherols.No
remarkablechangeswereobservedintheprofileofsterolsexceptforahighercontentofStigmasterol
and5,24StigmastadienolinACEoil.Inturn,α‐tocopherolwasenhancedinACEoil,whereasthe
proportionofβ‐tocopherolwaslowerthanthatofEVOO.TheproportionoftriterpeneacidsinACE
oil(~340mg/kg)doubledthatofEVOO(~150mg/kg),theformershowinganincreaseinoleanolic
andmaslinicacidstogetherwithadecreaseinursolicacid.Theproportionoftriterpenealcoholswas
alsohigherinwildoliveoil.Surprisingly,althoughtotalphenolcontentremainedthesame,bothoils
presentedacompletelydifferentprofileinthisregardbecausesecoiridoidswerepredominantinACE
oil,whileEVOOwasenrichedinortodiphenols.Thesefindingsmightcontributetotheknowledge
aboutthehealthypropertiesoftheseoils,attributabletotheirchemicalcomposition.
3.2.CharacterizationoftheExperimentalModel
Nosignificantchangeswereobservedinfoodintake,waterintakeandweightgainamongthe
studygroups(Figure1A–C).Figure1D,Eshowstheevolutionofsystolicbloodpressure(SBP)and
diastolicbloodpressure(DBP)valuesthroughoutthe6weekexperimentalperiod.TheLN+ACE
groupcounteractedthetypicalincreaseinbloodpressurecausedbyNOdepletion,speciallyfrom
Antioxidants2020,9,8859of33
thethirdweekonwards.Ontheotherhand,theLN+EVOOgroupshowedasignificantlylower
abilitytodecreasebloodpressureincomparisonwithLN+ACE.Thus,attheendoftreatment,both
SBPandDBPrevealedsignsofmarkedhypertensionintheLNAMEgroup(182/102mmHg,
respectively)whencomparedwiththecontrolgroup(123/83mmHg).EndpointvaluesintheLN+
ACEgroupwere138/89mmHg,whereastheequivalentvaluesforLN+EVOOwere158/96mmHg.
Asfortheeffectsofoiladministrationalone,theACEgroupstayedwithnormotensiveSBP/DBP
values(126/86mmHg),asdidtheEVOOgroup(132.5/86.7mmHg).
Figure1.Animalgeneralcharacteristics.(A)Foodintake,(B)waterintakeand(C)weightgainin
experimentalanimalgroups.Theweeklyprogressionof(D)systolicbloodpressure(SBP)and(E)
Antioxidants2020,9,88510of33
diastolicbloodpressure(DBP)arerepresentedforeachanimalgroup.Valuesareexpressedasmean
SEMofsevenanimalspergroup:ap<0.05vs.control;bp<0.05vs.NGnitroLargininemethyl
ester(LNAME);dp<0.05vs.LNAMEinducedhypertensivemicesupplementedwith12%ofEVOO
(LN+EVOO);ep<0.05vs.ACE.
3.3.HistomorphometricEffectsofDietarySupplementation
RepresentativeimagesofH/EstainedretinasareshowninFigure2A.Overall,therewereno
histologicaldifferencesduetodietarysupplementationwithACEoilorEVOO,orsecondaryto
treatmentwithLNAME,becauseallgroupsshowednormaldistributionandmorphologyinboth
retinalandchoroidallayers.However,athoroughmorphometricanalysisofretinallayerthickness
(Figure2B,C)revealedsignificantreductionsof22%,11%and16%intheganglioncelllayer(GCL),
outersegments(OS)andretinalpigmentaryepithelium/choroid(RPE/CH),respectively,together
witha12%increaseintheinnerplexiformlayer(IPL)intheLNAMEgroupincomparisonwiththe
controlgroup;thesealterationswerepartiallyreversedwhendietsweresupplementedwitheither
ACEoilorEVOO.DietarysupplementationwithACEoilorEVOOinLNAMEtreatedmicealso
resultedinthenarrowingoftheouterplexiformlayer(OPL),andtheoppositewastruefortheouter
nuclearlayer(ONL).Thethicknessoftheinnernuclearlayer(INL)remainedunchangedinall
groups.
Figure2.Histomorphometricanalysesofretinaslides.(A)Representativeimagesof
hematoxylin/eosinstaining;(B)retinallayerthickness;and(C)percentagesofthicknessrelativeto
Antioxidants2020,9,88511of33
thatinthecontrolgroup.Magnification:10×.ValuesareexpressedasmeanSEMofsevenanimals
pergroup:ap<0.05vs.control;bp<0.05vs.LNAME;cp<0.05vs.EVOO;dp<0.05vs.LN+EVOO;e
p<0.05vs.ACE.GCL:ganglioncelllayer;IPL,innerplexiformlayer;INL,innernuclearlayer;OPL,
outerplexiformlayer;ONL,outernuclearlayer;OS,outersegments;RPE/CH,retinalpigmentary
epithelium/choroid.
3.4.ROSLevelsandOxidativeStressMarkersinRetina
DHEstainingshowedanintensifiedsignalinLNAMEhypertensivemicecomparedwiththe
controlgroupatalllevels(2.59,3.08,3.92,2.25‐and1.62foldchangeinGCL,INL,ONL,OSand
RPE/CH,respectively),analterationthatwasreversedinhypertensiveanimalsfedwiththeACEoil
enricheddiet(Figure3A.1,A.2).Onthecontrary,thebeneficialactionofEVOOinthisregardwasnot
thatevident.Infact,nosignificantdifferenceswerefoundinGCL,INLandRPE/CHwhencomparing
LN+EVOOandLNAMEgroups.TheeffectivenessoftheACEoilsupplementarydietwasclearly
highlightedintheLN+ACEgroup,whereDHEstainingdecreasedinGCL(121%),INL(144%),ONL
(226%),OS(81%)andRPE/CH(42%)incomparisonwithLNAMEtreatedanimals.Inturn,the
LN+EVOOgroupshowedonlysignificantdifferencesincomparisonwiththeLNAMEgroupin
ONLandOS,withrespectivesignalreductionsof120%and41%.Theadministrationofoildietsto
normotensiveanimalsdidnotaffectDHEstaining.Inanycase,thepresenceofPEGSOD(Figure
3A.1)resultedintheabolitionofO2production,thusconfirmingthespecificityofDHEstaining.
ToclarifythespecificrolesofNOXisoformsinO2.production,retinaslideswerepreincubated
withdifferentNOXinhibitors(Figure3B.1,B.2).Interestingly,ourresultsshowedthegreatest
reductioninDHEdependentO2.signal(89%)whenincubatingretinalslidesfromtheLNAME
groupwiththeNOXpaninhibitorVAS2870,whereasmildreductionswereattributableto
NOX1/NOX4inhibitorGKT136901(22%),andspecificNOX1inhibitorML171(11%).Thissuggests
amajorimplicationoftheNOX2isoformintermsofexcessiveO2.generationinLNAME
hypertensiveanimals.Nochangeswereobservedinretinalslidesfromthecontrolgroupinthe
presenceandabsenceoftheseinhibitors(datanotshown).
AfterconfirmingtheoverproductionofO2−inretinallayersofhypertensivemice,glialfibrillary
acidicprotein(GFAP)wasalsomeasuredbyimmunofluorescenceasanoxidative
stress/inflammatorymarkerofgliosis(Figure3C.1).GFAPspecificsignalscouldbedetectedinthe
retinalplexiformlayers(IPL,OPL),OSandRPE/CHofLNAMEtreatedanimals,andthestaining
wassignificantlylowerinLN+ACEandLN+EVOOgroups.Specifically,GFAPexpressiondropped
to55%(IPL),36%(OPL),57%(OS)and57%(RPE/CH)intheLN+ACEgroup,andrespectivevalues
fortheLN+EVOOgroupwere36%,50%,65%and50%(Figure3C.2).Nofluorescencesignalfor
GFAPwasapparentinthecontrol,ACEandEVOOgroups(Figure3C.1).ThequantificationofGFAP
proteinexpressioninretinahomogenatesbyWesternblottingrevealedanupregulation(1.8fold)in
hypertensiveanimalsthatcouldbepreventedbyoilenricheddiets(Figure3C.2).
Asanadditionalmarkerofoxidativestress,thedegreeof3nitrosylationproteinswasalso
measuredinretinahomogenatesbyWesternblotting(Figure3D).Asignificantincreaseinthis
parameterwasobservedintheLNAMEgroup(2.1foldchangeoverallotherexperimentalgroups).
Takentogether,alltheseresultssuggestanimbalanceintheoxidativeandinflammatoryprocesses
inretinasandRPE/CHfromhypertensivemice,whichwerepartlyreversedbyACEoil‐andEVOO
baseddiets.
Antioxidants2020,9,88512of33
Antioxidants2020,9,88513of33
Antioxidants2020,9,88514of33
Figure3.(A.1)Dihydroethidium(DHE)labeling(redcolor)forreactiveoxygenspecies(ROS)was
presentinGCL,INL,ONLandOSintheretina,andalsoinRPE/CHlayers,whichcanbe
distinguishedwith4,6diamidino2phenylindole(DAPI,bluecolor)nucleistaining.Middleline
photosinthepanelrepresenttheeffectsofpreincubationwithpolyethyleneglycolconjugated
superoxidedismutase(PEGSOD).(A.2)Fluorescenceintensityin(A.1)relativetothatofcontrol
groupandquantifiedusingImageJsoftware.(B.1)DHElabelinginretinasfromLNAMEtreated
micefollowingpreincubationwithspecificnicotinamideadeninedinucleotidephosphate(NADPH)
oxidase(NOX)inhibitors:NOXpaninhibitor(VAS2870),dualNOX1/NOX4inhibitor(GKT136901)
andNOX1inhibitor(ML171).(B.2)Relativefluorescenceintensityin(B.1)relativetothatofcontrol
groupandquantifiedusingtheImageJsoftware.(C.1)Localization/expressionofGFAPinretinal
layers,withfurtherquantificationbymeasurementoffluorescenceintensityandbyWesternblotting
ofretinalhomogenates(C.2).(D)NitrosylationofproteinsestimatedbyWesternblottinginretinal
homogenates.Magnification:10×.ValuesareexpressedasmeanSEMoffouranimalspergroup:ap
<0.05vs.control;bp<0.05vs.LNAME;cp<0.05vs.EVOO;dp<0.05vs.LN+EVOO;ep<0.05vs.
ACE;*p<0.05vs.LN+GKT136901;#p<0.05vs.LN+ML171.RFU,relativefluorescenceunits.GCL,
ganglioncelllayer;IPL,innerplexiformlayer;INL,innernuclearlayer;OPL,outerplexiformlayer;
ONL,outernuclearlayer;OS,outersegments;RPE/CH,retinalpigmentaryepithelium/choroid.
3.5.NADPHOxidaseActivityinRetinaandChoroid
SincetheNADPHoxidasesystemseemstoplayamajorroleinO2productioninretinallayers,
theactivityofthisenzymewasdeterminedinretinaandchoroidhomogenates.Intheretina,
hypertensivemiceshowedasignificant1.9foldincreaserelativetothecontrolgroup,whichwas
blockedbysimultaneousadministrationofACEoil(Figure4A).Interestingly,suchaneffectwasnot
mimickedbyEVOO.Oilsupplementationhadnoeffectonnormotensive(LNAMEfree)animals.
AsshowninFigure4B,nochangeswereobservedinretinasamplesfromLNAMEmicefollowing
exposuretooxypurinolandrotenone,butDPIdidrestoreO2generationbacktonormal.Regarding
morespecificNOXinhibitors,preincubationwithGKT136901andML171reducedtheexcessive
superoxideproductioninhypertensiveanimalsonlyslightly(17%and9%,respectively),whilethe
Antioxidants2020,9,88515of33
useofVAS2870resultedina99%reductionandledtovaluessimilartothosemeasuredinthecontrol
group.Asimilarbehaviorwasreproducedinchoroidhomogenates(Figure4C,D).Therefore,not
onlyisNADPHoxidaseinvolvedintheenhancedproductionofO2intheretinaandchoroidof
hypertensiveanimals,butNOX2seemstobemuchmoreimportantforNADPHoxidaseactivation
thanNOX1andNOX4isoforms.NochangesinO2.Productionwereobservedinretinalandchoroid
samplesfromthecontrolgroupinthepresenceandabsenceofNOXinhibitors(datanotshown).
TheAmplexRedassayinretinahomogenatesrevealedexcessH2O2production(1.7foldhigher
thannormal)inLNAMEtreatedmice.Inthiscase,bothACEoil(117%ofcontrol)andEVOO(107%)
wereabletorevertthisH2O2overproductioninhypertensiveanimals,leadingtovaluessimilarto
thosereturnedbynormotensivemicewithorwithoutdietaryoilsupplementation.Noteworthily,
preincubationofretinahomogenatesfromtheLNAMEgroupwithVAS2870andGKT136901also
normalizedH2O2production(107%and126%,respectively),thusconfirmingthemajorparticipation
ofNOX4inH2O2formation(Figure4E).Again,H2O2productionwasunalteredinretinal
homogenatesfromthecontrolgroupinthepresenceandabsenceoftheseNOXinhibitors(datanot
shown).
Figure4.(A)RelativeNADPHoxidaseactivityinretinahomogenatesand(B)characterizationofthe
primarysourceofsuperoxideanionviapreincubationwithdifferentinhibitors,asspecifiedinSection
2.7.(C,D)Similarexperimentsasin(A,B)wereperformedinchoroidhomogenates.(E)H2O2levels,
measuredbyAmplexRedassay,inretinahomogenatesfromallsixexperimentalgroups,including
theeffectofspecificNOXinhibitorsonLNAMEtreatedanimals.Valuesareexpressedasmean
SEMoffouranimalspergroup:ap<0.05vs.control;bp<0.05vs.LNAME;fp<0.05vs.LN+ACE.
Antioxidants2020,9,88516of33
3.6.NOXExpressionandLocalizationinRetinalLayersandChoroid
NOX1,NOX2andNOX4immunofluorescencesignalsweresignificantlyhigherinLNAME
retinasincomparisonwithretinasfromallothergroups,includingLN+ACEandLN+EVOO(Figure
5A).NOX1andNOX4weredetectedmainlyinGCL,IPL,OPL,OSandRPE/CH,whereasNOX2
expressionwasonlyfoundinOPL,OSandRPE/CH.LN+ACEandLN+EVOOgroupsapparently
showedasimilarexpressionprofileintheretina,exceptforaslightlyhigherNOX4signalinthelatter.
Then,bothmRNAandproteinexpressionofNOXsisoformswerequantifiedinretinalhomogenates
andtheresultsparalleledthoseobservedinimmunofluorescenceexperiments.AnincreaseinmRNA
andproteinexpressionofNOX1(2.18‐and1.83foldchange,respectively),NOX2(2.88/2.83fold)
andNOX4(1.97/1.59fold)wasfoundinretinasfromtheLNAMEtreatedmicegroupincomparison
withretinasfromuntreatedanimals(Figure5B–D).ACEoilandEVOOsupplementeddietsreduced
theexpressionofallNOXisoformsinhypertensiveanimalstoasimilarextentbacktonormalvalues.
Antioxidants2020,9,88517of33
Figure5.(A)NOXexpression(redcolor)anddoublestainingwithDAPI(bluecolor)ofNOX1(top),
NOX2(middle)andNOX4(bottom)inretinallayersfromeachexperimentalgroup.Magnification:
10×.mRNAandproteinexpressionof(B)NOX1,(C)NOX2,and(D)NOX4inretinahomogenates
fromallgroups.Thequantitativefoldchangesingeneexpressionweredeterminedrelativetothe
correspondingvaluefortheglyceraldehyde3phosphatedehydrogenase(GAPDH)housekeeping
gene.ValuesareexpressedasmeanSEMoffouranimalspergroup:ap<0.05vs.control;bp<0.05
vs.LNAME.GCL:ganglioncelllayer;IPL,innerplexiformlayer;INL,innernuclearlayer;OPL,outer
plexiformlayer;ONL,outernuclearlayer;OS,outersegments;RPE/CH,retinalpigmentary
epithelium/choroid.
Antioxidants2020,9,88518of33
3.7.NitricOxideSynthaseExpression,NOConcentrationandArginaseEnzymes
ExperimentsonNOmetabolismandNOsynthase(NOS)isoformsrevealedahighergeneand
proteinexpressionoftotalendothelialisoform(TeNOS)intheLNAMEgroupcomparedwithall
otherexperimentalgroups(Figure6A,B).Inparticular,hypertensivemiceshowedadecreaseinthe
phosphorylationofeNOSatSer1177(whichreflectstheactivationofthisenzyme),togetherwithan
increaseinthephosphorylationatThr495(inhibitoryphosphorylation)(Figure6C,D).Consequently,
alower(0.63fold)ratioofpeNOSSer1177/TeNOSwasfoundinthishypertensivemodel(Figure6E).
BothACEoil‐andEVOOenricheddietsleadtoasimilarincreaseintheratioofpeNOSSer1177/p
eNOSThr495.Nonhypertensivemicefedoilenricheddietsbehavedsimilarlytothecontrolgroup.
Regardingtheinducible(iNOS)isoform,NOdepletedmiceshowedasignificantincreaseinmRNA
andproteinexpression(1.65‐and2.2foldchange,respectively),whichwasalsoreversedbyACEoil
andEVOOadministration(Figure6F).
NOconcentrationinretinalhomogenateswasreducedby50%inLNAMEtreatedanimals;this
alterationwascorrectedbyoilsupplementation,withahighereffectinfavorofACEoilenriched
dietscomparedtoEVOO(Figure6G).TofurtherdeepenNOmetabolism,thelocationandprotein
expressionofarginaseenzymeisoforms1(Arg1)and2(Arg2),whicharecommissionedinL
arginine(NOSsubstrate)degradation,aredepictedinFigure6H–J.Bothisoformsofthishydrolytic
enzymewereoverexpressedintheLNAMEgroup(2.42‐and2.87foldchange,respectively),and
valuesreturnedtonormalinbothLN+ACEandLN+EVOOgroups(Figure6H,I).Inaddition,
hypertensiveanimalspresentedwithanoverexpressionofarginaseisoformsinRPE/CH,OS,OPL
andattheboundaryGCL/IPL.Simultaneousdietarysupplementationwithoilsrevealed
immunofluorescencesignalsinRPE/CHandOS,withalowerintensitythanthatobservedin
hypertensivemicesubjectedtothestandarddiet.Inaddition,LN+EVOOandEVOOgroupsshowed
afaintArg1/2expressioninOPL,anobservationthatwasnotreproducedinACEorLN+ACE
retinas.Experimentsperformedwithanendothelialmarker(antiCD31)confirmedthatarginase
expressioncorrelatedwithendothelialretinalcells,sincetheimmunofluorescencesignalfrom
arginasesmergedwiththatfromCD31(yellowcolorinFigure6J).
Antioxidants2020,9,88519of33
Antioxidants2020,9,88520of33
Antioxidants2020,9,88521of33
Figure6.TotaleNOS(TeNOS)mRNAexpression(A)andproteinexpression(B)inretina
homogenatesfromallexperimentalgroups.TheactivationstatusofeNOSenzymewasestimated
fromtheratios:(C)peNOSSer1177/TeNOS(activation);(D)peNOSThr495/TeNOS(inhibition);and
(E)peNOSSer1177/peNOSThr495.(F)mRNAandproteinexpressionofiNOSisoforminretina
homogenates.(G)NOconcentrationinretinahomogenates.(H,I)Proteinexpressionofarginase
isoforms1and2inretinahomogenates.(J)Arginase1(left)andarginase2(right)expression(red
color)anddoublestainingwithCD31(greencolor)inretinallayers,wherethemergeisrepresented
inyellowcolor.NucleistainingwithDAPI(bluecolor)wasusedtoidentifyretinallayerineach
Antioxidants2020,9,88522of33
experimentalgroup.Magnification:10×.ValuesareexpressedasmeanSEMoffouranimalsper
group:ap<0.05vs.control;bp<0.05vs.LNAME;cp<0.05vs.EVOO;dp<0.05vs.LN+EVOO;ep<
0.05vs.ACE.GCL:ganglioncelllayer;IPL,innerplexiformlayer;INL,innernuclearlayer;OPL,outer
plexiformlayer;ONL,outernuclearlayer;OS,outersegments;RPE/CH,retinalpigmentary
epithelium/choroid.
3.8.AntioxidantEnzymesandTranscriptionFactorsinRetinaHomogenates
TheantioxidantenzymeexpressionatmRNAandproteinlevelsisshowninFigure7.Both
superoxidedismutase(SOD1)andglutathionereductase(GSHRed)displayedasignificant
upregulation(3.41‐and1.77foldforSOD1gene/proteinexpression,respectively;and2.15/1.77fold
forGSHRed)inmicesubjectedtoLNAMEtreatmentcomparedtothecontrolgroup(Figure7A,C).
Oilenricheddietsreversedthesevaluesbacktothoseobservedincontrolnormotensivemice,with
thesoleexceptionofSOD1proteinexpressionofinLN+ACE,inwhichvalueswerealmost2.5times
higherthanthoseobservedincontrolanimals.Ontheotherhand,theglutathioneperoxidase(GSH
Px)enzymewasdownregulatedintheLNAMEgroupatbothmRNA(0.73foldchange)andprotein
(0.79foldchange)levelscomparedwiththecontrolgroup(Figure7B),analterationthatwas
mitigatedinhypertensiveanimalstreatedsimultaneouslywithexperimentaloils.
DuetherelevanceofnuclearfactorkappaB(NFkB)andnuclearfactorerythroid2(Nrf2)
transcriptionfactorsasregulatorsofoxidativeimbalance/inflammationrelatedtoNADPHoxidase
andNOSpathways,theirgeneexpressionwasalsodeterminedandmeasuredbyRTqPCR.
OverexpressionofNFkB(2.81foldchangeovercontrolgroup)wasdetectedintheLNAMEgroup
andreversedviasimultaneousadministrationofoils(Figure7D).Onthecontrary,Figure7Edepicts
theobserveddownregulationofNrf2inhypertensiveanimals(0.42foldchange),withareversal
actionrepresentedbyACE(1.76foldovercontrolgroup)andLN+ACE(1.41fold)groups.
Antioxidants2020,9,88523of33
Antioxidants2020,9,88524of33
Figure7.Antioxidantenzymegeneandproteinexpressionof(A)superoxidedismutase(SOD1),(B)
glutathioneperoxidase(GSHPx)1/2,and(C)glutathionereductase(GSHRed)inretina
homogenatesfromeachexperimentalanimalgroup.mRNAexpressionoftranscriptionfactors
nuclearfactorkappaB(NFkB)(D)andnuclearfactorerythroid2(Nrf2)(E)intheretina.The
quantitativefoldchangesingeneexpressionweredeterminedrelativetoGAPDHineach
correspondinggroup.ValuesareexpressedasmeanSEMoffouranimalspergroup:ap<0.05vs.
control;bp<0.05vs.LNAME;cp<0.05vs.EVOO;dp<0.05vs.LN+EVOO;ep<0.05vs.ACE;fp<0.05
vs.LN+ACE.
4.Discussion
DespitethewellknownhealthyeffectsoftheMediterraneandietandEVOOinparticular,very
littleisknownaboutthepropertiesofothervarietiesofOOs,suchasACE(wildolive)oil.The
chemicalcompositionprofileoftheoilsusedinthisstudy,i.e.,ACEoilandEVOO(whichwere
obtainedfromthesamegeographicareaandprocessedfollowingequalprotocols)revealedasimilar
fattyacidcomposition,butinterestingdifferencesatthelevelofminorcomponents.Thus,the
unsaponifiablefractionfromACEoilwasricherthanthatofEVOOinsterols,tocopherols,triterpene
acids,alcoholsandsecoiridoids.Bothsterolsandtocopherolsarewellknownessential
micronutrientsinthedietofallmammals,withpotenthypolipidemicandantioxidantcapacities[49–
51].Furthermore,theproportionoftriterpeneacidsinACEisremarkable,consideringthe
antioxidantandneuroprotectiveeffectsassociatedwithmaslinicacid,amongothers[52,53]
Despitethefactthatthephenolcontentissimilarinbothoils,theyshowedaninvertedratio
ortodiphenol/secoiridoids,thelatterbeingthemainpolyphenolsinACEoil.Avarietyof
pharmacologicaleffectshasbeenreportedforthesecompoundsagainstdifferentpathologiesrelated
toinflammatoryandoxidantevents,duetotheirantidiabetic,antioxidant,antiinflammatory,
immunosuppressive,neuroprotective,anticancer,andantiobesityproperties[54–57].Therefore,our
findingsonthechemicalcompositionofACEoilandEVOOsuggestadifferentbehaviorintermsof
healthprotection.
ExperimentaltreatmentwithLNAMEisawellestablishedmodelofAH.Theadministrationof
oilenricheddietsand/orLNAMEdidnotaffectfood/waterintakenorweightgainthroughoutthe
6weekexperimentalperiod.Asexpected,asignificantandsustainedelevationofSBPandDBPwas
foundintheLNAMEgroup[45].Interestingly,hypertensionwasalleviatedinLNAMEtreated
animalssubjectedtosimultaneousadministrationofACEoil‐andEVOOenricheddiets,butaclearly
higherdepletionofbloodpressurewasobservedintheformer.Olivepolyphenolshavebeen
associatedwithpositivebloodpressureoutcomes[58];additionalexperimentscarriedoutinourlab
showedanimprovementinendothelialfunction,vascularremodelingandhypertrophyinaortas
fromhypertensiveanimalsuponadministrationofanACEoilenricheddiet(unpublishedresults).
Sincenochangeswerefoundintotalphenolcontentbetweenbothoils,thehigherhypotensiveeffect
observedfortheACEoildietmightperhapsbeattributabletoitselevatedsecoiridoidcompound
content.
Antioxidants2020,9,88525of33
Nomorphologicalchangesinretinallayersnorsignsofhypertensioninducedcellular
infiltrationwererevealedbyhematoxylin–eosinstaining.However,themorphometricanalysis
evidencedthinnerGCL,OSandRPE/CHlayersintheLNAMEgroupcomparedwithnormotensive
animals.Similarresultswerereportedinhypertensivepatientswithoutpreviousocular
abnormalities,whichwasassociatedwithlikelyarterialsclerosisandvascularcontractionduetoa
highintravascularpressureinthechoroid[59],andadecreaseinretinalbloodflow[60].These
modificationsinhypertensiveeyeswerereversedbythesimultaneousadministrationofACEoiland
EVOO,suggestingapositivemodulationofvascularsclerosisandretinalbloodflow.Surprisingly,
EVOOadministrationtonormotensiveanimalsalsoresultedinadecreaseinOSandRPE/CH
thicknesswhencomparedwithcontrolmice.
Oxidativestressishighlyrelatedtoocularpathologies,includingAMD[61]orDR[31];however,
theoriginofthisoxidativeimbalanceandthepathwaysinvolvedinthesubsequentdevelopmentof
oculardamagearestillunderresearch.Preliminaryexperimentsinourlabbroughtoutanincrease
inROSproductionandNADPHoxidaseactivityinretinasfromLNAMEhypertensiveWistarrats
(unpublishedobservations).Inthecurrentstudy,designedusingLNAMEhypertensiveC57B/6J
mice,similaralterationswereobservedinboththeretinaandchoroidlayersoftheeye.Theincrease
inROSgenerationinhypertensivemicecouldbereversedinallretinallayersbythesimultaneous
administrationofACEoil,whereastheEVOOenricheddietonlymitigatedROSoverproductionin
ONLandOSlayers.Theseresultsmightbeattributable,atleastinpart,tothehigheractivityofthe
enzymeNADPHoxidase,analterationthatwasalsoblockedinretinaandchoroidhomogenates
fromtheLNAME+ACEgroup,butnotinthosefromtheLNAME+EVOOgroup.Previousstudies
demonstratedadecreaseinROSproductioninLPSinducedmurineperitonealmacrophages
incubatedwitholeocanthal,oneofthemajorsecoiridoidspresentinOOs[62].Therefore,thechanges
betweenACEoilandEVOOmightbeduetoahigheramountofsecoiridoidsintheformer.Other
bioactiveminorcompounds,suchastocopherols(alsoelevatedinACEoiloverEVOO),mighthave
contributedtobetterantioxidantoutcomesfortheACEoilenricheddiet.
StudiesusingNOXinhibitorsdemonstratedapreferentialrolefortheNOX2isoformofNADPH
oxidaseinROSproductionandNADPHoxidaseactivityintheretinaandchoroidofhypertensive
animals,becausetheinhibitoryactionofGKT136901andML171(affectingNOX1/NOX4)wasmuch
lowerthanthatofVAS2870(whichcanalsoinhibitNOX2).Theseresultswereconfirmedby
additionalexperimentsonthegeneandproteinexpressionofNOXes,whichrevealedasignificant
riseinallthreeisoformsintheretinasofhypertensivemice,withNOX2showingthehighest
upregulation.Inthiscase,thesimultaneousadministrationofbothACEoilandEVOOtoLNAME
treatedanimalsbroughtthevaluesbacktolevelsobservedincontrolanimals.Theseresultsdidnot
matchthoseobservedforNADPHoxidaseactivity,wheretheLNAME+EVOOgroupretainedthe
elevatedvaluesfoundinhypertensivemice;ontheotherhand,theincreasereportedintheLNAME
groupforH2O2productionwasreversedbytheadministrationof