PresentationPDF Available

Molecular epidemiology of Chikungunya virus in its endemic regions

Authors:

Abstract and Figures

Chikungunya virus (CHIKV) is an emerging alphavirus, which causes millions of human infections every year. Being the etiological agent of Chikungunya fever, a febrile disease associated with severe arthralgia, CHIKV has probably been circulating in sylvatic transmission cycles for many centuries. Outbreaks have been reported in Africa and Asia since the early 1950s, from three CHIKV lineages, West African, East Central South Africa (ECSA), and Asian Urban. As new outbreaks happened in South America, individual strains from the known lineages have evolved, creating new monophyletic groups that generated novel geographic-based lineages. A recently updated phylogeny of CHIKV revealed a more fine-grained clade association of both ECSA and Asian lineages, particularly the presence of distinct lineages in South America (ex ECSA) and the Caribbean (ex Asian Urban). Building on the recently updated phylogeny of CHIKV, based on more than 700 publicly available CHIKV genomes, we report here the availability of an interactive CHIKV molecular epidemiology dataset. We provide an interactive view of CHIKV molecular phylogeny built on nextstrain, a web-based visualization framework for real-time tracking of pathogen evolution (https://www.nextstrain.org). We clocked the phylogenetic tree using the timetree approach built into nextstrain, which allows for updated estimates of the time of the branching events of CHIKV lineages. Moreover, researchers can now visualize the spread of CHIKV over time and space utilizing nextstrain. The latest build is available at https://nextstrain.org/community/ViennaRNA/CHIKV
Content may be subject to copyright.
Molecular epidemiology of Chikungunya
virus in its endemic regions
Michael T. Wolfinger
GCB 2020
15 September 2020
Research Group Bioinformatics and Computational Biology
& Department of Theoretical Chemistry
University of Vienna
joint work with!
Thomas Spicher, Markus Delitz and Andriano de Bernardi Schneider
Chikungunya Virus (CHIKV)
Family Togaviridae / genus Alphavirus; mosquito-borne (Aedes spp.)
Single-stranded (+) sense RNA virus
“Chikungunya” (Makonde language): “Disease that bend up the joints”
Chikungunya fever: febrile illness, arthralgia, rash, rarely causes hemorrhagic complications
Enzootic in tropical and subtropical regions of Africa
First outbreak described 1952 in Tanzania
No vaccine available
Weaver and Forrester, Antivir. Res. (2015)
2
Weaver and Forrester, Antivir. Res. (2015)
Alphavirus Genome Organization
Non-segmented, single-stranded, (+)-sense RNA genomes of 11-12kB length
Capped and polyadenylated
Structured untranslated regions (UTRs)
AV genomes appear to host cells as mRNA for immediate translation upon entry into the cytoplasm
Viralzone / ExPASy
3
https://viralzone.expasy.org/
CHIKV Epidemic Spread
Frickmann et al., Viruses (2019)
4
Viruses 2019,11, 550 2 of 8
often associated with temporary outbreak events [
9
], leading to temporally increased infection risks in
contrast to arbovirus infections such as dengue fever, with continuously increasing case numbers [
7
,
8
].
Viruses 2019, 11, x FOR PEER REVIEW 2 of 8
in contrast to arbovirus infections such as dengue fever, with continuously increasing case numbers
[7,8].
Figure 1. Countries or regions with chikungunya virus (CHIKV) endemicity and/or outbreaks
mentioned in this review in the order of appearance (black dots and numerals 1–11). 1. Réunion; 2.
Malay Archipelago; 3. Makonde/Tanzania; 4. Thailand; 5. Vietnam; 6. Southern Sudan; 7. Belize; 8.
Curaçao; 9. Saint Martin; 10. Puerto Rico; 11. Jamaica. Arrows with year dates indicate global spread
of CHIKV as described by Young, 2018 [7]. Map colorings show infestations of countries and areas
with relevant arthropod vectors according to Rezza and Weaver, 2019 [8]. Information on CHIKV
lineages were adapted from Weaver and Lecuit, 2015 [4]. Map template source: Petr Dlouhý,
Wikimedia Commons.
Accordingly, apart from the impact on local populations as well as on travelers, CHIKV also
poses a threat to soldiers or peace-keeping forces who are deployed in areas of endemicity and
exposed due to their professional outdoor activity. Up-to-date maps of areas of autochthonous
CHIKV transmission can be monitored at the Centers of Disease Control and Prevention [9].
Chikungunya fever disease is associated with elevated body temperature, rash, and severe, often
long-lasting polyarthralgia [10,11] with considerable impact on soldiers’ health and ability to fulfil
their duty on deployment. Persistent synovitis as described for a US soldier deployed to Central
America may occur [12]. In line with the symptoms, the term “chikungunya” is derived from the term
“kungunyala” of the Makonde language, meaning “to become contorted” [1,13]. The early symptoms
of chikungunya fever are clinically indistinguishable from other febrile tropical virus infections such
as dengue fever [11]. This circumstance makes differential diagnosis rather challenging, since on-site
surveillance in the field on deployment requires sophisticated mobile diagnostic equipment or high-
level host nation support.
Certainly, CHIKV is not the only viral agent with potentially harmful effects on the health of
deployed soldiers. Basically, deployed soldiers are exposed to the same infection risks as civilian
travelers or deployed civilian health care workers, with transmission routes ranging from smear
infections, like in the case of viral gastroenteritis, to viral infections transmitted by stings, bites, or
droplets from arthropods or other animals or human-to-human infections including sexually
transmitted viral diseases [14,15]. Only a few viral infection risks associated with traveling or
deployments are vaccine preventable, such as the arthropod-borne yellow fever and Japan B
encephalitis, tick-borne encephalitis, as well as rabies or hepatitis A and B infections [16].
This narrative minireview concentrates on and summarizes experiences of international military
medical services with the epidemiology of chikungunya infections in deployed personnel and
Figure 1.
Countries or regions with chikungunya virus (CHIKV) endemicity and/or outbreaks mentioned
in this review in the order of appearance (black dots and numerals 1–11). 1. R
é
union; 2. Malay
Archipelago; 3. Makonde/Tanzania; 4. Thailand; 5. Vietnam; 6. Southern Sudan; 7. Belize; 8. Curaçao;
9. Saint Martin; 10. Puerto Rico; 11. Jamaica. Arrows with year dates indicate global spread of CHIKV
as described by Young, 2018 [
7
]. Map colorings show infestations of countries and areas with relevant
arthropod vectors according to Rezza and Weaver, 2019 [
8
]. Information on CHIKV lineages were
adapted from Weaver and Lecuit, 2015 [4]. Map template source: Petr Dlouh˛,WikimediaCommons.
Accordingly, apart from the impact on local populations as well as on travelers, CHIKV also poses
a threat to soldiers or peace-keeping forces who are deployed in areas of endemicity and exposed due
to their professional outdoor activity. Up-to-date maps of areas of autochthonous CHIKV transmission
can be monitored at the Centers of Disease Control and Prevention [
9
]. Chikungunya fever disease is
associated with elevated body temperature, rash, and severe, often long-lasting polyarthralgia [
10
,
11
]
with considerable impact on soldiers’ health and ability to fulfil their duty on deployment. Persistent
synovitis as described for a US soldier deployed to Central America may occur [
12
]. In line with
the symptoms, the term “chikungunya” is derived from the term “kungunyala” of the Makonde
language, meaning “to become contorted” [
1
,
13
]. The early symptoms of chikungunya fever are
clinically indistinguishable from other febrile tropical virus infections such as dengue fever [
11
]. This
circumstance makes dierential diagnosis rather challenging, since on-site surveillance in the field on
deployment requires sophisticated mobile diagnostic equipment or high-level host nation support.
Certainly, CHIKV is not the only viral agent with potentially harmful eects on the health of
deployed soldiers. Basically, deployed soldiers are exposed to the same infection risks as civilian
travelers or deployed civilian health care workers, with transmission routes ranging from smear
infections, like in the case of viral gastroenteritis, to viral infections transmitted by stings, bites, or
droplets from arthropods or other animals or human-to-human infections including sexually transmitted
viral diseases [
14
,
15
]. Only a few viral infection risks associated with traveling or deployments are
vaccine preventable, such as the arthropod-borne yellow fever and Japan B encephalitis, tick-borne
encephalitis, as well as rabies or hepatitis A and B infections [16].
This narrative minireview concentrates on and summarizes experiences of international military
medical services with the epidemiology of chikungunya infections in deployed personnel and preventive
approaches for the deployment situation. The literature review was based upon PubMed/Medline
Updated CHIKV Phylogeny
590 CHIKV genomes
iq-tree / SH-aLRT
5
KY703952.1
KY703924.1
KY703926.1
KY703974.1
KY703891.1
KY703986.1
KY703982.1
KY703971.1
KY703907.1
KY703914.1
KY703892.1
KY703889.1
KY703995.1
KY703943.1
KY703944.1
KY703890.1
KY703965.1
KY703905.1
KY703988.1
KY703950.1
KY703997.1
KY703966.1
KY703933.1
KY703951.1
KY703923.1
KY703983.1
KY703987.1
KY703925.1
KY703990.1
KY703992.1
KY703975.1
KY703960.1
KY703999.1
KY703921.1
KY703968.1
KY703972.1
KY704002.1
KY703978.1
KY680375.1
KY703955.1
KY703948.1
KY703919.1
KY703959.1
KY703996.1
KY703935.1
KY703920.1
MF773560.1
KY680379.1
KY435459.1
KY435480.1
KY435456.1
KY435470.1
KY680399.1
KR559488.1
KR559475.1
KY703956.1
KY703898.1
KY680352.1
KY680361.1
KY680398.1
KY680384.1
KY703922.1
KY703908.1
KY680389.1
KR559476.1
KY703928.1
KY703909.1
KY703918.1
KY703901.1
KY703984.1
KY703947.1
KY680359.1
KT192707.1
KY680363.1
KY680355.1
KY703970.1
KY703994.1
KY703934.1
KY703899.1
KR559484.1
KR046232.1
KY703903.1
KY703902.1
KY703897.1
KY703927.1
KR559472.1
KY415985.1
KY415982.1
KY415978.1
KY415981.1
KY415979.1
KY415980.1
KY415983.1
KX702402.1
KY415984.1
KR559478.1
KX702401.1
KY680402.1
KY680356.1
KY680372.1
KY704001.1
KY435471.1
KY680382.1
KY435461.1
KY680386.1
KY680413.1
MG967666.1
KY680405.1
KY435455.1
KY703993.1
KY703940.1
KY703991.1
KY703894.1
KY703893.1
KY703976.1
KY703958.1
KY703937.1
KY703900.1
KY703973.1
KY703946.1
KY703954.1
KY703915.1
KY703938.1
KY703989.1
KY703979.1
KY703957.1
KY703942.1
KY703916.1
KY703985.1
KY703931.1
KY703888.1
KY680367.1
KR046230.1
KY703930.1
KY703895.1
KY703911.1
KY703980.1
KY703998.1
KY703967.1
KR559471.1
KR046229.1
KY680393.1
KY703917.1
KY703910.1
KY703962.1
KY703896.1
KR559481.1
KY703961.1
KY703936.1
KY703977.1
KY703913.1
MG921596.1
KY703945.1
KP851709.1
KY703906.1
KY680366.1
KY435476.1
KY680347.1
KY703904.1
KR046231.1
KY680364.1
KX262994.1
KY680373.1
KY680388.1
KY435472.1
KY435469.1
KY435475.1
KY435454.1
KY704000.1
KY703932.1
KY703963.1
KY703969.1
KY703949.1
KY680370.1
KX262992.1
KP164572.1
KY435458.1
KR046228.1
KY435474.1
KY575573.1
KR559492.1
KY435481.1
KR559473.1
KY435483.1
KY435484.1
KR559494.1
KR559495.1
KR559485.1
KY435482.1
KY435462.1
KR559497.1
KR559491.1
KX496989.1
KY435465.1
KY435464.1
KY435477.1
KY680396.1
KY435473.1
KY435460.1
KY680376.1
KX262991.1
KY680407.1
KR559489.1
KP164567.1
KY435479.1
KY435457.1
KY435468.1
KR046227.1
KP851710.1
KY435467.1
KY435485.1
KY435478.1
KR559490.1
KR046234.1
KR046233.1
KR559496.1
KY435463.1
KY435486.1
KJ451624.1
KT327165.1
KT327166.1
KT327163.1
KT327164.1
KT327167.1
MG208125.1
KY680412.1
KY680368.1
KY272969.1
KY680397.1
KY272962.1
KY680414.1
KY680411.1
KY680362.1
KY680377.1
MF001512.1
KP164571.1
KY680378.1
KY680395.1
KY272963.1
KY680351.1
KU355832.1
KY680349.1
KY272970.1
KY272968.1
MF001519.1
MF001509.1
KY272965.1
KY435466.1
KY680403.1
KY680409.1
KR559482.1
KR559480.1
MF001506.1
KY680350.1
KY680348.1
MF001508.1
KY680380.1
MF001516.1
MF001518.1
KR264950.1
KR264949.1
KY575572.1
KY680404.1
KY680381.1
MF001517.1
KY680394.1
MF001514.1
KY680410.1
KR559486.1
KR559479.1
KY680390.1
KY680354.1
KY272967.1
MF001515.1
MF001505.1
KY680400.1
KY575566.1
MF001507.1
KY680387.1
KY680374.1
MF001510.1
KY680357.1
KY680358.1
KY680360.1
KY575569.1
KY680369.1
MF001513.1
KY272966.1
KY272961.1
KY575565.1
MF001511.1
KY680391.1
KY680353.1
KY680408.1
KY680385.1
KY680401.1
KR559470.1
KY680406.1
KR559477.1
KR559498.1
KY680383.1
KY680371.1
KY272964.1
KY680392.1
KR264951.1
KR559474.1
KR559487.1
KR559483.1
MF773564.1
MF773563.1
KJ689453.1
KJ689452.1
KJ451623.1
KJ451622.1
MF773559.1
KR559493.1
MF773562.1
KT308162.1
KT308159.1
KT308160.1
KC488650.1
KF318729.1
KT308163.1
KT308161.1
MF773561.1
FJ807897.1
MF773565.1
KM923920.1
KM923917.1
KM923919.1
KM923918.1
KX168429.1
EU703761.1
EU703759.1
EU703760.1
KX097988.1
KX097982.1
KY883764.1
KM673291.1
MG664851.1
HM045790.1
HM045800.1
HM045791.1
HM045797.1
HM045802.1
HM045796.1
HM045787.1
KX262987.1
KX262988.1
HM045789.1
HM045808.1
HM045814.1
EF452493.1
HM045810.1
HM045803.1
EF027140.1
HM045813.1
HM045788.1
EF027141.1
MF076575.1
MF076573.1
MF076574.1
MF076572.1
JQ861257.1
JQ861255.1
JQ861258.1
JQ861253.1
JQ861256.1
JQ861254.1
MF076570.1
MF076569.1
MF076568.1
MF076577.1
MF076576.1
MF076571.1
JQ861260.1
JQ861259.1
KJ579186.1
KJ579184.1
KJ579185.1
KJ579187.1
GU301779.1
KT324224.1
FJ445430.1
KT324228.1
FJ445431.1
KX009167.1
KX009171.1
MF773567.1
KX262997.1
GU301781.1
MF773569.1
KC862329.1
FJ445463.1
FJ445433.1
FJ445432.1
FJ445445.1
KT324225.1
FJ445502.1
FJ445443.1
FJ445484.1
HQ846359.1
HQ846358.1
KF151175.1
KF151174.1
KF590565.1
KF590567.1
GU908223.1
KF590566.1
KF590564.1
KT324226.1
KX009168.1
HQ846357.1
HQ846356.1
JX088705.1
KX009170.1
GU199353.1
GU199352.1
KT324227.1
KP164869.1
GU301780.1
MF773568.1
KX009169.1
FJ807899.1
GQ428213.1
KT336782.1
KT336781.1
GQ428214.1
GQ428212.1
FJ000069.1
KX262989.1
KP003811.1
EU244823.1
KX262993.1
KP003810.1
FJ513657.1
GU013530.1
FJ513629.1
FJ513628.1
GU013528.1
FJ513679.1
FJ513637.1
GU013529.1
FJ513635.1
HM045801.1
GU199350.1
GU189061.1
FJ445428.1
HM045799.1
GQ428211.1
MF774616.1
MF774615.1
MF774617.1
MF774619.1
MF774618.1
MF740874.1
MF774613.1
MF773566.1
MG049915.1
KY057363.1
KY751908.1
KX619426.1
MG925665.1
MF499120.1
MG137428.1
KT336780.1
KT336779.1
KT336778.1
JQ065890.1
MG664850.1
JQ065891.1
KJ679578.1
JQ065892.1
KX619423.1
KX619422.1
KX619425.1
KX619424.1
KX881784.1
JN558836.1
JN558835.1
JN558834.1
GQ428210.1
FJ513654.1
FJ513645.1
FJ513673.1
FJ445426.1
FJ513632.1
KY575570.1
GU199351.1
FJ513675.1
FJ000067.1
KT336777.1
FJ807898.1
EU372006.1
GQ428215.1
EF027134.1
KJ941050.1
HM045794.1
KY575568.1
KY575567.1
FJ000068.1
FJ000062.1
FJ000064.1
FJ000063.1
FJ445427.1
KC614648.1
JF274082.1
EU564335.1
FJ807896.1
FJ445511.1
FJ445510.1
FJ000065.1
FJ000066.1
EF027137.1
EF210157.1
EF027138.1
EF027136.1
EF027135.1
KY575571.1
KP003808.1
KP003807.1
KP003809.1
EU037962.1
EU564334.1
EF012359.1
KT449801.1
DQ443544.1
KP702297.1
KF283986.1
MG649985.1
MG649973.1
MG649971.1
MG649974.1
MG649972.1
MG649984.1
MG649983.1
MG649981.1
KY124329.1
MG649982.1
MG649978.1
MG649977.1
MG649976.1
MG649970.1
MG649975.1
KY124328.1
MG649980.1
MG649979.1
KY055011.1
KY704952.1
KY704942.1
KU940225.1
KP164569.1
KP164568.1
KP164570.1
MG000876.1
KY704955.1
MG000875.1
KY704954.1
KX228391.1
HM045823.1
KY575574.1
HM045784.1
HM045812.1
EF027139.1
KY038947.1
HM045793.1
KY038946.1
HM045822.1
KP003813.1
KP003812.1
KX262996.1
KJ679577.1
HM045821.1
HM045806.1
HM045811.1
HM045805.1
HM045792.1
HM045809.1
HM045819.1
HM045818.1
HM045820.1
HM045817.1
KX262995.1
AY72 67 32. 1
KX262986.1
HM045786.1
HM045804.1
HM045816.1
HM045785.1
HM045815.1
North
South
Central
Americas
Caribbean
East
Middle
South
West
East
South
South-East
West
Europe
Oceania
Asia Other
Africa
Phylogenetic Tree Leaves
Middle African /
South American Lineage
Middle African /
South American Lineage -
Middle African only
African/Asian Lineages
American Lineage
Asian Urban Lineage
Western African Lineage
Indian Ocean Lineage
Eastern African Lineage
de Bernardi Schneider et al., Viruses (2019)
6
CHIKV Molecular Epidemiology
7
CHIKV Molecular Epidemiology
https://nextstrain.org/community/ViennaRNA/CHIKV
715 full CHIKV genomes
nextstrain / time tree
8
CHIKV Molecular Epidemiology
https://nextstrain.org/community/ViennaRNA/CHIKV
Can we infer lineage-specific RNA structures?
Many viruses have evolutionary conserved RNAs
9
Functional RNAs in Viruses
Exoribonuclease-resistant RNAs in Flaviviruses
Examples:
domain I domain II domain III
SLII SLIV
SLIII
SLI DB1 DB2
3'SL
AUAA
G
U
G
U
U
U
A
G
G
G
U
U
U
U
G
C
A
A
U
UU
A
A
U
U
A
A
A
U
A
U
G
C
A
A
U
G
U
A
AU
U
U
A
G
U
U
G
U
A
A
A
U
A
U
U
U
G
A
U
U
G
U
G
U
A
GCUUUAU
U
U
A
G
C
A
U
UGU
U
U
U
A
G
G
AU
A
G
U
A
G
A
AGUUAAGG
U
U
U
U
A
U
U
U
A
G
U
U
A
U
U
UUA
U
U
U
A
A
U
U
G
A
A
U
U
U
G
A
UAGUC
A
G
G
C
C
A
G
G
G
C
A
ACCUG
CC
A
C
C
G
G
A
A
G
UUG
A
G
U
A
G
A
C
G
G
U
G
C
U
G
C
C
U
GCGACUC AACC
C
C
A
G
G
CGG
A
C
U
G
G
GUUAA CAA AG
C
U
G
A
C
C
G
C
U
G
A
U
G
A
U
G
G
G
A
A
A
G
C
C
C
C
U
C
A
G
A
A
C
CG
U
U
U
C
G
G
A
GA
G
G
GA
C
C
C
U
G
C
C
U
A
U
U
G
G
A
A
G
C
G
U
C
C
A
G
CCCGUGUC
A
G
G
C
C
G
C
A
A
AGCG
CC
A
C
U
U
C
G
CC
A
A
G
G
A
G
U
G
C
A
G
C
C
U
GUACGGCC
C
C
A
G
G
AGG
A
C
U
G
G
GUUACC AA AG
C
C
G
AA
A
G
G
C C C C
C
A
C
G
G
C
C
C
A
A
G
C
G
A
A
C
A
G
A
C
G
G
U
G
A
UGCG
AA
CUGUUCGU
G
GAA
GG
A
CUA
G
A
G
G
U
UA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
GAACUUAG
G
U
G
C
G
G
C
C
C
A
A
G
C
C
G
U
U
U
C
C
G
A
A
G
C
U
G
UA
GGAACGGU
G
GAA
GG
A
CUA
G
A
G
G
U
UA
G
A
G
G
A
G
A
C
C
C
C
G
C
A
U
CAUAAGCAUCAAAAAAACAGCAUAUUGACAC
C
U
G
G
G
A
A
UU
A
G
A
C
U
A
G
GA
G
A
U
C
U
U
C
U
G
C
U
C
U
A
U
U
C
C
A
A
C
A
U
C
A
A
C
C
A
C
A
A
G
G
C
A
C
A
G
AG
C
GCCGA
A
A
A
U
U
G
U
G
G
C
U
G
G
U
G
G
G
G
A
A
C
U
A
G
A
C
C
A
C
A
G
G
A
U
C
U
xrRNA1
xrRNA2
Functional RNAs are often evolutionarily conserved, typically at the secondary structure level
10
Functional RNAs in Viruses
Exoribonuclease-resistant RNAs in flaviviruses
Cis-acting RNAs in SARS-CoV-2 (and other betacoronaviruses)
Examples:
Functional RNAs are often evolutionarily conserved, typically at the secondary structure level
AUUAAAG
G
U
U
U
A
U
A
C
C
U
U
CC
C
A
G
G
U
A
A
C
A
A
A
C
CAACCAACUUUCG
A
U
C
U
C
UUG
U
A
G
A
U
CUG
U
U
C
U
C
UAA
A
C
G
A
A
CUUUAA AAUC
U
G
U
G
U
G
G
C
U
G
U
C
A
C
U
C
G
G
C
U
GCA
U
G
C
U
U
A
G
U
G
C
A
C
U
C
A
C
G
C
A
GUAU
A
A
U
U
A
A
UAA
C
U
A
A
U
U
ACUGU
C
G
U
U
G
A
C
A
G
G
A
C
A
C
G
A
G
U
A
A
C
U
C
G
U
C
U
A
U
C
U
U
C
U
G
C
A
G
G
C
U
G
C
U
U
A
C
G
G
U
U
U
C
GU
CCGUG
UU
GCAGCC
G
AUCAU
C
A
G
CACAUCU
A
GG
UU
U
C
G
U
C
C
G
G
G
U
G
U
G
A
C
C
G
A
A
A
G
G
U
A
A
G
A
U
G
G
A
G
A
G
C
C
U
U
G
UC
CCUGG
U
U
U
C
A
A
C
G
AGAAA ACAC
A
C
G
U
C
C
A
A
CUC
A
GUUU
GCCUGUU
U
U
A
C
A
G
G
U
U
C
G
C
G
A
C
G
U
GCUCGUA
C
G
U
G
G
C
U
U
U
G
G
A
G
A
C
U
C
C
G
U
G
GA
G
G
AG
G
U
C
U
UA
U
C
A
G
A
G
G
C
A
C
G
UCAAC
A
U
C
U
U
A
A
A
G
A
U
G
G
C
A
C
U
U
G
U
G
G
C
U
U
A
G
U
A
G
A
A
G
U
U
G
A
A
A
AA
GGC
GU
U
U
U
G
C
C
U
C
A
A
C
U
U
G
A
A
C
A
G
C
CC
U
AU
G
U
GU
U
C
A
U
CAA
A
C
G
U
U
C
G
G
A
U
GCUCGA ACUG
11
Functional RNAs in Viruses
Examples:
Functional RNAs are often evolutionarily conserved, typically at the secondary structure level
AUUAAAG
G
U
U
U
A
U
A
C
C
U
U
CC
C
A
G
G
U
A
A
C
A
A
A
C
CAACCAACUUUCG
A
U
C
U
C
UUG
U
A
G
A
U
CUG
U
U
C
U
C
UAA
A
C
G
A
A
CUUUAA AAUC
U
G
U
G
U
G
G
C
U
G
U
C
A
C
U
C
G
G
C
U
GCA
U
G
C
U
U
A
G
U
G
C
A
C
U
C
A
C
G
C
A
GUAU
A
A
U
U
A
A
UAA
C
U
A
A
U
U
ACUGU
C
G
U
U
G
A
C
A
G
G
A
C
A
C
G
A
G
U
A
A
C
U
C
G
U
C
U
A
U
C
U
U
C
U
G
C
A
G
G
C
U
G
C
U
U
A
C
G
G
U
U
U
C
GU
CCGUG
UU
GCAGCC
G
AUCAU
C
A
G
CACAUCU
A
GG
UU
U
C
G
U
C
C
G
G
G
U
G
U
G
A
C
C
G
A
A
A
G
G
U
A
A
G
A
U
G
G
A
G
A
G
C
C
U
U
G
UC
CCUGG
U
U
U
C
A
A
C
G
AGAAA ACAC
A
C
G
U
C
C
A
A
CUC
A
GUUU
GCCUGUU
U
U
A
C
A
G
G
U
U
C
G
C
G
A
C
G
U
GCUCGUA
C
G
U
G
G
C
U
U
U
G
G
A
G
A
C
U
C
C
G
U
G
GA
G
G
AG
G
U
C
U
UA
U
C
A
G
A
G
G
C
A
C
G
UCAAC
A
U
C
U
U
A
A
A
G
A
U
G
G
C
A
C
U
U
G
U
G
G
C
U
U
A
G
U
A
G
A
A
G
U
U
G
A
A
A
AA
GGC
GU
U
U
U
G
C
C
U
C
A
A
C
U
U
G
A
A
C
A
G
C
CC
U
AU
G
U
GU
U
C
A
U
CAA
A
C
G
U
U
C
G
G
A
U
GCUCGA ACUG
We can find them by thermodynamic modelling and consensus structure prediction
Exoribonuclease-resistant RNAs in flaviviruses
Cis-acting RNAs in SARS-CoV-2 (and other betacoronaviruses)
CHIKV 3’UTR
12
WA
ECSA-IOL
ECSA-MASA
AUL-Am
AUL-As
AUL-Cbn
110 full length CHIKV 3’UTRs
Variable length (510nt — 930nt)
Structural RNA alignments + Covariance models
Thermodynamic modelling based on ViennaRNA Package
CHIKV 3’UTR: Conserved RNA Structures
13
WA
ECSA-IOL
ECSA-MASA
AUL-Am
AUL-As
AUL-Cbn
CSE
CSE
CSE
CSE
CSE
CSE
G
A
G
A
U
G
U
U
A
U
U
U
UGU
U
U
U
U
A
A
U
A
U
U
U
C
UG
UA
AU
UG
Conserved Sequence Element (CSE)
14
WA
ECSA-IOL
ECSA-MASA
AUL-Am
AUL-As
AUL_Cbn
Y-a CSE
Y-a CSE
Y-a CSE
Y-a Y-b CSE
Y-a Y-b CSE
Y-a Y-b CSE
CHIKV 3’UTR: Conserved RNA Structures
Y-shaped Element (SL-Y)
G
A
G
A
U
G
U
U
A
U
U
U
UGU
U
U
U
U
A
A
U
A
U
U
U
C
UG
UA
AU
UG
15
CHIKV 3’UTR: Conserved RNA Structures
Stem-loop a (SL-a)
WA
ECSA-IOL
ECSA-MASA
AUL-Am
AUL-As
AUL-Cbn
Y-a CSE
SL-a Y-a CSE
SL-a Y-a CSE
SL-a Y-a Y-b CSE
SL-a Y-a Y-b CSE
SL-a Y-a Y-b CSE
UG
A
C
A
A
C
U
A
G
G
U
A
U
G
A
A
G
G
C
A
U
A
CG
CG
U
C
CC
UA
A
A
G
A
G
A
C
A
C
A
C
C
G
C
A
U
A
U
A
G
C
U
A
G
G
A
A
U
C
GC
UA
CG
G
A
G
A
U
G
U
U
A
U
U
U
UGU
U
U
U
U
A
A
U
A
U
U
U
C
UG
UA
AU
UG
16
CHIKV 3’UTR: Conserved RNA Structures
Stem-loop b (SL-b)
AGG
U
A
U
A
U
G
U
G
U
C
C
C
C
U
AA
GA
GACACA
C
C
A
U
A
U
A
UAGCU
AU
WA
ECSA-IOL
ECSA-MASA
AUL-Am
AUL-As
AUL-Cbn
SL-b SL-b Y-a CSE
SL-a SL-b Y-a CSE
SL-a SL-b Y-a CSE
SL-a SL-b Y-a Y-b CSE
SL-a SL-b Y-a Y-b CSE
SL-a SL-b SL-b Y-a Y-b CSE
UG
A
C
A
A
C
U
A
G
G
U
A
U
G
A
A
G
G
C
A
U
A
CG
CG
U
C
CC
UA
A
A
G
A
G
A
C
A
C
A
C
C
G
C
A
U
A
U
A
G
C
U
A
G
G
A
A
U
C
GC
UA
CG
G
A
G
A
U
G
U
U
A
U
U
U
UGU
U
U
U
U
A
A
U
A
U
U
U
C
UG
UA
AU
UG
17
CHIKV 3’UTR: Conserved RNA Elements
Unstructured repeat (UR)
5
1
A
C
U
2
U
A
3
U
4
A
5
G
6
A
7
U
8
C
9
U
A
10
A
11
A
12
G
13
G
14
G
15
C
16
C
U
17
A
G
18
U
19
U
C
A
20
U
G
A
21
U
C
22
A
23
A
24
C
25
C
26
C
27
C
28
U
29
G
30
A
31
A
32
U
33
A
34
A
G
35
U
36
A
37
A
38
C
39
A
40
A
41
A
42
A
43
C
U
44
A
45
C
U
46
G
A
47
A
48
A
49
A
50
A
51
C
U
52
C
53
A
54
C
A
55
C
U
56
A
57
A
58
A
59
A
60
A
61
C
U
62
U
C
63
A
64
C
U
65
A
66
A
67
A
68
A
69
A
U
70
C
71
G
A
72
A
G
73
A
74
A
75
A
76
A
3
WA
ECSA-IOL
ECSA-MASA
AUL-Am
AUL-As
AUL-Cbn
SL-b UR-1 SL-b UR-2 UR-3 Y-a CSE
SL-a UR-1 SL-b UR-2 UR-3 Y-a CSE
SL-a UR-1 SL-b UR-2 UR-3 Y-a CSE
SL-a UR-1 SL-b UR-2 UR-3 Y-a UR-4 Y-b CSE
SL-a UR-1 SL-b UR-2 UR-3 Y-a UR-4 Y-b CSE
SL-a UR-1 SL-b UR-2 SL-b UR-3 UR-4 Y-a UR-5 Y-b CSE
CHIKV 3’UTR Overview
SL-b UR SL-b UR UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y CSE
SL-a UR SL-b UR SL-b UR UR SL-Y UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y UR SL-Y CSE
WA
ECSA-IOL
ECSA-MASA
AUL-Cbn
AUL-Am
AUL-As
500 9007000 250
CHIKV 3'UTRs
AUL-Cbn specific duplication
18
UG
A
C
A
A
C
U
A
G
G
U
A
U
G
A
A
G
G
C
A
U
A
CG
CG
U
C
CC
UA
A
A
G
A
G
A
C
A
C
A
C
C
G
C
A
U
A
U
A
G
C
U
A
G
G
A
A
U
C
GC
UA
CG
AGG
U
A
U
A
U
G
U
G
U
C
C
C
C
U
AA
GA
GACACA
C
C
A
U
A
U
A
UAGCU
AU
CG
G
A
A
G
A
G
A
U
G
U
AG
G
U
A
C
U
U
A
A
G
C
U
U
C
U
UA
A
A
A
G
CA
G
C
C
G
A
AC
U
C
A
CU
U
U
G
A
G
A
U
G
U
A
G
G
C
A
U
A
G
C
A
U
A
C
C
G
A
A
C
U
C
U
U
C
CACG
A
U
CG
G
A
A
G
A
G
A
U
G
U
AG
G
U
A
C
U
U
A
A
G
C
U
U
C
U
UA
A
A
A
G
CA
G
C
C
G
A
AC
U
C
A
CU
U
U
G
A
G
A
U
G
U
A
G
G
C
A
U
A
G
C
A
U
A
C
C
G
A
A
C
U
C
U
U
C
CACG
A
U
G
A
G
A
U
G
U
U
A
U
U
U
UGU
U
U
U
U
A
A
U
A
U
U
U
C
UG
UA
AU
UG
5
1
A
C
U
2
U
A
3
U
4
A
5
G
6
A
7
U
8
C
9
U
A
10
A
11
A
12
G
13
G
14
G
15
C
16
C
U
17
A
G
18
U
19
U
C
A
20
U
G
A
21
U
C
22
A
23
A
24
C
25
C
26
C
27
C
28
U
29
G
30
A
31
A
32
U
33
A
34
A
G
35
U
36
A
37
A
38
C
39
A
40
A
41
A
42
A
43
C
U
44
A
45
C
U
46
G
A
47
A
48
A
49
A
50
A
51
C
U
52
C
53
A
54
C
A
55
C
U
56
A
57
A
58
A
59
A
60
A
61
C
U
62
U
C
63
A
64
C
U
65
A
66
A
67
A
68
A
69
A
U
70
C
71
G
A
72
A
G
73
A
74
A
75
A
76
A
3
5
1
A
C
U
2
U
A
3
U
4
A
5
G
6
A
7
U
8
C
9
U
A
10
A
11
A
12
G
13
G
14
G
15
C
16
C
U
17
A
G
18
U
19
U
C
A
20
U
G
A
21
U
C
22
A
23
A
24
C
25
C
26
C
27
C
28
U
29
G
30
A
31
A
32
U
33
A
34
A
G
35
U
36
A
37
A
38
C
39
A
40
A
41
A
42
A
43
C
U
44
A
45
C
U
46
G
A
47
A
48
A
49
A
50
A
51
C
U
52
C
53
A
54
C
A
55
C
U
56
A
57
A
58
A
59
A
60
A
61
C
U
62
U
C
63
A
64
C
U
65
A
66
A
67
A
68
A
69
A
U
70
C
71
G
A
72
A
G
73
A
74
A
75
A
76
A
3
5
1
A
C
U
2
U
A
3
U
4
A
5
G
6
A
7
U
8
C
9
U
A
10
A
11
A
12
G
13
G
14
G
15
C
16
C
U
17
A
G
18
U
19
U
C
A
20
U
G
A
21
U
C
22
A
23
A
24
C
25
C
26
C
27
C
28
U
29
G
30
A
31
A
32
U
33
A
34
A
G
35
U
36
A
37
A
38
C
39
A
40
A
41
A
42
A
43
C
U
44
A
45
C
U
46
G
A
47
A
48
A
49
A
50
A
51
C
U
52
C
53
A
54
C
A
55
C
U
56
A
57
A
58
A
59
A
60
A
61
C
U
62
U
C
63
A
64
C
U
65
A
66
A
67
A
68
A
69
A
U
70
C
71
G
A
72
A
G
73
A
74
A
75
A
76
A
3
5
1
A
C
U
2
U
A
3
U
4
A
5
G
6
A
7
U
8
C
9
U
A
10
A
11
A
12
G
13
G
14
G
15
C
16
C
U
17
A
G
18
U
19
U
C
A
20
U
G
A
21
U
C
22
A
23
A
24
C
25
C
26
C
27
C
28
U
29
G
30
A
31
A
32
U
33
A
34
A
G
35
U
36
A
37
A
38
C
39
A
40
A
41
A
42
A
43
C
U
44
A
45
C
U
46
G
A
47
A
48
A
49
A
50
A
51
C
U
52
C
53
A
54
C
A
55
C
U
56
A
57
A
58
A
59
A
60
A
61
C
U
62
U
C
63
A
64
C
U
65
A
66
A
67
A
68
A
69
A
U
70
C
71
G
A
72
A
G
73
A
74
A
75
A
76
A
3
Lineage-specific duplication
in AUL-Caribbean isolates
SL-a SL-b SL-Y SL-Y CSEUR UR UR UR
Summary
SL-b UR SL-b UR UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y CSE
SL-a UR SL-b UR SL-b UR UR SL-Y UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y UR SL-Y CSE
SL-a UR SL-b UR UR SL-Y UR SL-Y CSE
WA
ECSA-IOL
ECSA-MASA
AUL-Cbn
AUL-Am
AUL-As
500 9007000 250
CHIKV 3'UTRs
AUL-Cbn specific duplication
Conclusive mapping of sequence repeats to structured and unstructured 3’UTR regions
Individual lineages show varied replication potential in mosquito / vertebrate cells
CHIKV nextstrain build can help identifying lineage-specific RNA structures in coding regions
Acknowledgements
Thomas Spicher
Markus Delitz
Ronny Lorenz
Roman Ochsenreiter
Ivo Hofacker
University of Vienna
University San Diego
Adriano de Bernardi Schneider
@mtwolfinger
https://doi.org/10.3390/v11090798
ResearchGate has not been able to resolve any citations for this publication.
ResearchGate has not been able to resolve any references for this publication.