Molecular tools in monitoring the outset of tomato leaf curl virus (ToLCV) Transmission in the Philippines

Abstract

The study validated the use of Loop-Mediated Isothermal Amplification (LAMP) and polymerase chain reaction (PCR) in tracking the possible cause of transmission of the tomato leaf curl virus (ToLCV). Detection of ToLCV was performed by assessing the detection rate from the parallel tests of these molecular methods against the greenhouse-controlled conventional method. Assessment of symptomatic and asymptomatic plants was conducted before sampling and processing for the assays. Plant viruses are commonly transmitted by vectors, most significantly by the Silverleaf whiteflies or Bemisia tabaci. Here, PCR and LAMP detected the virus in seedlings 0-dpi (0-day post-inoculation) even before the symptoms appeared while yellowing and minor curling of leaflet ends were observed in tomato plants at 12 dpi. Results revealed that the transmission of ToLCV occurs not only via the insect vector but this virus can also be transmitted through contaminated seeds and can be expected in soil particles. The results suggest the benefits of using these molecular diagnostic methods for ToLCV in detecting the early stage of infection when symptoms are not yet fully expressed thus, saving the assay time, resources and most importantly, the crops.

Full text

Journal Pre-proof
Molecular tools in monitoring the outset of tomato leaf curl virus (ToLCV)
Transmission in the Philippines
Rubigilda Paraguison-Alili, Renmar M. Dela Cruz, Ellen S Romero,
Hannah M. Cruz, Celynne O. Padilla, Fe L. Porciuncula
PII: S2214-6628(20)30050-5
DOI: https://doi.org/10.1016/j.cpb.2020.100169
Reference: CPB 100169
To appear in: Current Plant Biology
Received Date: 12 April 2020
Revised Date: 19 July 2020
Accepted Date: 24 July 2020
Please cite this article as: {doi: https://doi.org/
This is a PDF file of an article that has undergone enhancements after acceptance, such as
the addition of a cover page and metadata, and formatting for readability, but it is not yet the
definitive version of record. This version will undergo additional copyediting, typesetting and
review before it is published in its final form, but we are providing this version to give early
visibility of the article. Please note that, during the production process, errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal
pertain.
© 2020 Published by Elsevier.

1
Molecular Tools in Monitoring the Outset of Tomato Leaf Curl Virus (ToLCV) Transmission in the Philippines
Rubigilda Paraguison-Alili1*, Renmar M. Dela Cruz, Ellen S Romero, Hannah M. Cruz, Celynne O. Padilla, and Fe L.
Porciuncula
Ramon Magsaysay-Center for Agricultural Resources and Environment Studies, Central Luzon State University, Science City
of Muñoz, Nueva Ecija, Philippines 3119
Contact No.: +63-915-905-7373; E-mail: rubigee@gmail.com
* Correspondence to:
Rubigilda Paraguison-Alili
Ramon Magsaysay-Center for Agricultural Resources and Environment Studies, Central Luzon State University, Science City
of Muñoz, Nueva Ecija, Philippines 3119
E-mail: rubigee@gmail.com
Tel. No. +63-915-905-7373
Highlights
 Results revealed that Transmission of ToLCV occurs not only via the insect vector but this virus can also be transmitted
through contaminated seeds and the soils. The results suggest the benefits of using these molecular diagnostic
methods for ToLCV in detecting the early stage of infection when symptoms are not yet fully expressed. In this case,
it will strengthen the evidence on the presence of infected plants before the symptom expression while visual
diagnoses are likely enough to confirm the infection thus, saving the assay time, resources and most importantly, the
crops.
ABSTRACT
The study validated the use of Loop-Mediated Isothermal Amplification (LAMP) and polymerase chain reaction (PCR) in
tracking the possible cause of transmission of the tomato leaf curl virus (ToLCV). Detection of ToLCV was performed by
assessing the detection rate from the parallel tests of these molecular methods against the greenhouse-controlled conventional
method. Assessment of symptomatic and asymptomatic plants was conducted before sampling and processing for the assays.
Plant viruses are commonly transmitted by vectors, most significantly by the Silverleaf whiteflies or Bemisia tabaci. Here, PCR
and LAMP detected the virus in seedlings 0-dpi (0-day post-inoculation) even before the symptoms appeared while yellowing
Journal Pre-proof

2
and minor curling of leaflet ends were observed in tomato plants at 12 dpi. Results revealed that the transmission of ToLCV
occurs not only via the insect vector but this virus can also be transmitted through contaminated seeds and can be expected in
soil particles. The results suggest the benefits of using these molecular diagnostic methods for ToLCV in detecting the early
stage of infection when symptoms are not yet fully expressed thus, saving the assay time, resources and most importantly, the
crops.
Keywords: Tomato Leaf Curl Virus (ToLCV); Transmission; Polymerase Chain Reaction (PCR); Loop-mediated Isothermal
Amplification (LAMP)
1.1 INTRODUCTION
Tomato (Lycopersicum esculentum Mill) is one of the most popular and most widely grown fruit vegetable in the world.
In the Philippines, the local tomato farming sector has been one of the major contributors to agriculture next to the onion. Tomato
ranks fourth among the major vegetables and root crops in the total volume of production which has reached 91.26 thousand
MT, 4.1 percent higher than the previous year's output amounting to 87.68 thousand MT[1]. Despite steady development and
progressive growth of the local tomato farming sector, production yield and survival of the crop are still being periled by the
detrimental effects of several disease-causing entities. Apart from known bacterial and fungal entities that can cause severe
damage to tomatoes, many plant viruses also affect the crop. Being ranked second following fungi [2], viruses are known to be
one of the most economically important plant pathogens as they consistently induce significant economic loss by limiting plant
produce quality and quantity estimated to up to more than a billion dollars per year worldwide.
Amidst the tomato viruses that are endemic in the country, tomato leaf curl virus (ToLCV) and tomato mosaic virus(ToMv) are
being construed as the most important, destructive, devastating and contagious viral disease of all [3]. In general, these viruses
have been implicated to cause 60% up to almost 100% yield loss in tomato production globally. Also, its mode of infectivity
exhibits a host non- specificity denoting that a wide array of crops like cotton, coffee beans, peppers, and tobaccos became
susceptible to the injurious effects of the diseases creating a greater negative economic impact on agriculture.
ToLCV is a geminivirus belonging to the family Geminiviridae under the genus Begomovirus. It is first seen in 1959 infecting
tomatoes grown in the Jordan Valley, Israel. It has a characteristic morphology described as having twinned quasi-isometric
incompletely geminate icosahedra encapsulating a single 2787 nucleotides (total MW 980,000) covalently closed genomic
circular ssDNA [4]. Its viral genome is capable of encoding for six major proteins derived from open-reading frames (ORFs) on
the viral and complementary viral strands. Introduction and spread of the infection from plant to plant have been attributed to
the feeding behavior of its vector, Silverleaf whiteflies or Bemisia tabaci which transmits the virus in a non-propagative and
persistent manner. Biotype B is usually the form of B. tabaci involved [5] which spreads with high frequency [6]. Affected
Journal Pre-proof

3
plants exhibit outward symptoms several weeks after viral inoculation which include severe stunting, a marked reduction in leaf
size, upward cupping and chlorosis of the leaf margins, mottling, flower abscission and significant yield reduction [7].
As yet, no known established treatments are effective for plants contracted with ToLCV. To keep the existing ToLCV -related
disease outbreaks at bay and to prevent future disease epidemics, accurate pathogen diagnosis is important in the development
and design of disease management strategies. There are several traditional methods particularly cultural, biological, and
serological as well as the determination of the physical and chemical properties of the virus that had already been utilized, and
these provided augmented arsenals for the development of new management strategies through the years. However, the above
techniques are unwieldy, time-consuming, tedious, cost-inefficient and less sensitive. It is only capable of demonstrating 20%
to 75% sensitivities which oftentimes lead to misdiagnoses of up to 80% of cases [8]. Nevertheless, the advent of nucleic acid-
based assays eliminates the constraints associated with the above-mentioned procedures for they significantly exhibit superior
sensitivity, reliability, and reproducibility [9].
Polymerase chain reaction (PCR) is the most extensively used and well appreciated among the techniques because it is extremely
sensitive in vitro method capable of amplifying trace amounts of viral nucleic acid in samples to detectable levels. Conversely,
the test requires infrastructure, refrigerated enzymes, and thermal cycling equipment that often make the tests difficult to
implement outside of centralized reference laboratories [9[. To address the limitations of PCR associated with the requirement
for the expensive thermal cycling equipment, as well as inhibitory effects of co-extracted host plant inhibitors on amplification,
and the time investment per sample [10, 11, 12], isothermal nucleic acid amplification methods were developed to fill in those
gaps. Introduced by Notomi and his colleagues, loop-mediated isothermal amplification assay or simply LAMP is an isothermal
reaction whose sensitivity and specificity are far superior to PCR; that is, the former is proven to be 10x more sensitive and
specific than the latter since it employs six primers which target different regions of the DNA/cDNA template. Unlike PCR, it
does not require a thermocycler, uses a shorter amplification time than PCR, and does not require meticulously purified RNA or
DNA template that is free of host contaminants. However, downstream applications of LAMP products such as direct sequencing,
cloning, and restriction analysis are more complicated than PCR as LAMP generates multimeric products [13].
At present, the Philippines lacks government agencies that would monitor disease incidence in tomatoes. As a result, there are
no existing policies, guidelines, programs and projects which are specifically planned and organized to control and eradicate
the pathogens affecting the tomatoes. This gap accentuates the importance of awareness of the occurrence, extent, and impact
of the ToLCV-induced outbreaks. Therefore, it is important to develop comprehensive surveillance to assess the extent of the
incidence of the viruses, to identify the factors that contribute to disease transmission and to come up with a system that records
the status of disease occurrence locally. Equally important is to develop a fast, simple, low-cost yet reliable, sensitive and
specific nucleic acid-based diagnostic technique that would serve as a screening protocol for the presence of the leaf curl virus.
A screening protocol is deemed necessary to monitor the occurrence and development of ToLCV endemics to come up with
Journal Pre-proof

4
proper and judicious ways in establishing management strategies aimed to combat and limit the occurrence of tomato viruses
in the country..
1.2 METHODOLOGY
1.2.1 Collection of Samples
Samples collected, both symptomatic and asymptomatic were all suspected infected with TolCV. A total of ninety-four (94)
samples which comprised 50 tomato leaves, 13 whiteflies, 21 soil and 10 water samples used were purposively obtained from
different organic farms. Also, seeds acquired from a regular agricultural supplier were tested.
1.2.2 Nucleic Acid Extraction and Quantification of Nucleic Acid
This study made use of the following samples: leaf tissue, whiteflies, soil, seeds, water samples used in irrigating the plants. For
leaf tissue, whiteflies and seeds, DNA extraction was done by maceration with alkaline lysis by 0.5M NaOH added with 100mM
Tris-Cl. Water precipitates which were pelleted after subjecting the water samples at maximum speed centrifugation for 5 min
in 1.5 microcentrifuge tubes and were also crudely extracted by alkaline lysis extraction. DNA and RNA extracts from soil were
purified using standard protocols using commercial kits; NucleoSpin® Soil as per manufacturer's instructions. For kit-extracted
eluates, nucleic acids were quantified using IMPLEN P330 Nanophotometer to quantify and determine the concentration (ng/µL)
and purity at A260/A280 of the extracts. The samples that met the required DNA concentration were used in the study. Products
were loaded in a 1.5% agarose gel stained with INTRON GelSafe dye, electrophoresed at 100V for at least 45 minutes and
viewed under UV light and were scored to obtain results.
1.2.3 The target: C1RAP Gene/ C1 or Replication Association Protein Gene
C1RAP gene of ToLCV encodes the Replication-associated protein or better known as REP. It is located on the negative
complementary strand of the viral genome consisting of 1088 nucleotides. It plays an important role in the replication and
transcriptional regulation of viral ssDNA. The protein that the gene encoded is the sole viral protein required for viral replication
(Gronenborn, 2007). The phylogenetic markers tagged as C1RAPG for ToLCV was specifically designed to target the genes that
encode the replication-associated protein of TOLCV using the published sequences freely accessible at the National Center for
Biotechnology Information (NCBI) with accession No. NC_005032. Generated oligonucleotide sequences were aligned using
the Basic Local Alignment Search Tool (BLAST) accessible at NCBI to verify the specificity of the primers (Table 1). Several
phylogenetic and detection studies demonstrate success in utilizing the genes selected for the study.
Journal Pre-proof

5
The previously described DNA markers were optimized using crude extracts from pooled leaf samples collected from tomato
plants manifesting conspicuous symptoms of leaf curl disease. The samples were collected during the summer of 2016 from the
tomato growing plots of an organic farm in Central Luzon State University, Science City of Munoz, Nueva Ecija, Philippines
and in April 2017 from tomato farms in Benguet and La Union. The primer pairs were successfully optimized using BioRad
T100 Thermal Cycler with its corresponding RT-PCR thermal and cycling profile. PCR products of positive representative
samples with discrete bands in gels were submitted to 1st Base DNA Sequencing Services in Singapore for direct DNA
sequencing to verify the PCR results. The raw data sequence retrieved was assembled on CodonCode Aligner online software.
The assembled sequence was then used as a template for designing new sets of primers to be used for detection/ routine field
testing.
1.2.4 Loop-Mediated Isothermal Amplification (LAMP)
Loop-Mediated Isothermal Amplification (LAMP), through its uniqueness, has provided the world with a powerful molecular
diagnostic tool. This innovative gene amplification technique, amplifies nucleic acid at a very rapid pace, maintaining high
sensitivity, specificity, and efficiency. The simplicity of its protocol and overall low cost of application are the most innovative
features of LAMP [14]. To perform LAMP, harboring in the C1RAPG gene, four specific primers, including outer primers (F3
and B3 and inner primers (FIP and BIP) were used (Table 2). LAMP reaction was carried out in a 12.5ml reaction mixture
prepared and mixed accordingly with the following reagents: 1x polymerase buffer (Lucigen ®), 1.2M betaine (Sigma-Aldrich),
0.2mM each of two outer primers (F3 and B3), and 0.8mM each of two inner primers (FIP and BIP), 0.4mM dNTP mix, 2 units
of Bst DNA polymerase (Lucigen ®), and 1.0 ml of the extract was added. Optimization was performed with temperatures from
60 to 65oC degrees Celsius and incubation time from 30, 60, and 90 minutes and terminated for 2 minutes at 85oC. The LAMP
reaction with the specific primers at 64 oC to 65oC for 60 to 90mins demonstrated efficient color reactions from the positive
controls. All sets of primers were evaluated for their routine in LAMP assays targeting the C1RAP gene.
1.2.5 Intervention/ Experimental Study as Conventional Method
 Intervention/Experimental study focusing on the observation of symptoms of the disease was the chosen conventional
tool for the investigation of viral infection. The study was intended to observe and to document the plant conditions
daily until the initial presentation of symptoms occurred. Through this experiment, the number of days from the day of
infection or inoculation from the insect vector (whitefly) to the day when the symptoms manifested was demonstrated.
Alongside, leaf, whiteflies, and soil were collected starting from DAY 0 (the day when plants were transplanted and
when whiteflies carrying the virus were released into the cage) until the day the symptoms manifested. Collected
samples were subjected to optimize PCR and LAMP protocols. Plants were maintained in a screen house for the
Journal Pre-proof

6
subsequent 'early-detection' studies. On the other hand, the source of seeds used in this experiment was also processed
for molecular procedures. The tomato seeds from an agricultural supplier were sown in sterilized soil in a plastic tray.
After 3 weeks, the germinated seedlings were transplanted in a 10 x 10 polyethylene pots containing sterilized soil with
40 g organic fertilizer. The seedlings in the pot were maintained in two improvised net cages with one tomato seedling
in each cage (Supplementary Figure 1).
 Virus inoculation. Treatment 1. Virus inoculation was done on healthy tomato seedling in one cage. It was exposed
to whiteflies that had been feeding for 2 weeks on leaf curl infected tomato. No application of biopesticide was done.
The development of symptoms using a severity rating scale (Supplemental Table 1) was observed and diagnosed starting
at 0-day post-inoculation (dpi) until 12 dpi as shown below:
 Preparation of healthy test plants. Treatment 2 served as control wherein no insect vectors were added and
Biopesticide was sprayed to each seedling to protect them from being exposed to whitefly vectors was intended for
virus inoculation. It was maintained and grown up to 6 to 8 leaf stage, until ready for inoculation.
1.3 RESULTS AND DISCUSSION
1.3.1 Detection of C1RAPG for Tomato Leaf Curl Virus by PCR and LAMP
Both symptomatic and asymptomatic plants were collected from the selected organic farms and a total of ninety-four (94)
samples comprised of 50 tomato leaves, 13 whiteflies, 21 soil, and 10 water samples were purposively obtained (Table 1).
Sources of samples include the Central Luzon State University organic farm, Bantug in the Science City of Muñoz, Sta Rosa
Farm in Nueva Ecija, Farm 1 and 2 in Benguet and La Union Farm. Seeds used in the experimental study were also tested to
confirm the source of infection. These seeds were procured commercially from a known regular supplier. Leaf samples and
whole plants were selected either suspected infected or generally with symptoms of ToLCV. These samples underwent crude
DNA extraction using alkaline lysis extraction. Samples for detection purposes were processed for PCR and LAMP. DNA
markers were designed using the generated sequence from the C1RAP gene only with a shorter target region taken from the gene
with an amplicon size of 200bp.
To evaluate the viability of the designed primer sets, PCR and LAMP were carried out to detect ToLCV targeting the C1RAPG.
All collected samples were processed for crude alkaline lysis extraction and assayed initially using PCR amplification of DNA.
Journal Pre-proof

7
The size of the DNA product amplified from the detection of C1RAPG was confirmed with the expected 200-bp amplicon.
Representative PCR products are shown in Figure 1. The summary of the assessment of all samples can be referred to in Table
3. From the fifty (50) leaf samples, 33 were observed to be positive i.e. 66% of the entire leaf samples collected. However, most
samples assayed 100% positive with the virus, particularly in LAMP assay. Commercial seeds and the soil were also tested and
revealed that they essentially can be the potential outset of transmission. LAMP reactions were essentially performed as described
in the materials and methods using the optimized conditions of 65oC for 90 minutes, the target gene was amplified detecting the
ToLCV. Positive reactions exhibit green fluorescence after adding with SYBR Green I dye (Figure 2). Also, LAMP reactions
can be confirmed by the presence of multiple, ladder-like band pattern in gel electrphoresis (Figure 3).
From the fifty (50) leaf samples, LAMP detected 49 positive i.e. 98% from the leaf samples collected. Whitefly insect vectors
were also detected 100% from the collected samples and none was detected in water samples (Table 4).
CLSU Farm, Nueva Ecija
Munoz Farm, Nueva Ecija
Benguet Farm Sta. Rosa Farm La Union Farm
Soil Seeds
Figure 1. Representative PCR products amplified using C1RAPG DNA markers for detection with amplicon size of 200-bp.
Shown are samples taken from leaf samples from CLSU Farm, Munoz Farm, Benguet, Sta. Rosa and La Union. Seeds were also
revealed to be positive with the ToLCV
200bp
Journal Pre-proof

8
Leaf Samples Soil Samples
Figure 2. Detection of positive LAMP reaction using a UV transilluminator or blue LED light. These are representative leaf
samples. Green fluorescence indicates positive, orange to whitish orange indicates negative reactions.
Leaf LAMP products
Figure 3. A 1.5% agarose gel showing DNA amplification (ladder-like bands) confirming positive for ToLCV .
1.3.2 Intervention/ Experimental Study as Conventional Method
From samples collected in Central Luzon State University, greenhouse cage for Treatment 1 was accomplished with virus
inoculation and was applied on healthy tomato seedling. It was maintained and grown up to 6 to 8 leaf stage, until ready for
inoculation. Stages of plant growth were fully documented beginning from seedling up to the stage when actual leaf curling was
observed. It was exposed to whiteflies that had been feeding for 2 weeks on leaf curl infected tomato and no application of
biopesticide was done. Treatment 2 served as control where no insect vectors were added and biopesticide was sprayed to each
seedling to protect them from being exposed to whiteflies (Supplemental Figure 2).
Visual observation on the tomato plant started from 0 dpi until the 4th-week post-inoculation to determine the level of symptom
severity (Supplemental Table 1). Yellowing and minor curling of leaflet ends (Rating scale 2) were observed at 12 dpi (Table
5). The manifestation of the symptoms of the ToLCV disease was observed onwards after the 12th day. A wide range of leaf
yellowing, curling and cupping with some reduction in size yet, plants continue to develop with a rating scale 3 (Supplemental
Figure 3). Figure 4 shows the results of samples collected from Treatment 1 and Treatment 2 Day 0- Day 12 that were subjected
to PCR and LAMP detected with ToLCV-positive. The same DNA markers for ToLC viral detection were also applied for
routine testing in whiteflies (Figure 5).
M 0 1 2 3 4 5 6 7 8 9 10 11 12
12
A
- + - - + + + +
Journal Pre-proof

9
200bp
Treatment 1
Treatment 2 Control
Figure 4. Gel Electrophoretic results of PCR and LAMP amplification from samples collected daily from the experiment
showing all of the samples collected were positive for C1RAP gene from day 0 to day 12. (A) PCR products of treatment 1
samples (B) PCR products from treatment 2 samples. M – Molecular weight marker. All positive PCR products have an amplicon
size of 200bp.
A B
Figure 5. Gel Electrophoretic results of PCR and LAMP amplification from samples collected daily from the experiment
showing positive reactions for C1RAP gene markers from day 0 to day 12. (A) LAMP products of treatment 1 samples. LAMP
products have ladder-like band patterns in agarose gel electrophoresis (B) LAMP products of Treatment 2 samples, (C) Positive
M 0 1 2 3 4 5 6 7 8 9 10 11 12 - +
+
B
ML - w1 w2 w3 w4 w5 w6
C
ML 0 1 2 3 4 5 6 7 8 9 10 M L 11 12 -
Journal Pre-proof

10
PCR product representatives from whitefly samples used in the experimental studies with a target amplicon size of 200bp. ML/M
– Molecular weight marker.
1.3.3 Confirmation of ToLCV using seed samples
To verify that the tomato seeds used in the experimental study are a potential source of infection, they were subjected to PCR
and LAMP assays. Results demonstrated that the target C1RAP gene was also amplified verifying that the commercial seeds
used in the study were also contaminated with the virus (Figure 9).
A. B.
Figure 6. (A) Gel electrophoretic result using C1RAPG DNA markers for detecting ToLCV in representative seeds. M- Marker,
N- No Template Control P1 and P2 are PCR products L1 and L2 are LAMP products. (B) LAMP assay showed green
fluorescence from the seed samples (S1 and S2).
Analytical Sensitivity or Limit of Detection (Lod) of LAMP and PCR
All sets of primers were evaluated for routine LAMP assay targeting the C1RAP gene. Analytical sensitivity was analyzed by
determining the detection limit (LoD) of LAMP and PCR A serial 10-fold dilutions of cDNA was analyzed by performing LAMP
and PCR reactions per dilution with: 305 ng/µL (original concentration), 30.5 ng, 3.0 ng, 305 pg, 30.5 pg, 3.0 pg, 305 fg, 30.5
fg, and 3.05 fg, of nucleic acid per microliter. The results showed that the limit of detection (LoD) of LAMP is 30.5 fg (Table 6
and Figure 3) while 3.05 pg for PCR. This indicates that the sensitivity of the LAMP assay was 20-fold more sensitive than that
of the PCR.
Figure 3. Florescence observation for LAMP serial dilution
1.4 SUMMARY AND CONCLUSION
A total of ninety-four (94) samples which of comprised 50 tomato leaves, 13 whiteflies, 21 soil, and 10 water samples were
purposively obtained from different organic farms. Commercial seeds used in the experimental study were also tested. The
M P1 P2 N L1 L2 N +
PC
Journal Pre-proof

11
collection of samples comprising both the symptomatic and asymptomatic plants was processed applying PCR and LAMP
molecular techniques to investigate their capability of an early detection of the disease. C1RAPG markers were designed and
successfully applied for detecting ToLCV in leaves, whiteflies, soil and seed samples. Accordingly, the DNA marker sets for
PCR and LAMP were routinely tested on the samples from the selected organic farms in Central and Northern Luzon in the
Philippines.
ToLCV is transmitted by whiteflies (Bemisia tabaci) in a persistent-circulative non-propagative manner (viruses that manage to
pass through the gut into the hemolymph and then to the salivary glands; circulative viruses include both those that disseminate
but do not replicate in the body of the insect). The virus can be efficiently transmitted during the adult stages. This virus
transmission has a short acquisition access period of 15–20 minutes, and a latent period of 8–24 hours [15]. Tomato leaf curl
disease is not transmitted in handling but it is harbored in infected host plants, some of which may be hosts that do not show
symptoms. The whitefly is a serious pest in tomatoes and other vegetable crops.
LAMP can become superior than standard PCR when it comes to cost-efficiency that will benefit countries with limited
resources. Although the advantages of the PCR is beyond than that of the conventional methods such as increased sensitivity,
still the technique has several limitations. The instrument is itself and the consumables are costly as compared with the
conventional methods. The technical and standardized protocols are limited and prone to inhibitors, modified protocols and
reagents and higher expertise and technical skills are required for performing PCR assay. It is also restricted to laboratories
with good financial support. On the other hand, LAMP can be field-based without requiring thermal cyclers, monitoring can be
done with visual, naked-eye observation. It requires shorter steps compared to PCR and is particularly resilient to inhibitors, non-
target DNA, physical and chemical parameter modifications, exposure of reagents to ambient temperature and prolonged times
in preparing the reactions and therefore crude extract can be utilized.
PCR and LAMP detected ToLCV in the seedlings 0 day after inoculation in the greenhouse even before the symptoms appeared
while yellowing and minor curling of leaflet ends were observed in tomato plant at 12 dpi. The manifestation of the symptoms
of the ToLCV disease was continuously observed after the 12th day and a wider range of leaf yellowing, curling and cupping
and reduction in size. Similarly, the leaf and the whitefly samples were also confirmed positive for ToLCV. We have tested the
possibility of the presence of the virus in soils and seeds and proved that they can be an evident source of infection. [16] reported
that the Tomato yellow leaf curl virus (TYLCV) is also a well-known tomato-infecting begomovirus and transmitted by Bemisia
tabaci. Seed transmission is possible in TYLCV-infected tomato plants that were infected by both viruliferous whitefly-mediated
transmission and agro-inoculation. Taken together, ToLCV can also be transmitted not only via the insect vector but seeds and
soils can be potential sources of infection. The results suggest the benefits of using these assays for ToLCV to detect the early
stage of ToLC infection when symptoms are not yet fully expressed. In this instance, reinforce the evidence on the presence of
infected plants before symptom expression.
Journal Pre-proof

12
Author statements
We are enclosing herewith a manuscript entitled " Molecular Tools in Monitoring the Outset of Tomato Leaf Curl Virus
(ToLCV) Transmission in the Philippines" for consideration for publication in the Current Plant Biology journal. With the
submission of this manuscript we would like to undertake that the above-mentioned manuscript has not been published
elsewhere, accepted for publication elsewhere or under editorial review for publication elsewhere; and that our university, the
Central Luzon State University in the Philippines is fully aware of this submission.
Thank you very much and hoping for your very gracious consideration.
Conflict of Interest Statement
The authors certify that they have NO affiliations with or involvement in any organization or entity with any financial interest
(such as honoraria; educational grants; participation in speakers’ bureaus; membership, employment, consultancies, stock
ownership, or other equity interest; and expert testimony or patent-licensing arrangements), or non-financial interest (such as
personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this
manuscript.
REFERENCES
[1] PHILIPPINE STATISTICS AUTHORITY Major Vegetables and Rootcrops Quarterly BulletinJanuary-March 2017. Volume
11 No. 1. ISSN 2094-618x
[2] Vidaver, A. K. and Lambrecht, P. A. 2004. Bacteria as plant pathogens. The Plant Health Instructor.
www.apsnet.org/.../PathogenGroups/Pages/B acteria.aspx (Accessed Jul. 20, 2014).
[3] Rajasri M, Lakshmi KV, R. V. V. P. Rao, K. Reddy L. (2011). Effect of Different Mulches on the Incidence of Tomato
Leaf Curl Virus and its Vector Whitefly Bemisia tabaci in Tomato. Biology 2011 1 November 2011
[4] Navot N; Pichersky E; Zeiden M; Zamir D; Czosnek H, 1991. Tomato yellow leaf curl virus: A whitefly-transmitted
geminivirus with a single genomic component. Virology, 185:151-161.
Journal Pre-proof

13
[5] Mehta, P.; Wyman, J.A.; Nakhla, M.K.; Maxwell, D.P. (1994) Transmission of tomato yellow leaf curl geminivirus by
Bemisia tabaci. Journal of Economic Entolomogy 87, 1291-1297.
[6] McGrath, P.F.; Harrison, B.D. (1995) Transmission of tomato leaf curl geminiviruses by Bemisia tabaci: effect of virus
isolate and vector biotype. Annals of Applied Biology 126, 307-316.
[7] Cohen S., Antignus Y. (1994): Tomato yellow leaf curl virus (TYLCV), a whitefly-borne geminivirus of tomatoes. In: Harris
K.F. (ed.): Advances in Disease Vector Research. Vol. 10. Springer-Verlag, New York: 259–288.
[8] Liu EB, Wadford DA, Seto J, Vu M, Hudson NR, Thrasher L, Torres S, Dyer DW, Chodosh J, Seto D, Jones MS.
Computational and serologic analysis of novel and known viruses in species human adenovirus D in which serology and
genomics do not correlate. PLoS One. 2012;7(3):e33212. doi: 10.1371/journal.pone.0033212. Epub 2012 Mar 13
[9] Taniuchi, M., Verweij, J. J., Noor, Z., Sobuz, S. U., Lieshout, L., Petri, W. A., Jr., Haque, R. and Houpt, E. R.
(2011). High throughput multiplex PCR and probe-based detection with Luminex beads for seven intestinal parasites.
Am J Trop Med Hyg, 84, 332-337.doi:
[10] Martínez-Culebras BPV, Font I, Jordá C. A rapid PCR method to discriminate between Tomato yellow leaf curl virus
isolates. Ann Appl Biol. 2001;139:251–7.
[11] Satya P, Mitra S, Ray DP, Mahapatra BS, Karan M, Jana S, Sharma, AK. Rapid and inexpensive NaOH based direct PCR
for amplification of nuclear and organelle DNA from ramie (Boehmerianivea), a bast fibre crop containing complex
polysaccharides. Ind Crop Prod. 2013;50:532–6.
12] Wang CT, Wang XZ, Tang YY, Zhang JC, Yu SL, Xu JZ, Bao ZM. (2009). A rapid and cheap protocol for preparation of
PCR templates in peanut. Electron J Biotechnol. 2009;12:1–6.
[13] Bakheit MA, Torra D, Palomino LA, Thekisoe OM, Mbati PA, Ongerth J, Karanis P. (2008) Sensitive and specific detection
of Cryptosporidium species in PCR-negative samples by loop-mediated isothermal DNA amplification and confirmation
of generated LAMP products by sequencing. Vet Parasitol. 2008 Nov 25;158(1-2):11-22. doi:
10.1016/j.vetpar.2008.09.012. Epub 2008 Sep 11. PMID: 18940521
[14] Abdullahi, Umar & Naim, Rochman & Wan Taib, Wan Rohani & Saleh, Ahmadu & Muazu, Anas & Aliyu, Sani & Baig,
Atif. (2015). Loop-Mediated Isothermal Amplification (LAMP), An Innovation in Gene Amplification: Bridging the Gap
in Molecular Diagnostics; A Review. Indian Journal of Science and Technology. 8. 1-12. 10.17485/ijst/2015/v8i17/55767.
[15] Pakkianathan BC, Kontsedalov S, Lebedev G, Mahadav A, Zeidan M, Czosnek H, Ghanim M. Replication of Tomato
Yellow Leaf Curl Virus in Its Whitefly Vector, Bemisia tabaci. J Virol. 2015 Oct;89(19):9791-803. doi:
10.1128/JVI.00779-15. Epub 2015 Jul 15. PMID:26178995
[16] Kil, Eui-Joon & Kim, Sunhoo & Lee, Ye-Ji & Byun, Hee-Seong & Park, Jungho & Seo, Haneul & Kim, Chang-Seok &
Shim, Jae-Kyoung & Lee, Jung-Hwan & Kim, Ji-Kwang & Lee, Kyeong-Yeoll & Choi, Hong-Soo & Lee, Sukchan.
Journal Pre-proof

14
(2016). Tomato yellow leaf curl virus (TYLCV-IL): A seed-transmissible geminivirus in tomatoes. Scientific Reports. 6.
19013. 10.1038/srep19013.
Table 1. C1RAP gene DNA markers designed specifically for Philippine strain with their corresponding Annealing
Temperatures and Amplicon sizes.
Target
Gene
Primer Design
Annealing
Temperature
Amplicon
Size (bp)
C1RAPG
for
Primer
designing
Forward Primer (5'-3')
ATGGCACCACCCAGAAAATT
Reverse Primer (5'-3')
CGCCTGCGTATTGGTCTCCTC
58°C
1088
C1RAPG
for
detection
Forward Primer (5'-3')
TCAGGGAGCTAAATCAAGC
Reverse Primer (5'-3')
AAATCTTTTGGAGCTAACTCC
60°C
200
Table 2. Designed LAMP DNA markers for C1RAP gene specific for ToLCV
Target Gene
Primer Design
ToLCV_S1_F3
Outer primers
TCAGGGAGCTAAATCAAGC
ToLCV_S1_B3
AAATCTTTTGGAGCTAACTCC
ToLCV_S1_FIP
Inner primers
TCCATCGACCTGAAACTCACC-
CAAATCATATATTGATAAGGACGGA
ToLCV_S1_BIP
TCAACAATCGGCCAATGACG-
CTAATTACATTAAGAGCCTCCG
Table 3. PCR Assessment of Samples Collected for ToLCV
Source/Farm
Leaf
No. of
positive
Whitefly
No. of
positive
Soil
No. of
positive
Water
No. of
positive
Seeds
(Procured
from
supplier)
No. of positive
CLSU, Nueva
Ecija
16
16
(100%)
3
3
(100%)
8
3
(38%)
2
0
1 pack
Representative
seeds
(100%)
Bantug
18
5
(28%)
6
6
(100%)
3
2
(75%)
1
0
Sta. Rosa Farm
6
6
(100%)
3
3
(100%)
4
3
(75%)
2
0
Benguet Farm 1
3
2
1
1
(100%)
3
1
(33%)
1
0
Benguet Farm 2
3
2
0
0
2
0
2
0
La Union
Farm
4
2
0
0
2
0
2
0
TOTAL
50
33
13
21
10
Percentage
66%
100%
43%
0%
100%
Journal Pre-proof

15
Table 4. LAMP Assessment of Samples Collected for ToLCV
Source/Farm
Leaf
No. of
positive
Whitefly
No. of
positive
Soil
No. of
positive
Water
No. of
positive
Seeds
(Procured
from
supplier)
No. of
positive
CLSU, Nueva
Ecija
16
16
(100%)
3
3
(100%)
8
3
(37.5%)
2
0
1 pack
Representative
seeds
(100%)
Bantug
18
17
6
6
(100%)
3
2
(67%)
1
0
Sta. Rosa Farm
6
6
(100%)
3
3
(100%)
4
2
(50%)
2
0
Benguet Farm 1
3
3
(100%)
1
1
(100%)
3
3
(100%)
1
0
Benguet Farm 2
3
3
(100%)
0
0
2
1
(50%)
2
0
La Union
Farm
4
4
(100%)
0
0
2
1
(50%)
2
0
TOTAL
50
49
13
13
21
10
0
Percentage
98%
100%
43%
Table 5. Severity symptoms of tomato plant at different observation period day post inoculation (dpi).
Observation Period
(dpi)
Rating Scale
0
0
1
0
2
0
3
0
4
0
5
0
6
0
7
0
8
0
9
0
10
0
11
0
12
2
13
2
14
2
15
2
3rd week
2
4th week
3
Table 6. Sensitivity Detection Limit for LAMP and PCR
Serial Dilution
LAMP (+/-)
PCR (+/-)
0
Original stock (305 ng/uL)
+
+
1
1/10 (30.5 ng)
+
+
2
1/100 (3.05 ng)
+
+
3
1/1000 (305 pg)
+
+
4
1/10000 (30.5 pg)
+
+
5
1/100000 (3.05 pg)
+
+
6
1/1000000 (305 fg)
+
-
Journal Pre-proof

16
7
1/10000000 (30.5 fg)
+
-
8
1/100000000 (3.05 fg)
-
-
Journal Pre-proof