Real-time tracking of stem cell viability, proliferation, and differentiation with autonomous bioluminescence imaging

Abstract

Background:
Luminescent reporter proteins are vital tools for visualizing cells and cellular activity. Among the current toolbox of bioluminescent systems, only bacterial luciferase has genetically defined luciferase and luciferin synthesis pathways that are functional at the mammalian cell temperature optimum of 37 °C and have the potential for in vivo applications. However, this system is not functional in all cell types, including stem cells, where the ability to monitor continuously and in real-time cellular processes such as differentiation and proliferation would be particularly advantageous.

Results:
We report that artificial subdivision of the bacterial luciferin and luciferase pathway subcomponents enables continuous or inducible bioluminescence in pluripotent and mesenchymal stem cells when the luciferin pathway is overexpressed with a 20-30:1 ratio. Ratio-based expression is demonstrated to have minimal effects on phenotype or differentiation while enabling autonomous bioluminescence without requiring external excitation. We used this method to assay the proliferation, viability, and toxicology responses of iPSCs and showed that these assays are comparable in their performance to established colorimetric assays. Furthermore, we used the continuous luminescence to track stem cell progeny post-differentiation. Finally, we show that tissue-specific promoters can be used to report cell fate with this system.

Conclusions:
Our findings expand the utility of bacterial luciferase and provide a new tool for stem cell research by providing a method to easily enable continuous, non-invasive bioluminescent monitoring in pluripotent cells.

Full text

M E T H O D O L O G Y A R T I C L E Open Access
Real-time tracking of stem cell viability,
proliferation, and differentiation with
autonomous bioluminescence imaging
Michael Conway
1
, Tingting Xu
2
, Andrew Kirkpatrick
1
, Steven Ripp
1,2
, Gary Sayler
1,2
and Dan Close
1*
Abstract
Background: Luminescent reporter proteins are vital tools for visualizing cells and cellular activity. Among the
current toolbox of bioluminescent systems, only bacterial luciferase has genetically defined luciferase and luciferin
synthesis pathways that are functional at the mammalian cell temperature optimum of 37 °C and have the potential
for in vivo applications. However, this system is not functional in all cell types, including stem cells, where the ability to
monitor continuously and in real-time cellular processes such as differentiation and proliferation would be particularly
advantageous.
Results: We report that artificial subdivision of the bacterial luciferin and luciferase pathway subcomponents enables
continuous or inducible bioluminescence in pluripotent and mesenchymal stem cells when the luciferin pathway is
overexpressed with a 20–30:1 ratio. Ratio-based expression is demonstrated to have minimal effects on phenotype or
differentiation while enabling autonomous bioluminescence without requiring external excitation. We used this
method to assay the proliferation, viability, and toxicology responses of iPSCs and showed that these assays are
comparable in their performance to established colorimetric assays. Furthermore, we used the continuous
luminescence to track stem cell progeny post-differentiation. Finally, we show that tissue-specific promoters can be
used to report cell fate with this system.
Conclusions: Our findings expand the utility of bacterial luciferase and provide a new tool for stem cell research by
providing a method to easily enable continuous, non-invasive bioluminescent monitoring in pluripotent cells.
Keywords: Autobioluminescence, Bacterial luciferase, Bioimaging, Lux, Stem cells, iPSC, MSC, Luciferase, Luciferin
Background
Bioluminescence is a powerful tool for visualizing cells
and monitoring their physiology. Multiple luciferase re-
porter systems are available, with firefly (luc), Nanoluc
(Nluc), and Renilla (Rluc) luciferase the most commonly
employed. These systems have been used, either alone
or in combination, to monitor viability [1], gene expres-
sion [2], infection progression [3], and a multitude of
other applications [4]. The use of luciferases is especially
prevalent in mammalian systems, where autofluores-
cence resulting from requisite excitation wavelength
stimulation diminishes signal-to-noise values and com-
plicates data acquisition. However, similar to the re-
quired photonic excitation of fluorescent systems, the
most widely used luciferases must be activated through
the exogenous application of a chemical substrate
(luciferin).
Luciferin application can be problematic from eco-
nomical, logistical, and biological perspectives. The
chemical itself is expensive; decomposes upon exposure
to light, oxygen, and moisture; and requires frozen stor-
age. In most cases, its application also requires the
© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if
changes were made. The images or other third party material in this article are included in the article's Creative Commons
licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons
licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain
permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the
data made available in this article, unless otherwise stated in a credit line to the data.
* Correspondence: dan.close@490biotech.com
1
490 BioTech, Knoxville, TN 37996, USA
Full list of author information is available at the end of the article
Conway et al. BMC Biology (2020) 18:79
https://doi.org/10.1186/s12915-020-00815-2
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

destruction of the cells under study for luciferase expos-
ure. Biological processing results in dynamic uptake and
clearance rates between experiments [5,6], and chemical
interaction produces artifacts in high-throughput opera-
tions [7]. These restrictions limit the functionality of lu-
ciferases when working with precious samples or those
that are destined for further experimentation.
To avoid the complications of external substrate appli-
cation, two bioluminescent systems have been elucidated
that genetically encode both the luciferase and luciferin
components required for autonomous functionality: fun-
gal and bacterial luciferases. Fungal luciferase (luz) re-
quires the luciferin 3-hydroxyhispidin and the co-factor
O
2
. While the oxygen co-factor is readily available in
mammalian cells, 3-hydroxyhispidin can be produced
from naturally occurring caffeic acid via the expression
of 4′-phosphopantetheinyl transferase, hispidin-3-
hydroxylase, and a polyketide synthase. This system
functions in mammalian cells when exogenously supple-
mented with luciferin, but genetically encoded luciferin
synthesis to support continuous or real-time monitoring
has not been demonstrated in these hosts [8].
Bacterial luciferase (lux) utilizes fatty aldehyde as lucif-
erin and O
2
and FMNH
2
as co-factors. It is thermostable
up to 42 °C [9] but has been limited primarily to pro-
karyotic or single-cellular eukaryotic hosts [10]. Al-
though it functions in mammalian cells [11,12], it
displays reduced luminescent output relative to bio-
luminescent systems requiring external substrate appli-
cation and has a peak output at 490 nm, which is
relatively blue-shifted compared to the in vivo imaging
optimum [13]. The system is also more complex than
externally stimulated systems. It is comprised of five
genes (luxCDABE) that work in a coordinated fashion to
express the luciferase heterodimer (consisting of the
LuxA and LuxB proteins) and the luciferin generation
pathway (consisting of the LuxC, LuxD, and LuxE pro-
teins) [14]. To function in mammalian hosts, the system
must also incorporate a flavin reductase gene (luxF)to
maintain sufficient levels of FMNH
2
for continuous lu-
minescent production [11]. In this work, we leverage the
inherent complexity of this system to re-engineer its ex-
pression such that it functions reliably in stem cells and
their progeny and to organize the multiple genes under
an orientation that permits genetic encoding of condi-
tional expression such that cells self-regulate the initi-
ation or cessation of bioluminescent signals in response
to predetermined events.
Results
Overexpression of the luciferin synthesis pathway is
required for continuous luminescence in iPSCs
The previously published pCMV
lux
vector [12] harbors a
synthetic lux operon consisting of viral 2A element
linked luxCDABEF genes under the control of a CMV
promoter and has only been shown to function effectively
in a handful of immortalized cancer cell lines [11,12].
pCMV
lux
functionality was confirmed via observation of
autobioluminescence following transfection into HEK293
cells (2.09 × 10
5
(± 4.03 × 10
3
) photons/s) (data is available
at https://osf.io/h5qzj/ [15]). To establish a baseline for
vector functionality in iPSCs, it was transfected without
modification. This approach failed to produce autobiolu-
minescence (20 (± 62) photons/s; p= 0.309 compared to
untransfected control) (data is available at https://osf.io/h5
qzj/ [15]) after transient transfection and following qPCR-
based analysis confirming genomic integration of the lux-
CDABEF genes in stably transfected isolates. We thus
sought to tailor the lux operon for iPSC expression. The
CMV promoter can undergo methylation-based silencing
in some cell types [16], most notably in embryonic stem
cells [17]. Because iPSCs can undergo random methyla-
tion dynamics throughout reprogramming and subse-
quent culture, ultimately resulting in methylation patterns
similar to their embryonic stem cell counterparts [18], the
viral CMV promoter was replaced with a chicken beta
actin (CBA) promoter that provides stable transgene ex-
pression in both stem and differentiated cells [19]. This
will mitigate any potential promoter silencing while simul-
taneously improving downstream compatibility in a wider
array of differentiated cell types. Similarly, the SV40 pro-
moter driving the neomycin selection marker was replaced
with a nanog promoter to enable stem cell-specific selec-
tion [20](Fig.1a). Transfection of this new construct,
Stem-lux
CDABEF
, resulted in weak but measurable autobio-
luminescence that did not persist for more than 24–72 h.
These observations suggested that lux operon expression
in iPSCs was capable of supporting autobioluminescence
but that some or all of the system components were not
expressed sufficiently to support efficient autobiolumines-
cent production.
Viral 2A linker-based expression of multiple open
reading frames can result in decreased transcription of
the genes distal to the promoter [12]. The operon was
therefore divided into its component subsections: the lu-
ciferin pathway-encoding luxCDEF genes (Stem-lux
CDEF
)
and the luciferase-encoding luxAB genes (Stem-lux
AB
)
(Fig. 1b). To identify a strategy in which sufficient lucif-
erin would be produced to enable a robust biolumines-
cent phenotype without negatively effecting host
physiology, each component was transiently co-
transfected at molar ratios from 1:1 to 40:1 and measur-
ing the resulting light output 24–48 h post-transfection
(Fig. 1c). The best performing transient transfection of
Stem-lux
CDEF
/Stem-lux
AB
resulted in 9.5 × 10
3
(± 235)
photons/s, outperforming the unmodified pCMV
lux
vec-
tor under the same conditions (20 (± 62) photons/s)
(data is available at https://osf.io/h5qzj/ [15]).
Conway et al. BMC Biology (2020) 18:79 Page 2 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

A stable, autobioluminescent iPSC line was generated
by co-transfecting the Stem-lux
CDEF
and Stem-lux
AB
vectors using the 20–30:1 M ratio found to produce the
brightest signal in the transient transfection experiment,
selecting antibiotic-resistant clonal lines, and qualita-
tively selecting the brightest lineage from among the iso-
lated clones. This line was denoted as iPSC-lux.
Genomic qPCR-based analysis confirmed the selected
lineage had a ~ 27:1 ratio of the luciferin pathway and
luciferase genes (Additional file 1: Fig. S1a), which was
within the predicted range. Transcriptional analysis
showed that despite the 27:1 luciferin:luciferase genomic
integration ratio, the luciferin components were
transcribed at a ratio of 15.4:1 (± 1.0) (Additional file 1:
Fig. S1b). This reduced transcriptional ratio may be due
to the positional effects of the insertion location or the
difference in the transcribed length of the luciferin
generation pathway mRNA compared to the luciferase
component mRNA (4470 nucleotides vs 2139
nucleotides).
The growth rate of the iPSC-lux line was indistin-
guishable from that of the wild-type iPSCs
(Additional file 2: Fig. S2a), as was its metabolic activity
level as measured by ATP content and cell viability as
measured by NAD(P)H oxidoreductase activity
(Additional file 2: Fig. S2b&c). Long-term culture of this
lineage (> 3 months) did not reveal any impact on
growth rate relative to the wild-type parent line resulting
from the metabolic burden of continuous light produc-
tion. Autobioluminescent cells retained the expression
of pluripotency markers (Additional file 2: Fig. S2d-f)
and a normal karyotype (Additional file 2: Fig. S2g&h),
suggesting that the integration of the split lux operon
did not affect the pluripotency or genomic stability.
Fig. 1. Introducing the lux luciferin:luciferase operon components at 20–30:1 M ratios produces robust autobioluminescence in iPSCs. aSingle
operon, 2A-segmented, polycistronic lux operon driven by the chicken beta actin (CBA) promoter and flanked by sequence elements facilitating
transposon-mediated genomic integration (TE). bSplit lux cassette orientation enabling ratio-based component expression. F2A, foot and mouth
disease viral 2A element; E2A, equine rhinitis A viral 2A element; Ta2A, synthetic Thosea asigna viral 2A element; P2A, Porcine teschovirus 1 viral 2A
element; T2A, Thosea asigna viral 2A element. cLight production following transient transfection of Stem-lux
CDEF
:Stem-lux
AB
from bat a 1:1 M
ratio compared to otherwise identical cells transfected with the same amount of Stem-lux
AB
but increasing molar ratios of Stem-lux
CDEF
. The
average radiance was normalized to the MTT signal. Values are representative of N= 3 replicates. Error bars represent the standard error of the
means. p/s/cm
2
/sr; photons/s/cm
2
/steradian. Data is available at https://osf.io/h5qzj/ [15]
Conway et al. BMC Biology (2020) 18:79 Page 3 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Validation of autobioluminescent assays for monitoring
viability and proliferation
If luciferin production is correctly titrated to support
consistent enzymatic turnover without modification of
host physiology, the continuous, self-generated bio-
luminescence of the iPSC-lux line should correlate
linearly with the population size by exhibiting light out-
put proportional to the cell number. To test this, a range
of iPSC-lux cells were examined for autobioluminescent
output. The observed average radiance correlated
strongly (R
2
= 0.93) to the number of plated cells
(Fig. 2a). These results were validated against MTT as-
says across all population sizes. Results from the two
assay formats were strongly correlated (R
2
= 0.98)
(Fig. 2b), suggesting the autobioluminescent assay for-
mat is faithfully reporting viable population size. Unlike
the colorimetric MTT assay, which uses the NAD(P)H-
dependent cellular oxidoreductase enzymes of lysed cells
to reduce a tetrazolium dye, using autobioluminescence
to assay population size and viability does not require
interaction with or destruction of the sample. This
avoids imparting unintended influence over the cells and
enables continuous observation or further downstream
testing post-interrogation.
We next sought to validate whether autobiolumines-
cence could similarly report viability changes in response
to toxicological challenge. Treatment of the iPSC-lux
line with a range of doxorubicin concentrations resulted
in dose-dependent changes to autobioluminescent out-
put indicative of changing cellular viability. These results
were consistent with validation measurements made
using complementary MTT assays (R
2
= 0.99) and
yielded similar half-maximal inhibitory concentration
(IC
50
) values (autobioluminescence = 1.31 × 10
−8
M;
MTT = 1.41 × 10
−8
M (Fig. 2c, d). These data illustrate
that the autobioluminescent assay is capable of reporting
changes in cellular viability resulting from autonomous
modulation of the cells’autobioluminescent output in
response to cell stress and death.
Continuous light production enables lineage tracking
post-differentiation
We sought to test whether the autobioluminescent
phenotype is preserved in progeny differentiated from
the continuously luminescent iPSC-lux line. Derivation
of iPSCs into cardiomyocytes enables the exploration of
cardiotoxicity and cardiac biology. Enabling the continu-
ous assessment of cellular health and metabolic activity
Fig. 2. Stem-lux
CDEF
/Stem-lux
AB
-induced autobioluminescence faithfully recapitulates the results of common assays without necessitating sample
destruction. aThe fold change in autobioluminescence relative to the background correlates strongly with the initial cell seeding density (R
2
=
0.93) to allow a continuous population size determination. N= 6 replicates. bThe fold change in autobioluminescence relative to the background
correlates strongly with the fold change in MTT absorbance (570 nm) relative to the background (R
2
= 0.98). N= 6 replicates. ciPSCs challenged
with the indicated doses of doxorubicin report viability without perturbation similarly to the destructive MTT assay. dViability measurements
from the two test formats show a strong correlation between the results. The inset shows the correlation between test results under low viability
conditions as indicated in the boxed section of the main plot. Values are representative of N= 3 replicates. Error bars represent the standard error
of the means. p/s/cm
2
/sr; photons/s/cm
2
/steradian. Data is available at https://osf.io/h5qzj/ [15]
Conway et al. BMC Biology (2020) 18:79 Page 4 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

across this transition and beyond would be a beneficial
research tool. Targeted cardiac differentiation [21] of the
iPSC-lux line produced autobioluminescent cardiomyo-
cytes.The autobioluminescent signal of the derived car-
diomyocytes (CM-lux) did not differ from that of their
iPSC progenitors (Fig. 3a), suggesting the autobiolumi-
nescent phenotype is not radically altered by the change
in cell type. We next sought to determine whether CM-
lux cells retained the ability to report cytotoxic exposure
impacts via self-modulation of autobioluminescence.
Following a 24-h exposure to a range of doxorubicin
concentrations, CM-lux autobioluminescence decreased
in a dose-response fashion (Fig. 3b) with an IC
50
of
0.29 μM. This value agrees with the published IC
50
value
as calculated using PrestoBlue, an alternative non-lytic
assay that uses a resazurin-based solution to measure
the reducing power of living cells and been correlated
with cardiomyocyte viability, contractility, electrophysi-
ology, calcium handling, and signaling [22].
Autobioluminescent iPSC-derived models increase per
sample data output by transitioning endpoint
measurements to kinetic assays without necessitating
alterations to existing protocols
Cardiotoxicity testing is an essential part of therapeutic
development and non-therapeutic chemical risk assess-
ment. While continuous cell monitoring is possible for
these applications (e.g., impedance plates), the equip-
ment and consumable costs for these approaches are sig-
nificantly high as to inhibit their common application.
Thus, these screens more commonly utilize iPSC-
derived cardiomyocytes within a destructive end-point
assay that yields only a single measurement time point.
In this format, orchestrating replicates to capture kinetic
toxicity data becomes expensive and introduces
experimental variation even with modest increases in
scale. To address this problem, we sought to validate the
use of CM-lux cells to provide real-time, continuous car-
diotoxicity monitoring in response to a chemical chal-
lenge over an extended time.
CM-lux cells were continuously monitored for 5 h to
establish a baseline signal. Subsets of cells were then
challenged with a range of doxorubicin concentrations
while continuing to measure light output over the next
25 h. Increasing doxorubicin concentrations resulted in
decreasing autobioluminescent output across the post-
treatment monitoring window (Fig. 4a). The continuous
data show that higher concentrations of doxorubicin
exert toxic effects faster than lower doses despite the dif-
ferent concentrations resolving to approximately the
same level of autobioluminescent output by the end of
the assay. This trend remains when examining 2.5-h in-
tervals (Fig. 4b), indicating that the assay can be recapit-
ulated using equipment that is not capable of real-time
image acquisition. The calculation of IC
50
values over
the experimental time course revealed a reduction in
IC
50
concentration with time (Fig. 4c). While this is ex-
pected for a known cardiotoxic compound like doxo-
rubicin, the kinetic values provide an enhanced context
for determining the IC
50
value by allowing this measure-
ment to be performed after the value stabilizes, thus en-
abling a more confident assessment of toxicity.
Real-time transcriptional activation or tissue-specific
differentiation bioreporters can be easily produced by
regulating luciferase component expression with
appropriate promoters
To expand the utility of this approach, we sought to test
whether autobioluminescence could be controlled with
an inducible promoter to report changes in gene
Fig. 3. Cardiomyocytes derived from autobioluminescent iPSCs maintain a continuous light production. aThe autobioluminescent signal from
iPSCs with genomically integrated Stem-lux
CDEF
:Stem-lux
AB
(iPSC-lux) is not altered following differentiation into cardiomyocytes (CM-lux). b
Autobioluminescent CM-lux cells remain capable of reporting changes in viability in response to doxorubicin challenge and produce IC
50
values
similar to previous reports [22]. Values are representative of N= 3 replicates. Error bars represent the standard error of the means. p/s/cm
2
/sr;
photons/s/cm
2
/steradian. Data is available at https://osf.io/h5qzj/ [15]
Conway et al. BMC Biology (2020) 18:79 Page 5 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

expression. To determine if this was possible using a
model system, an improved tetracycline promoter was
cloned upstream of the luciferase and co-integrated with
either a control vector expressing a tTA transactivator
(doxycycline exposure activates binding of the transacti-
vator to the TET operator and inhibits transcription of
the luciferase genes) or an rtTA reverse transactivator
(doxycycline exposure inhibits binding of the transacti-
vator to the TET operator and allows transcription of
the luciferase genes) [23] (Fig. 5a). This allowed interro-
gation of inducible and repressible expression using the
highly characterized tetracycline transactivator system.
Both the inducible and repressible iPSC lines were
capable of self-modulating autobioluminescent expres-
sion in response to doxycycline exposure (Fig. 5c, d) and
retained their ability to report cardiotoxicity when differ-
entiated into cardiomyocytes (Additional file 3: Fig. S3).
To determine if the inducible expression approach could
be leveraged to achieve tissue-specific functionality, the
cardiac tissue-specific TNNT2 promoter [24] was cloned
into Stem-lux
AB
in place of the CBA promoter to create
TNNT2-lux
AB
(Fig. 5b) and co-expressed with Stem-lux-
CDEF
in iPSCs and iPSC-derived cardiomyocytes. Auto-
bioluminescent expression was observed only in the
cardiac cells (Fig. 5e). These results demonstrate tran-
scriptional activation monitoring without necessitating
Fig. 4. Autobioluminescent cardiomyocytes enable kinetic doxorubicin toxicity monitoring over prolonged time periods. aCM-lux
autobioluminescence pre- and post-challenge with increasing doses of doxorubicin (challenge was introduced at the time indicated by the white
arrow). bRepresentative pseudocolor images of CM-lux autobioluminescent signal at 2.5-h intervals over the time series shown in a.cThe
calculated IC
50
of doxorubicin plotted against time. Values are representative of N= 3 replicates. Error bars represent the standard error of the
means. p/s/cm
2
/sr; photons/s/cm
2
/steradian. Data is available at https://osf.io/h5qzj/ [15]
Conway et al. BMC Biology (2020) 18:79 Page 6 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Fig. 5. (See legend on next page.)
Conway et al. BMC Biology (2020) 18:79 Page 7 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

external stimulation to allow for automated signal track-
ing under normal growth conditions. Using this ap-
proach, specific cellular lineages can be endowed with a
persistent autobioluminescent phenotype that enables
longitudinal proliferation and viability tracking.
Ratio-based luciferin:luciferase expression similarly
enables continuous bioluminescence in MSCs
Having established autobioluminescence in iPSCs and
iPSC-derived cardiomyocytes, we reasoned that multipo-
tent mesenchymal stem cells should also be capable of
autobioluminescent light production using this ap-
proach. To test this, we established an optimal Stem-
lux
CDEF
:Stem-lux
AB
expression ratio through the trans-
fection of human adipose-derived mesenchymal stem
cells (hADMSC) (Additional file 4: Fig. S4a). This ratio
was identified to be identical to that for iPSCs, between
20 and 30:1. Autobioluminescence from MSCs express-
ing Stem-lux
CDEF
and Stem-lux
AB
strongly correlated
with cell number (Additional file 4: Fig. S4b) and could
be imaged in vivo following intraperitoneal (IP) injection
into a mouse model (Additional file 5: Fig. S5a). Auto-
bioluminescent signals from injected cells correlated
strongly with cell number (R
2
= 0.99) (Additional file 5:
Fig. S5b), suggesting this approach can be used to non-
invasively monitor changes in cell population sizes for
applications such as tissue regeneration or tumor forma-
tion/treatment. To demonstrate that autobioluminescent
MSCs can be used to track cell migration, cells were
injected into the tail vein and allowed to circulate for 1
h. At this time, specific accumulation in the lungs was
readily detectable (Additional file 6: Fig. S6). These find-
ings are consistent with previous reports of MSC accu-
mulation under this experimental design [25].
Discussion
Bioluminescent assays are routinely used to localize and
monitor cells in vitro and in vivo. However, the lucifer-
ases commonly employed in these assays necessitate the
destruction of the cells under study and result in only
intermittent snapshots of data. These limitations stem
from the requirement to add an exogenous chemical lu-
ciferin. Because the applied luciferin is finite, it is only
functional until oxidation during the bioluminescent re-
action. This limits data collection to a single point. Fur-
thermore, applied luciferin bioavailability is dynamic
over time due to the constantly changing amount of un-
processed luciferin, the physiology of the cell at the time
of application, and the route of administration [5,6].
Nonetheless, the high signal-to-noise ratio of biolumin-
escent reporters relative to their fluorescent counterparts
and the availability of different luciferin variants that can
modulate the kinetics of the bioluminescent reaction
[26,27] make bioluminescence a preferred imaging mo-
dality despite its disadvantages. Developing alternative
bioluminescent systems, such as the bacterial luciferase
system, that obviate these hurdles further improves the
utility of bioluminescence in vitro and in vivo.
The primary concern surrounding bacterial luciferase
gene cassette expression in mammalian cells is the poten-
tial toxicity of the fatty aldehyde luciferin [28]. This is es-
pecially true when the luciferase genes are modulated to
enable autonomous reporter functionality while luciferin
synthesis occurs constitutively. Previous reports suggest
that 1:1 luciferin:luciferase expression ratios do not pro-
duce sufficient fatty aldehyde to exert negative biochem-
ical or phenotypical effects in human cells [11,12]. In this
work, the luciferin synthesis genes are expressed 27:1 rela-
tive to the luciferase genes (Additional file 1:Fig.S1).
None of the tested cells displays abnormal growth rates or
other phenotypic changes (Additional file 2:Fig.S2).How-
ever, the transfection of luciferin:luciferase gene ratios
below 20:1 and beyond 30:1 shows decreased autobiolumi-
nescent output (Fig. 1c). Given that the transcriptional ex-
pression ratio of the luciferin:luciferase genes following
stable selection was found to be similar to their trans-
fected molar ratio (Additional file 1: Fig. S1), these results
suggest that lower luciferin pathway transcriptional ratios
are likely insufficient to support substrate generation at a
level capable of supporting robust light production, while
higher ratios likely result in fatty aldehyde levels that inter-
fere with cellular metabolism and therefore reduce light
(See figure on previous page.)
Fig. 5. Autonomous reporting of transcriptional activity and tissue identification using autobioluminescence. aTwo vector inducible or
repressible autobioluminescence cassette schematics. The first vector uses a modified tetracycline response element (
TET
O) to control the
expression of the viral 2A-segmented, polycistronic lux operon. In the second vector, CBA drives the expression of either a transactivator (tTA)
that provides constitutive lux expression until it is repressed in the presence of doxycycline or a reverse transactivator (rtTA) that inhibits lux
expression until doxycycline is present. bFor tissue-specific reporting, the luciferase component genes are controlled by the cardiac-specific
TNNT2 promoter. ciPSCs with the lux genes under the control of the tetracycline responsive promoter and a separately integrated CBA-driven
reverse transactivator (rtTA) produce autobioluminescence when exposed to increasing amounts of doxycycline for either 4 or 24 h. dIn contrast,
iPSCs with the lux genes under the control of the tetracycline responsive promoter and a separately integrated CBA-driven transactivator (tTA)
show a reduction in autobioluminescent output in response to doxycycline exposure. Values are representative of N= 3 replicates. Error bars
represent the standard error of the means. p/s/cm
2
/sr; photons/s/cm
2
/steradian. eBoth wild-type iPSCs and iPSC-derived cardiomyocytes
produce autobioluminescence when transfected with Stem-lux
CDEF
/Stem-lux
AB
, but only cardiomyocytes produce light when the Stem-lux
CDEF
/
TNNT2-lux
AB
vectors are used. Data is available at https://osf.io/h5qzj/ [15]
Conway et al. BMC Biology (2020) 18:79 Page 8 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

output. The 20–30:1 ratio appears to be an ideal balance
for providing sufficient luciferin to drive the reaction for-
ward while avoiding complicating effects.
It has been suggested that intentionally limiting sub-
strate production can decrease luminescent output rela-
tive to externally supplemented systems, such as firefly
luciferase, that saturate the luciferase with exogenous lu-
ciferin [13]. Alternative bacterial luciferase coding se-
quences with increased luminescence have been
published [1,29], and it has recently been shown that
improved codon optimization strategies can significantly
improve luminescence to be similar to firefly luciferase
while maintaining lower luciferin:luciferase ratios than
those identified as optimal for stem cell expression [30].
To facilitate comparisons between lux cassette expres-
sion strategies and elucidate the baseline functionality of
bacterial luciferase in stem cells, this work utilized the
codon usage pattern and viral 2A linker region orienta-
tions from the first demonstration of bacterial luciferase
in mammalian cells [11]. This format is the most widely
available version of the mammalian-optimized bacterial
luciferase cassette, and therefore, our results should rep-
resent what could be expected if the system is deployed
with minimal modification.
The previous bacterial luciferase system only displayed
efficient signal expression in a handful of immortalized
cancer cell lines [11,12] and was not capable of produ-
cing any signal greater than the background when trans-
fected into iPSCs (this work). The approach detailed in
this effort overcomes this lack of functionality. While it
is likely that the modification of the promoters used and
the adoption of the luciferin pathway overexpression
strategy both contributed to enabling stem cell-based
autobioluminescent production, we hypothesize that the
overexpression strategy provided the largest impact on
functionality. The original CMV promoter is a strong
promoter and, although potentially subject to silencing
in stem cells [17], has been successfully used for iPSC-
based transgene expression [31]. We also show that,
when using the luciferin pathway overexpression strat-
egy, signal is produced from tissue-specific promoters
such as TNNT2 or inducible systems such as the tetra-
cycline transactivator system (Fig. 5). The application of
this approach improves the functionality of the bacterial
luciferase system by allowing it to function in a wider
breadth of cell types than the previous incarnation. Fur-
ther modification to incorporate the output signal en-
hancement strategies demonstrated in alternative cell
types should further improve the sensitivity and signal-
to-noise ratio of bacterial luciferase in stem cells and de-
rived progeny, but may require cell type-specific codon
optimization since the reason behind the unusually high
impact of codon optimization on expression is not well
understood [30].
Although the level of bioluminescent output observed
using the least enhanced version of bacterial luciferase
was not found to be limiting for in vitro stem cell appli-
cations, the relatively low output flux and 490 nm emis-
sion maximum of this system increased the difficulty of
in vivo signal acquisition. This was overcome by lever-
aging the consistent, continuous output of the autobio-
luminescent phenotype to increase photon-counting
integration time and capture sufficient signal to distin-
guish from the background when working with small
animal subjects. Despite the extended integration time
being shorter than the combined time required to per-
form luciferin injection, wait for substrate uptake, and
perform photon counting using a firefly luciferase re-
porter, this may still be problematic for some applica-
tions. In these cases, the incorporation of recent
bacterial luciferase functional enhancement protocols
would be an alternative approach for improving signal-
to-noise ratios without necessitating increased integra-
tion time.
However, because autobioluminescent stem and stem-
derived cells remain physiologically similar to their non-
bioluminescent counterparts (Additional file 2:Fig.S2)
and in vitro performance was suitable using the unen-
hanced bacterial luciferase, any published version of
mammalian-optimized bacterial luciferase can be used to
convert traditional endpoint assays to achieve repeated
data acquisition. This is especially useful in discovery-
based applications where the timing and duration of treat-
ment effects are not known a priori (Figs. 3band4;
Additional file 3: Fig. S3). By retaining bioluminescence as
the output format, these cells allow higher throughput
processing in equipment without automated injection
pumps to supply exogenous luciferin and enables the tran-
sition from endpoint to kinetic assay formats without ne-
cessitating the acquisition of new equipment. This
provides an increased informational capacity relative to al-
ternative bioluminescent systems while maintaining the
non-destructive, lower operational cost, and amenability
to automated high-throughput applications attributes of
fluorescent systems.
Conclusions
Given the utility of autobioluminescent systems to self-
direct signal activation and deactivation and the wide-
spread use of bioluminescent systems in stem cell
models, the adaptation of the bacterial luciferase system
to function in iPSC and MSC lines provides a new tool
for interrogation of physiological changes. The non-
invasive bioluminescent signal and necessity for an in-
tact, viable cell to permit signal generation holds great
potential for multiplexing with the current suite of de-
structive endpoint assays. The incorporation of this ap-
proach alongside existing research tools will expand the
Conway et al. BMC Biology (2020) 18:79 Page 9 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

capabilities of stem cell-based research and provide a fa-
cile means for bioluminescent interrogation of precious
samples where the use of destructive bioluminescent ap-
proaches is logistically infeasible.
Methods
Vector construction
Stem-lux
CDABEF
was derived from pCMV
lux
(490 Bio-
Tech) [12] by replacing the SV40 promoter driving neo-
mycin resistance with the NANOG promoter [20] and
the CMV promoter driving luxCDABEF to the CBA pro-
moter. The pCMV
lux
CMV promoter was excised with
NheI and MluI, and a synthetic 61-bp fragment contain-
ing an AscI site (Integrated DNA Technologies) was
inserted using the NEBuilder HiFi DNA Assembly Clon-
ing Kit (HiFi; New England Biolabs). The CBA promoter
was ligated into the construct using the existing NheI
and newly introduced AscI sites. The SV40 promoter
was excised with SfiI and SbfI. The NANOG promoter
was amplified from human genomic DNA using the for-
ward primer 5′-TCAGGCCTCCAAGGCCGCTGGT
TTCAAACTCCTGAC-3′and the reverse primer 5′-
CCTCCTCTTCCTCTATACTAAC-3′. The resulting
PCR product was digested with SfiI and SbfI and ligated
in place of the removed SV40 promoter. Synthetic DNA
fragments containing inverted PiggyBac terminal repeats
were then added up- and downstream of the cassette ex-
pression region using HiFi DNA Assembly. Sanger se-
quencing was used to confirm successful assembly.
The Stem-lux
AB
vector was created by excising the
NANOG-NEO-CBA fragment from Stem-lux
CDABEF
with
SfiI and AscI. The luxAB gene sequence was amplified via
PCR using the forward primer 5′-GCAAAGAATTCGCG
GCCGCGGTACCGGCGCGCCGGCCTCCGAAACCAT
GAAG-3′and the reverse primer 5′-TGCAGGCCGG
CCGGATCCTAGGTATACGCGTGCCCGGATCGATC
CTTATCG-3′. The modified Stem-lux
CDABEF
vector was
digested with AscI and MluI, and the luxAB PCR product
was inserted into the linearized vector via HiFi cloning.
Following assembly, synthetic DNA fragments containing
PiggyBac inverted terminal repeats were added up- and
downstream of the luxAB expression region using HiFi
DNA Assembly. The vector was then Sanger sequenced to
confirm successful assembly.
The backbone of the Stem-lux
CDEF
construct was gen-
erated by HiFi cloning a 1185-bp synthetic DNA frag-
ment (IDT) containing the NANOG promoter, the
zeomycin resistance gene, and the bGH poly-A sequence
upstream of the CBA promoter. The luxCDEF gene se-
quence was prepared by PCR amplifying luxCDEF in
two individual sections sharing 25 bp of overlap using
the upstream primers 5′-GTCTCATCATTTTG
GCAAAGAATTCGCGGCCGCGCCACCATGGGCA
CCAAGAAG-3′and 5′-CAGGTGGTCGTTGTCCAT
AGCAATG-3′and the downstream primers 5′-
CATTGCTATGGACAACGACCACCTG-3′and 5′-
GTTAATTAAAGCTTGTTAACGAATTCGGCGCGCC
GCTGGTTCTTTCCGCCTCAG-3′. The backbone, up-
stream and downstream luxCDEF fragments, and flank-
ing PiggyBac inverted terminal repeat regions were then
assembled into the final Stem-lux
CDEF
construct using
HiFi cloning. Assembly was confirmed by Sanger
sequencing.
The tetO promoter-driven luxCDABEF vector was
generated as previously described [12] except that the
NANOG promoter was used to drive neomycin resist-
ance as described above. The complementary transacti-
vator (tTA and rtTA) vectors were generated by
replacing the luxCDEF sequence of Stem-lux
CDEF
with
either rtTA or tTA by restriction and ligation at the
unique NotI and AscI sites. The inserted rtTA and tTA
sequences were PCR amplified using the primers 5′-
GGCAAAGAATTCGCGGCCGCATGTCTAGACTGG
ACAAGAGC-3′,5′-AGCTTGTTAACGAATTCGGCG
CGCCTTACCCGGGGAGCATGTCAAGGTC-3′, and
5′-GGCAAAGAATTCGCGGCCGCATGTCTAGATTA
GATAAAAG-3′,5′-AGCTTGTTAACGAATTCG
GCGCGCCCTACCCACCGTACTCGTCAATTC-3′, re-
spectively. Following assembly, synthetic DNA fragments
containing PiggyBac inverted terminal repeats were
added up- and downstream of the gene expression re-
gions using HiFi DNA Assembly. Each construct was
verified by Sanger sequencing.
Cell culture
Episomally reprogrammed human fibroblast-derived
iPSCs (Applied Stem Cell) were cultured in Essential-8
Medium (E8; Thermo Fisher Scientific) on growth
factor-reduced Matrigel (Corning)-coated tissue culture-
treated cultureware at 37 °C with 5% CO
2
in a humidi-
fied incubator. Every 3–5 days, just prior to colony con-
fluence, cells were dissociated with Accutase (Innovative
Cell Technologies), diluted, and replated in E8 contain-
ing 10 μM Y27632 dihydrochloride (LC Labs). After 24 h
in culture, the medium was changed to E8 without
Y27632 dihydrochloride until the subsequent passage.
MSCs (a generous gift from Dr. Stacey Stephenson of
the University of Tennessee Medical Center) were cul-
tured on uncoated tissue culture-treated plasticware in
MesenPRO RS Medium (Thermo Fisher Scientific) and
passaged at 75% confluence to 3–5×10
3
cells/cm
2
. Gen-
omic integration of autobioluminescent constructs was
achieved by electroporation. G418 and/or neomycin was
added to the culture medium 72 h after electroporation
and used continuously thereafter. Clonal lineage deriv-
ation was achieved either by colony picking or cell dilu-
tion and expansion. Positive clones were verified by
Conway et al. BMC Biology (2020) 18:79 Page 10 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

genomic DNA sequencing and autobioluminescent light
output.
Electroporation
Transient and stable iPSC lines were generated using the
NEON Transfection system (Thermo Fisher Scientific)
according to the manufacturer’s recommendation.
Briefly, iPSCs were harvested with Accutase, washed
twice with PBS, and resuspended at a concentration of
2×10
7
cells/mL in 10 or 100 μL of Buffer R containing
the desired DNA. Cells were co-electroporated with the
target lux vectors and a transposase-expressing vector.
Immediately following electroporation, cells were diluted
in prewarmed E8 containing Y27632 and plated. MSC
and cardiomyocyte electroporations were performed
identically, except that cardiomyocytes were recovered
in Advanced RPMI (Thermo Fisher Scientific) and MSCs
were recovered in MesenPRO RS medium (Thermo
Fisher Scientific).
Transient and stable cell line selection
Following transient transfection, electroporated cells
were assayed 24 h post-electroporation. Stably trans-
fected autobioluminescent iPSCs were electroporated
with the Stem-lux
CDEF
and Stem-lux
AB
vectors as de-
scribed. Beginning 48 h post-transfection, selective pres-
sure was applied using 100 μg G418/mL and 1 μg
zeocin/mL. Antibiotic-supplemented medium was
refreshed every 24 h until individual clonal lines were
formed. Each resistant lineage was assayed for light pro-
duction using an IVIS Lumina imaging system (Perki-
nElmer) and qualitatively rank-ordered based on their
autobioluminescent signal intensity. The lineage produ-
cing the greatest signal was denoted as iPSC-lux and
used for further experimentation.
Cardiac differentiation and culture
Cardiac differentiation was performed as previously de-
scribed [32,33]. Briefly, iPS lines were seeded in 12- or
24-well plates. At 2–3 days post-seeding, the cells were
treated with CHIR99021 (Tocris) for 24 h. At 3 days
post-seeding, the cells were treated with IWP4 (Tocris)
for 24 h. At 7 days post-seeding, the medium was
switched to Advanced RPMI (Thermo Fisher Scientific).
Beating was observed between days 7 and 14, and differ-
entiation was confirmed by observation of beating and
immunohistochemical staining with the cardiac-specific
anti-Troponin T antibody (Additional file 7: Fig. S7).
Cardiomyocytes were maintained in Advanced RPMI
supplemented with GlutaMAX.
qPCR
Genomic DNA was isolated from pellets containing 1–
5×10
5
cells previously frozen at −80 °C using the Quick
DNA Miniprep kit (Zymo Research) following the manu-
facturer’s instructions. qPCR was performed in technical
triplicate on the QuantStudio 3 (Applied Biosystems)
using the Ambion Power SYBR Power Green Cells-to-CT
Kit (Thermo Fisher Scientific) according to the manufac-
turer’sinstructions.luxA was probed with primers 5′-
GCTACCACTATCTTTGACGACTC-3′and 5′-
GTCGATGCGTCTGTTAGTATCC-3′.luxD was probed
with primers 5′-GCCAGCACCATCAACAATATG-3′
and 5′-TCACTTCGTCCTGTTTGACC-3′.
qRT-PCR
mRNA was isolated from pellets containing 1–5×10
5
cells and prepared for qRT-PCR using the Power SYBR
Green Cells-to-CT Kit (Thermo Fisher Scientific) ac-
cording to the manufacturer’s instructions. qRT-PCR
was performed in technical triplicate on the QuantStu-
dio 3 (Applied Biosystems). The use of viral 2A linker
regions to join the open reading frames of the luciferase
and luciferin operons results in the production of a sin-
gle mRNA for each operon that is broken into individual
proteins during translation when the ribosome encoun-
ters the 2A peptide region. This results in the luxA:luxB
(luciferase) transcriptional levels always being 1:1 and
the luxC:luxD:luxE:frp (luciferin generation pathway)
transcriptional levels always being 1:1:1:1. Luciferin tran-
script abundance was probed with primers 5′-CGAGAA
CCTGGAAAACAAGC- 3′and 5′-TTGTCGTCCA
CGATGTTGAT-3′. Luciferin pathway transcript abun-
dance was probed with primers 5′-TGGTGTTCTG
CATCGACTACC-3′and 5′-CAGGCCGCCGATGT
ACAC-3′.
Immunohistochemistry
iPSCs were plated on Matrigel-coated petri dishes with
optical glass centers (MatTek) and cultured until suffi-
ciently confluent for passage. Cells were fixed with 4%
PFA for 15 min at room temperature, washed twice with
PBS, permeabilized with 0.4% Triton X-100 in PBS for 5
min at room temperature, and washed twice with PBS.
Fixed and permeabilized cells were then blocked in PBS
containing 0.4% Triton X-100 and 5% goat serum over-
night at 4 °C. The primary antibody was applied at the
specified dilution (Additional file 8: Table S1) in PBS
containing 2% goat serum and 0.4% Triton X-100 for 2 h
at room temperature or overnight at 4 °C. Cells were
then washed 4 times with PBS, and the secondary anti-
body (Additional file 8: Table S1) was added in PBS con-
taining 0.4% Triton X-100 and 5% goat serum for 2 h at
room temperature. Cells were washed 4 times in PBS
and imaged on an Eclipse TE300 fluorescent microscope
(Nikon).
Conway et al. BMC Biology (2020) 18:79 Page 11 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

MTT assay
Cells were assayed in biological triplicate for viable cell
numbers using the CellTiter 96 Non-Radioactive Cell
Proliferation Assay (MTT) (Promega) according to the
manufacturer’s protocol. Briefly, cells plated in triplicate
were treated with dye solution for 2 h and then treated
with stop solution and incubated for an additional 1 h.
Absorbance at 570 nm was measured with a Synergy
plate reader (BioTek). Medium only absorbance was
subtracted from all samples, and experimental samples
were reported as the average fold change relative to un-
treated control cells. Statistical comparisons were pre-
formed using two-tailed Student’sttests with a
significance cutoff of p= 0.05.
Karyotype
The pluripotent reprogramming required for the deriv-
ation of iPSCs can frequently result in copy number
variation that would change the developmental potential
and malignant capacity of the cells or influence the ex-
pression of the integrated bacterial luciferase genes. To
ensure these effects were not present in the cells used
for this work, live cell line samples were sent to Cell
Line Genetics (Madison, WI) for G-band karyotyping ac-
cording to the vendor’s instructions.
Doxycycline induction and compound challenge testing
All compounds were sourced from MilliporeSigma and
were resuspended in DMSO. Cardiomyocyte toxicity
reporting was performed by seeding biological triplicate
replicates of 7.5 × 10
4
25-day-old cells per well in
Matrigel-coated 96-well plates. Cells were challenged
24–48 h after seeding. Challenge compounds were pre-
pared by serial dilution. All tests included vehicle
(DMSO only) and unchallenged (medium only) controls.
Assays were performed using an IVIS Lumina imaging
system (PerkinElmer) at the indicated times. Doxycycline
induction experiments used identical cell seeding and
monitoring procedures but substituted doxycycline
treatment for chemical challenge as indicated. Statistical
comparisons were performed using two-tailed Student’s
ttests with a significance cutoff of p= 0.05.
In vivo cell imaging
Autobioluminescent hADMSCs were prepared for ani-
mal injection by first washing once with PBS, then dis-
sociating with Accutase. Dissociated cells were pelleted
and washed 3× with PBS. After washing, the indicated
number of cells was concentrated into 50 (tail vein) or
100 (intraperitoneal) μL of PBS and injected into tripli-
cate biological replicate FVB/NHsd mice (Envigo). Im-
aging was performed using an IVIS Lumina imaging
system at the indicated times. Statistical comparisons
were performed using two-tailed Student’sttests with a
significance cutoff of p= 0.05.
Supplementary information
Supplementary information accompanies this paper at https://doi.org/10.
1186/s12915-020-00815-2.
Additional file 1: Fig. S1. Luciferin:luciferase component integration
and transcriptional expression ratios in autobioluminescent cells
following extended time in culture. PDF File detailing the results of qPCR
and qRT-PCR experiments to determine luciferin:luciferase integration
and expression post-transfection. (a) Genomic DNA from iPSC-lux lines 11
passages after stable transfection with a 30:1 molar ratio of Stem-lux
CDEF
:-
Stem-lux
AB
or cardiomyocytes stably transfected with the tetracycline-
repressible lux operon (TET-lux; 1:1 molar ratio), were probed by qPCR to
determine the actual gene expression ratios post-transfection. Because
the luciferin and luciferase pathway genes were expressed using 2A
elements to concatenate each component into a single open reading
frame, the second gene of each operon was used for qPCR analysis. As
described in [12], this approach provides an average expression level for
each operon while accounting for possible reduced expression of the
genes distal to the promoter. (b) qRT-PCR analysis reveals that, despite
their 27:1 genomic integration ratio, the luciferin pathway is only
transcribed at 15:1 relative to the luciferase pathway. Data is available at
https://osf.io/h5qzj/ [15].
Additional file 2: Fig. S2. iPSC-lux cell lines maintain the physiological
markers of their wild type counterparts. PDF file showing the evaluation
of physiological effects resulting from continuous autobioluminescent
expression. Wild type and autobioluminescent iPSCs display similar (a)
growth rates, (b) metabolic activity levels, and (c) relative viability when
cultured under identical conditions. (d) Wild type iPSCs cultured for
approximately 3 months were fixed and immunohistochemically labeled
for Nanog, Oct4, and Ssea-4. The red circle at 100× denotes the region
shown at 400×. (e) An iPSC line cultured for 11 passages (approximately
3 months) following genomic integration of Stem-lux
CDEF
and Stem-lux
AB
expresses markers of pluripotency similar to wild type. (f) Pluripotency
marker expression was also similar in iPSCs stably transfected with the
tetracycline-repressible lux operon. Both the (g) constitutive and (h)
inducible autobioluminescent iPSC cell lines retained a normal 46, XX
karyotype. Data is available at https://osf.io/h5qzj/ [15].
Additional file 3: Fig. S3. Tetracycline repressible autobioluminescent
iPSC cells differentiated into cardiomyocytes and challenged with
increasing concentrations of known cardiomodulators. PDF file
demonstrating the use of autobioluminescent cardiomyocytes for
cardiotoxicity screening. Similar to constitutively autobioluminescent
iPSCs and iPSC-derived cardiomyocytes, the cells were capable of
reporting changes in viability due to chemical challenge via
corresponding changes in autobioluminescent output. Values are
representative of N= 3 replicates. Error bars represent standard error of
the means. p/s/cm
2
/sr; photons/second/cm
2
/steradian. Data is available
at https://osf.io/h5qzj/ [15].
Additional file 4: Fig. S4. The autobioluminescent phenotype can be
introduced into MSCs similarly to iPSCs. PDF file showing the result of
transfecting different luciferin:luciferase ratios into MSCs and how the
resulting autobioluminescent cells can be used to track population size.
(a) Light output of MSCs transfected with increasing ratios of Stem-
lux
CDEF
:Stem-lux
AB
from 1:1 to 40:1. The ideal 20-30:1 ratio identified for
MSCs was the same as that for iPSCs. (b) The autobioluminescent output
of MSCs transfected with Stem-lux
CDEF
and Stem-lux
AB
correlated with cell
number similar to iPSCs. Values are representative of N= 3 replicates.
Error bars represent standard error of the means. p/s/cm
2
/sr; photons/
second/cm
2
/steradian. Data is available at https://osf.io/h5qzj/ [15].
Additional file 5: Fig. S5. In vivo imaging of autobioluminescent
hADMSCs. PDF file showing the injection of autobioluminescent MSCs
into a small animal model. (a) Increasing numbers of hADMSCs
expressing genomically integrated Stem-lux
CDEF
and Stem-lux
AB
were
injected intraperitoneally into fvb inbred mice at the locations indicated
by the red circles (number of injected cells indicated below red circle)
Conway et al. BMC Biology (2020) 18:79 Page 12 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

and assayed after 10 min. (b) The resulting autobioluminescent signals
showed a strong correlation to injected cell number. p/s/cm
2
/sr;
photons/second/cm
2
/steradian. Data is available at https://osf.io/h5qzj/
[15].
Additional file 6: Fig. S6. Autobioluminescent hADMSCs show
accumulation in the lungs following tail vein injection. PDF file showing
the accumulation of autobioluminescent MSCs in the lungs of a small
animal model following tail vein injection. 1 × 10
6
hADMSCs with
genomically integrated Stem-lux
CDEF
and Stem-lux
AB
were injected into
the tail vein of fvb inbred mice. At 1 h post-injection the subjects were
sacrificed and dissected to determine the inter-organellar localization of
the labeled cells. p/s/cm
2
/sr; photons/second/cm
2
/steradian.
Additional file 7: Fig. S7. Immunohistochemical confirmation of
cardiac differentiation. PDF File showing staining of cardiomyocytes with
the anti-Troponin-T antibody to confirm successful differentiation.
Following the onset of beating, cardiomyocyte differentiation was
confirmed by staining with the primary antibody: Troponin T, Cardiac
Isoform Ab-1, Mouse Monoclonal Antibody, Clone: 13-11 Isotype: IgG1
and visualizing with the secondary antibody: Goat anti Mouse IgG (H+L)
Alexa Fluor 488. Cells were imaged using both the transmitted light and
green fluorescent protein (GFP) channels of an EVOS M5000 Cell Imaging
System at 40× magnification.
Additional file 8: Table S1. Antibodies used in this study. PDF File
detailing the antibodies used in this study.
Acknowledgements
Not applicable.
Authors’contributions
MC prepared the DNA constructs, performed the experiments and cell
culture, analyzed the data, and wrote the manuscript. TX performed the
experiments and cell culture and analyzed the data. AK prepared the DNA
constructs and performed the experiments. SR and GS designed and
planned the experiments and interpreted and discussed the results. DC
designed the study, analyzed and interpreted the data, and wrote the
manuscript. All authors read and approved the final manuscript.
Funding
Funding for this research was provided by the National Institutes of Health
(NIH) National Institute of General Medical Sciences under award number
R42GM116622, the NIH National Institute of Environmental Health Sciences
under award number R44ES026269, and the National Science Foundation
(NSF) Major Research Instrumentation Program under award number
1530953. The content is solely the responsibilities of the authors and does
not necessarily represent the official views of the NIH or the NSF.
Availability of data and materials
All data generated or analyzed during this study are included in this
published article, its supplementary information files, and available in the
Center for Open Science repository, https://osf.io/7mpd5/.
Ethics approval and consent to participate
All animal work was performed in adherence to the institutional guidelines
put forth by the animal care and use committee of the University of
Tennessee. All animal research procedures were approved by the University
of Tennessee Animal Care and Use Committee (protocol number 2504-0317)
and were in accordance with the National Institutes of Health guidelines.
Consent for publication
Not applicable.
Competing interests
MC, SR, GS, and DC have filed patent applications pending related to this
work.
Author details
1
490 BioTech, Knoxville, TN 37996, USA.
2
Center for Environmental
Biotechnology, The University of Tennessee, Knoxville, TN 37996, USA.
Received: 11 January 2020 Accepted: 18 June 2020
References
1. Gregor C, Gwosch KC, Sahl SJ, Hell SW. Strongly enhanced bacterial
bioluminescence with the ilux operon for single-cell imaging. Proc Natl
Acad Sci. 2018;115(5):962–7.
2. Kondo T, Strayer CA, Kulkarni RD, Taylor W, Ishiura M, Golden SS, et al.
Circadian rhythms in prokaryotes: luciferase as a reporter of circadian gene
expression in cyanobacteria. Proc Natl Acad Sci. 1993;90(12):5672–6.
3. Francis KP, Joh D, Bellinger-Kawahara C, Hawkinson MJ, Purchio TF, Contag
PR. Monitoring bioluminescent Staphylococcus aureus infections in living
mice using a novel luxABCDE construct. Infect Immun. 2000;68(6):3594–600.
4. Waidmann MS, Bleichrodt FS, Laslo T, Riedel CU. Bacterial luciferase
reporters: the Swiss army knife of molecular biology. Bioeng Bugs. 2011;2(1):
8–16.
5. Inoue Y, Kiryu S, Izawa K, Watanabe M, Tojo A, Ohtomo K. Comparison of
subcutaneous and intraperitoneal injection of D-luciferin for in vivo
bioluminescence imaging. Eur J Nucl Med Mol Imag. 2009;36(5):771–9.
6. Lee K, Byun S, Paik J, Lee S, Song S, Choe Y, et al. Cell uptake and tissue
distribution of radioiodine labelled D-luciferin: implications for luciferase
based gene imaging. Nucl Med Commun. 2003;24(9):1003.
7. Auld DS, Inglese J. Interferences with luciferase reporter enzymes. In: GS S,
NP C, K B, editors. Assay Guidance Manual. Bethesada, MD: Eli Lilly &
Company and the National Center for Advancing Translational Sciences;
2018. p. 917–32.
8. Kotlobay AA, Sarkisyan KS, Mokrushina YA, Marcet-Houben M, Serebrovskaya
EO, Markina NM, et al. Genetically encodable bioluminescent system from
fungi. Proc Natl Acad Sci. 2018;115(50):12728–32.
9. Szittner R, Meighen E. Nucleotide sequence, expression, and properties of
luciferase coded by lux genes from a terrestrial bacterium. J Biol Chem.
1990;265(27):16581–7.
10. Kirkpatrick A, Xu T, Ripp S, Sayler G, Close D. Biotechnological advances in
luciferase enzymes. In: Suzuki H, editor. Bioluminescence. London:
IntechOpen; 2019. p. 1–23.
11. Close DM, Patterson SS, Ripp S, Baek SJ, Sanseverino J, Sayler GS.
Autonomous bioluminescent expression of the bacterial luciferase gene
cassette (lux) in a mammalian cell line. PLoS One. 2010;5(8):e12441.
12. Xu T, Ripp S, Sayler G, Close D. Expression of a humanized viral 2A-
mediated lux operon efficiently generates autonomous bioluminescence in
human cells. PLoS One. 2014;9(5):e96347.
13. Close DM, Hahn RE, Patterson SS, Ripp SA, Sayler GS. Comparison of human
optimized bacterial luciferase, firefly luciferase, and green fluorescent
protein for continuous imaging of cell culture and animal models. J Biomed
Optics. 2011;16(4):e12441.
14. Meighen EA. Molecular biology of bacterial bioluminescence. Microbiol Rev.
1991;55:123–42.
15. Conway M, Xu T, Kirkpatrick A, Ripp S, Sayler G, Close D. Real-time tracking
of stem cell viability, proliferation and differentiation with autonomous
bioluminescence imaging. Center for Open Science; 2020. https://osf.io/
7mpd5/. https://doi.org/10.17605/OSF.IO/7MPD5.
16. Mehta AK, Majumdar SS, Alam P, Gulati N, Brahmachari V. Epigenetic
regulation of cytomegalovirus major immediate-early promoter activity in
transgenic mice. Gene. 2009;428(1–2):20–4.
17. Meilinger D, Fellinger K, Bultmann S, Rothbauer U, Bonapace IM, Klinkert
WE, et al. Np95 interacts with de novo DNA methyltransferases, Dnmt3a and
Dnmt3b, and mediates epigenetic silencing of the viral CMV promoter in
embryonic stem cells. EMBO Rep. 2009;10(11):1259–64.
18. Nishino K, Toyoda M, Yamazaki-Inoue M, Fukawatase Y, Chikazawa E,
Sakaguchi H, et al. DNA methylation dynamics in human induced
pluripotent stem cells over time. PLoS Genet. 2011;7(5):e1002085.
19. Luo Y, Liu C, Cerbini T, San H, Lin Y, Chen G, et al. Stable enhanced green
fluorescent protein expression after differentiation and transplantation of
reporter human induced pluripotent stem cells generated by AAVS1
transcription activator-like effector nucleases. Stem Cell Transl Med. 2014;
3(7):821–35.
20. Xu R-H, Sampsell-Barron TL, Gu F, Root S, Peck RM, Pan G, et al. NANOG is a
direct target of TGFβ/activin-mediated SMAD signaling in human ESCs. Cell
Stem Cell. 2008;3(2):196–206.
21. Lian X, Hsiao C, Wilson G, Zhu K, Hazeltine LB, Azarin SM, et al. Robust
cardiomyocyte differentiation from human pluripotent stem cells via
Conway et al. BMC Biology (2020) 18:79 Page 13 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci. 2012;
109(27):E1848–E57.
22. Sharma A, Burridge PW, McKeithan WL, Serrano R, Shukla P, Sayed N, et al.
High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with
human induced pluripotent stem cells. Sci Transl Med. 2017;9(377):eaaf2584.
23. Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, Bujard H.
Transcriptional activation by tetracyclines in mammalian cells. Science. 1995;
268(5218):1766–9.
24. Wu B, Zhou B, Wang Y, Cheng HL, Hang CT, Pu WT, et al. Inducible
cardiomyocyte-specific gene disruption directed by the rat Tnnt2 promoter
in the mouse. Genesis. 2010;48(1):63–72.
25. Kurtz A. Mesenchymal stem cell delivery routes and fate. Int J Stem Cells.
2008;1(1):1–7.
26. Kojima R, Takakura H, Ozawa T, Tada Y, Nagano T, Urano Y. Rational design
and development of near-infrared-emitting firefly luciferins available in vivo.
Angew Chem Int Ed. 2013;52(4):1175–9.
27. Mofford DM, Reddy GR, Miller SC. Aminoluciferins extend firefly luciferase
bioluminescence into the near-infrared and can be preferred substrates
over D-luciferin. J Am Chem Soc. 2014;136(38):13277–82.
28. Hollis RP, Lagido C, Pettitt J, Porter AJR, Killham K, Paton GI, et al. Toxicity of
the bacterial luciferase substrate, n-decyl aldehyde, to Saccharomyces
cerevisiae and Caenorhabditis elegans. FEBS Lett. 2001;506(2):140–2.
29. Cui B, Zhang L, Song Y, Wei J, Li C, Wang T, et al. Engineering an enhanced,
thermostable, monomeric bacterial luciferase gene as a reporter in plant
protoplasts. PLoS One. 2014;9(10):e107885.
30. Gregor C, Pape JK, Gwosch KC, Gilat T, Sahl SJ, Hell SW. Autonomous
bioluminescence imaging of single mammalian cells with the bacterial
bioluminescence system. Proc Natl Acad Sci. 2019;116(52):26491–6.
31. Wu C, Hong SG, Winkler T, Spencer DM, Jares A, Ichwan B, et al.
Development of an inducible caspase-9 safety switch for pluripotent stem
cell–based therapies. Mol Ther –Methods Clin Dev. 2014;1:14053.
32. Lian X, Bao X, Zilberter M, Westman M, Fisahn A, Hsiao C, et al. Chemically
defined, albumin-free human cardiomyocyte generation. Nat Methods.
2015;12(7):595–6.
33. Lian X, Zhang J, Azarin SM, Zhu K, Hazeltine LB, Bao X, et al. Directed
cardiomyocyte differentiation from human pluripotent stem cells by
modulating Wnt/β-catenin signaling under fully defined conditions. Nat
Protoc. 2013;8(1):162–75.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Conway et al. BMC Biology (2020) 18:79 Page 14 of 14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com