Dandelion prevents liver fibrosis, inflammatory response, and oxidative stress in rats

Abstract

Background
Liver fibrosis is the main contributor to the chronic liver-associated morbidity and mortality.

Purpose
The study was conducted to evaluate the effects of whole plant powder of dandelion ( Taraxacum officinale ) on liver fibrosis.

Methods
Liver fibrosis was induced by the oral administration of 20% carbon tetrachloride (CCL4), twice a week for 8 weeks. Simultaneously, dandelion root extract (500 mg/kg) was daily administered via the same route.

Results
Dandelion remarkably improved the liver histology as evidenced by histopathological scoring with hematoxylin-eosin staining. Masson staining and hydroxyproline content similarly showed that dandelion decreased collagen deposition. Both mRNA and protein levels of α-smooth muscle actin and collagens 1 and 3 have been decreased after dandelion treatment compared to CCL4 group. Dandelion also downregulated the mRNA expressions of inflammatory factors interleukin-IL-1β, tumor necrosis factor-α, remodeling growth factor-β1, cyclooxygenase-2, and nuclear factor kappa-B and decreased the myeloperoxidase activity. Additionally, the effects of dandelion were associated with the decreased levels of the hepatic oxidative stress markers (malondialdehyde and P. carbonyl) and elevation of the activity of superoxide dismutase activity. Dandelion’s effect to alleviate the fibrosis and inflammation induced by CCL4 treatment in the livers and was more pronounced than with silymarin. The total antioxidant study of dandelion extract revealed that dandelion has notable ferric reducing antioxidant power and high total phenolic content.

Conclusion
Finally, these results suggest that dandelion prevents the progression of hepatic fibrosis induced by CCL4. The dandelion’s antifibrotic effects could be attributed to its ability to scavenge free radicals and to attenuate inflammatory cells activations.

Full text

R E S E A R C H Open Access
Dandelion prevents liver fibrosis,
inflammatory response, and oxidative stress
in rats
Alaaeldin Ahmed Hamza
1,2*
, Mona Gamel Mohamed
1
, Fawzy Mohamed Lashin
1
and Amr Amin
2,3*
Abstract
Background: Liver fibrosis is the main contributor to the chronic liver-associated morbidity and mortality.
Purpose: The study was conducted to evaluate the effects of whole plant powder of dandelion (Taraxacum
officinale) on liver fibrosis.
Methods: Liver fibrosis was induced by the oral administration of 20% carbon tetrachloride (CCL4), twice a week
for 8 weeks. Simultaneously, dandelion root extract (500 mg/kg) was daily administered via the same route.
Results: Dandelion remarkably improved the liver histology as evidenced by histopathological scoring with
hematoxylin-eosin staining. Masson staining and hydroxyproline content similarly showed that dandelion decreased
collagen deposition. Both mRNA and protein levels of α-smooth muscle actin and collagens 1 and 3 have been
decreased after dandelion treatment compared to CCL4 group. Dandelion also downregulated the mRNA
expressions of inflammatory factors interleukin-IL-1β, tumor necrosis factor-α, remodeling growth factor-β1,
cyclooxygenase-2, and nuclear factor kappa-B and decreased the myeloperoxidase activity. Additionally, the effects
of dandelion were associated with the decreased levels of the hepatic oxidative stress markers (malondialdehyde
and P. carbonyl) and elevation of the activity of superoxide dismutase activity. Dandelion’s effect to alleviate the
fibrosis and inflammation induced by CCL4 treatment in the livers and was more pronounced than with silymarin.
The total antioxidant study of dandelion extract revealed that dandelion has notable ferric reducing antioxidant
power and high total phenolic content.
Conclusion: Finally, these results suggest that dandelion prevents the progression of hepatic fibrosis induced by
CCL4. The dandelion’s antifibrotic effects could be attributed to its ability to scavenge free radicals and to attenuate
inflammatory cells activations.
Keywords: Dandelion, Hepatic fibrosis, Protection, Oxidative stress, Hepatic stellate cell
Background
Liver fibrosis occurs as a compensatory response to the
process of tissue repair in a wide range of chronic liver in-
jures and inflammations (Cordero-Espinoza & Huch,
2018). Chronic liver injuries and inflammations have been
implicated in the pathogenesis of a number of liver dis-
eases including chronic viral and metabolic disorders.
Dead or dying epithelial cells as well as phagocytes release
inflammatory mediators that initiate inflammatory reac-
tion (Higashi, Friedman, & Hoshida, 2017). Among these
mediators are transforming the growth factor beta 1
(TGFβ1), tumor necrosis factor (TNF α), interleukin IL-
1β, reactive oxygen species (ROS), and cyclooxygenase-2
(COX2) (Higashi et al., 2017; Park, Cha, Youn, Cho, &
Song, 2010; Wahid et al., 2018). The major driver of liver
© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if
changes were made. The images or other third party material in this article are included in the article's Creative Commons
licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons
licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain
permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
* Correspondence: alaa17mm@gmail.com;a.amin@uaeu.ac.ae
1
Hormone Evaluation Department, National Organization for Drug Control
and Research (NODCAR), 6 Abu Hazem St., Pyramids, Giza, Egypt
2
Biology Department, College of Science, United Arab Emirates University,
Al-Ain, UAE
Full list of author information is available at the end of the article
The Journal of Basi
c
and Applied Zoolog
y
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43
https://doi.org/10.1186/s41936-020-00177-9

fibrogenesis is an activation of hepatic stellate cells (HSCs)
which is the major cellular source of matrix protein-
secreting myofibroblasts (Higashi et al., 2017). Cellular
changes accompanying HSC activation include morpho-
logical changes such as the appearance of the cytoskeletal
protein α-smooth muscle actin (α-SMA) and a dramatic
increase in types I and III collagens (Friedman, 2008). This
excess deposition of ECM disrupts the normal architec-
ture of the liver that gradually degenerates the normal cel-
lular function of the organ and causes liver failure with
significant morbidity and mortality (Friedman, 2008).
Studies have demonstrated that liver fibrosis may be
prevented and even reversed by bioactive food compo-
nents and natural products including silymarin (Bae, Park,
&Lee,2018). Natural product-based drugs recently have
attracted extensive attention in the prevention and treat-
ment of liver disease (Amin et al., 2016;Amin&
Mahmoud-Ghoneim, 2009; Amin & Mahmoud-Ghoneim,
2011; Ashktorab et al., 2019;Hamza,2010; Hamza et al.,
2018;Lietal.,2018). Main reasons for the use of herbal
drugs include their lower cost compared with conven-
tional drugs, minor drug reactions hence reduced side ef-
fects and high safety (Bae et al., 2018). Among myriad of
herbal drugs, silymarin, which is being explored for a wide
variety of disorders such as oxidative stress, inflammatory
disorders, and liver disorders (Ali et al., 2018), the usual
therapeutic dose 200 mg/kg of silymarin administered to
CCL4-induced model of liver fibrosis can inhibit the fibro-
genic mechanism and the progression of initial liver fibro-
sis (Clichici et al., 2015; Neha, Jaggi, & Singh, 2016)
Dandelion (Taraxacum officinale) is a member of the
Asteraceae (Compositae) family and is a common peren-
nial weed distributed in the warmer temperature zones
of the Northern Hemisphere (Schutz, Carle, & Schieber,
2006). As dandelion is an edible plant, it has been used
as traditional herbal medicine in the Arabian zones for
the treatment of liver and spleen ailments (Schutz et al.,
2006). It has been used as folk medicines in China, India,
Russia, Pakistan, and Italy for the treatment of chronic
liver diseases (Devaraj, 2016; Martinez et al., 2015). Sev-
eral health-promoting properties, including diuretic,
anti-inflammatory, anti-carcinogenic, and anti-oxidative
activities, have been attributed to the use different parts
of dandelion (Devaraj, 2016; Martinez et al., 2015). Dan-
delion contains a wide array of phytochemicals whose
biological activities are explored in various human health
care areas (Devaraj, 2016; Martinez et al., 2015). These
include sesquiterpene lactones, terpenoids, polysaccha-
rides, and phenolic compounds (Gonzalez-Castejon, Vis-
ioli, & Rodriguez-Casado, 2012; Schutz et al., 2006;
Williams, Goldstone, & Greenham, 1996). Recently, dan-
delion has garnered attention for its antioxidant and its
anti-inflammatory effects and its possible beneficial ef-
fects against the development of obesity, cancer, and
numerous cardiovascular risk factors (Jeon, Kim, & Kim,
2017; Ovadje, Ammar, Guerrero, Arnason, & Pandey,
2016; Rehman et al., 2017). Dandelion continues to be
commercialized as herbal formulation mainly for its po-
tential to prevent or ameliorate the outcome of several
chronic liver disorder such liver fibrosis. Yet, it received
very limited research attention. Few early studies re-
ported dandelion’s anti-inflammatory, anti-oxidative, and
the hepatoprotective effects of acute liver damage in-
duced in animals by different chemicals such as by gal-
actosamine (Park, Kim, Purck, Noh, & Song, 2007),
carbon tetrachloride (Clichici et al., 2015; Park et al.,
2010) and acetaminophen (Colle et al., 2012), and
chronic CCL4 liver damage (Al-Malk, Abo-Golayel,
Abo-Elnaga, & Al-Beshri, 2013). Administration of dan-
delion root water-ethanoic extract for 10 days amelio-
rated the CCL4-induced hepatic fibrosis in mice
(Domitrovic, Jakovac, Romic, Rahelic, & Tadic, 2010).
This study suggested that administration of dandelion
root extract promotes the complete regression of fibrosis
and the enchantment of hepatic regenerative capabilities.
This investigation was designed to evaluate the protect-
ive effects of dandelion root extract on hepatic fibrosis
in male rats induced by CCL4 and its relationship with
oxidative stress, inflammation, and HSC activation.
Materials and methods
Chemicals
The herbal preparation of dandelion capsule was manu-
factured by Herbal Factors Company, Ltd. (SKU 4501,
LOT778496, 1550 United Boulevard, Coqutlam, BC,
Canada V3: 6Y2); each capsule contains 800 mg of dan-
delion extracted roots of Taraxacum officinale. Chlora-
min T, types I and III collagens, N-methyl-2-
phenylindol, Folin-Ciocalteu reagent, pyrogallol, super-
oxide dismutase, catalase, 2, 4-dinitophenylhydrazine, o-
dianisidine, p-dimethyl-amino-benzaldehyde, and bovine
albumin were obtained from Sigma Chemical Co. (St.
Louis, MO). Rabbit monoclonal anti-α-smooth muscle
actin (SMA) (ab32575) antibody, rabbit polyclonal anti-
collagen 1 (ab21287), and 3 antibody (ab7778) were pur-
chased from Abcam, and all other chemicals were ob-
tained from local commercial suppliers.
Animals
Adult male albino rats (150–200 g) of the Wistar strain
were obtained from the Animal House, National
Organization for Drug Control and Research (NODCAR,
Cairo, Egypt). They were maintained on standard pellet
diet and tap water ad libitum and were kept in polycar-
bonate cages with wood chip bedding under 12 h light/
dark cycle and room temperature 22–24 °C. Rats were
acclimatized to the environment for 1 week prior to ex-
perimental use.
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 2 of 13

Induction of liver fibrosis
Fibrosis was induced by an oral administration of 20%
CCL4/corn oil, 1 ml/kg body weight, twice a week for 8
weeks to produce slowly reversible cirrhosis, as de-
scribed by Varga, Brenner, and Phan (Varga, Brenner, &
Phan, 2005) and Hamza (Hamza, 2010).
Determination of total phenolic content of dandelion
Total phenolic content was determined by the method
of Singleton (Singleton, Orthofer, & Lamuela-Raventos,
1999) using the Folin-Ciocalteu reagent. Results were
expressed in milligrams of gallic acid equivalent per
grams dry weight of crude plant material.
Determination of total antioxidant capacity of dandelion
The total antioxidant capacity (TAC) in crude extract
was evaluated using ferric reducing antioxidant power
(FRAP) assay (Benzie & Strain, 1996). The FRAP assay
measures the change in absorbance at 593 nm due to the
formation of a blue colored ferrous-tripyridyltriazine
complex from colorless oxidized ferric form by the ac-
tion of electron donating antioxidants. Ascorbic acid was
used as a standard for the calibration curve.
Treatment regime
Twenty-four rats were randomly divided into four
groups (six rats each) and were subjected to the follow-
ing treatments; the first group (fibrotic group) has re-
ceived an oral administration of 20% CCL4/corn oil, 1
ml/kg body weight, twice a week for 8 weeks to produce
a slow reversible cirrhosis; the second group (control
group) has received corn oil (1 ml/kg body weight); the
third group (protected groups) and the fourth group
(standard group) have received CCL4. Following the ad-
ministration of CCL4, dandelion 500 mg/kg body weight
and silymarin 200 mg/kg body weight were adminis-
trated orally and continued daily for 8 weeks. Powder
from dandelion root capsule was suspended in 10 ml of
distilled water before administration. Doses of dandelion
and silymarin were selected based on their previously re-
ported hepatoprotective properties (Park et al., 2010).
The time intervals between the administration of CCL4
and each of Dandelion and silymarin were 5 h to avoid
the disturbance of the absorption of each agent. The
normal control group was treated daily with an equiva-
lent volume of water for 8 weeks. After 8th week, all rats
were anesthetized with 3% sodium pentobarbital (45 mg/
kg, i.p.), and blood samples were collected from the
retro-orbital plexus. After the blood was drown from
rats, the animals were euthanized by cervical dislocation
under 3% sodium pentobarbital anesthesia, and the liver
was quickly taken out and weighted after washed with
cold normal saline.
Sample preparation
The livers from all animals were collected and weighed;
then, harvested liver tissues were fixed in 10% buffered
formalin, for histopathological examination. Other liver
tissues were removed and rinsed with ice-cold isotonic
saline, quickly frozen in liquid nitrogen, and stored at −
80 °C for analysis of fibrotic, oxidative stress, and inflam-
matory markers. The serum was collected by centrifu-
ging the blood samples in a refrigerated centrifuge (4 °C)
at 3000 rpm for 20 min (A. A. (Hamza, 2010)) and stored
at 4 °C. For biochemical determination, frozen liver sam-
ples were homogenized in ice-cold Tris-HCL buffer
(150 mM, pH 7.4). The wt/vol ratio of the tissue to the
homogenization buffer was 1:10 wt/vol.
Biochemical assays and histopathology
The level of malondialdehyde (MDA), as marker of lipid
peroxidation, was measured according to the method of
Gerard-Monnier (Gérard-Monnier et al., 1998), where
MDA reacts with N-methyl-2-phenylindol and forms a
blue complex with absorption maximum at 586 nm.
Two hundred microliter of liver sample was added to
650 μl of a solution containing 10 mM N-methyl-2-phe-
nylindol in a mixture of acetonitrile/methanol (3:1),
followed by adding 150 μl of 37% HCl. After 1 h of incu-
bation at 45 °C, the absorbance was measured at 586
nm. The MDA concentration was determined against
MDA standard curve. The results were expressed as
nanomole of MDA per milligram of protein.
The level of liver superoxide dismutase (SOD) enzyme
was assayed according to the method described by
Nandi and Chatterjee (Nandi & Chatterjee, 1988). It is
based on the ability of SOD to inhibit the auto-oxidation
of pyrogallol at alkaline pH. Two 2 ml of reaction mix-
ture contained 1 mM diethylene triaminepenta acetic
acid, 40 μl catalase, 50 mM Tris-cacodylate buffer, pH
8.5 mixed with 15 μl of liver homogenate. The reaction
was started by the addition of 200 μl of freshly prepared
2.6 nM of pyrogallol solution in 10 mM HCl. Change in
absorbance was recorded at 420 nm for 5 min at 1-min
interval. One unit of SOD has been described to cause
50% inhibition of auto-oxidation pyrogallol present in
the assay mixture.
Hepatic protein carbonyl (P. carbonyl) contents were
determined based on the method of Reznick and Packer
(Reznick & Packer, 1994). This method is based on spec-
trophotometric detection of the reaction of 2, 4-
dinitophenylhydrazine with P. carbonyl to form protein
hydrazones at 370 nm. The results were expressed as
nanomole of carbonyl group per milligram of protein
with molar extinction coefficient of 22,000 M/cm. Mye-
loperoxidase (MPO) activity in hepatic homogenate was
assayed based on the method of Hillegass (Hillegass,
Griswold, Brickson, & Albrightson-Winslow, 1990). 2.95
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 3 of 13

ml of substrate contained 50 mM potassium phosphate
buffer containing 0.53 mM o-dianisidine and 20 mM
H
2
O
2
mixed with 50 μl of liver homogenate. Change in
absorbance was recorded at 460 nm for 5 min at 1-min
interval. One unit of MPO was defined as amount of
MPO present that degrades 1 μM peroxide per a minute
at 25 °C.
Liver collagen concentrations were performed by
measuring hydroxyproline (HP) content in liver samples
using a modification of the method of Edwards and
Brien (Edwards & Brien, 1980). Briefly, 0.5 ml of 20%
liver homogenate was digested in 1 ml of 6 N HCl at 110
°C for 18 h then was dried at 60 °C under vacuum. The
sediment was dissolved in 400 μl of acetate buffer pH
6.5; then, 0.8 ml of 1.41 % chloramin T reagent dissolved
in acetate buffer pH 6.5 was added. After incubation for
25 min at room temperature, 0.8 ml of mixture contain-
ing 15 g p-dimethyl-amino-benzaldehyde and 30% per-
chloric acid in 60 ml n-propanol was added, and mixture
was incubated at 60 °C for 25 min. After cooling, the ab-
sorbance of samples and standards was measured at 550
nm. The results were expressed as microgram of HP per
milligram of protein. The total protein content of liver
was performed according to the Lowry method as modi-
fied by Peterson (Peterson, 1977). Aspartate aminotrans-
ferase (AST) and alanine aminotransferase (ALT)
activities as well as albumin and total protein concentra-
tions were estimated in serum using Randox reagent kits
(Randox Laboratories Ltd., Co. Antrim, UK) and follow-
ing their instruction manual. In all the estimations, ab-
sorbance was recorded using a PerkinElmer, Lambda 25
UV/VIS spectrophotometer.
Histopathological evaluation
Pieces of the livers were fixed in 10% neutral phosphate-
buffered formalin and embedded in paraffin before cut-
ting into 5-μm sections. The hydrated tissue sections
were stained with hematoxylin and eosin (H & E) and
Masson-Trichrome, for the different histological exami-
nations. The sections were examined under an Olympus
DX41-light microscope (Honduras St., London, UK). In
hematoxylin and eosin stain, the presence of necrosis,
inflammation, and necrosis was evaluated and graded as
follows: grade 0, absent; grade 1, present in one third of
the lobules; grade 2, present in two thirds of the lobules;
and grade 3, present in all of the lobules. In Masson
stain of collagen, fibrosis was graded according to the
method of Gui, Wei, Wang, Wu, Sun, and Chen (Gui
et al., 2006): grade 0, normal (no visible fibrosis); grade
1, fibrosis present (collagen fiber present as small septa
in portal area, central area, or peripheral area); grade2,
mild fibrosis (collagen fiber extended as septa from por-
tal tract to central vein forming incomplete septa); grade
3, moderate fibrosis (collagen fibers formed thin
complete septa); and grade 4, severe fibrosis (collagen fi-
bers formed thick septa and pseudo lobe formation).
Immunohistochemical evaluation
Liver tissue sections were mounted onto slides, dewaxed
in xylene, and hydrated and subjected to heat-induced
antigen retrieval according to standard protocols. The
levels of α-smooth muscle actin (α-SMA) and types I
and III collagens were determined by immunohisto-
chemically methods according to the protocols described
by Varga et al. (Varga et al., 2005). The numbers of α-
SMA and types I and III collagen positive cells were
counted in five randomly selected high-power fields (×
400) per liver section for six animals of each group.
Real-time quantitative reverse-transcriptase polymerase
chain reaction (RT-PCR) analysis
Total RNA was isolated from liver frozen tissue by a
RNeasy Mini Kit (QIAGEN, Valencia, CA) and assessed
with a dual spectrophotometer Gene JET Kit (Thermo
Fisher Scientific Inc., Germany, #K0732). RT-PCR was
used for quantitative analysis of gene expression of
TNF-α, NF-kB, IL-1β, COX2 TGF-β,α-SMA, Colla1,
and Colla 3. The PCR reaction was carried out in 48-
well plate Step One real-time PCR systems (Applied Bio-
systems, Foster city, USA), and results were analyzed
using the Applied Biosystems software version 2. Twenty
nanograms of purified RNA from each sample was ap-
plied for reverse transcription with subsequent quantita-
tive PCR amplification with Bioline, amedian lifescience
Company, UK (SensiFASTTMSYBR®Hi-ROX) One-step
Kit (Catalog number PI-50217V). Thermal profile was as
follows: 45 °C for 20 min in one cycle (for cDNA synthe-
sis) followed by 10 min at 95 °C for reverse transcriptase
enzyme inactivation. Forty cycles of PCR amplification
were further carried out as follows: 10 s at 95 °C, 30 s at
58 °C, and 1 min at 72 °C. Changes in the expression of
each target gene were normalized relative to the mean
cycle threshold (CT) values of the housekeeping gene
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) by
ΔCt method. The sequence of primers for all studied
genes was shown in Table 1.
Statistical analysis
Data were expressed as mean ± SEM. Comparisons among
multiply groups were performed by one-way analysis of
variance (ANOVA) followed by Dunnett’sttest post-hoc
analysis test for multiple comparisons with P<0.05being
considered as statistically significant. In a nonparametric
analysis, differences between the groups were performed by
the Kruskal-Wallis Htest, and the significant of the differ-
ences between the groups was determined by Mann-
Whitney Utest. All statistical analysis was performed by
SPSS (version 20) statistical program (SPSS Inc., Chicago,
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 4 of 13

IL, USA). Figures were done using GraphPad Prism pro-
gram (version 5) (San Diego, California, USA).
Results
Dandelion’s overall antioxidant and phenolic contents
The antioxidant and phenolic overall contents are pre-
sented in Fig. 1. The FRAP assay is a direct test of total
antioxidant capacity (TAC). In the present study, dande-
lion had high FRAP value. TAC of dandelion was con-
centration dependent where a concentration of 1000 mg
of dry herb contained the highest TAC which equals to
21.45 μmol ascorbic acid equivalent. Dandelion was
found to contain high total polyphenolic content and
equals to 6.88 mg gallic acid equivalent per 1000 mg of
dry dandelion.
Dandelion improved liver function in CCL4-treated rats
Figure 2shows the effects of dandelion on liver func-
tion’s biomarkers of in rats treated with CCL4. In rats
treated with CCL4, activities of AST and ALT were
significantly increased in serum whereas serum levels
of albumin and total proteins were significantly de-
creased compared to normal control group. In con-
trast, both serum AST and ALT activities were
significantly decreased while serum levels of albumin
and protein were significantly increased in the dande-
lion treatment group. These effects were comparable
to that of the well-known hepatoprotective agent sily-
marin. The hepatoprotective effects of dandelion were
superior to that of silymarin.
Dandelion attenuated liver damage and fibrosis in CCL4-
treated rats
To further evaluate the effect of dandelion on liver
damage and fibrosis, H & E and Masson’s trichromic
stained sections were performed (Fig. 3). CCL4 treat-
ment induced severe liver damage, which included
marked fatty degeneration, necrosis of hepatocytes,
and massive intrusion of inflammatory cells to the
liver of CCL4-treated group (Fig. 3a, b). Normal
lobular architecture was observed in the control
group. However, concomitant treatment of dandelion
significantly reduced histological scores of fatty
Table 1 The gene-specific primers used for RT-PCR
Gene
name
Primer sequence 5′-3′Gene bank accession
number
TNF-αF: AACTCGAGTGACAAGCCCGTAG
R: GTACCACCAGTTGGTTGTCTTTGA
NM_012675.3
NF-kB F: CATTGAGGTGTATTTCACGG
R: GAACACAATGGCCACTTGCC
NM_199267.2
IL-1βF: GCTGTGGCAGCTACCTATGTCTTG
R: AGGTCGTCATCATCCCACGAG
NM_031512.2
COX-2 F: ACTTGCTCACTTTGTTTCATTC
R: TTTGATTAGTACTGTAGGGTTAATG
S67722.1
TGF-βF: TGCGCCTGCAGAGATTCAAG
R: AGGTAACGCCAGGAATTGTTGCTA
NM_021578.2
α-SMA F: ACCAACTGGGACGACATGGAG
R: CGTGAGGATCTTCATGAGGTAGTC
NM_031004.2
Colla1 F: GAACTTGGGGCAAGACAGTCA
R: GTCACGTTCAGTTGGTCAA
NM_053304.1
Colla3 F: TTGATGTGCAGCTGGCATTC
R: GCCACTGGCCTGATCCATAT
NM_009930
GAPDH F: CCCCTTCATTGACCTCAACTAC
ATGG
R: GCCTGCTTCACCACCTTCTTGA
TGTC
NM_017008.4
Fig. 1 Total phenolic and total antioxidant contents of dandelion
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 5 of 13

degeneration, necrosis, and inflammation in compari-
son with CCL4-treated group. Silymarin treatment
markedly lessened the degrees of liver necrosis and
inflammatory cell intrusions, but the efficacy of dan-
delion in restoring normal architecture of the liver is
more evident. Level of hepatic fibrosis was examined
with Masson stain and HP content as shown in Fig.
3c–e. First, liver sections were stained by Masson
stain, which stains collagen fibers blue. After treat-
ment with CCL4, obvious increase in fibrosis was
noted in CCL4-treated group compared with control
group. Treatment with dandelion and silymarin barely
showed signs of liver fibrosis (Fig. 3d). Interestingly,
the level of liver fibrosis and size of fibrous septa
were obviously less in dandelion- and silymarin-
treated groups. Finally, analysis of hepatic HP content,
the major component of collagen protein, was carried
out as a liver fibrosis biomarker (Fig. 3e). In agree-
ment with the results of Masson stain, HP content
was significantly higher in the liver of CCL4-treated
group and further alleviated by the treatment with ei-
ther dandelion or silymarin.
Effect of dandelion on hepatic oxidative stress markers in
CCL4-treated rats
To investigate the effect of dandelion and silymarin on
liver’s oxidative stress caused by CCL4, hepatic MDA
and P. carbonyl contents as well as SOD activity were
detected. Figure 4shows the effects of dandelion and
silymarin on CCL4-induced oxidative stress damage in
rats. CCL4 treatment caused a significant increase in
hepatic content of MDA and P. carbonyl and a signifi-
cant decrease in hepatic SOD activity compared with
control group. Administration of each of dandelion and
silymarin, normalized hepatic contents of MDA and P.
carbonyl with partly prevented the decrease of SOD’s ac-
tivity. Compared with dandelion group, there was a sig-
nificant improvement in oxidative stress in silymarin-
Fig. 2 Effect of dandelion and silymarin on serum markers of liver function in CCL4-treated (model). Data are expressed as mean ± SEM for six
animals in each group. Units of ALT and AST are IU/L; units of albumin and T. protein are g/dl. aP< 0.05 vs. control group. bP< 0.05 vs.
model group
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 6 of 13

Fig. 3 Histological results of liver tissues of rats stained with H & E and Masson’s trichromic. (a&b)The livers of rats treated with CCL4 showing
degenerated and necrotic liver cells associated with inflammation and fatty change. Treatment with dandelion and silymarin reduced these
pathological changes. All pictures are × 100 magnifications. (c&d) In Masson sections, collagens are stained blue. Liver sections of rats treated
with CCL4 (model) and CCL4+ silymarin-treated rats showing massive fibrosis with sizable fibrous septa. The group treated with dandelion and
silymarin showing less formation and accumulation of collagen fibrous. Magnification × 100. eEffect of dandelion and silymarin on hepatic HP
content in CCL4-treated group (model). Each column represents the mean ± SEM for 5 rats per group. Units of HP content are μg/mg protein. a
P< 0.05 vs. control; bP< 0. 05 vs. CCL4 group; cP< 0. 05 vs. dandelion group
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 7 of 13

treated group, but dandelion revealed the best efficacy in
normalization of hepatic SOD activity and P. carbonyl
content.
Effects of dandelion on expression of α-SMA and collagen
types 1 and 3 in CCL4-treated rats
We confirmed stellate cell activation during fibrosis in
liver sections by identifying the expression of the α-SMA
which is a good marker of stellate cell activation during
fibrosis. The expression of α-SMA marker in immuno-
staining sections was evident mostly in the blood vessel
wall of the normal group. As expected, the number of α-
SMA positive cells was significantly increased in fibrous
septa and areas of inflammations in CCL4-treated group
(Fig. 5a). This effect was confirmed by mRNA expression
levels of α-SMA (Fig. 5c) which showed their upregula-
tion of the livers of fibrotic group. Treatment with either
dandelion or silymarin has significantly attenuated the
number of α-SMA positive cells compared to the fibrotic
group. Similarly, dandelion and silymarin significantly
decreased the mRNA expression levels of α-SMA in rats
compared to those of the CCL4-treated group (Fig. 5c).
Dandelion revealed the best effects in mRNA expression
of this marker compared to silymarin-treated group.
Collagen types I and III were immunohistochemically la-
beled and were stained brown. Collagen was weakly de-
posited around centrolobular veins of the normal group.
CCL4 group displayed the depositions of collagen types
I and III, forming fibrous septa surrounding the lobules
(Fig. 5a, b). Treatment with dandelion and silymarin at-
tenuated collagen accumulation and the number of col-
lagen types I and III positive cells in CCL4-treated rats.
In addition, excessive deposition of ECM in the fibrotic
liver was confirmed by real-time PCR (Fig. 5c), and the
amount of collagen 1 and collagen 3 mRNA was signifi-
cantly higher in CCL4-treated rats than in control rats;
however, dandelion treatment markedly alleviated the ef-
fect of CCL4 and reduced the expression of collagen 1
and collagen 3 mRNA (Fig. 5c). Treatment with dande-
lion showing the best effects in those markers of liver fi-
brosis was compared to silymarin-treated group.
Effects of dandelion on expression of inflammatory
markers in CCL4-treated rats
The hepatic MPO activity and mRNA levels of inflam-
matory markers, including IL-1β, TNF-α, TGF β, NF-kB,
and COX-2, in rat livers are shown in Fig. 6. MPO activ-
ity of the liver was adopted as a marker of oxidative
stress and inflammation and tissue neutrophil accumula-
tion and activation. Hepatic MPO activity was signifi-
cantly elevated in CCL4-intoxicated group in
comparison with control group. Dandelion and silymarin
treatment significantly decreased hepatic MPO activity
compared to CCL4-treated group (Fig. 6). CCL4 signifi-
cantly upregulated the mRNA levels of IL-1β, TNF-α,
TGF β, NF-kB, and COX-2 in the livers of rats com-
pared to control group. Dandelion and silymarin signifi-
cantly decreased the mRNA expression level of mRNA
of IL-1β, TNF-α, TGF β, NF-kB, and COX-2 in the livers
of rats compared to CCL4-treated group (Fig. 6). Dande-
lion revealed the best effects in inhibition of inflamma-
tory response of livers compared to silymarin-treated
group.
Discussion
The current study showed that dandelion treatment re-
duced liver injury, improved liver function, and de-
creased ECM deposition. These protecting consequences
can be attributed, at least in part, to the reduction of
HSC activation, the inhibition of inflammatory signaling
pathway, and the suppression of oxidative stress-induced
damage. Present results showed that repeated doses of
Fig. 4 Effect of dandelion and silymarin on hepatic markers of oxidative stress in CCL4 treated groups (model). Data are presented as mean ±
SEM for 6 animals per group. MDA and P. carbonyl units are nmol/mg protein; SOD enzyme unit is IU/mg protein. aP< 0.05 vs. control group. b
P< 0.05 vs. model group
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 8 of 13

Fig. 5 (See legend on next page.)
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 9 of 13

CCL4 caused a significant elevation in serum AST and
ALT activities and a significant depletion of in serum al-
bumin and total protein levels, indicating the injury of
liver cells and the decrease in liver synthetic function.
However, both dandelion and silymarin treatment attenu-
ated serum AST and ALT activities indicating hepatopro-
tective effects against hepatocellular injury. In additions,
dandelion treatment improved liver synthetic function
confirmed by normalized serum albumin and total protein
levels. Additionally, these hepatoprotective properties of
dandelion were associated with improvements of liver
histopathological changes. The present results are coin-
cided with previous studies that showed the hepatoprotec-
tive effects of dandelion against hepatotoxicity induced by
several chemicals (Colle et al., 2012; Park et al., 2010). Fur-
thermore, hepatotoxicity of CCL4 model in the present
work was accompanied with inflammation and fibrosis.
Fibrogenesis is known to be associated with the necrosis
and inflammation of the liver (Fortea et al., 2018;Wahid
et al., 2018). CCL4 is considered one of the most used
hepatotoxins in the experimental study of liver diseases.
Hepatic responses in rats to chronic CCL4 administration
are shown to be superficially like human cirrhosis (Varga
et al., 2005). In the liver, CCL4 generates methyl trichlor-
ide radicals (CCl3·), which lead to pronounced centrilobu-
lar liver necrosis, induction of the inflammatory response,
activation of HSCs, and increasing of extracellular matrix
production (Ni et al., 2018; Wahid et al., 2018).
(See figure on previous page.)
Fig. 5 The expression of α-SMA collagens I and III positive cells of liver tissues of rats was determined by immunohistochemical satin (aand b)
and by mRNA expression in the liver by quantitative RT-PCR (c). Representative histological pictures (a) and the semi-quantitative analysis (b)
showing the expression of α-SMA and collagens I and III positive cells in different experimental groups. All pictures are × 100 magnifications. In
control section, immunohistochemical staining is only revealed in vascular structures. In CCL4 sections, clear staining for α-SMA and collagens I
and III is manifested along with the fibrous septa. The immunohistochemical expression of cells in each section was calculated by counting
numbers of brown staining, α-SMA positive cells, in five fields per section at × 400 magnification. bColumns represent the means ± SEM for 6
animals per group. aP< 0.05 vs. control group; bP< 0.05 vs. CCL4 group. Analysis of α-SMA and types 1 and 3 collagen mRNA expression in
the liver by quantitative RT-PCR (n= 3 per group). Data were normalized to GAPDH mRNA. Data are presented as means ± SEM. aP< 0.05 vs.
control group; bP< 0.05 vs. CCL4 group; cP< 0.05 vs. dandelion group
Fig. 6 Effects of dandelion and silymarin on inflammatory markers. aMPO activity (n= 6 per group) and mRNA expression of bIL-1β,cTNF-α,d
TGF β,eNF-kB, and fCOX-2 in liver tissues (n= 3 per group). Results of mRNA expression were normalized to GAPDH mRNA. Data are presented
as means ± SEM. aP< 0.05 vs. control group. bP< 0.05 vs. CCL4 group. cP< 0.05 vs. dandelion group
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 10 of 13

Excess deposition of ECM is the characteristic futures
of liver fibrosis (Cordero-Espinoza & Huch, 2018). Our
results showed that CCL4 administration led to sever ac-
cumulation of collagen in the liver tissues as indicated
from the result of the Masson staining, collagens 1 and 2
staining, and the increased level of HP, a considerable
amino acid present in collagen. This was concomitant
with the increased hepatic mRNA expression of collagen
1 and collagen 3. Herein, the treatment with dandelion
has a notable preventive effect against CCL4-induced
liver fibrosis in rats. Besides, its improvement effect in
the histological findings of Masson stain and HP con-
tent, dandelion markedly decreased the expressions of
types 1 and 3 collagens. These findings point out that
dandelion could inhibit the synthesis and deposition of
collagen in liver tissue which may additionally be the
pharmacological basis of its hepatoprotective property.
Moreover, the results of this work confirmed that dan-
delion inhibited liver damage and fibrosis more effect-
ively than silymarin.
Activation of HSCs is a core cellular event responsible
for the production of collagen and the progression of
liver fibrosis (Ni et al., 2018; Shay & Hamilton, 2018). In
CCL4-treated group of the present work, accumulation
of hepatic fibers is associated with increased α-SMA de-
position indicates that activated HSCs are the primary
source for the fibrosis seen in the CCL4-treated rats.
This study showed that dandelion inhibited hepatic fi-
brosis and decreased protein and mRNA expression of
α-SMA; hence, dandelion might inhibit HSCs activation.
Previous studies indicated that the protective effect of
dandelion on liver fibrosis induced by CCL4 in mice was
accompanied with the inactivation of HSCs (Domitrovic
et al., 2010). Therefore, its antifibrotic effect may be due
to the attenuation of HSCs activation.
The possible mechanism underling the hepatotoxic
and fibrotic effect of CCL4 could be the generation of
ROS by its metabolized into the highly reactive tri-
chloromethyl radical (CCl3•) (Fortea et al., 2018;Ni
et al., 2018). These radicals are assumed to initiate
oxidative damage hepatocellular membrane via lipid
peroxidation and protein oxidation and induced the
release of inflammatory mediators from activated in-
flammatory cells (Fortea et al., 2018;Shay&
Hamilton, 2018). Furthermore, oxidative stress plays a
vital role in the activation of HSCs during propaga-
tion of fibrogenesis (Higashi et al., 2017). The present
study showed that repeated administration of CCL4 re-
sulted in upregulation of oxidative stress markers MDA,
levels of P. carbonyl, and depletion of SOD activity in liver
dandelion administration, on the other hand, prevented
the increase in MDA and P. carbonyl levels and amelio-
rated the depletion in SOD activity in liver. These findings
suggest that the hepatoprotective antifibrotic effects of
dandelion could be attributed to its antioxidant activity
which coincides with the previous results (Dirleise (Colle
et al., 2012; Davaatseren et al., 2013)). The antioxidant ac-
tivity of dandelion was confirmed in this study by FRAP
assay. Thus, the antioxidant property of dandelion could
be attributed to its high phenolic contents that was con-
firmed in this study. These phenolic contents can act in
several ways, including direct free radical scavenging, che-
lating of metal ions, and regeneration of membrane-
bound antioxidants. This finding is consistent with previ-
ous findings that were demonstrated the polyphenolic
compounds and antioxidant activity of dandelion root
(Domitrovic et al., 2010) and leaf extracts (Davaatseren
et al., 2013;Parketal.,2010). Dandelion was shown to
prevent the toxicity of several other models via inhibiting
oxidative damage (Park et al., 2010;Schutzetal.,2006).
Several polyphenolic compounds were isolated from dan-
delion of fruits, leaves, flowers, and roots such as chicoric
chlorogenic, caffeic, p-coumaric, ferulic, vanillic, and pro-
tocatechuic acids (Gonzalez-Castejon et al., 2012;Schutz
et al., 2006).
Prolong hepatic damage triggers the progression of in-
flammatory responses and inflammatory cells infiltration
including neutrophils and lymphocytes (Higashi et al.,
2017). One of the important neutrophil specific enzymes
released after neutrophil infiltrations is MPO (Hillegass
et al., 1990). Our study showed increased hepatic MPO
activity demonstrating that tissue injury, oxidative stress,
and then fibrosis involve the contribution of neutrophil
infiltrations. In the current work, elevation of inflam-
matory cell infiltrations and expressions of different
inflammatory markers including IL-1β,TNF-α,TGF-
β1, COX-2, and NF-κB expression collectively with
excess deposition of ECM revealed that the propaga-
tion of inflammation during repeated administration
of CCL4 and chronic hepatic damage are strongly in-
volved in activation of HSCs and promotion of fibro-
sis. The anti-inflammatory effect of dandelion was
herein confirmed by the decrease in the MPO activity
in the liver and by the inhibiting of the expressions
of pro-inflammatory markers in liver tissues. We
propose that the anti-inflammatory effect of dandelion
could be involved in pharmacological mechanisms
that lead to antifibrotic effect in the liver. A previous
animal study has revealed the hepatoprotective effect
of two polysaccharides isolated from dandelion, as
shown by the alleviations of inflammatory responses
and the amelioration of oxidative stress. These poly-
saccharides (administered at 304.92 mg/kg body
weight, for 7 days) attenuated CCL4-induced hepatic
damage in albino rats through the attenuated of in-
flammatory markers including NF-kB, iNOS, COX-2,
TNF-a, and IL-1 (Gonzalez-Castejon et al., 2012;Park
et al., 2010).
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 11 of 13

Given its hepatoprotective and antifibrotic properties,
silymarin is a commonly prescribed drug for patients
with liver diseases (Clichici et al., 2015). In the present
work, the hepatoprotective capacities of dandelion were
shown to be more potent than our positive control, sily-
marin in inhibition of liver fibrosis and inflammation.
This could attribute to the differences in polyphenolic
compound classes and contents. Dandelion contains a
wide array of phytochemicals including sesquiterpene
lactones, terpenoids, polysaccharides, and phenolic com-
pounds ((Gonzalez-Castejon et al., 2012; Martinez et al.,
2015; Williams et al., 1996).
Conclusion
Dandelion was effective in the prevention of CCL4-
induced liver fibrosis in rats. The primary mechanism of
this antifibrotic effect could be attributed to its antioxi-
dant and anti-inflammatory properties.
Abbreviations
ALT: alanine aminotransferase; AST: Aspartate aminotransferase; CCL4: Carbon
tetrachloride; COX2: Cyclooxygenase-2; FRAP: Ferric reducing antioxidant
power; HP: Hydroxyproline; α-SMA: Smooth muscle α-actin; HSC: Hepatic
stellate cells; TGFβ1: Growth factor beta 1; ROS: Reactive oxygen species; TNF
α: Tumor necrosis factor; SOD: Superoxide dismutase;
MDA: Malondialdehyde; P. carbonyl: Protein carbonyl; NF-Kb: Nuclear factor
kappa-B
Acknowledgements
The authors would like to thank Hanan Mohamed Mehany and Mohamed
Mustafa, at animal house, NODCAR, Egypt, for their excellent technical help.
Authors’contributions
A.A.H., F.M.L., M.G., and A.A. designed the study. A.A.H., F.M.L., M.G., and A.A.
performed the experiments and did the statistical analysis. A.A.H., F.M.L., M.G.,
and A.A. assisted with methodology and contributed resources. A.A.H and
A.A. wrote the first draft of the manuscript, and all authors contributed to
the editing of the revised manuscript and approved the manuscript.
Funding
This work has been partially supported by grant Al Jalila Foundation fund #
21S098 for Amr Amin.
Availability of data and materials
The datasets supporting the conclusions of this article are available from the
corresponding author on reasonable request.
Ethics approval and consent to participate
The protocol was conducted in accordance with standard guide to the care
and use of experimental animals (Canadian Council of Animal Care 1993)
and according to the ethical standards approved by the Animal Ethics
Committee for animal care and use of NODCAR (NODCAR/II/45/19).
Consent for publication
Not applicable
Competing interests
The authors declared no potential conflicts of interest with respect to the
research, authorship, and/or publication of this article.
Author details
1
Hormone Evaluation Department, National Organization for Drug Control
and Research (NODCAR), 6 Abu Hazem St., Pyramids, Giza, Egypt.
2
Biology
Department, College of Science, United Arab Emirates University, Al-Ain, UAE.
3
The University of Chicago, Chicago, IL, USA.
Received: 25 March 2020 Accepted: 10 June 2020
References
Ali, M., Khan, T., Fatima, K., Ali, Q. U. A., Ovais, M., Khalil, A. T., et al. (2018). Selected
hepatoprotective herbal medicines: Evidence from ethnomedicinal
applications, animal models, and possible mechanism of actions.
Phytotherapy Research,32(2), 199–215.
Al-Malk, A. L., Abo-Golayel, M. K., Abo-Elnaga, G., & Al-Beshri, H. (2013).
Hepatoprotective effect of dandelion (Taraxacum officinale) against induced
chronic liver cirrhosis. Journal of Medicinal Plants Research,7(20), 1494–1505.
Amin, A., A Hamza, A., Daoud, S., Khazanehdari, K., Al Hrout, A., Baig, B., et al.
(2016). Saffron-based crocin prevents early lesions of liver cancer: In vivo,
in vitro and network analyses. Recent Patents on Anti-Cancer Drug Discovery,
11(1), 121-133.
Amin, A., & Mahmoud-Ghoneim, D. (2009). Zizyphusspina-christi protects against
carbon tetrachloride-induced liver fibrosis in rats. Food and Chemical
Toxicology,47(8), 2111–2119.
Amin, A., & Mahmoud-Ghoneim, D. (2011). Texture analysis of liver fibrosis
microscopic images: A study on the effect of biomarkers. Acta Biochimica et
Biophysica Sinica,43(3), 193–203.
Ashktorab, H., Soleimani, A., Singh, G., Amr, A., Tabtabaei, S., Latella, G., et al.
(2019). Saffron: The golden spice with therapeutic properties on digestive
diseases. Nutrients,11(5), 943.
Bae, M., Park, Y. K., & Lee, J. Y. (2018). Food components with antifibrotic activity
and implications in prevention of liver disease. The Journal of Nutritional
Biochemistry,55,1–11.
Benzie, I. F., & Strain, J. J. (1996). The ferric reducing ability of plasma (FRAP) as a
measure of (antioxidant power): The FRAP assay. Analytical Biochemistry,293,
70–76.
Clichici, S., Olteanu, D., Nagy, A. L., Oros, A., Filip, A., & Mircea, P. A. (2015).
Silymarin inhibits the progression of fibrosis in the early stages of liver injury
in CCl(4)-treated rats. Journal of Medicinal Food,18(3), 290–298.
Colle, D., Arantes, L. P., Gubert, P., da Luz, S. C. A., Athayde, M. L., Teixeira Rocha, J.
B., et al. (2012). Antioxidant properties of Taraxacum officinale leaf extract are
involved in the protective effect against hepatoxicity induced by
acetaminophen in mice. Journal of Medicinal Food,15(6), 549–556.
Cordero-Espinoza, L., & Huch, M. (2018). The balancing act of the liver: Tissue
regeneration versus fibrosis. The Journal of Clinical Investigation,128(1), 85–96.
Davaatseren, M., Hur, H. J., Yang, H. J., Hwang, J. T., Park, J. H., Kim, H. J., et al.
(2013). Taraxacum official (dandelion) leaf extract alleviates high-fat diet-
induced nonalcoholic fatty liver. Food and Chemical Toxicology,58,30–36.
Devaraj, E. (2016). Hepatoprotective properties of dandelion: Recent update.
Journal of Applied Pharmaceutical Science,6(4), 202–205.
Domitrovic, R., Jakovac, H., Romic, Z., Rahelic, D., & Tadic, Z. (2010). Antifibrotic
activity of Taraxacum officinale root in carbon tetrachloride-induced liver
damage in mice. Journal of Ethnopharmacology,130(3), 569–577.
Edwards, C. A., & Brien, W. D. (1980). Modified assay for determination of
hydroxyproline in a tissue hydrolyzate. Clinica Chemica Acta,104, 161–167.
Fortea, J. I., Fernández-Mena, C., Puerto, M., Ripoll, C., Almagro, J., Bañares, J., et al.
(2018). Comparison of two protocols of carbon tetrachloride-induced
cirrhosis in rats –Improving yield and reproducibility. Scientific Reports,8(1),
9163.
Friedman, S. L. (2008). Hepatic fibrosis -- overview. Toxicology,254(3), 120–129.
Gérard-Monnier, D., Erdelmeier, I., Régnard, K., Moze-Henry, N., Yadan, J.-C., &
Chaudiere, J. (1998). Reactions of 1-methyl-2-phenylindole with
malondialdehyde and 4-hydroxyalkenals. Analytical applications to a
colorimetric assay of lipid peroxidation. Chemical Research in Toxicology,
11(10), 1176–1183.
Gonzalez-Castejon, M., Visioli, F., & Rodriguez-Casado, A. (2012). Diverse biological
activities of dandelion. Nutrition Reviews,70(9), 534–547.
Gui, S.-Y., Wei, W., Wang, H., Wu, L., Sun, W.-Y., Chen, W.-B., et al. (2006). Effects
and mechanisms of crude astragalosides fraction on liver fibrosis in rats.
Journal of Ethnopharmacology, 103,154-159.
Hamza, A. A. (2010). Ameliorative effects of Moringa oleifera lam seed extract on
liver fibrosis in rats. Food and Chemical Toxicology,48(1), 345–355.
Hamza, A. A., Heeba, G. H., Elwy, H. M., Murali, C., El-Awady, R., & Amin, A. (2018).
Molecular characterization of the grape seeds extract’s effect against
chemically induced liver cancer: In vivo and in vitro analyses. Scientific
Reports,8(1), 1270.
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 12 of 13

Higashi, T., Friedman, S. L., & Hoshida, Y. (2017). Hepatic stellate cells as key target
in liver fibrosis. Advanced Drug Delivery Reviews,121,27–42.
Hillegass, L., Griswold, D., Brickson, B., & Albrightson-Winslow, C. (1990).
Assessment of myeloperoxidase activity in whole rat kidney. Journal of
Pharmacological Methods,24(4), 285–295.
Jeon, D., Kim, S. J., & Kim, H. S. (2017). Anti-inflammatory evaluation of the
methanolic extract of Taraxacum officinale in LPS-stimulated human
umbilical vein endothelial cells. BMC Complementary and Alternative Medicine,
17(1), 508.
Li, Q., Li, H. J., Xu, T., Du, H., Huan Gang, C. L., Fan, G., et al. (2018). Natural
medicines used in the traditional Tibetan medical system for the treatment
of liver diseases. Frontiers in Pharmacology,9, 29.
Martinez, M., Poirrier, P., Chamy, R., Prufer, D., Schulze-Gronover, C., Jorquera, L.,
et al. (2015). Taraxacum officinale and related species-an
ethnopharmacological review and its potential as a commercial medicinal
plant. Journal of Ethnopharmacology,169, 244–262.
Nandi, A., & Chatterjee, I. (1988). Assay of superoxide dismutase activity in animal
tissues. Journal of Biosciences,13(3), 305–315.
Neha, Jaggi, A. S., & Singh, N. (2016). Silymarin and its role in chronic diseases.
Advances in experimental Medicine Biology,929,25–44.
Ni, M. M., Wang, Y. R., Wu, W. W., Xia, C. C., Zhang, Y. H., Xu, J., et al. (2018). Novel
insights on notch signaling pathways in liver fibrosis. European Journal of
Pharmacology,826,66–74.
Ovadje, P., Ammar, S., Guerrero, J. A., Arnason, J. T., & Pandey, S. (2016). Dandelion
root extract affects colorectal cancer proliferation and survival through the
activation of multiple death signalling pathways. Oncotarget,7(45), 73080–
73100.
Park, C. M., Cha, Y. S., Youn, H. J., Cho, C. W., & Song, Y. S. (2010). Amelioration of
oxidative stress by dandelion extract through CYP2E1 suppression against
acute liver injury induced by carbon tetrachloride in Sprague-Dawley rats.
Phytotherapy Research,24(9), 1347–1353.
Park, J. Y., Kim, J. J., Purck, C. M., Noh, K. H., & Song, Y. S. (2007). Hepatopeotective
activity of Taraxacum officinale water extract against D-galactosamine-
induced hepatitis in rats. The FASEB Journal,21, 847.847.
Peterson, G. L. (1977). A simplification of the protein assay method of Lowry et al
which is more generally applicable. Analytical Biochemistry,83, 346–356.
Rehman, G., Hamayun, M., Iqbal, A., Khan, S. A., Khan, H., Shehzad, A., et al. (2017).
Effect of methanolic extract of dandelion roots on cancer cell lines and AMP-
activated protein kinase pathway. Frontiers in Pharmacology,8, 875.
Reznick, A. Z., & Packer, L. (1994). [38] Oxidative damage to proteins:
Spectrophotometric method for carbonyl assay. In Methods in enzymology
(Vol. 233, pp. 357-363): Elsevier.
Schutz, K., Carle, R., & Schieber, A. (2006). Taraxacum--A review on its
phytochemical and pharmacological profile. Journal of Ethnopharmacology,
107(3), 313–323.
Shay, J. E. S., & Hamilton, J. P. (2018). Hepatic fibrosis: Avenues of investigation
and clinical implications. Clin Liver Dis (Hoboken),11(5), 111–114.
Singleton, V. L., Orthofer, R., & Lamuela-Raventos, R. M. (1999). Analysis of total
phenols and other oxidation substrates and antioxidants by means of folin-
ciocalteu reagent. In L. Packer (Ed.), Methods in enzymology, (vol. 299, pp.
152–178). San Diego,London, New York, Tokyo: Academic Press,Harcourt
Brace & Company.
Varga, J., Brenner, D., & Phan, S. H. (2005). Fibrosis research: Methods and protocols,
(vol. 117). Totowa, New Jersey: Springer Science & Business Media.
Wahid, B., Ali, A., Rafique, S., Saleem, K., Waqar, M., Wasim, M., et al. (2018). Role of
altered immune cells in liver diseases: A review. Gastroenterología y
Hepatología (English Edition),41(6), 377–388.
Williams, C. A., Goldstone, F., & Greenham, J. (1996). Flavonoids, cinnamic acids
and coumarins from the different tissues and medicinal preparations of
Taraxacum officinale. Phytochemistry,42(1), 121–127.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Hamza et al. The Journal of Basic and Applied Zoology (2020) 81:43 Page 13 of 13