Global molecular diversity of RSV – the “INFORM RSV” study

Abstract

Background:
Respiratory syncytial virus (RSV) is a global cause of severe respiratory morbidity and mortality in infants. While preventive and therapeutic interventions are being developed, including antivirals, vaccines and monoclonal antibodies, little is known about the global molecular epidemiology of RSV. INFORM is a prospective, multicenter, global clinical study performed by ReSViNET to investigate the worldwide molecular diversity of RSV isolates collected from children less than 5 years of age.

Methods:
The INFORM study is performed in 17 countries spanning all inhabited continents and will provide insight into the molecular epidemiology of circulating RSV strains worldwide. Sequencing of > 4000 RSV-positive respiratory samples is planned to detect temporal and geographical molecular patterns on a molecular level over five consecutive years. Additionally, RSV will be cultured from a subset of samples to study the functional implications of specific mutations in the viral genome including viral fitness and susceptibility to different monoclonal antibodies.

Discussion:
The sequencing and functional results will be used to investigate susceptibility and resistance to novel RSV preventive or therapeutic interventions. Finally, a repository of globally collected RSV strains and a database of RSV sequences will be created.

Full text

S T U D Y P R O T O C O L Open Access
Global molecular diversity of RSV –the
“INFORM RSV”study
Annefleur C. Langedijk
1
, Robert Jan Lebbink
2
, Christiana Naaktgeboren
3
, Anouk Evers
2
, Marco C. Viveen
2
,
Anne Greenough
4,5
, Terho Heikkinen
5,6
, Renato T. Stein
7
, Peter Richmond
8
, Federico Martinón-Torres
9
,
Marta Nunes
5,10,11
, Mitsuaki Hosoya
12
, Christian Keller
13
, Monika Bauck
14
, Robert Cohen
15
, Jesse Papenburg
16
,
Jeffrey Pernica
17
, Marije P. Hennus
18
, Hong Jin
19
, David E. Tabor
19
, Andrev Tovchigrechko
19
, Alexey Ruzin
19
,
Michael E. Abram
19
, Deidre Wilkins
19
, Joanne G. Wildenbeest
1
, Leyla Kragten-Tabatabaie
5,20
, Frank E. J. Coenjaerts
2
,
Mark T. Esser
19
and Louis J. Bont
1,5*
Abstract
Background: Respiratory syncytial virus (RSV) is a global cause of severe respiratory morbidity and mortality in
infants. While preventive and therapeutic interventions are being developed, including antivirals, vaccines and
monoclonal antibodies, little is known about the global molecular epidemiology of RSV. INFORM is a prospective,
multicenter, global clinical study performed by ReSViNET to investigate the worldwide molecular diversity of RSV
isolates collected from children less than 5 years of age.
Methods: The INFORM study is performed in 17 countries spanning all inhabited continents and will provide
insight into the molecular epidemiology of circulating RSV strains worldwide. Sequencing of > 4000 RSV-positive
respiratory samples is planned to detect temporal and geographical molecular patterns on a molecular level over
five consecutive years. Additionally, RSV will be cultured from a subset of samples to study the functional
implications of specific mutations in the viral genome including viral fitness and susceptibility to different
monoclonal antibodies.
Discussion: The sequencing and functional results will be used to investigate susceptibility and resistance to novel
RSV preventive or therapeutic interventions. Finally, a repository of globally collected RSV strains and a database of
RSV sequences will be created.
Keywords: Respiratory syncytial virus, Next generation sequencing, Temporal and geographical diversity, Molecular
epidemiology, Monoclonal antibodies, Vaccines
© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if
changes were made. The images or other third party material in this article are included in the article's Creative Commons
licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons
licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain
permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the
data made available in this article, unless otherwise stated in a credit line to the data.
* Correspondence: l.bont@umcutrecht.nl
1
Department of Paediatric Immunology and Infectious Diseases, Wilhelmina
Children’s Hospital, University Medical Centre Utrecht, Utrecht University,
Utrecht, the Netherlands
5
ReSViNET foundation, Zeist, the Netherlands
Full list of author information is available at the end of the article
Langedijk et al. BMC Infectious Diseases (2020) 20:450
https://doi.org/10.1186/s12879-020-05175-4
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Article summary
Strengths
INFORM RSV is large enough to identify drivers of
spatial and temporal distribution.
Sequencing platform was selected based on a
comparative pilot study.
RSV is cultured to translate genotype to function.
INFORM RSV is collaborating with others including
researchers from the UEDIN, WHO and NIH.
Limitations
Clinical information is limited, no follow-up data
available.
Background
Respiratory syncytial virus (RSV) is the leading cause of
lower respiratory tract infections in children worldwide
[1]. While most children infected with RSV suffer from
runny noses, coughing and wheezing, RSV infection can
escalate to bronchiolitis, pneumonia and even death [2].
Globally in 2015, 48,000–74,500 children under the age
of 5 years died with RSV in-hospital, predominantly in
low- and middle-income countries [2].
Although RSV is recognized as a global health prob-
lem, there is no licensed vaccine currently available any-
where in the world. Efforts to develop a vaccine initially
failed in the 1960s when the first vaccine candidate, a
formalin-inactivated vaccine, did not protect against
RSV in children but instead induced exacerbated lung
disease after subsequent RSV exposure requiring
hospitalization and causing death [3,4]. The potential
risk of enhanced disease has hampered vaccine develop-
ment such that, even after more than 50 years of effort,
no vaccine is available yet. An alternative approach for
prevention of RSV disease is passive immunization with
monoclonal antibodies (mAbs). RSV-IGIV (RespiGam),
an intravenous immunoglobulin containing high titers of
RSV neutralizing antibodies, was initially approved in
1995 as a passive immunization strategy but was discon-
tinued in 2003 after its replacement by the more potent
mAb palivizumab (humanised mAb that targets the RSV
fusion (F) protein) [5]. Palivizumab is the only currently
approved prophylaxis and its use is limited to high-risk
infants (premature, heart and lung disease, Down syn-
drome) in high-income countries [3]. These data dem-
onstrate that neutralizing Abs are efficient in preventing
RSV disease and that antibody levels correlate with RSV
disease prevention. The development of suptavumab
(REGN2222), another mAb targeting the RSV F protein
as a preventive strategy for use in preterm infants was
discontinued in 2017 as it failed to meet the primary
endpoint of preventing medically-attended RSV
infections [6,7]. A promising mAb candidate currently
in clinical development is nirsevimab (MEDI8897),
which targets the prefusion form of RSV F protein [8].
With a higher potency and extended half-life as com-
pared to palivizumab, nirsevimab holds promise for pro-
tecting from RSV-associated lower respiratory disease
for all infants entering their first RSV season and high-
risk infants entering their first and second RSV seasons
[7,8].
Future clinical use of therapeutics, vaccines and mAbs
to prevent RSV raises concerns about the emergence of
local resistant strains [9,10]. Therefore, RSV global sur-
veillance is required. The Observational US Targeted
Surveillance of Monoclonal Antibody Resistance and
Testing of RSV (OUTSMART-RSV) surveillance pro-
gram characterized circulating RSV strains in the U.S.
during the 2017–18 season [11]. RSV strains that are re-
sistant to palivizumab were found to be rare [10]. The
frequency of natural resistance-associated polymor-
phisms for nirsevimab was also low (in vitro < 1%). How-
ever, the degree to which the acquisition of resistance
will impact the effectiveness of current and future RSV
therapeutics on a global scale remains unclear. To date,
mAb-resistant mutants (MARMs) have not been thor-
oughly studied worldwide and little is known about the
prevalence of naturally occurring resistant RSV strains
either. The International Network For Optimal Resist-
ance Monitoring of RSV (INFORM RSV) study will
therefore prospectively describe the molecular epidemi-
ology of RSV by monitoring temporal and geographic
distribution of whole viral genome sequences. In
addition to monitoring, we will construct a large reposi-
tory of RSV sequence derived from a diverse geographic
location. In the present article, we describe the method-
ology of the INFORM RSV study.
Study objectives
Primary objective
To investigate the molecular diversity of RSV isolates re-
covered from a global population of children less than 5
years of age over a five-year period.
Secondary objectives
1. To evaluate the prevalence of strains with
polymorphisms in the binding regions for RSV
mAbs
2. To compile a repository for RSV sequences
3. To perform functional virology studies
4. To test for susceptibility of newly identified RSV
strains to RSV mAbs
5. To establish natural molecular evolution of RSV
genomes before the widespread use of RSV mAbs
or vaccines
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 2 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Methods
Study design
INFORM RSV is a global clinical study initiated in 2017
by AstraZeneca to prospectively analyze RSV strains col-
lected from children < 5 years of age. Collaborators were
identified via the Respiratory Syncytial Virus Network
(ReSViNET; www.resvinet.org). The ReSViNET Founda-
tion is the international leading non-profit organization
committed to reducing global burden of RSV infection.
In the INFORM RSV study, RSV positive nasal samples
will be collected from subjects as part of routine clinical
care at local clinical sites and shipped to the laboratory
of the University Medical Centre Utrecht (UMCU), the
Netherlands, for sequencing and culturing.
In the INFORM RSV study, the goal is to collect and
sequence approximately 4000 RSV positive respiratory
samples during a 5-year period (2017–2022), which cor-
relates to 50 or 100 samples per site per year (Additional
files, Table 1). At the time of writing, the INFORM RSV
study has been ongoing for 2 years and is currently con-
ducted in 17 countries at 18 sites (Fig. 1). We aim to ex-
pand to other countries where disease burden studies
are ongoing. To ensure both seasonal and geographical
diversity, we endeavor to collect 10–20 samples per site
per month, over the ~ five-month RSV season, which is
on average 5 months long. If the site is able to collect
more than the required number of samples, a subset will
be randomly selected. Viral genomic sequencing will be
performed on all samples by NGS using RT-PCR ampli-
fied cDNAs at the UMCU laboratory. To study
molecular resistance, a subset of strains (~ 10%) will be
randomly selected and cultured to evaluate functional
susceptibility to anti-viral drugs being developed, and
viral fitness of RSV variant with drug binding site
changes or dominant changes in non-drug binding site.
Study participants
Children are eligible to participate in the study if they
meet all the inclusion criteria (Table 1). Children can
participate in the study when they fulfill all the following
criteria: (1) under the age of 5 years at time of sampling,
(2) admitted to the hospital or visiting the outpatient
clinic, (3) tested positive for RSV or suspected to have
RSV infection when RSV testing is not standard practice.
Suspicion of RSV is defined by respiratory tract infection
(RTI) symptoms. In instances where testing for RSV is
not a standard of care, the informed consent procedure
is performed before sample collection for study pur-
poses. Lower and upper RTIs are not differentiated.
Signed and dated written informed consent is obtained
from parent(s)/legal representative(s) in accordance with
the INFORM RSV study protocol, the International
Conference on Harmonization Guideline on Good Clin-
ical Practice E6 (ICH-GCP) and applicable national and
international regulatory requirements including the Dec-
laration of Helsinki. Children who meet the exclusion
criteria of using preventive or treatment medication for
RSV e.g. palivizumab, ribavirin or an experimental RSV
mAb or vaccine will be excluded from participation.
Fig. 1 Countries participating in the INFORM RSV study. Red –Start in 2017; Blue –Start in 2018; Yellow –Start in 2019. The figure was created
by ACL using Maptive (https://www.maptive.com)
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 3 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Sample collection, storage and shipment
After informed consent is obtained, nasopharyngeal
samples are collected using flocked swabs and placed in
Copan Universal Transport Medium (UTM). When pa-
tients are ventilated, bronchial aspirates are collected in
Copan UTM. Samples are stored locally at −80 °C.
When −80 °C storage is unavailable, samples can be
stored at −20 °C before shipment to the UMCU labora-
tory. Samples are preferably stored in the original con-
tainer and labeled with unique barcode provided by the
UMCU corresponding to the INFORM RSV code. Sam-
ples are shipped frozen on dry ice to the UMCU labora-
tory for sequencing and culturing after each season.
Nucleic acid extraction and RSV subtyping
Nucleic acids are extracted from 250 to 500 μL of RSV
positive nasal specimens using the MagNA Pure 96
DNA and Viral NA Large Volume kit (Roche Diagnos-
tics, Mannheim, Germany) according to the manufac-
turer’s instructions. Nucleic acids are eluted in 50 μL
elution buffer. RSV subtyping and quantification is per-
formed by multiplexed TaqMan RT-PCR analysis of the
RSV N gene using RSV-A and RSV-B specific primer/
probe mixes. The TaqMan RT-PCR reactions are per-
formed on a StepOnePlus System (Applied Biosystems)
in 10 μL total volume, including 1 μL of nucleic acids,
TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher
Scientific), 900 nM RSV-A forward primer (5′AGATCA
ACTTCTGTCATCCAGCAA 3′), 900 nM RSV-A re-
verse primer (5′TTCTGCACATCATAATTAGGAG
TATCAAT 3′), 300 nM RSV-B forward primer (5′
AAGATGCAAATCATAAATTCACAGGA 3′), 300 nM
RSV-B reverse primer (5′TGATATCCAGCATCTTTA
AGTATCTTTATAGTG 3′), 58.3 nM RSV-A probe (5′
CACCATCCAACGGAGCACAGGAGAT 3′,5′6-FAM/
ZEN/3′IBFQ), and 66.7 nM RSV-B probe (5′TTCCCT
TCCTAACCTGGACATAGCATATAACATACCT 3′,
5′JOE NHS/ZEN/3′IBFQ) (Integrated DNA Technolo-
gies). Cycling conditions are 50 °C for 2 min and 95 °C
for 10 min, followed by 45 cycles of 95 °C for 15 s and
60 °C for 60 s.
RT-PCR amplification of RSV genomes and next
generation sequencing
Upon RSV subtyping, the appropriate primer pairs are
used to reverse transcribe and PCR amplify the four
overlapping RSV genome fragments by using the Super-
Script IV One-Step RT-PCR System (Invitrogen, CA) in
a 9800 Fast thermal cycler (Applied Biosystems). The
four overlapping genome fragments together comprise
of the full RSV genome encompassing all viral genes, yet
lacking the far 3′and 5′genome termini. Degenerate
bases are used in places of genetically variable bases
across RSV-A and RSV-B strains when necessary
(Table 2). Cycling conditions are 55 °C for 10 min and
98 °C for 2 min, followed by 40 cycles of 98 °C for 10 s,
61 °C for 10 s and 72 °C for 3 min. Amplicons are verified
on 1% agarose gels, pooled in equimolar amounts, and
purified from 1% agarose gel using the GeneJet PCR Purifi-
cation Kit (Thermo Fisher Scientific). The purified ampli-
cons are then quantified using the Quant-iT PicoGreen
dsDNA Assay Kit (Thermo Fisher Scientific) according to
the manufacturer’s instructions. Subsequently, the normal-
ized PCR products are subjected to Next Generation Se-
quencing (NGS) library construction using the Nextera XT
DNA Library Prep Kit according to the manufacturer’s
protocol (Illumina). Illumina sequencing adapters and bar-
codes are added to the tagmented DNA via PCR amplifica-
tion using unique custom oligo sequences (Integrated DNA
Technologies). Subsequently, the DNA is purified and size-
selected using 0.6 X volume of Ampure XP reagent (Beck-
man Coulter, Inc.) according to the manufacturer’sproto-
col. Next, the purified DNA is quantified using the Quant-
iT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific)
and mixed in equimolar amounts. Sequencing is performed
on the Illumina NextSeq500 platform (Illumina, Inc), gen-
erating paired-end 150 bp reads.
Table 1 Eligibility criteria for the INFORM RSV study
Inclusion Criteria Exclusion Criteria
Age < 5 years Use of palivizumab or experimental
medication for RSV
Confirmed RSV positive diagnosis
Written informed parental consent
Table 2 Primers used in this study to amplify overlapping RSV
genome fragments
Primer Sequence (5′-3′)
RSVA-fragment 1-Fw AAAAATGCGTACWACAAACTTGC
RSVA-fragment 1-Rev GTTGGTCCTTGGTTTTGGAC
RSVA-fragment 2-Fw CACAGTGACTGACAACAAAGGAG
RSVA-fragment 2-Rev GCTCATGGCAACACATGC
RSVA-fragment 3-Fw CGAGGTCATTGCTTGAATGG
RSVA-fragment 3-Rev CACCACCACCAAATAACATGG
RSVA-fragment 4-Fw AGGGTGGTGTCAAAAACTATGG
RSVA-fragment 4-Rev ACGAGAAAAAAAGTGTCAAAAACT
RSVB-fragment 1-Fw AAAAATGCGTACTACAAACTTGC
RSVB-fragment 1-Rev TTGTGCTTGGCTTGTTGTTC
RSVB-fragment 2-Fw AAGGGTTAGCCCATCCAAMC
RSVB-fragment 2-Rev TGCTAAGGCTGATGTCTTTCC
RSVB-fragment 3-Fw GTCCTCGTCTGARCAAATTGC
RSVB-fragment 3-Rev TAGGTCCTCTTTCACCACGAG
RSVB-fragment 4-Fw GAGGGATCCACAGGCTTTAGG
RSVB-fragment 4-Rev ACGAGAAAAAAGTGTCAAAAACT
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 4 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

RSV genome assembly and annotation
Assembly of the sequencing reads into complete ge-
nomes is performed with AstraZeneca’sNext-
Generation Sequencing Microbial Surveillance Tool-
box (NGS-MSTB) –a fully automated distributed
pipeline implemented with a Common Workflow Lan-
guage (CWL), and with a user interface based on the
Galaxy bioinformatics workbench [12]. The main pro-
cessing step is a targeted de-novo assembly using
Ariba [13]withAstraZeneca’scustomizedassembly
protocol tuned for robustnessinthepresenceof
mixed viral subpopulations and very high coverage
variability. This is followed by post-assembly filtering
of the low-abundance poorly assembled quasi-species.
The pipeline creates a Web report with quality con-
trol metrics and genome browser views at the contig
and individual read levels. A manuscript with detailed
description of the assembly pipeline and its open-
source release is in preparation.
The assignment of RSV subtypes is performed dur-
ing the assembly process and the assignment of RSV
genotypes is performed by phylogenetic clustering
using a reference database of previously described ge-
notypes [14].
To determine the polymorphisms in the F protein
binding regions of RSV mAbs, the gene sequences are
translated into amino acid sequences, aligned against
reference sequences (NL13 strains), and the amino acid
changes are recorded.
RSV culture
Frozen respiratory samples stored in UTM are thawed,
combined 1:1 with DMEM (Dulbecco’s Minimal Essen-
tial Medium; Lonza) supplemented with 5% FBS and
100 μg/ml Normocin (InvivoGen), and subsequently fil-
tered through a 0.45 μm filter. The filtrate is used to in-
fect HEp-2 cells (60% confluent) in T25 flasks for 1 h at
33 °C and 5% CO2. The supernatant is replaced with
fresh DMEM supplemented with 5% FBS and 100 μg/ml
Normocin and placed back into the 33 °C humidified,
5% CO2 incubator. The viral culture is harvested upon
reaching approximately 70% cytopathic effect (CPE) by
centrifugation at 247×g for 10 min and combining the
supernatant with 50% sucrose in dPBS (sterile filtered).
The viruses are stored in 1 ml aliquots at −80 °C.
Data collection and management
Data is recorded on an electronic sample reporting form
(SRF) (Table 3). SFRs from all sites are uploaded to a
central database (eCASTOR) by Julius Clinical after
which the clinical data are merged with the sequencing
data. To ensure subject anonymity only a unique subject
number and the age in months will be entered. Data will
be locked after each season.
Table 3 Patient variables in the electronic case record form
Variables Description
Site ID
Study ID
Country
Visiting date
Age Age in months
Gender Male / Female
Length of stay < 24 h / > 24 h / Outpatient
Referring department Paediatric Intensive Care Unit / General Paediatric Ward /
Outpatient clinic (including Emergency Department)
RSV detection method PCR / molecular point-of-care-test
RSV subtype A / B
Storage temperature -20 °C / -80 °C
Gestational age at birth Calculated duration of pregnancy in weeks
Severe comorbidity Congenital heart disease / Hematological malignancies /
Neurological disease / Bronchopulmonary dysplasia / Other
(specified in provided space)
Breastfeeding Yes (exclusive) / No / Partial
Day care attendance Yes / No
Current hay fever, asthma and/or eczema in either parent Yes / No
Smoking in household Yes / No
Other children in household under the age of 6 Yes / No
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 5 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Outcomes
Primary endpoint
RSV sequences from a global population of hospitalized
children.
Secondary endpoints
1. Total number of RSV A and B subtypes and related
genomes and the association of these subtypes with
patient characteristics (Table 3)
2. Homology of the F gene from wild-type circulating
RSV to that of reference strains
3. The total number of RSV strains with
polymorphisms in RSV mAbs binding regions or
antigenic sites of RSV F protein
Sample size calculation
The minimal number of samples needed for this study is
2500. The sample size will result in precise frequency es-
timates of RSV A and B subtypes as well as polymor-
phisms. The width of the 95% confidence interval (CI)
will be no larger than 4%. In extremely low or high
prevalence (e.g. < 7.5% or > 92.5%) the width of the 95%
CI will be less than 2%. This study is also well powered
to detect differences in the prevalence of subtypes (RSV
A vs B). An estimate of the mean prevalence of RSV A
(two-thirds) was derived from the study by Zhu et al.
[10]. The INFORM RSV study has at least 90% power to
detect a difference in the prevalence of subtypes between
groups of 7% at an alpha of 0.05 (e.g. 70% RSV A in
males vs. 63% RSV A in females), and at least 90% power
to detect an effect size of 0.08 using a 4 degrees of free-
dom chi-square test. This means, for example, that this
study can detect a difference in the distribution of RSV
subtypes if the prevalence of RSV A across the sites were
approximately as follows: 58, 62, 66, 70, and 74%. These
sample size calculations were conducted in PASS soft-
ware, using the two-sided CIs for single proportions with
the simple asymptotic method with continuity correction
and a chi-square test power analysis. Although 2500
samples are sufficient to detect the desired effect, and
based on the minimal invasiveness for INFORM partici-
pants, the study will expand and add more countries to
maximize insight in geographic and temporal diversity.
Discussion
In the INFORM RSV study, RSV isolates are subject to
RSV subtyping and viral genome analysis. The main pur-
pose of the project is to secure RSV samples to monitor
RSV strains for changes in key epitopes recognized by
mAbs. RSV is a member of the human orthopneumoviri-
dae family [15], which are RNA viruses and therefore
prone to genomic mutations. The possibility of immuno-
logical escape or viral resistance from mAbs approved or
under development is a potential concern. In fact, a pre-
vious study performed by Regeneron (NCT02325791) to
evaluate the efficacy and safety of suptavumab for the
prevention of medically attended RSV infection in pre-
term infants failed to meet its predefined efficacy end-
point based on its reduced efficacy against RSV B strains
[16]. The reduced RSV B efficacy was due to a two-
amino acid change at positions 172 and 173 in the anti-
genic site V region of the F protein, the epitope of supta-
vumab, which reduced susceptibility to suptavumab
neutralization in vitro. It is therefore important that clin-
ical studies involving anti-RSV F mAbs monitor for
amino acid substitutions in antigenic binding regions of
RSV isolates from subjects experiencing virologic failure,
and to assess the impact of these changes on phenotypic
susceptibility and viral fitness.
A key challenge for the INFORM RSV study is tem-
poral diversity, as the timing of RSV outbreaks differs by
season and location around the world. Another chal-
lenge is how to best integrate and interpret whole gen-
ome sequences in relation to clinical variables. To
overcome this challenge, bioinformaticians from Astra-
Zeneca, UMCU and Julius Clinical are working closely
together to develop an integrated database and a robust
pipeline to characterize the thousands of RSV sequences
that will be generated.
In summary, this global prospective study aims at
monitoring the molecular epidemiology of RSV to en-
sure that already approved therapeutics and those in de-
velopment will be effective against currently circulating
strains worldwide. The study has the potential to provide
valuable information for vaccines, monoclonal antibodies
and therapeutic drugs in development and will contrib-
ute to creating an international RSV repository.
Supplementary information
Supplementary information accompanies this paper at https://doi.org/10.
1186/s12879-020-05175-4.
Additional file 1: Table 1. Countries participating in the INFORM RSV
study.
1
Two sites are collecting 50 samples each.
Abbreviations
RSV: Respiratory syncytial virus; INFORM RSV: International Network for
Optimal Resistance Monitoring of RSV; mAb: Monoclonal antibody; NA: Not
applicable; SRF: Sample reporting form; CI: Confidence interval; F: Fusion
Acknowledgements
Not applicable.
Patient and public involvement
At what stage in the research process were patients/public first
involved in the research and how?
Answer: We have an active patient advisory board that has been part of the
research team from the start. This includes prioritizing research questions,
designing the study and involvement of knowledge transfer of study results.
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 6 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

How were the research question(s) and outcome measures developed
and informed by their priorities, experience, and preferences?
Answer: Research questions and outcomes were developed by the UMC
Utrecht and approved by the patient advisory board.
How were patients/public involved in the design of this study?
Answer: See above.
How were they involved in the recruitment to and conduct of the
study?
Answer: Patients have not been involved in recruitment other than
optimizing the patient information.
Were they asked to assess the burden of the intervention and time
required to participate in the research?
Answer: See above.
How were (or will) patients and the public be involved in choosing
the methods and agreeing?
Answer: See above.
Plans for dissemination of the study results to participants and wider
relevant communities?
Answer: See above.
Authors’contributions
All named authors in this article participated in the INFORM study. All
authors read and approved the final manuscript. ACL, AG, TH, RTS, PR, FMT,
MN, MH, CK, MB, RC, JP1*, JP2*, MPH and JGW were involved in patient
recruitment. RJL, AE, MCV and FEJC performed laboratory analyses. ACL, CN,
HJ, DET, AT, AR, MEA, DW, LKT, MTE and LJB contributed to the design of the
work, analysis and/or interpretation of data. ACL wrote the manuscript. * JP1
is corresponding to Jesse Papenburg, chosen because this name is furthest
up in the author list.
Funding
The INFORM study received funding from AstraZeneca. The protocol has
been developed by the authors. AstraZeneca has access to all data except
viral sequences outside the RSV F and G genes. Data analysis is done by the
principle investigator (Louis J Bont).
Availability of data and materials
As the current manuscript describes the study protocol and no other data,
we do not have any raw data to share at the moment.
Ethics approval and consent to participate
The INFORM study has been approved by the ethic committees of all 18
participating sites:
The Netherlands:The Medical Research Ethics Committee of the UMC
Utrecht (reference number WAG/mb/17/016170).
Italy: Ethics Committee for Clinical Testing of the Province of Padova
of the Padova Hospital (no. 345 of 27/10/2016).
Russia: The Department for Science, Innovation Development and
Management of Health and Biological Risks, Ministry of Health of the
Russian Federation.
Germany: Ethics Committee of the Medical Faculty of the Philipps
University Marburg.
France: Ethics Committee Southwest and Overseas of the Créteil
Intercommunal Hospital Centre (ID-RCB No.: 2018-A02360–55 (file 1–
18-73).
Spain: Ethics Committee for Research Santiago-Lugo of the Hospital
Centre University of Santiago (registration code 2017/397).
South Korea: Medical Research Committee of the Seoul National
University Hospital.
Finland: Ethics Committee of the Hospital District of Southwest
Finland, Turku.
Australia: Human Research Ethics Committee of the Perth Children’s
Hospital.
Brazil: The Research Ethics Committee of the Centro INFANT at
Pontificia Universidade Catolica de Rio Grande do Sul (opinion
number 2,569,872).
Canada: Hamilton Integrated Research Ethics Board of the McMaster
University.
Canada: Research Ethics Board of the McGill University Health Centre.
South Africa: Human Research Ethics Committee of the University of
the Witwatersrand Johannesburg (no. M170966).
Japan: Research Ethics Committee of the Fukushima Medical
University (no. 29212).
The United Kingdom: Health Research Authority of the King’s College
Hospital (no. 17/EM/0469).
Taiwan: Mackay Memorial Hospital Institutional Review Board (no.
19MMHIS171e).
Chile: Ethics Committee for Research on Human Subjects of the
Faculty of Medicine, University of Chile.
Mexico: Ethics Committee of the University Autónoma De Nuevo
León, Faculty of Medicine.
Written informed consent was obtained from parent(s)/legal representative(s)
of all children participating in the study.
Consent for publication
Not applicable.
Competing interests
FMT and JP are members of the editorial board of BMC Infectious Diseases.
MCN has received grant funding from AstraZeneca. JP has received
consulting/speaker fees/honoraria from AbbVie, Seegene Canada and
Cepheid, and research grant funding outside of the current work from
AbbVie, BD Diagnostics, AstraZeneca, Sanofi Pasteur, Hoffmann-La Roche and
Janssen Pharmaceutical. LJB has not received personal fees or other personal
benefits. UMCU has received funding from Abbvie, AstraZeneca, Janssen, the
Bill and Melinda Gates Foundation, Nutricia (Danone) and MeMed Diagnos-
tics. UMCU has received major cash or in kind funding as part of the public
private partnership IMI-funded RESCEU project from GSK, Novavax, Janssen,
AstraZeneca, Pfizer and Sanofi. UMCU has received major funding by Julius
Clinical for participating in the INFORM study sponsored by AstraZeneca.
UMCU has received minor funding for participation in trials by Regeneron
and Janssen from 2015 to 2017. UMCU received minor funding for consult-
ation and invited lectures by AbbVie, AstraZeneca, Ablynx, Bavaria Nordic,
MabXience, Novavax, Pfizer, Janssen. LJB is the founding chairman of the
ReSViNET Foundation. Nirsevimab development is jointly funded by AstraZe-
neca and Sanofi Pasteur.
Author details
1
Department of Paediatric Immunology and Infectious Diseases, Wilhelmina
Children’s Hospital, University Medical Centre Utrecht, Utrecht University,
Utrecht, the Netherlands.
2
Department of Medical Microbiology, University
Medical Center Utrecht, Utrecht, the Netherlands.
3
Julius Center for Health
Sciences and Primary Care, University Medical Center Utrecht, Utrecht, the
Netherlands.
4
Department of Women and Children’s Health, School of Life
Course Sciences, Faculty of Life Sciences and Medicine, King’s College
London, London, UK.
5
ReSViNET foundation, Zeist, the Netherlands.
6
Department of Paediatrics, University of Turku and Turku University Hospital,
Turku, Finland.
7
Centro INFANT at Pontificia Universidade Catolica de Rio
Grande do Sul, Porto Alegre, Brazil.
8
Department of Paediatrics, The
University of Queensland, Brisbane, Australia.
9
Department of Paediatrics,
Hospital Clínico Universitario de Santiago, Santiago, Galicia, Spain.
10
Medical
Research Council: Respiratory and Meningeal Pathogens Research Unit,
School of Pathology, Faculty of Health Sciences, University of the
Witwatersrand, Johannesburg, South Africa.
11
Department of Science and
Technology/National Research Foundation: Vaccine Preventable Diseases
Unit, Faculty of health Sciences, University of the Witwatersrand,
Johannesburg, South Africa.
12
Department of Paediatrics, Fukushima Medical
University School of Medicine, Fukushima, Japan.
13
Department of Virology,
University Hospital Giessen and Marburg, Marburg, Germany.
14
Department
of Paediatrics, University Hospital Giessen and Marburg, Marburg, Germany.
15
Association Clinique et Thérapeutique Infantile du Val-de-Marne, CHI
Créteil, GRC Gemini, Université Paris XII, Créteil, France.
16
Department of
Paediatrics, Division of Pediatric Infectious Diseases, Montreal Children’s
Hospital, McGill University Health Centre, Montreal, Canada.
17
Department of
Paediatrics, McMaster University, Hamilton, Canada.
18
Paediatric Intensive
Care Unit, Wilhelmina Children’s Hospital, University Medical Centre Utrecht,
Utrecht University, Utrecht, the Netherlands.
19
AstraZeneca, Gaithersburg/
South San Francisco, USA.
20
Julius Clinical, Zeist, the Netherlands.
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 7 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Received: 11 December 2019 Accepted: 17 June 2020
References
1. Hall CB, Weinberg GA, Iwane MK, Blumkin AK, Edwards KM, Staat MA,
Auinger P, Griffin MR, Poehling KA, Erdman D, et al. The burden of
respiratory syncytial virus infection in young children. N Engl J Med. 2009;
360(6):588–98.
2. Shi T, McAllister DA, O'Brien KL, Simoes EAF, Madhi SA, Gessner BD, Polack
FP, Balsells E, Acacio S, Aguayo C, et al. Global, regional, and national
disease burden estimates of acute lower respiratory infections due to
respiratory syncytial virus in young children in 2015: a systematic review
and modelling study. Lancet. 2017;390(10098):946–58.
3. Mazur NI, Martinon-Torres F, Baraldi E, Fauroux B, Greenough A, Heikkinen T,
Manzoni P, Mejias A, Nair H, Papadopoulos NG, et al. Lower respiratory tract
infection caused by respiratory syncytial virus: current management and
new therapeutics. Lancet Respir Med. 2015;3(11):888–900.
4. Muralidharan A, Li C, Wang L, Li X. Immunopathogenesis associated with
formaldehyde-inactivated RSV vaccine in preclinical and clinical studies.
Expert Rev Vaccines. 2017;16(4):351–60.
5. Wu H, Pfarr DS, Losonsky GA, Kiener PA. Immunoprophylaxis of RSV
infection: advancing from RSV-IGIV to palivizumab and motavizumab. Curr
Top Microbiol Immunol. 2008;317:103–23.
6. Mejias A, Garcia-Maurino C, Rodriguez-Fernandez R, Peeples ME, Ramilo O.
Development and clinical applications of novel antibodies for prevention
and treatment of respiratory syncytial virus infection. Vaccine. 2017;35(3):
496–502.
7. Mazur NI, Higgins D, Nunes MC, Melero JA, Langedijk AC, Horsley N,
Buchholz UJ, Openshaw PJ, McLellan JS, Englund JA, et al. The respiratory
syncytial virus vaccine landscape: lessons from the graveyard and promising
candidates. Lancet Infect Dis. 2018;18(10):e295–311.
8. Zhu Q, McLellan JS, Kallewaard NL, et al. A highly potent extended half-life
antibody as a potential RSV vaccine surrogate for all infants. Sci Transl Med.
2017;9(388):eaaj1928. https://doi.org/10.1126/scitranslmed.aaj1928.
9. Papenburg J, Carbonneau J, Hamelin ME, Isabel S, Bouhy X, Ohoumanne N,
Dery P, Paes BA, Corbeil J, Bergeron MG, et al. Molecular evolution of
respiratory syncytial virus fusion gene, Canada, 2006-2010. Emerg Infect Dis.
2012;18(1):120–4.
10. Zhu Q, Lu B, McTamney P, Palaszynski S, Diallo S, Ren K, Ulbrandt ND,
Kallewaard N, Wang W, Fernandes F, et al. Prevalence and significance of
substitutions in the fusion protein of respiratory syncytial virus resulting in
neutralization escape from antibody MEDI8897. J Infect Dis. 2018;218(4):
572–80.
11. Ruzin A, Pastula ST, Levin-Sparenberg E, Jiang X, Fryzek J, Tovchigrechko A,
Lu B, Qi Y, Liu H, Jin H, et al. Characterization of circulating RSV strains
among subjects in the OUTSMART-RSV surveillance program during the
2016-17 winter viral season in the United States. PLoS One. 2018;13(7):
e0200319.
12. Goecks J, Nekrutenko A, Taylor J, Galaxy T. Galaxy: a comprehensive
approach for supporting accessible, reproducible, and transparent
computational research in the life sciences. Genome Biol. 2010;11(8):R86.
13. Hunt M, Mather AE, Sanchez-Buso L, Page AJ, Parkhill J, Keane JA, Harris SR.
ARIBA: rapid antimicrobial resistance genotyping directly from sequencing
reads. Microb Genom. 2017;3(10):e000131.
14. Tabatabai J, Prifert C, Pfeil J, Grulich-Henn J, Schnitzler P. Novel respiratory
syncytial virus (RSV) genotype ON1 predominates in Germany during winter
season 2012-13. PLoS One. 2014;9(10):e109191.
15. Rima B, Collins P, Easton A, Fouchier R, Kurath G, Lamb RA, Lee B, Maisner A,
Rota P, Wang L, et al. ICTV Virus Taxonomy Profile: Pneumoviridae. J Gen
Virol. 2017;98(12):2912–3.
16. REGN2222 presentation at the 11th International Respiratory Syncytial Virus
Symposium, Asheville, NC, United States of America In.; 2018.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Langedijk et al. BMC Infectious Diseases (2020) 20:450 Page 8 of 8
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com