Access to this full-text is provided by MDPI.
Content available from Nutrients
This content is subject to copyright.
nutrients
Article
Anti-Adipogenic Effect of Neferine in 3T3-L1 Cells
and Primary White Adipocytes
Miey Park 1,2, Jinyoung Han 1and Hae-Jeung Lee 1, 2, *
1Department of Food and Nutrition, College of BioNano Technology, Gachon University,
Gyeonggi-do 13120, Korea; mieyp@naver.com (M.P.); hanalice@gc.gachon.ac.kr (J.H.)
2Institute for Aging and Clinical Nutrition Research, Gachon University, Gyeonggi-do 13120, Korea
*Correspondence: skysea@gachon.ac.kr; Tel.: +82-31-750-5968; Fax: +82-31-724-4411
Received: 25 May 2020; Accepted: 17 June 2020; Published: 22 June 2020
Abstract:
Neferine, an alkaloid component extracted from lotus seed embryos, is known for its
anti-inflammatory, anticancer, and antioxidant properties. However, the anti-adipogenic activity
of neferine has not been thoroughly investigated. In this study, neferine was found to inhibit
lipid accumulation in a dose-dependent manner during the differentiation of 3T3-L1 cells without
inducing cytotoxicity. Real-time polymerase chain reaction and immunoblot analysis revealed the
downregulation in the expression of peroxisome proliferator activated receptor gamma (PPAR
γ
),
CCAAT/enhancer-binding protein alpha (C/EBP
α
), sterol regulatory element-binding protein-1c
(SREBP-1c), and fatty acid synthase (FAS) and the upregulation in carnitine palmitoyltransferase-1
(CPT-1) and sirtuin 1 (SIRT1) levels following neferine treatment. Furthermore, neferine increased
the phosphorylation of adenosine monophosphate-activated protein kinase (AMPK) and acetyl-CoA
carboxylase (ACC), which is an important regulator of fatty acid oxidation. Our result indicates
that neferine attenuates adipogenesis and promotes lipid metabolism by activating AMPK-mediated
signaling. Therefore, neferine may serve as a therapeutic candidate for obesity treatment.
Keywords: neferine; 3T3-L1 preadipocytes; differentiation; anti-adipogenic activity
1. Introduction
The prevalence of obesity, one of the biggest health problems among all age groups, is increasing
worldwide [
1
,
2
]. In 2014, about 30% of the world’s population was estimated to be overweight or
obese [
3
]. Obesity is characterized by the excessive accumulation of adipocytes, leading to a rise
in body weight. It is a critical predictor of numerous comorbidities such as cardiovascular disease,
insulin resistance-related diabetes, cancer, and depression [
4
–
6
]. Common weight loss cures in obese
individuals include diets, physical activity, behavioral therapies, and pharmacological treatments [7].
Anti-obesity drugs involved in weight regulation are known to exert harmful side-effects, including
headache and blood pressure abnormalities [
8
,
9
]. Hence, studies have been directed to investigate the
potential role of plants to treat obesity and related metabolic disorders and to elucidate their beneficial
effects on lipid and glucose metabolism [10].
Neferine is a bisbenzylisoquinoline alkaloid isolated from the seed embryo of Nelumbo nucifera,
commonly known as lotus [
11
]. It has been consumed for a long time in India and China [
12
].
Neferine has been found to exhibit therapeutic properties such as antioxidant, anti-inflammatory,
anticancer, and anti-amnesic effects [
13
–
15
]. Considering these beneficial properties, neferine
may be exploited for the development of curative products with no side-effects [
11
]. For years,
the embryos of N. nucifera seeds have been consumed in China and India to ameliorate various
diseases and its typical bisbenzylisoquinoline alkaloid is neferine [
11
,
12
,
16
]. Previous studies have
demonstrated its antioxidation, anti-inflammation, and anticancer properties [
13
–
15
]. Neferine can
Nutrients 2020,12, 1858; doi:10.3390/nu12061858 www.mdpi.com/journal/nutrients
Nutrients 2020,12, 1858 2 of 12
be potentially useful to treat cardiovascular diseases such as arrhythmia, thrombosis, and platelet
aggregation [17,18]
. Further, it is known to exert protective effects against Alzheimer’s disease, amnesia,
and
depression [15,19,20]
, which is suggestive of the plausible application of this phytochemical for
curative purposes [18].
The differentiation of precursor cells into mature adipocytes is controlled by several markers
associated with adipogenesis [
21
]. The transcription factors, peroxisome proliferator-activated
receptor-
γ
(PPAR
γ
), CCAAT/enhancer-binding proteins (CEBPs), and sterol regulatory element-binding
proteins (SREBPs) are key regulators of adipogenesis [
22
–
24
], and AMP-activated protein kinase (AMPK)
is a chief regulator of the underlying molecular mechanism [
25
]. Mitochondrial beta-oxidation plays
an important role in energy metabolism and is regulated by carnitine palmitoyltransferase-1 (CPT-1)
and acetyl-CoA carboxylase (ACC) [
26
]. AMPK upregulates the activity of CPT-1 and increases the
transport of free fatty acids for beta-oxidation through the inhibition of the phosphorylation of ACC
and decreases in the concentration of malonyl-CoA [
25
,
27
,
28
]. Further, it suppresses the expression of
ACC and fatty acid synthase (FAS), which are critical transcription factors of lipogenesis, by inhibiting
SREBP-1c activity [
29
]. Until now, very few studies have investigated the anti-adipogenic/lipogenic
effect of neferine in 3T3-L1 preadipocytes. In the present study, we evaluate the effects of neferine on
adipogenesis and lipid metabolism of 3T3-L1 preadipocytes.
2. Materials and Methods
2.1. Materials
Neferine (C38H44N2O6) was purchased from Sigma (St. Louis, MO, USA) and solvated in
dimethyl sulfoxide. 3T3-L1 preadipocytes were acquired from the ATCC (
Manassas, VA, USA
).
Cell growth medium (DMEM), bovine calf serum (BCS), trypsin, fetal bovine serum (FBS),
and insulin were supplied by Thermo Fisher (San Jose, CA, USA), while antibiotic-antimycotic
solution, 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR), dorsomorphin (Compound C),
3-isobutyl-1-methylxanthine (IBMX), and dexamethasone (DEX) were procured from Sigma (St. Louis,
MO, USA).
2.2. Cell Culture and Differentiation of Preadipocytes
3T3-L1 preadipocytes were grown in DMEM supplemented with 10% BCS and
antibiotic-antimycotic solution in a 5% CO
2
incubator at 37
◦
C. Differentiation of preadipocytes was
induced by substituting the medium with DMEM containing 10% FBS and adipocyte differentiation
cocktail (MDI; 1 µM DEX, 0.5 mM IBMX, and 10 µg/mL insulin) for 3 days.
C57BL/6 mice (Five-week-old males) were used for the isolation of primary adipocytes and stromal
vascular fraction (SVF), as per the protocol described in the journal [
30
]. In brief, lumps of fat tissues
collected from mice were minced with scissors and incubated with phosphate-buffered saline (PBS;
Thermo Fisher, San Jose, CA, USA) supplemented with 1.5 U/mL of collagenase D (Sigma, St. Louis,
MO, USA) at 37
◦
C for 30 min to 1 h. The lysate obtained was filtered with 40-mm cell strainers (SPL
Life Science, Pocheon-si, Gyeonggi-do, Korea) and washed with PBS. After centrifugation (1200 rpm,
10 min) the cells were resuspended in DMEM. Adipocytes were cultured in SVF culture medium
and incubated at 37
◦
C and 5% CO
2
atmosphere. The primary white adipose tissue was subjected
to differentiation using MDI, as previously described. Neferine was prepared at 20 mM and used
to treat 3T3-L1 preadipocytes and SVF cells at 1, 2.5, 5, and 10
µ
M concentrations. The negative
control was undifferentiated cells, while the positive control included differentiated cells without
neferine treatment. 3T3-L1 preadipocytes were treated with an activator or inhibitor of AMPK. AICAR
(10
µ
M) or dorsomorphin (5
µ
M) was added during differentiation until the cells were harvested.
All experiments were carried out in triplicates, as per the guidelines for the care and use of laboratory
animals of Gachon University (reference number: GIACUC-R2019004).
Nutrients 2020,12, 1858 3 of 12
2.3. Cell Viability Assay
Preadipocytes 3T3-L1 cells were planted in 96-well plates (1
×
10
4
cells/well) and allowed to adhere
and grow for 24 h. Next, the cells were treated with neferine at 1, 2.5, 5, and 10
µ
M concentrations
and incubated at 37
◦
C for 24, 48, and 72 h under 5% CO
2
atmosphere. Cells were subjected to Cell
Counting Kit-8 (Dojindo Molecular Technologies, Rockville, MD, USA) assay, as recommended by
the manufacturer. The absorbance was measured at 450 nm using a microplate reader (BioTek Inc.,
Winooski, VT, USA).
2.4. Lipids Quantification
Experimental control, or neferine-treated 3T3-L1 cells, were rinsed and fixed using 4%
paraformaldehyde for an hour or longer. Cells were gently washed with 60% isopropanol and
allowed to dry. Each well was stained using a filtered Oil Red O working solution in isopropanol:
distilled water for 1 h at room temperature (20–22
◦
C). Images of stained lipid droplets were obtained
under an inverted microscope (Nikon Eclipse, Shinagawa, Tokyo, Japan). The dye was dissolved in
100% isopropanol, and the absorbance was read at 500 nm wavelength.
2.5. Quantification of Gene Expression
Total RNA was isolated by the TaKaRa
®
method according to the instructions of the manufacturer
(TaKaRa Bio, Kusatsu, Shiga, Japan). In total, 2 µg of isolated RNA was used for quantification using
QuantStudio 3 (Thermo Fisher Scientific, San Jose, CA, USA), and 50 ng RNA was reversely transcribed
to complementary DNA using a PCR (TaKaRa Bio, Kusatsu, Shiga, Japan). RT-PCR was performed
using TB Green (TaKaRa Bio, Kusatsu, Shiga, Japan), and all reactions were carried out in triplicates.
The sequences of forward and reverse primer sets are shown in Table 1.
Table 1. Primer sets for real-time quantitative polymerase chain reaction.
Gene Forward (50–30) Reverse (50–30)
PPARγTTTTCAAGGGTGCCAGTTTC AATCCTTGGCCCTCTGAGAT
C/EBPαTTACAACAGGCCAGGTTTCC GGCTGGCGACATACAGTACA
SREBP-1 TGTTGGCATCCTGCTATCTG AGGGAAAGCTTTGGGGTCTA
β-actin CTGTCCCTGTATGCCTCTG ATGTCACGCACGATTTCC
PPAR
γ
: peroxisome proliferator-activated receptor gamma, C/EBP
α
: CCAAT/enhancer-binding protein alpha,
SREBP-1: Sterol regulatory element-binding transcription factor-1.
2.6. Protein Quantification and Immunoblot Analysis
To analyze the expression of proteins such as PPAR
γ
, C/EBP
α
, SREBP-1, FAS, CPT-1, AMPK,
ACC, and
β
-actin, the cells treated with different concentrations of neferine were subjected to western
blot analysis. 3T3-L1 adipocytes and primary white adipocytes were extracted with a protein lysis
buffer (iNtRON Biotechnology, Seongnam, Korea) containing protease and phosphatase inhibitors
(Thermo Fisher, San Jose, CA, USA). After incubation for 30 min on ice, total protein from each
sample was quantified using a PRO-MEASURE protein measurement solution (iNtRON Biotechnology,
Seongnam, Korea). Samples with same protein amounts were separated on SDS-PAGE gel, and the
separated bands were electro-transferred to a polyvinylidene fluoride (PVDF) membrane. For 1 h,
the membrane was blocked and immunoblotted with primary antibodies for 2 h, followed by probing
with horseradish peroxidase-labeled secondary antibodies for 1 h. The reactive bands of target proteins
were detected by the Quant LAS 500 system (GE Healthcare Bio-Sciences AB, Björkgatan, Uppsala,
Sweden) using an enhanced chemiluminescence (ECL) reagent (Amersham Pharmacia, Little Chalfont,
Buckinghamshire, UK).
Nutrients 2020,12, 1858 4 of 12
2.7. Statistical Analysis
All experiments were independently performed in triplicates and presented as mean
±
standard
deviation (SD). Data were analyzed on GraphPad Prism 5.03 (GraphPad Software Inc., La Jolla, CA,
USA) using the one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test. Probability
(p) values less than 0.05 (*) were considered statistically significant.
3. Results
3.1. Effect of Neferine on the Viability of 3T3-L1 Cells
A cell viability assay was used to investigate the cytotoxicity of neferine on 3T3-L1 preadipocytes.
At 20
µ
M concentration, neferine significantly reduced the viability of cells after treatment for 24 and
72 h (Figure 1). Therefore, 10 µM neferine concentration was used in subsequent experiments.
Nutrients 2020, 12, x FOR PEER REVIEW 4 of 12
2.7. Statistical Analysis
All experiments were independently performed in triplicates and presented as mean ± standard
deviation (SD). Data were analyzed on GraphPad Prism 5.03 (GraphPad Software Inc., La Jolla, CA,
USA) using the one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test.
Probability (p) values less than 0.05 (*) were considered statistically significant.
3. Results
3.1. Effect of Neferine on the Viability of 3T3-L1 Cells
A cell viability assay was used to investigate the cytotoxicity of neferine on 3T3-L1
preadipocytes. At 20 μM concentration, neferine significantly reduced the viability of cells after
treatment for 24 and 72 h (Figure 1). Therefore, 10 μM neferine concentration was used in subsequent
experiments.
Figure 1. Effects of neferine on 3T3-L1 preadipocyte viability. Neferine was used at 2.5, 5, 10, and 20
μM concentrations for 24, 48, and 72 h. * p < 0.05 and *** p < 0.001 vs. Con. All data are presented as
mean ± SD, and experiments were performed for at least three times. The positive control (Con) was
differentiated 3T3-L1 cells treated with adipocyte differentiation cocktail.
3.2. Effect of Neferine on Intracellular Lipid Accumulation in 3T3-L1 Adipocytes
After inducing differentiation for 7 days, 3T3-L1 preadipocytes were stained with Oil Red O dye
to observe intracellular lipid accumulation (Figure 2A). In comparison with control cells, those
treated with neferine (1.25, 2.5, 5, and 10 μM) showed a significant decrease in lipid content in a dose-
dependent manner (Figure 2B). These results demonstrated that neferine was involved in the
inhibition of 3T3-L1 cell differentiation and lipid accumulation.
3.3. Effect of Neferine on the Adipogenesis of 3T3-L1 Cells
To investigate the effects of neferine on adipogenesis, we performed RT-PCR. As shown in
Figure 3, neferine significantly decreased the mRNA expression levels of the key adipogenic
transcription factors, PPARγ, C/EBPα, and SREBP-1c (Figure 3A–C).
The relative protein levels of PPARγ, C/EBPα, and SREBP1c in neferine-treated cells reduced in
a dose-dependent manner (Figure 4A–D). Taken together, these data indicated that neferine
downregulated the expression of the key factors associated with adipogenesis.
3.4. Effect of Neferine on Fatty Acid Oxidation in 3T3-L1 Adipocytes
We differentiated 3T3-L1 cells into mature adipocytes and prepared three identical immunoblots
to study the effect of neferine on fatty acid oxidation. Relative CPT-1 protein expression was
Con 2.5 510 20
0
50
100
150
24 h
48 h
72 h
*** *
***
Neferine (μM)
Relative viability of 3T3-L1 cells
(% of control)
Figure 1.
Effects of neferine on 3T3-L1 preadipocyte viability. Neferine was used at 2.5, 5, 10, and 20
µ
M concentrations for 24, 48, and 72 h. * p<0.05 and *** p<0.001 vs. Con. All data are presented as
mean
±
SD, and experiments were performed for at least three times. The positive control (Con) was
differentiated 3T3-L1 cells treated with adipocyte differentiation cocktail.
3.2. Effect of Neferine on Intracellular Lipid Accumulation in 3T3-L1 Adipocytes
After inducing differentiation for 7 days, 3T3-L1 preadipocytes were stained with Oil Red O
dye to observe intracellular lipid accumulation (Figure 2A). In comparison with control cells, those
treated with neferine (1.25, 2.5, 5, and 10
µ
M) showed a significant decrease in lipid content in a
dose-dependent manner (Figure 2B). These results demonstrated that neferine was involved in the
inhibition of 3T3-L1 cell differentiation and lipid accumulation.
Nutrients 2020,12, 1858 5 of 12
Nutrients 2020, 12, x FOR PEER REVIEW 5 of 12
significantly upregulated following neferine treatment in a dose-dependent manner (Figure 5A).
Neferine increased the expression of sirtuin 1 (SIRT1) at concentrations up to 5 μM (Figure 5B).
(A)
(B)
Figure 2. Effects of neferine on intracellular lipid accumulation. (A) Lipid droplets were measured by
Oil Red O staining. Cell were treated with neferine at concentrations of 1, 2.5, 5, and 10 μM. Scale bar
indicates 100 μm. (B) Relative lipid content is expressed as percentage. ** p < 0.01 and *** p < 0.001 vs.
Con. All data are presented as mean ± SD, and experiments were performed at least thrice. The
positive control (Con) was differentiated 3T3-L1 cells treated with adipocyte differentiation cocktail.
(A) (B) (C)
Figure 3. Effects of neferine on the expression of adipogenic marker genes. PCR was used to assess
mRNA expression levels of (A) PPARγ, (B) C/EBPα, and (C) SREBP1c. * p < 0.05, ** p < 0.01, and
*** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were performed at least
thrice. The positive control (Con) was differentiated 3T3-L1 cells treated with adipocyte
differentiation cocktail.
3.5. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
We studied the effect of neferine on the AMPK pathway of 3T3-L1 adipocytes using western blot
analysis. The ratio of p-AMPK/AMPK increased following neferine treatment in a dose-dependent
manner, as indicated in Figure 6A. Phosphorylation of ACC also significantly increased following
treatment with neferine at concentrations up to 5 μM (Figure 6B). Thus, neferine activated the
signaling mediated by AMPK.
Con 1.25 2.5 510
0
50
100
150
** ***
***
Neferine (μM)
Lipid a ccumulat ion (% o f control )
PPAR
γ
mRNA
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
*
Neferine (μM)
Relative mRNA expression
C/EBP
α
mRNA
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
***
***
Neferine (μM)
Relative mRNA expression
SREBP-1c mRNA
Con 12.5 510
0.0
0.5
1.0
1.5
**
***
***
**
Neferine (μM)
Relative mRNA expression
Figure 2.
Effects of neferine on intracellular lipid accumulation. (
A
) Lipid droplets were measured by
Oil Red O staining. Cell were treated with neferine at concentrations of 1, 2.5, 5, and 10
µ
M. Scale bar
indicates 100
µ
m. (
B
) Relative lipid content is expressed as percentage. ** p<0.01 and *** p<0.001
vs. Con. All data are presented as mean
±
SD, and experiments were performed at least thrice. The
positive control (Con) was differentiated 3T3-L1 cells treated with adipocyte differentiation cocktail.
3.3. Effect of Neferine on the Adipogenesis of 3T3-L1 Cells
To investigate the effects of neferine on adipogenesis, we performed RT-PCR. As shown in Figure 3,
neferine significantly decreased the mRNA expression levels of the key adipogenic transcription factors,
PPARγ, C/EBPα, and SREBP-1c (Figure 3A–C).
Nutrients 2020, 12, x FOR PEER REVIEW 5 of 12
significantly upregulated following neferine treatment in a dose-dependent manner (Figure 5A).
Neferine increased the expression of sirtuin 1 (SIRT1) at concentrations up to 5 μM (Figure 5B).
(A)
(B)
Figure 2. Effects of neferine on intracellular lipid accumulation. (A) Lipid droplets were measured by
Oil Red O staining. Cell were treated with neferine at concentrations of 1, 2.5, 5, and 10 μM. Scale bar
indicates 100 μm. (B) Relative lipid content is expressed as percentage. ** p < 0.01 and *** p < 0.001 vs.
Con. All data are presented as mean ± SD, and experiments were performed at least thrice. The
positive control (Con) was differentiated 3T3-L1 cells treated with adipocyte differentiation cocktail.
(A) (B) (C)
Figure 3. Effects of neferine on the expression of adipogenic marker genes. PCR was used to assess
mRNA expression levels of (A) PPARγ, (B) C/EBPα, and (C) SREBP1c. * p < 0.05, ** p < 0.01, and
*** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were performed at least
thrice. The positive control (Con) was differentiated 3T3-L1 cells treated with adipocyte
differentiation cocktail.
3.5. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
We studied the effect of neferine on the AMPK pathway of 3T3-L1 adipocytes using western blot
analysis. The ratio of p-AMPK/AMPK increased following neferine treatment in a dose-dependent
manner, as indicated in Figure 6A. Phosphorylation of ACC also significantly increased following
treatment with neferine at concentrations up to 5 μM (Figure 6B). Thus, neferine activated the
signaling mediated by AMPK.
Con 1.25 2.5 510
0
50
100
150
** ***
***
Neferine (μM)
Lipid a ccumulat ion (% o f control )
PPAR
γ
mRNA
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
*
Neferine (μM)
Relative mRNA expression
C/EBP
α
mRNA
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
***
***
Neferine (μM)
Relative mRNA expression
SREBP-1c mRNA
Con 12.5 510
0.0
0.5
1.0
1.5
**
***
***
**
Neferine (μM)
Relative mRNA expression
Figure 3.
Effects of neferine on the expression of adipogenic marker genes. PCR was used to assess
mRNA expression levels of (
A
) PPAR
γ
, (
B
) C/EBP
α
, and (
C
)SREBP1c. * p<0.05, ** p<0.01,
and
*** p<0.001
vs. Con. All data are presented as mean
±
SD, and experiments were performed
at least thrice. The positive control (Con) was differentiated 3T3-L1 cells treated with adipocyte
differentiation cocktail.
The relative protein levels of PPAR
γ
, C/EBP
α
, and SREBP1c in neferine-treated cells reduced
in a dose-dependent manner (Figure 4A–D). Taken together, these data indicated that neferine
downregulated the expression of the key factors associated with adipogenesis.
Nutrients 2020,12, 1858 6 of 12
Nutrients 2020, 12, x FOR PEER REVIEW 6 of 12
3.6. Effect of Neferine on the Adipogenesis of Primary White Adipocytes
Primary white adipocytes were isolated from the subcutaneous and epididymal adipose tissues
of C57BL/6 mice to examine the effect of neferine on adipogenic factors. Primary white adipocytes
treated with neferine showed a consdierbale decrease in the relative protein expression of PPARγ,
C/EBPα, and SREBP-1c in a neferine concentration-dependent manner, consistent with the results
observed with 3T3-L1 adipocytes (Figure 7A–D).
(A) (B)
(C) (D)
Figure 4. Effect of neferine on adipogenesis. Protein expression levels of (A) PPARγ, (B) C/EBPα, and
(C) SREBP-1c were analyzed by immunoblotting. (D) Immunoblot results of adipogenic factors in
3T3-L1 cells. These results are expressed following normalization with β-actin level. * p < 0.05, ** p <
0.01, and *** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were performed
at least thrice. The control (Con) was positive control that differentiated 3T3-L1 cells treated with
adipocyte differentiation cocktail.
(A) (B)
Figure 5. Effect of neferine on the expression of the protein involved in fatty acid oxidation. Western
blotting was carried out to analyze the protein expression of (A) CPT-1 and (B) SIRT1 following
normalization to β-actin. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. Con. All data are presented as mean
PPARγ
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
***
Neferine (μM)
Relative expression
C/E B P α
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
**
Neferine (μM)
Relative expr ession
SREBP-1c
Con 12.5 510
0.0
0.5
1.0
1.5
**
** ** **
Neferine (μM)
Relative expression
Figure 4.
Effect of neferine on adipogenesis. Protein expression levels of (
A
) PPAR
γ
, (
B
) C/EBP
α
,
and (
C
) SREBP-1c were analyzed by immunoblotting. (
D
) Immunoblot results of adipogenic factors
in 3T3-L1 cells. These results are expressed following normalization with
β
-actin level. * p<0.05,
** p<0.01
, and *** p<0.001 vs. Con. All data are presented as mean
±
SD, and experiments were
performed at least thrice. The control (Con) was positive control that differentiated 3T3-L1 cells treated
with adipocyte differentiation cocktail.
3.4. Effect of Neferine on Fatty Acid Oxidation in 3T3-L1 Adipocytes
We differentiated 3T3-L1 cells into mature adipocytes and prepared three identical immunoblots to
study the effect of neferine on fatty acid oxidation. Relative CPT-1 protein expression was significantly
upregulated following neferine treatment in a dose-dependent manner (Figure 5A). Neferine increased
the expression of sirtuin 1 (SIRT1) at concentrations up to 5 µM (Figure 5B).
Nutrients 2020, 12, x FOR PEER REVIEW 6 of 12
3.6. Effect of Neferine on the Adipogenesis of Primary White Adipocytes
Primary white adipocytes were isolated from the subcutaneous and epididymal adipose tissues
of C57BL/6 mice to examine the effect of neferine on adipogenic factors. Primary white adipocytes
treated with neferine showed a consdierbale decrease in the relative protein expression of PPARγ,
C/EBPα, and SREBP-1c in a neferine concentration-dependent manner, consistent with the results
observed with 3T3-L1 adipocytes (Figure 7A–D).
(A) (B)
(C) (D)
Figure 4. Effect of neferine on adipogenesis. Protein expression levels of (A) PPARγ, (B) C/EBPα, and
(C) SREBP-1c were analyzed by immunoblotting. (D) Immunoblot results of adipogenic factors in
3T3-L1 cells. These results are expressed following normalization with β-actin level. * p < 0.05, ** p <
0.01, and *** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were performed
at least thrice. The control (Con) was positive control that differentiated 3T3-L1 cells treated with
adipocyte differentiation cocktail.
(A) (B)
Figure 5. Effect of neferine on the expression of the protein involved in fatty acid oxidation. Western
blotting was carried out to analyze the protein expression of (A) CPT-1 and (B) SIRT1 following
normalization to β-actin. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. Con. All data are presented as mean
± SD, and experiments were performed at least thrice. The positive control (Con) was differentiated
3T3-L1 cells treated with adipocyte differentiation cocktail.
PPARγ
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
***
Neferine (μM)
Relative expression
C/E B P α
Con 12.5 510
0.0
0.5
1.0
1.5
***
***
**
Neferine
(
μ
M
)
Relative expr ession
SREBP-1c
Con 12.5 510
0.0
0.5
1.0
1.5
**
** ** **
Neferine (
μ
M)
Relative expression
Figure 5.
Effect of neferine on the expression of the protein involved in fatty acid oxidation. Western
blotting was carried out to analyze the protein expression of (
A
) CPT-1 and (
B
) SIRT1 following
normalization to
β
-actin. * p<0.05, ** p<0.01, and *** p<0.001 vs. Con. All data are presented as mean
±
SD, and experiments were performed at least thrice. The positive control (Con) was differentiated
3T3-L1 cells treated with adipocyte differentiation cocktail.
Nutrients 2020,12, 1858 7 of 12
3.5. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
We studied the effect of neferine on the AMPK pathway of 3T3-L1 adipocytes using western blot
analysis. The ratio of p-AMPK/AMPK increased following neferine treatment in a dose-dependent
manner, as indicated in Figure 6A. Phosphorylation of ACC also significantly increased following
treatment with neferine at concentrations up to 5
µ
M (Figure 6B). Thus, neferine activated the signaling
mediated by AMPK.
Nutrients 2020, 12, x FOR PEER REVIEW 7 of 12
(A) (B)
Figure 6. Effects of neferine on AMPK and ACC during the differentiation of 3T3-L1 adipocytes.
Ratios of relative expression levels of (A) p-AMPK/AMPK and (B) p-ACC/ACC are presented. * p <
0.05, ** p < 0.01, and *** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were
performed at least thrice. The positive control (Con) was differentiated 3T3-L1 cells treated with
adipocyte differentiation cocktail.
(A) (B)
(C) (D)
Figure 7. Effects of neferine on adipogenesis of primary white adipocytes. Protein expression levels
of (A) PPARγ, (B) C/EBPα, and (C) SREBP-1c were investigated. (D) Detected bands of adipogenic
factors. Results are expressed following normalization of values to β-actin level. * p < 0.05, ** p < 0.01,
and *** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were performed at
least thrice. The positive control (Con) was differentiated primary white adipocytes treated with
differentiation cocktail.
PPARγ
Con 12.5 510
0.0
0.5
1.0
1.5
*** *** ***
**
Neferine (μM)
Relative expression
C/E B P α
Con 12.5 510
0.0
0.5
1.0
1.5
*** *** ***
Neferine (μM)
Relati ve expression
SREBP-1c
Con 12.5 510
0.0
0.5
1.0
1.5
*** ***
**
Neferine (μM)
Relative expression
Figure 6.
Effects of neferine on AMPK and ACC during the differentiation of 3T3-L1 adipocytes. Ratios
of relative expression levels of (
A
)p-AMPK/AMPK and (
B
)p-ACC/ACC are presented.
*p<0.05
,
** p<0.01, and *** p<0.001 vs. Con. All data are presented as mean
±
SD, and experiments were
performed at least thrice. The positive control (Con) was differentiated 3T3-L1 cells treated with
adipocyte differentiation cocktail.
3.6. Effect of Neferine on the Adipogenesis of Primary White Adipocytes
Primary white adipocytes were isolated from the subcutaneous and epididymal adipose tissues of
C57BL/6 mice to examine the effect of neferine on adipogenic factors. Primary white adipocytes treated
with neferine showed a consdierbale decrease in the relative protein expression of PPAR
γ
, C/EBP
α
,
and SREBP-1c in a neferine concentration-dependent manner, consistent with the results observed
with 3T3-L1 adipocytes (Figure 7A–D).
3.7. Effect of Neferine on the AMPK Pathway of Primary White Adipocytes
To investigate the effect of neferine on the AMPK pathway of primary white adipocytes,
three identical western blots were prepared. AMPK and ACC expression was dose-dependently
upregulated by neferine treatment (Figure 8A,B). Together, these data demonstrated that neferine
activates the AMPK signaling pathway in primary white adipocytes.
3.8. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
To confirm whether AMPK activation was involved in mediating the anti-adipogenic effects
of neferine, 3T3-L1 cells were treated with an AMPK inhibitor dorsomorphin (5
µ
M) and AMPK
activator AICAR (10
µ
M). As described in Figure 9, the protein expression level of AMPK increased
following AICAR treatment but reduced after dorsomorphin treatment. Neferine treatment significantly
upregulated AMPK expression as compared to control treatment. These data demonstrate that the
AMPK pathway plays an important role in mediating the anti-adipogenic effects of neferine in
3T3-L1 adipocytes.
Nutrients 2020,12, 1858 8 of 12
Nutrients 2020, 12, x FOR PEER REVIEW 7 of 12
(A) (B)
Figure 6. Effects of neferine on AMPK and ACC during the differentiation of 3T3-L1 adipocytes.
Ratios of relative expression levels of (A) p-AMPK/AMPK and (B) p-ACC/ACC are presented. * p <
0.05, ** p < 0.01, and *** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were
performed at least thrice. The positive control (Con) was differentiated 3T3-L1 cells treated with
adipocyte differentiation cocktail.
(A) (B)
(C) (D)
Figure 7. Effects of neferine on adipogenesis of primary white adipocytes. Protein expression levels
of (A) PPARγ, (B) C/EBPα, and (C) SREBP-1c were investigated. (D) Detected bands of adipogenic
factors. Results are expressed following normalization of values to β-actin level. * p < 0.05, ** p < 0.01,
and *** p < 0.001 vs. Con. All data are presented as mean ± SD, and experiments were performed at
least thrice. The positive control (Con) was differentiated primary white adipocytes treated with
differentiation cocktail.
PPARγ
Con 12.5 510
0.0
0.5
1.0
1.5
*** *** ***
**
Neferine (μM)
Relative expression
C/E B P α
Con 12.5 510
0.0
0.5
1.0
1.5
*** *** ***
Neferine (μM)
Relati ve expression
SREBP-1c
Con 12.5 510
0.0
0.5
1.0
1.5
*** ***
**
Neferine (μM)
Relative expression
Figure 7.
Effects of neferine on adipogenesis of primary white adipocytes. Protein expression levels
of (
A
) PPAR
γ
, (
B
) C/EBP
α
, and (
C
) SREBP-1c were investigated. (
D
) Detected bands of adipogenic
factors. Results are expressed following normalization of values to
β
-actin level. * p<0.05, ** p<0.01,
and *** p<0.001 vs. Con. All data are presented as mean
±
SD, and experiments were performed
at least thrice. The positive control (Con) was differentiated primary white adipocytes treated with
differentiation cocktail.
Nutrients 2020
,
12
, x FOR PEER REVIEW 8 of 12
3.7. Effect of Neferine on the AMPK Pathway of Primary White Adipocytes
To investigate the effect of neferine on the AMPK pathway of primary white adipocytes, three
identical western blots were prepared. AMPK and ACC expression was dose-dependently
upregulated by neferine treatment (Figure 8A,B). Together, these data demonstrated that neferine
activates the AMPK signaling pathway in primary white adipocytes.
(A) (B)
Figure 8. Effects of neferine on AMPK and ACC in primary white adipocytes. Western blot analysis
was performed to evaluate the ratio of the relative protein expression levels of (A) p-AMPK/AMPK
and (B) p-ACC/ACC. * p < 0.05 and ** p < 0.01 vs. Con. All data are presented as mean ± SD, and
experiments were performed at least thrice. The positive control (Con) was differentiated primary
white adipocytes treated with differentiation cocktail.
3.8. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
To confirm whether AMPK activation was involved in mediating the anti-adipogenic effects of
neferine, 3T3-L1 cells were treated with an AMPK inhibitor dorsomorphin (5 μM) and AMPK
activator AICAR (10 μM). As described in Figure 9, the protein expression level of AMPK increased
following AICAR treatment but reduced after dorsomorphin treatment. Neferine treatment
significantly upregulated AMPK expression as compared to control treatment. These data
demonstrate that the AMPK pathway plays an important role in mediating the anti-adipogenic effects
of neferine in 3T3-L1 adipocytes.
Figure 9. Effect of neferine in 3T3-L1 adipocytes treated with an inhibitor (dorsomorphin) and
activator (5-aminoimidazole-4-carboxamide ribonucleotide (AICAR)) of AMPK. ** p < 0.01 and *** p <
0.001 vs. without Neferine. The ratio of p-AMPK/AMPK was analyzed using immunoblotting. All
data are presented as mean ± SD, and experiments were performed at least thrice.
Figure 8.
Effects of neferine on AMPK and ACC in primary white adipocytes. Western blot analysis
was performed to evaluate the ratio of the relative protein expression levels of (
A
)p-AMPK/AMPK and
(
B
)p-ACC/ACC. * p<0.05 and ** p<0.01 vs. Con. All data are presented as mean
±
SD, and experiments
were performed at least thrice. The positive control (Con) was differentiated primary white adipocytes
treated with differentiation cocktail.
Nutrients 2020,12, 1858 9 of 12
Nutrients 2020
,
12
, x FOR PEER REVIEW 8 of 12
3.7. Effect of Neferine on the AMPK Pathway of Primary White Adipocytes
To investigate the effect of neferine on the AMPK pathway of primary white adipocytes, three
identical western blots were prepared. AMPK and ACC expression was dose-dependently
upregulated by neferine treatment (Figure 8A,B). Together, these data demonstrated that neferine
activates the AMPK signaling pathway in primary white adipocytes.
(A) (B)
Figure 8. Effects of neferine on AMPK and ACC in primary white adipocytes. Western blot analysis
was performed to evaluate the ratio of the relative protein expression levels of (A) p-AMPK/AMPK
and (B) p-ACC/ACC. * p < 0.05 and ** p < 0.01 vs. Con. All data are presented as mean ± SD, and
experiments were performed at least thrice. The positive control (Con) was differentiated primary
white adipocytes treated with differentiation cocktail.
3.8. Effect of Neferine on the AMPK Pathway of 3T3-L1 Adipocytes
To confirm whether AMPK activation was involved in mediating the anti-adipogenic effects of
neferine, 3T3-L1 cells were treated with an AMPK inhibitor dorsomorphin (5 μM) and AMPK
activator AICAR (10 μM). As described in Figure 9, the protein expression level of AMPK increased
following AICAR treatment but reduced after dorsomorphin treatment. Neferine treatment
significantly upregulated AMPK expression as compared to control treatment. These data
demonstrate that the AMPK pathway plays an important role in mediating the anti-adipogenic effects
of neferine in 3T3-L1 adipocytes.
Figure 9. Effect of neferine in 3T3-L1 adipocytes treated with an inhibitor (dorsomorphin) and
activator (5-aminoimidazole-4-carboxamide ribonucleotide (AICAR)) of AMPK. ** p < 0.01 and *** p <
0.001 vs. without Neferine. The ratio of p-AMPK/AMPK was analyzed using immunoblotting. All
data are presented as mean ± SD, and experiments were performed at least thrice.
Figure 9.
Effect of neferine in 3T3-L1 adipocytes treated with an inhibitor (dorsomorphin) and activator
(5-aminoimidazole-4-carboxamide ribonucleotide (AICAR)) of AMPK. ** p<0.01 and *** p<0.001 vs.
without Neferine. The ratio of p-AMPK/AMPK was analyzed using immunoblotting. All data are
presented as mean ±SD, and experiments were performed at least thrice.
4. Discussion
Obesity, a growing pandemic, is associated with various metabolic disorders. Numerous
researches have been directed to ameliorate obesity and related complications [
31
,
32
]. As most
anti-obesity drugs exert side-effects [
33
], plant-based phytochemicals are gaining attention. In general,
lipid droplet accumulation and preadipocytes differentiation into mature adipocytes are regarded as the
hallmark events in obesity [
32
,
34
]. The present study suggests that neferine prominently reduces lipid
accumulation and differentiation of 3T3-L1 adipocytes and primary white adipocytes by regulating
adipogenic transcriptional factors and AMPK pathway.
The differentiation of 3T3-L1 preadipocytes is mainly mediated by critical nuclear transcription
factors, PPAR
γ
and C/EBP
α
[
35
]. C/EBP
β
and C/EBP
δ
are stimulated in the process of differentiation,
thereby inducing the expression of PPARγand C/EBPα[36]. Even without hormones, differentiation
of preadipocytes is induced by the expression of PPAR
γ
. Thus, PPAR
γ
may be a core factor involved
in adipogenesis [
37
]. C/EBP
α
is expressed along with PPAR
γ
after the end of growth during the
adipogenic stage [
38
] and associated with lipid metabolism [
39
]. PPAR
γ
and C/EBP
α
control the
positive feedback loop to mediate adipogenesis [
40
]. SREBP-1c is also a vital regulator involved in
adipocyte differentiation and lipid metabolism and participates in lipogenesis [
24
,
41
]. In this study,
neferine downregulated the expression of adipogenic/lipogenic mRNAs and proteins, including PPAR
γ
,
C/EBP
α
, and SREBP-1c, in 3T3-L1 adipocytes and primary white adipocytes. In addition, Oil Red O
staining demonstrated the neferine-mediated inhibition of intracellular lipid accumulation.
AMPK plays a key role in mitochondrial energy homeostasis and regulates lipid and fatty acid
metabolism [
42
,
43
]. AMPK is known to exert beneficial effects in many tissues, including the adipose
tissue, and activation of AMPK is known to suppress adipogenesis by reducing the expression of
adipogenic factors [
44
]. ACC, a major regulator of mitochondrial fatty acid oxidation, is phosphorylated
upon AMPK activation [
45
]. In the present study, the cells treated with neferine showed upregulated
AMPK expression and ACC phosphorylation.
SIRT1 is an NAD-dependent protein that separates acetyl groups from various proteins [
46
]. SIRT1,
Like AMPK, is involved in cellular processes such as energy and lipid metabolism and mitochondrial
biogenesis, and controls adipokines in the adipose tissue [
47
,
48
]. CPT-1 is associated with fatty acid
metabolism and imports the acyl group of long-chain fatty acids to mitochondria to generate acyl
carnitines [
49
,
50
]. Further, the activation of AMPK and SIRT1 induces
β
-oxidation by stimulating
CPT-1 expression [
51
]. Here, we found that the protein expression levels of SIRT1 and CPT-1 were
increased in 3T3-L1 adipocytes following neferine treatment.
Nutrients 2020,12, 1858 10 of 12
As previously stated, neferine upregulated p-AMPK/AMPK and p-ACC/ACC ratios. Moreover,
the AMPK activity of neferine-treated 3T3-L1 cells was promoted by AICAR, an AMPK agonist,
and suppressed by the AMPK antagonist dorsomorphin. We showed that the anti-adipogenic effect of
neferine was related to AMPK-mediated regulation.
Taken together, our study demonstrates that neferine prominently inhibits the accumulation of
intracellular lipid and differentiation of 3T3-L1 and primary white adipocytes into mature adipocytes at
moderate concentrations through the AMPK signaling pathway. Overall, we verify that neferine may
exhibit potential therapeutic properties for obesity management. Further investigation is warranted to
demonstrate the underlying mechanism and substantiate the safety and value of neferine.
Author Contributions:
Investigation, visualization, data arrangement, and writing, M.P.; Investigation and
original draft preparation, M.P., J.H., and H.-J.L.; conceptualization and supervision, H.-J.L. All authors have read
and agreed to the published version of the manuscript.
Funding:
The “Cooperative Research Program of the Center for Companion Animal Research (Project No.
PJ01398402)”, Rural Development Administration, Republic of Korea, supported this work.
Conflicts of Interest: The authors declare no competing financial interests.
References
1.
Dhurandhar, E.J.; Keith, S.W. The aetiology of obesity beyond eating more and exercising less. Best Pr. Res.
Clin. Gastroenterol. 2014,28, 533–544. [CrossRef] [PubMed]
2.
Donohoe, C.L.; O’Farrell, N.J.; Doyle, S.L.; Reynolds, J.V. The role of obesity in gastrointestinal cancer:
Evidence and opinion. Ther. Adv. Gastroenterol. 2013,7, 38–50. [CrossRef] [PubMed]
3.
Tremmel, M.; Gerdtham, U.-G.; Nilsson, P.M.; Saha, S. Economic Burden of Obesity: A Systematic Literature
Review. Int. J. Environ. Res. Public Health 2017,14, 435. [CrossRef] [PubMed]
4.
Gurmaches, J.S.; Guertin, D.A. Adipocyte lineages: Tracing back the origins of fat. Biochim. Biophys.
Acta Bioenerg. 2013,1842, 340–351. [CrossRef]
5. Haslam, D.W.; James, W.P.T. Obesity. Lancet 2005,367, 1197–1209. [CrossRef]
6.
Wajchenberg, B.L. Subcutaneous and Visceral Adipose Tissue: Their Relation to the Metabolic Syndrome.
Endocr. Rev. 2000,21, 697–738. [CrossRef]
7.
Finelli, C.; Padula, M.C.; Martelli, G.; Tarantino, G. Could the improvement of obesity-related co-morbidities
depend on modified gut hormones secretion? World J. Gastroenterol. 2014,20, 16649–16664. [CrossRef]
8.
Karamadoukis, L.; Shivashankar, G.H.; Ludeman, L.; Williams, A. An unusual complication of treatment
with orlistat. Clin. Nephrol. 2009,71, 430–432. [CrossRef]
9.
Slovacek, L.; Pavl
í
k, V.; Slovackova, B. The effect of sibutramine therapy on occurrence of depression
symptoms among obese patients. Nutr. Metab. Cardiovasc. Dis. 2008,18, 18–43. [CrossRef]
10.
Gamboa-G
ó
mez, C.I.; Rocha-Guzm
á
n, N.E.; Gallegos-Infante, J.A.; Moreno-Jim
é
nez, M.R.;
V
á
zquez-Cabral, B.D.; Gonz
á
lez-Laredo, R.F. Plants with potential use on obesity and its complications.
EXCLI J. 2015,14, 809–831.
11.
Asokan, S.M.; Mariappan, R.; Muthusamy, S.; Velmurugan, B.K.; Shibu, M.A.; Ravichandran, M.;
Shanmugavadivu, M. Pharmacological benefits of neferine—A comprehensive review. Life Sci.
2018
,
199, 60–70. [CrossRef] [PubMed]
12.
Sharma, B.R.; Gautam, L.N.S.; Adhikari, D.; Karki, R. A Comprehensive Review on Chemical Profiling
ofNelumbo Nucifera: Potential for Drug Development. Phytother. Res.
2016
,31, 3–26. [CrossRef] [PubMed]
13.
Kadioglu, O.; Law, B.Y.K.; Mok, S.W.F.; Xu, S.-W.; Efferth, T.; Wong, V.K.W. Mode of Action Analyses of
Neferine, a Bisbenzylisoquinoline Alkaloid of Lotus (Nelumbo nucifera) against Multidrug-Resistant Tumor
Cells. Front. Pharmacol. 2017,8, 308. [CrossRef] [PubMed]
14.
Sivalingam, K.S.; Paramasivan, P.; Weng, C.F.; Viswanadha, V.P. Neferine Potentiates the Antitumor Effect
of Cisplatin in Human Lung Adenocarcinoma Cells Via a Mitochondria-Mediated Apoptosis Pathway.
J. Cell. Biochem. 2017,118, 2865–2876. [CrossRef] [PubMed]
15.
Jung, H.A.; Jin, S.E.; Choi, R.J.; Kim, N.H.; Kim, Y.S.; Ryu, J.H.; Kim, N.-W.; Son, Y.K.; Park, J.J.; Choi, J.S.
Anti-amnesic activity of neferine with antioxidant and anti-inflammatory capacities, as well as inhibition of
ChEs and BACE1. Life Sci. 2010,87, 420–430. [CrossRef]
Nutrients 2020,12, 1858 11 of 12
16.
Paudel, K.R.; Panth, N. Phytochemical Profile and Biological Activity of Nelumbo nucifera. Evid. Based
Complement. Altern. Med. 2015,2015, 1–16. [CrossRef]
17.
Miura, D.S.; Wynn, J.; Torres, V.; Laux, B.; Keefe, D.; Somberg, J.C. Antiarrhythmic efficacy of ethmozine in
patients with ventricular tachycardia as determined by programmed electrical stimulation. Am. Heart J.
1986,111, 661–666. [CrossRef]
18.
Zhou, Y.-J.; Xiang, J.-Z.; Yuan, H.; Liu, H.; Tang, Q.; Hao, H.-Z.; Yin, Z.; Wang, J.; Ming, Z. Neferine exerts its
antithrombotic effect by inhibiting platelet aggregation and promoting dissociation of platelet aggregates.
Thromb. Res. 2013,132, 202–210. [CrossRef]
19.
Jung, H.A.; Karki, S.; Kim, J.H.; Choi, J.S. BACE1 and cholinesterase inhibitory activities of Nelumbo nucifera
embryos. Arch. Pharm. Res. 2014,38, 1178–1187. [CrossRef]
20.
Sugimoto, Y.; Nishimura, K.; Itoh, A.; Tanahashi, T.; Nakajima, H.; Oshiro, H.; Sun, S.; Toda, T.; Yamada, J.
Serotonergic mechanisms are involved in antidepressant-like effects of bisbenzylisoquinolines liensinine and
its analogs isolated from the embryo of Nelumbo nucifera Gaertner seeds in mice. J. Pharm. Pharmacol.
2015
,
67, 1716–1722. [CrossRef]
21.
Drolet, R.; Richard, C.; Sniderman, A.D.; Mailloux, J.; Fortier, M.; Huot, C.; Rh
é
aume, C.; Tchernof, A.;
Rh, C. Hypertrophy and hyperplasia of abdominal adipose tissues in women. Int. J. Obes.
2007
,32, 283–291.
[CrossRef] [PubMed]
22.
Gregoire, F.M.; Smas, C.M.; Sul, H.S. Understanding adipocyte differentiation. Physiol. Rev.
1998
,78, 783–809.
[CrossRef] [PubMed]
23.
Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab.
2006
,4, 263–273. [CrossRef]
[PubMed]
24.
Eberl
é
, D.; Hegarty, B.; Bossard, P.; Ferre, P.; Foufelle, F. SREBP transcription factors: Master regulators of
lipid homeostasis. Biochimie 2004,86, 839–848. [CrossRef]
25.
Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol.
Cell Biol. 2017,19, 121–135. [CrossRef]
26.
Schreurs, M.; Kuipers, F.; Van Der Leij, F. Regulatory enzymes of mitochondrial
β
-oxidation as targets for
treatment of the metabolic syndrome. Obes. Rev. 2010,11, 380–388. [CrossRef]
27.
Saggerson, E.D. Malonyl-CoA, a Key Signaling Molecule in Mammalian Cells. Annu. Rev. Nutr.
2008
,28,
253–272. [CrossRef]
28.
Wolfgang, M.J.; Kurama, T.; Dai, Y.; Suwa, A.; Asaumi, M.; Matsumoto, S.-I.; Cha, S.H.; Shimokawa, T.;
Lane, M.D. The brain-specific carnitine palmitoyltransferase-1c regulates energy homeostasis. Proc. Natl.
Acad. Sci. USA 2006,103, 7282–7287. [CrossRef]
29.
Kim, E.; Lee, J.-H.; Ntambi, J.M.; Hyun, C.-K. Inhibition of stearoyl-CoA desaturase1 activates AMPK and
exhibits beneficial lipid metabolic effects in vitro. Eur. J. Pharmacol. 2011,672, 38–44. [CrossRef]
30.
Hausman, R.B.; Park, H.J.; Hausman, G.J. Isolation and Culture of Preadipocytes from Rodent White Adipose
Tissue. In Advanced Structural Safety Studies; Springer Science and Business Media: Berlin, Germany, 2008;
Volume 456, pp. 201–219.
31.
Lavie, C.J.; De Schutter, A.; Parto, P.; Jahangir, E.; Kokkinos, P.; Ortega, F.B.; Arena, R.; Milani, R.V. Obesity and
Prevalence of Cardiovascular Diseases and Prognosis—The Obesity Paradox Updated.
Prog. Cardiovasc. Dis.
2016,58, 537–547. [CrossRef]
32.
Elagizi, A.; Kachur, S.; Lavie, C.J.; Carbone, S.; Pandey, A.; Ortega, F.B.; Milani, R.V. An Overview and Update
on Obesity and the Obesity Paradox in Cardiovascular Diseases. Prog. Cardiovasc. Dis.
2018
,61, 142–150.
[CrossRef]
33.
Onakpoya, I.; Heneghan, C.J.; Aronson, J.K. Post-marketing withdrawal of anti-obesity medicinal products
because of adverse drug reactions: A systematic review. BMC Med. 2016,14, 191. [CrossRef] [PubMed]
34.
Rayalam, S.; Della-Fera, M.A.; Baile, C.A. Phytochemicals and regulation of the adipocyte life cycle.
J. Nutr. Biochem. 2008,19, 717–726. [CrossRef] [PubMed]
35.
Jang, B.-C. Artesunate inhibits adipogeneis in 3T3-L1 preadipocytes by reducing the expression and/or
phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. Biochem. Biophys. Res. Commun.
2016,474, 220–225. [CrossRef] [PubMed]
36.
Wu, Z.; Rosen, E.D.; Brun, R.; Hauser, S.; Adelmant, G.; Troy, E.A.; McKeon, C.; Darlington, G.J.; Spiegelman, B.
Cross-Regulation of C/EBP
α
and PPAR
γ
Controls the Transcriptional Pathway of Adipogenesis and Insulin
Sensitivity. Mol. Cell 1999,3, 151–158. [CrossRef]
Nutrients 2020,12, 1858 12 of 12
37.
Tang, Q.; Lane, M.D. Adipogenesis: From Stem Cell to Adipocyte. Annu. Rev. Biochem.
2012
,81, 715–736.
[CrossRef]
38.
Ji, S.; Doumit, M.E.; Hill, R.A. Regulation of Adipogenesis and Key Adipogenic Gene Expression by 1,
25-Dihydroxyvitamin D in 3T3-L1 Cells. PLoS ONE 2015,10, e0126142. [CrossRef]
39.
Engin, A. Fat Cell and Fatty Acid Turnover in Obesity; Springer Science and Business Media: Berlin, Germany,
2017; Volume 960, pp. 135–160.
40.
Rosen, E.D.; Hsu, C.-H.; Wang, X.; Sakai, S.; Freeman, M.W.; Gonzalez, F.J.; Spiegelman, B.M. C/EBPalpha
induces adipogenesis through PPARgamma: A unified pathway. Genes Dev. 2002,16, 22–26. [CrossRef]
41.
Yahagi, N.; Shimano, H.; Hasty, A.H.; Amemiya-Kudo, M.; Okazaki, H.; Tamura, Y.; Iizuka, Y.; Shionoiri, F.;
Ohashi, K.; Osuga, J.-I.; et al. A crucial role of sterol regulatory element-binding protein-1 in the regulation of
lipogenic gene expression by polyunsaturated fatty acids. J. Biol. Chem.
1999
,274, 35840–35844. [CrossRef]
42.
Viollet, B.; Andreelli, F. AMP-Activated Protein Kinase and Metabolic Control. Handb. Exp. Pharmacol.
2011
,
203, 303–330. [CrossRef]
43.
O’Neill, H.M.; Holloway, G.P.; Steinberg, G.R. AMPK regulation of fatty acid metabolism and mitochondrial
biogenesis: Implications for obesity. Mol. Cell. Endocrinol. 2013,366, 135–151. [CrossRef] [PubMed]
44.
Habinowski, S.A.; Witters, L.A. The Effects of AICAR on Adipocyte Differentiation of 3T3-L1 Cells.
Biochem. Biophys. Res. Commun. 2001,286, 852–856. [CrossRef] [PubMed]
45.
Angin, Y.; Beauloye, C.; Horman, S.; Bertrand, L. Regulation of Carbohydrate Metabolism, Lipid Metabolism,
and Protein Metabolism by AMPK. Exp. Suppl. 2016,107, 23–43. [CrossRef] [PubMed]
46.
Michan, S.; Sinclair, D.A. Sirtuins in mammals: Insights into their biological function. Biochem. J.
2007
,404,
1–13. [CrossRef]
47.
Fullerton, M.D.; Steinberg, G.R. SIRT1 takes a backseat to AMPK in the regulation of insulin sensitivity by
resveratrol. Diabetes 2010,59, 551–553. [CrossRef]
48.
Banks, A.S.; Kon, N.; Knight, C.; Matsumoto, M.; Gutierrez-Juarez, R.; Rossetti, L.; Gu, W.; Accili, M. SirT1
Gain of Function Increases Energy Efficiency and Prevents Diabetes in Mice. Cell Metab.
2008
,8, 333–341.
[CrossRef]
49.
Ducharme, N.A.; Bickel, P.E. Minireview: Lipid Droplets in Lipogenesis and Lipolysis. Endocrinology
2008
,
149, 942–949. [CrossRef]
50.
McGarry, J.D.; Brown, N.F. The Mitochondrial Carnitine Palmitoyltransferase System—From Concept to
Molecular Analysis. Eur. J. Biochem. 1997,244, 1–14. [CrossRef]
51.
Szkudelski, T.; Szkudelska, K. Effects of AMPK activation on lipolysis in primary rat adipocytes: Studies at
different glucose concentrations. Arch. Physiol. Biochem. 2016,123, 1–7. [CrossRef]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Available via license: CC BY 4.0
Content may be subject to copyright.
