Effect of Gymnema sylvestre on Insulin Receptor (IR) and Proglucagon Gene Expression in Streptozotocin Induced Diabetic Rats

Full text

Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020 S277
Original Arcle
www.ijper.org
Effect of
Gymnema sylvestre
on Insulin Receptor (IR)
and Proglucagon Gene Expression in Streptozotocin
Induced Diabetic Rats
Eswar Kumar Kilari*, Swathi Putta, Kotaiah Silakabattini
Pharmacology Division, A.U. College of Pharmaceutical Sciences, Andhra University, Visakhapatnam, Andhra Pradesh, INDIA.
ABSTRACT
Aim: To study the expression of Insulin Receptor (IR) in pancreas and proglucagon in
the ileum homogenate with the hydroalcoholic extract of
Gymnema sylvestre
(HAGS)
in streptozotocin induced diabetic rats. Materials and Methods: The HAGS was
administered once daily at 100, 200 and 400mg/kg bd.wt for 28 days to STZ induced
diabetic rats. Blood samples were collected at the end of 28 days. Serum blood
glucose, glycosylated hemoglobin (HbA1c), insulin levels; SOD (Superoxide Dismutase),
CAT (Catalase), MDA (Malondialdehyde) were estimated in the pancreatic and liver
homogenates and the expression of pancreatic Insulin Receptor (IR) and intestinal
proglucagon were estimated at the end of 28 days treatment period in all the treatment
groups. Results: The HAGS showed a signicant reduction in the serum levels of glucose
and HbA1c with elevated insulin levels in diabetic rats. The HAGS showed a signicant
reduction in MDA with elevated levels of SOD and CAT in the pancreatic and liver
homogenates. The expression levels of pancreatic Insulin Receptor (IR) and intestinal
proglucagon were increased signicantly with HAGS in diabetic rats. Conclusion: It is
concluded that HAGS has signicant antihyperglycemic activity through stimulation of
GLP-1 release and its enhanced proglucagon expression in ileum followed by Insulin
Receptor (IR) expression in pancreas. This may be due to the presence of active principles
like saponins, triterpenoids and anthraquinones in
Gymnema sylvestre
.
Key words: Diabetes,
Gymnema sylvestre,
Proglucagon, Insulin, GLP-1, Insulin Receptor.
DOI: 10.5530/ijper.54.2s.84
Correspondence:
Dr. Kilari Eswar Kumar
Associate Professor, A.U.
College of Pharmaceutical
Sciences, Andhra University,
Visakhapatnam-530003,
Andhra Pradesh, INDIA.
Phone: +91 9440632728
E-mail: ekilari@gmail.com
Submission Date: 17-07-2019;
Revision Date: 05-11-2019;
Accepted Date: 12-05-2020
INTRODUCTION
The diabetes is a chronic metabolic progressive
disease with hyperglycemia or insulin resis-
tance or both.1 People at the age between
20 to 79 years were prone to diabetes and
it was reported that 382 million diabetics
were reported among 219 countries in the
world and was estimated to increase upto
592 million in 2035.2 The uncontrolled
hyperglycemia that tends to the development
of microvascular and macrovascular
complications might be due to the oxidative
stress, polyol pathway, hexosamine pathway,
formation of advance glycation end products
and also due to incretin effect.3
The insulin secretion was stimulated by the
incretin hormones, which are produced
from the gastrointestinal tract in response
to nutrients entry.4 Glucose Insulinotropic
Peptide (GIP) and Glucagon like peptide-1
(GLP-1) are the two major gut peptides
belongs to the incretin family. The GLP-1
majorly is involved in the insulin stimulation5
and also inhibits the motility6 of gastroin-
testinal tract and appetite due to its highest
insulinotropic action. These actions of
GLP-1 were found to be disturbed in diabetic
patients.7 Hence, there is a need to identify
a potential neutraceutical compound to
target and modulate the actions of GLP-1
in the management of type 2 diabetes.
There are several GLP-1 analogues available
in the market such as exenatide and liraglu-
tide, but chronic use of these analogues may
produces several unwanted effects such as

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
S278 Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020
pancreatitis, renal failure, thyroid tumors and GI distur-
bances such as nausea, diarrhoea, etc.8
The usage of herbal drugs and herbal based prod-
ucts were found to be increased due to their action on
various biochemical pathways involved to alleviate the
diabetes and associated complications based on their
phytochemical constituents.9 Now a days, potential use
of herbal drugs was found to be beneted over the use
of allopathic medications due to their fewer side effects.
The leaves of Gurmar (Gymnema sylvestre), Asclepediaceae
popularly called as sugar destroyer. The leaves of gurmar
is a rich source of alkaloids, anthraquinone glycosides,
avanoids, gymnemic acids, tartaric acid, formic acid,
butyric acid, phytin, resin, Lupenol, stigmasterol10,11
and calcium oxalate.12 It poses a wide range of pharma-
cological properties as control over frequent urination,13
stomach stimulation, anti-diabetic,14,15 anti-ulcer, anti-
inammatory and antioxidant properties.16 Hence the
present work was undertaken with the objective of
studying the effect of Gymnema sylvestre for antidiabetic,
antioxidant, intestinal proglucagon and pancreatic insu-
lin receptor gene expression levels in STZ induced dia-
betic rats.
MATERIALS AND METHODS
Plant extract
The aqueous stem extract of Gymnema sylvestre was
obtained from Lalia Impex, Vijayawada.
Chemicals and drugs
2, 2-diphenyl-1-picrylhydrazyl (DPPH) was purchased
from Sigma Chemical Co. (St.Louis, MO, USA). TRIzol
reagent was purchased from GeNei, Bangalore, India.
Taq DNA polymerase was acquired from Invitrogen
(Carlsbad, CA, USA). Sitagliptin was purchased from
Himedia chemicals. The remaining kits and chemicals
used are of analytical grade.
In vitro
antioxidant activities
The HAGS extract tested for DPPH radical scavenging
potency according to the method Liu and Zaho, 2006.17
The hydrogen peroxide scavenging assay was esti-
mated using the method reported by Ruch et al. 1989.18
According to Winter bourn 1984,19 hydroxyl radical
scavenging activity was calculated. Scavenging activ-
ity of superoxide anion radical was determined by
the method of Beauchamp, 1971.20 nitric oxide scaveng-
ing activity was calculated according to the method of
Marcocci, 1994.21 reducing power of the extracts was
determined by the method of Oyaizu, 1986.22
Acute toxicity studies
The acute toxicity studies are conducted according
to the OCED 423 guidelines. Adult albino mice of
either sex were used and starved overnight. The HAGS
extracts was tested at 2000mg.kg b.wt.23 The behavioral,
neurological and autonomic prole, toxicity and
mortality were observed upto 72 hrs.
Animals
Adult male Wistar rats (180±10g) were purchased from
Mahaveer Enterprises, Hyderabad, India. All the animals
are maintained under the standard temperature
(23±2ºC), 50% of humidity and 12:12 hrs light and
dark cycles. The standard pellet diet with Carbohydrates
(48.8gm), Protein (21gm), Fat (3gm), Calcium (0.8gm),
Phosphorous (0.4gm), Fiber (5gm), Moisture (13g) and
Ash (8gm) was obtained from Rayon’s Biotech Pvt Ltd,
India and at ad libitum water. The animal house had CPC-
SEA (Regd. No.516/01/A/CPCSEA) approval and
the work was approved by the Institutional animal
ethics committee (IAEC-19/AU-Pharm/2017-18).
Experimental design
After acclimatization period all the animals are divided
into 6 groups and with 6 rats of each group. The animals
are under 16 hrs deprived before the experimentation.
The fasting blood glucose levels were estimated before
starting the experiment. Group 1 received vehicle,
group 2 a single dose of STZ (60 mg/kg b.wt) and
dissolved in citrate buffer, group 3 received 1.0 ml
of sitagliptin (5mg/kg), group 4 treated with HAGS
(100 mg/ kg), group 5 treated with HAGS (200 mg/ kg)
and group 6 treated HAGS (400 mg /kg) once daily
by oral administration in STZ induced diabetic rats.
Blood was collected using retro orbital plexus to
estimate serum biochemical parameters. All the animals
were anaesthetized using ether anesthesia prior to scari-
cation by cervical dislocation method at the end of 28
days.
Biochemical Estimation
At the end of 28 days the serum blood glucose levels,
HbA1c and insulin levels were estimated.24 The
pancreas was isolated and prepared 10% homogenate
using 10mM Tris hydrochloride buffer using tissue
homogenizer and centrifuged at 12000rpm for 15 min
at 0°C using cooling centrifuge (R-247, Refrigerated
Centrifuge, Mumbai, India). The tissue parameters such
as protein,25 lipid peroxidation (LPO),26 Superoxide dis-
mutase (SOD)27 and Catalase (CAT)28 were estimated in
all the treatment groups.
Total RNA extraction and reverse transcription
and polymerase chain reaction

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020 S279
Total RNA was isolated from intestinal samples using
TRIzol reagent (GeNei, Bangalore, India) according
to manufacture’s instructions. The RNA concentration
was measured at 260 nm with UV spectrophotometer
(UV-1800 UV-Vis Spectrophotometer, Japan). The
RNA pellet was dissolved in diethylpyrocarbonate
(DPEC) treated water. The cDNA was synthesized using
9μL of total RNA and reverse transcriptase purchased
from Invitrogen, Carlsbad, USA. The PCR studies
were conducted by using thermal cycler PCR Machine
(Model No.LT- 240) using Taq DNA polymerase
with the following thermal cycle proling: initial
denaturation at 95°C for 5 min followed by 30 cycles
(Denaturation at 95°C for 5 min, annealing at 60°C
for 30 Sec, denaturation at 72°C for 30 Sec and extension
at 72°C for 10 min).
The following primer sets were used to amplify
proglucagon and insulin gene expression. All the primers
were ordered from GeNei, Bangalore, India.
Proglucagon
Forward: PLG-F_R: GTAATGCTGGTACAAGGCAG
Reverse: PLG-R_R: TTGATGAAGTCTCTGGTG-
GCA
Insulin
Forward: INSULIN-F_384: CCCTAAGTGACCAGC-
TACA
Reverse: INSULIN-R_384: TTGCAGTAGTTCTC-
CAGTTG
RESULTS
The Effect of
HAGS
on
in vitro
anti-oxidant activity
The HAGS showed a signicant in vitro antioxidant
activity (Table 1). The various concentrations of HAGS
showed dependent radical scavenging activity. The IC50
values of HAGS for scavenging of DPPH, hydrogen
peroxide, nitric oxide, reducing power, phosphomo-
lybdinum and hydroxyl radical scavenging activity of
HAGS extract showed signicant scavenging activity
compared to the ascorbic acid.
The Effect of
HAGS
on blood glucose, HbA1c and
insulin
STZ induced diabetic rats showed signicant increase
in blood glucose and HbA1c levels when compared
with controls (Table 2). Whereas HAGS and sitagliptin
treated diabetic rats showed a signicant decrease in
blood glucose and HbA1c levels. In diabetic rats, insulin
levels were signicantly (p<0.05) decreased when
compared to normal rats. Whereas in HAGS treated
Table 1: Effect of HAGS on
in vitro
antioxidant
activity.
In vitro Antioxidant
Activity
IC50(µg)
Ascorbic acid HAGS
DPPH radical 22.65± 1.0 38.47±0.8
H2O2 radical 02.59± 0.9 02.68±1.3
Nitric Oxide radical 265.71± 1.9 495.4±0.5
Reducing Power 16.82± 0.8 07.39±0.8
Phosphomolybdenum 61.34± 0.5 112.3±1.0
Hydroxyl radical 301.32± 1.2 272.6±1.3
Values are expressed as mean±SEM; n=3
Table 2: Effect of HAGS of blood glucose, %HbA1c
and insulin levels in STZ induced diabetic rats.
Groups
Blood
Glucose
(mg/dL)
%HbA1c Insulin
(uIU/ml)
Normal 88.05±1.8* 2.89±0.10* 4.86±0.22*
Diabetic control 366.2±6.5 10.12±0.33 3.29±0.89
Standard 95.1±3.5* 3.55±0.23* 4.65±0.45*
HAGS(100mg/kg) 125.9±3.0* 7.23±0.22* 3.96±0.89*
HAGS(200mg/kg) 102.4±2.8* 5.31±0.11* 4.54±0.76*
HAGS(400mg/kg) 93.23±5.7* 3.77±0.18* 4.88±0.77*
P<0.05* signicance followed by two way ANOVA followed by Bonferroni’s post
test when compared with toxicant group.
diabetic rats, insulin levels were signicantly (p<0.05)
increased when compared to diabetic rats.
The Effect of
HAGS
on protein, Malionaldehyde
(MDA) and antioxidant enzyme levels in pancreas
and liver
Total protein levels were found to be decreased in
diabetic liver and pancreas whereas treatment with
HAGS showed increased levels of protein levels
signicantly at p<0.05 (Figure 1). Antioxidant enzymes
like SOD and catalase levels were signicantly (p<0.05)
decrease in both pancreas and liver of diabetic rats.
Furthermore, HAGS extract and Sitagliptin treatment
Figure 1: Effect of HAGS on protein levels in liver and
pancreas of STZ induced diabetic rats.
Values are expressed as mean±SEM;
n
=6

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
S280 Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020
elevated the levels of SOD, CAT when compared to
diabetic rats at p<0.05 (Figure 2, 3). The MDA contents
were signicantly (p<0.05) increased in both of the
pancreas and liver of diabetic rats and with HAGS
treatment showed a signicant reduction of MDA when
compared to control induced rats. However, HAGS and
Sitagliptin treated diabetic rats showed a signicant
(p<0.05) decline in MDA contents when compared to
the diabetic rats (Figure 4).
Figure 2: Effect of HAGS on SOD levels in liver and pancreas
of STZ induced diabetic rats.
Values are expressed as mean±SEM;
n
=6
Figure 3: Effect of HAGS on CAT levels in liver and pancreas
of STZ induced diabetic rats.
Values are expressed as mean±SEM;
n
=6
Figure 5: Effect of HAGS on insulin gene expression in
pancreas of STZ induced diabetic rats by using RT-PCR.
Values are expressed as mean±SEM;
n
=6
Figure 6: Effect of HAGS on percentage fold change of insulin
expression.
Values are expressed as mean±SEM;
n
=6
Figure 4: Effect of HAGS on MDA levels in liver and pancreas
of STZ induced diabetic rats.
Values are expressed as mean±SEM;
n
=6
The Effect of
HAGS
on intestinal proglucagon and
pancreatic insulin gene expression levels
The pancreatic insulin gene expression levels were
signicantly (p< 0.05) decreased in diabetic rats when
compared to control rats (Figure 5). However, in
HAGS and sitagliptin treated diabetic rats insulin gene
expression levels and expression fold change were sig-
nicantly (p< 0.05) increased when compared with
diabetic rats (Figure 6, Figure 7). Figure 8 showed the
Figure 7: Effect of HAGS on insulin gene expression fold
change in pancreas of STZ induced diabetic rats.
Values are expressed as mean±SEM;
n
=6

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020 S281
STZ induced diabetic rats showed a signicant (p<0.05)
decrease in intestinal proglucagon gene expression
levels in comparison to control rats, whereas, in HAGS
and sitagliptin treated diabetic rats, the proglucagon
gene expression levels and fold change were signicantly
increased (Figure 9, Figure 10) when compared with the
diabetic rats.
DISCUSSION
Free radicals are the major cause of oxidative stress.
The imbalance between the free radicals and antioxidant
defense system lead to the alteration of antioxidant
potential tend to the development of diabetes mellitus
and other chronic metabolic dysfunctions.29 Hyper-
glycemia itself also causes production of oxygen free
radicals and their by the end products. The HAGS
extract possesses signicant antioxidant activity in var-
ious in vitro models, it may be due to the electron or
hydrogen donating capability of HAGS and they can
stabilize or terminate the free radical chain reactions.
In the present study HAGS extract shows signicant
in vitro antioxidant activity against hydroxyl, hydrogen
peroxide, nitric oxide and DPPH radicals compared
to ascorbic acid. The free radical induced diabetes was
achieved by using Streptozotocin due to the cytotoxic
effect on pancreatic β-cells.30 The STZ alkylates the
pancreatic DNA; thereby it produces reduced insu-
lin levels, altered glucose metabolism and utilization.31
The STZ also causes stimulation of nitric oxide free
radicals and initiates DNA strand break of β cells of
pancreas.32 In STZ induced diabetic rats were elevated
blood glucose levels but in the treatment with HAGS
there was a signicant reduction in elevated blood
glucose levels. The glucose upon irreversible conden-
sation with the hemoglobin at the N terminal chain
tends to the formation of Glycosylated hemoglobin
(HbA1c).33 The levels of HbA1c were found to be
elevated in STZ induced rats and reverted to normal
range after treatment with HAGS extract. It indicates
that protective activity of HAGS from hyperglycemia
might be reason to the improvement in insulin secretion.
In the present study in STZ induced diabetic rats, MDA
content was increased. Treatment with HAGS extract
for 28 days signicantly reduced the pancreatic MDA
content indicating a protective role of extract; this may
be attributed to the presence of phytochemicals such as
alkaloids, glycosides and steroids. Many of antioxidant
principles reported to have inhibitory action on MDA
levels.34 Antioxidant defense system provides the body
to ght against free radicals. The SOD acts by reducing
the conversion of superoxide into hydrogen peroxide.35
In diabetic condition, the levels of SOD are found to
be diminished and could result to excessive formation
of H2O2. The SOD was found to be glycosylated during
diabetes.36 The CAT is an enzyme playing a role in
elimination of H2O2.
37 Both the SOD and CAT were
found to be decreased in STZ induced diabetic rats.
Treatment with HAGS showed a signicant elevation
of SOD and CAT that might be due to its antioxidant
Figure 8: Effect of HAGS on Proglucagon gene expression in
ileum of STZ induced diabetic rats by using RT-PCR.
Values are expressed as mean±SEM;
n
=6
Figure 9: Effect of HAGS on percentage fold change of
proglucagon expression.
Values are expressed as mean±SEM;
n
=6
Figure 10: Effect of HAGS on proglucagon gene expression
fold change in ileum of STZ induced diabetic rats.
Values are expressed as mean±SEM;
n
=6

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
S282 Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020
activity as they have hydroxyl radical and H2O2
scavenging activity as discussed. The HAGS extract
treated diabetic rats pancreatic antioxidant enzymes
were signicantly increased which could be attributable
to strong anti-oxidative properties.38
The prohormone convertase 2 (PC2) enzymes breaks-
down the proglucagon into glucagon in pancreatic α
cells and the prohormone convertase 1 are involved in
the conversion of proglucagon into GLP-1 in intestinal
L- cells. Hence, the present study aimed to identify the
mechanism of proglucagon in stimulating the GLP-1
in ileum and its effect on insulin secretion and insulin
expression in pancreas as reported earlier by Whalley
NM, 2011.39 As mentioned above, STZ induced diabetes
resulted to enhanced generation of GLP-1 with
Gymnema sylvestre treatment. The activity might be due to
the presence of gymnemic acid present in the HAGS as
reported earlier by Nakamura et al. 199940 to increased
insulin secretion, increased utilization of glucose and
inhibition of glucose absorption from intestine.
There was a signicant reduction of proglucagon
expression in STZ induced diabetic rats when compared
with the normal control rats. The treatment with HAGS
was found to increase the expression of proglucagon
in intestinal homogenate in diabetic rats. This might be
the key mechanism in increased release of insulin from
pancreatic β cells. Further the HAGS also found to
increase the expression of Insulin Receptor (IR) gene
in pancreatic β cells, which might be responsible for
antihyperglycemic activity. The present study proves the
herbal drug induced antihyperglycemic activity.
CONCLUSION
The signicant antihyperglycemic activity through
its activity on stimulation of GLP-1 release and its
enhanced proglucagon expression in ileum followed by
insulin receptor (IR) expression in pancreas. This may
be due the presence of active principles like saponins,
triterpenoids and anthraquinones in Gymnema sylvestre.
ACKNOWLEDGEMENT
The authors acknowledge the nancial support from
AICTE-RPS New Delhi [Grant No. Ref. No: 1. F.No:
A.V (3)/ AICTE-RPS/ 2014].
CONFLICT OF INTEREST
Authors do not have any conict of interest.
ABBREVIATIONS
IR: Insulin Receptor; GLP-1: Glucagon like peptide-1;
GIP: Glucose Insulinotropic Peptide; STZ: Strepto-
zotocin; SOD: Superoxide dismutase; CAT: Catalase;
TBA: Thiobarbituric Acid; NO: Nitric oxide; PC2:
Prohormone Convertase -2.
REFERENCES
1. Putta S, Yarla NS, Kumar KE, Lakkappa DB, Kamal MA, Scotti L, et al.
Preventive and Therapeutic Potentials of Anthocyanins in Diabetes and
Associated Complications. Curr Med Chem. 2018;25(39):5347-71.
2. Guariguata L, Whiting DR, Hambleton I, Beagley J, Linnenkamp U, Shaw JE,
et al. Global estimates of diabetes prevalence for 2013 and projections for
2035. Diabetes Res Clin Pract. 2014;103(2):137-49.
3. Marcovecchio ML, Lucantoni M, Chiarelli F. Role of chronic and acute
hyperglycemia in the development of diabetes complications. Diabetes
Technology and Therapeutics. 2011;13(3):389-94.
4. MacDonald PE, El-Kholy W, Riedel MJ, Salapatek AM, Light PE, Wheeler
MB. The multiple actions of GLP-1 on the process of glucose-stimulated
insulin secretion. Diabetes. 2002;51(Suppl 3):S434-42.
5. Orskov C, Holst JJ, Nielsen OV. Effect of truncated glucagon-like peptide-1
[proglucagon-(78-107) amide] on endocrine secretion from pig pancreas,
antrum and nonantral stomach. Endocrinology. 1988;123(4):2009-13.
6. Wettergren A, Schjoldager B, Mortensen PE, Myhre J, Christiansen J,
Holst JJ. Truncated GLP-1 (proglucagon 78-107-amide) inhibits gastric
and pancreatic functions in man. Digestive Diseases and Sciences.
1993;38(4):665-73.
7. Layer P, Holst JJ, Grandt D, Goebell H. Ileal release of glucagon-like
peptide-1 (GLP-1). Association with inhibition of gastric acid secretion in
humans. Digestive Diseases and Sciences. 1995;40(5):1074-82.
8. Gupta V. Glucagon-like peptide-1 analogues: An overview. Indian J
Endocrinol Metab. 2013;17(3):413-21.
9. Kar A, Choudhary BK, Bandyopadhyay NG. Comparative evaluation of
hypoglycaemic activity of some Indian medicinal plants in alloxan diabetic
rats. J Ethnopharmacol. 2003;84(1):105-8.
10. Kanetkar P, Singhal R, Kamat M. Gymnema sylvestre: A Memoir. J Clin
Biochem Nutr. 2007;41(2):77-81.
11. Yen DTH, Toan NV, Tai BH, Yen PH, Nhiem NX, Kiem V, et al. Oleananesaponins
from Gymnema sylvestre. Phytochemistry. 2019;57(1):39-45.
12. Sinsheimer JE, Subba RG, McIlhenny HM. Constituents from Gymnema
sylvestre Leaves V: Isolation and Preliminary Characterization of the
Gymnemic Acids. Journal of Pharmaceutical Sciences. 1970;59(5):622-8.
13. Evans WC. Trease and evans’ pharmacognosy E-book: Elsevier Health
Sciences. Amsterdam, Netherlands. 2009.
14. Daisy P, Eliza J, Farook KA. A novel dihydroxy gymnemic triacetate isolated
from Gymnema sylvestre possessing normoglycemic and hypolipidemic
activity on STZ-induced diabetic rats. Journal of Ethnopharmacology.
2009;126(2):339-44.
15. Ramkumar KM, Ponmanickam P, Velayuthaprabhu S, Archunan G, Rajaguru
PJF, Toxicology C. Protective effect of Gymnema montanum against renal
damage in experimental diabetic rats. Food Chem Toxicol. 2009;47(10):2516-21.
16. Koch TR, Yuan LX, Stryker SJ, Ratliff P, Telford GL, Opara EC, et al. Total
antioxidant capacity of colon in patients with chronic ulcerative colitis. Dig Dis
Sci. 2000;45(9):1814-9.
17. Mouming LX, Industries F. Antioxidant Activities and Functional Composition
Content of Selected Phyllanthus emblica L. Fruits Juice [J]. Food and
Fermentation Industries. 2006;5.
18. Ruch RJ, Cheng SJ, Klaunig JEJC. Prevention of cytotoxicity and inhibition of
intercellular communication by antioxidant catechins isolated from Chinese
green tea. Carcinogenesis.1989;10(6):1003-8.
19. Winterbourn CC, Button HC. Hydroxyl radical production from hydrogen
peroxide and enzymatically generated paraquat radicals: Catalytic
requirements and oxygen dependence. Archives of Biochemistry and
Biophysics. 1984;235(1):116-26.

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020 S283
20. Beauchamp C, Fridovich I. Superoxide dismutase: Improved assays and an
assay applicable to acrylamide gels. Analytical Biochemistry. 1971;44(1):276-87.
21. Marcocci L, Maguire JJ, Droylefaix MT, Packer L. The nitric oxide-scavenging
properties of Ginkgo biloba extract EGb 761. Biochemical and Biophysical
Research Communications. 1994;201(2):748-55.
22. Oyaizu M. Studies on Products of Browning Reaction Antioxidative Activities
of Products of Browning Reaction Prepared from Glucosamine. The
Japanese Journal of Nutrition and Dietetics. 1986;44(6):307-15.
23. Patel C, Dadhaniya P, Hingorani L, Soni MG. Safety assessment of
pomegranate fruit extract: Acute and Subchronic Toxicity Studies. Food
and Chemical Toxicology: An International Journal Published for the British
Industrial Biological Research Association. 2008;46(8):2728-35.
24. Trinder P. Determination of glucose in blood using glucose oxidase with an
alternative oxygen acceptor. Annals of Clinical Biochemistry. 1969;6(1):24-7.
25. Lowry OH, Rosebrough NJ, Farr AL, Randall RJJJobc. Protein measurement
with the Folin phenol reagent. Journal of Biological Chemistry. 1951;193:265-75.
26. Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by
thiobarbituric acid reaction. Analytical Biochemistry.1979;95(2):351-8.
27. Misra HP, Fridovich I. The role of superoxide anion in the autoxidation of
epinephrine and a simple assay for superoxide dismutase. Journal of
Biological Chemistry. 1972;247(10):3170-5.
28. Maehly A, Chance B. Catalases and peroxidases. Methods Biochem Anal.
1954;1:357-424.
29. Maritim AC, Sanders A, Watkins Iii JB. Diabetes, oxidative stress and
antioxidants: A review. Journal of Biochemical and Molecular Toxicology.
2003;17(1):24-38.
30. Kumar GPS, Arulselvan P, Kumar DS, Subramanian SP. Anti-diabetic activity
of fruits of Terminalia chebula on streptozotocin induced diabetic rats. Journal
of Health Science. 2006;52(3):283-91.
31. Arumugam S, Kavimani S, Kadalmani B, Ahmed ABA, Akbarsha MA, Rao
MV. Antidiabetic activity of leaf and callus extracts of Aegle marmelos in
rabbit. Science Asia. 2015.
32. Rodrı́guez T, Alvarez B, Busquets S, Carbó N, López-Soriano FJ,
Argilés JMJB, et al. The increased skeletal muscle protein turnover of
the streptozotozin diabetic rat is associated with high concentrations
of branched-chain amino acids. Biochemical and Molecular Medicine.
1997;61(1):87-94.
33. O’Hea EL, Moon S, Grothe KB, Boudreaux E, Bodenlos JS, Wallston K, et al.
The interaction of locus of control, self-efcacy and outcome expectancy in
relation to HbA1c in medically underserved individuals with type 2 diabetes.
Journal of Behavioral Medicine. 2009;32(1):106-17.
34. Bagri P, Ali M, Aeri V, Bhowmik M, Sultana S. Antidiabetic effect of Punica
granatum owers: Effect on hyperlipidemia, pancreatic cells lipid peroxidation
and antioxidant enzymes in experimental diabetes. Food and Chemical
Toxicology. 2009;47(1):50-4.
35. Blokhina O, Virolainen E, Fagerstedt KVJAob. Antioxidants, oxidative
damage and oxygen deprivation stress: a review. Annals of Botany.
2003;91(2):179-94.
36. Ravi K, Ramachandran B, Subramanian S. Protective effect of Eugenia
jambolana seed kernel on tissue antioxidants in streptozotocin-induced
diabetic rats. Biological and Pharmaceutical Bulletin. 2004;27(8):1212-7.
37. Kilari EK, Putta S. Biological and Phytopharmacological Descriptions of Litchi
Chinensis. Pharmacogn Rev. 2016;10(19):60-5.
38. Althunibat OY, Al-Mustafa AH, Tarawneh K, Khleifat KM, Ridzwan BH,
Qaralleh HN. Protective role of Punica granatum L. peel extract against
oxidative damage in experimental diabetic rats. Process Biochemistry.
2010;45(4):581-5.
39. Whalley NM, Pritchard LE, Smith DM, White A. Processing of proglucagon
to GLP-1 in pancreatic alpha-cells: Is this a paracrine mechanism enabling
GLP-1 to act on beta-cells?. The Journal of Endocrinology. 2011;211(1):99-106.
40. Nakamura Y, Tsumura Y, Tonogai Y, Shibata T. Fecal steroid excretion is
increased in rats by oral administration of gymnemic acids contained in
Gymnema sylvestre leaves. J Nutr. 1999;129(6):1214-22.
SUMMARY
Herbal medicines may be used as an alternative therapy in this condition as they are effectively used for the
treatment of diabetes in Ayurveda and are generally well tolerated. Gymnema sylvestre is recommended for
diabetes and several chronic diseases. The aim of the present study was to determine the effect of hydro
alcoholic extract of Gymnema sylvestre (HAGS) on antihyperglycemia, in vivo antioxidant, intestinal proglucagon
and pancreatic insulin gene expression levels in streptozotocin induced diabetic rats. The synthesis and
secretion of proglucagon-derived peptides are regulated in a tissue-specic manner in pancreas and intestine.
Treated groups divided into 6 groups serves as control (group 1), diabetic control (group 2), sitagliptin
(group 3), HAGS100, 200 and 400 mg/kg body weight as group 4,5 and 6 respectively were administered
orally once a day for 28 days. A signicant increase in blood glucose and glycosylated hemoglobin (HbA1c)
with decrease serum insulin was observed in diabetic rats. Treatment with HAGS reduced the elevated lev-
els of blood glucose and HbA1c with signicant increase in insulin in comparison with diabetic rats. At the
end of the study period rats were sacrice and tissue samples were used for further investigations. A signicant
reduction was observed in malondialdehyde content with elevated levels of superoxide dismutase and catalase
in the pancreas and liver homogenates of diabetic rats with HAGS treatment. Pancreatic insulin and intestinal
proglucagon expression levels were decreased in diabetic rats. In HAGS treated diabetic rats, the pancreatic
insulin and intestinal proglucagon levels were elevated to normal levels. This indicates HAGS has protective
effects on insulin and proglucagon, which is further responsible for elevated levels of GLP-1 activity. It
concludes that HAGS has signicant antioxidant, antihyperglycemic activity and protective activity on GLP-1.
This may be due the presence of Gymnema saponins and gymnemic acids in Gymnema sylvestre.

Kilari, et al.: In situ Insulin Receptor and Proglucagon Gene Expression by Gymnema sylvestre
S284 Indian Journal of Pharmaceutical Education and Research | Vol 54 | Issue 2 (Suppl) | Apr-Jun, 2020
PICTORIAL ABSTRACT
Cite this article: Kilari EK, Putta S, Silakabattini K. Effect of
Gymnema sylvestre
on Insulin Receptor (IR) and
Proglucagon Gene Expression in Streptozotocin Induced Diabetic Rats. Indian J of Pharmaceutical Education and
Research. 2020;54(2s):s277-s284.