ArticlePublisher preview available

Functional characterization of a C‐terminal splice variant of the human melanocortin 1 receptor

Wiley
Experimental Dermatology
Authors:
Idoya Martínez‐Vicente
Idoya Martínez‐Vicente
Idoya Martínez‐Vicente
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Marta Abrisqueta at University of Murcia
Marta Abrisqueta
Cecilia Herraiz
Cecilia Herraiz
Cecilia Herraiz
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Celia Jiménez‐Cervantes
Celia Jiménez‐Cervantes
Celia Jiménez‐Cervantes
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Show all 6 authorsHide
Read publisher preview
Download citation
To read the full-text of this research, you can request a copy directly from the authors.

Abstract and Figures

The melanocortin 1 receptor (MC1R) is a major determinant of skin pigmentation and sensitivity to ultraviolet radiation. When stimulated by its natural agonists, it promotes the switch from synthesis of poorly photoprotective and lightly colored pheomelanins to production of photoprotective and darker eumelanins. In addition to an unusually high number of single nucleotide polymorphisms, the MC1R is expressed as 3 protein‐coding splice variants. Two transcripts display different 5’ untranslated sequences but yield the same open reading frame corresponding to the canonical 317 aminoacids protein (termed MC1R). An alternative transcript named MC1R‐203 encodes for a 382 amino acids protein of poorly characterized functional properties containing an additional 65 aminoacids C‐terminal extension. Given the known roles of the MC1R C‐terminal extension in forward trafficking, coupling to intracellular effectors and desensitization, the different structure of this domain in MC1R and MC1R‐203 may lead to significant functional alteration(s). We have assessed the functional properties of MC1R‐203, as compared with the canonical MC1R form. We show that unstimulated HBL human melanoma cells express the MC1R‐203 spliceoform, although at much lower levels than canonical MC1R. When expressed in heterologous HEK293 cells, the presence of the 65 aminoacid‐long cytosolic extension immediately after Cys316 in MC1R‐203 did not impair the intracellular stability of the protein, but it interfered with functional coupling to the cAMP cascade and with the ubiquitylation of ARRB2 associated with MC1R desensitization. Conversely, MC1R‐203 retained full capacity to activate ERK1/2 signaling. Accordingly, MC1R‐203 displays biased signaling when expressed in HEK293 cells.
Structure and expression of MC1R alternative splicing products. A, Structure of the MC1R gene splice variants. Exons are depicted in coloured boxes (empty for UTRs, filled for coding sequences), and the number of nucleotides in the corresponding ORFs is shown below. The position of PCR primers is shown by arrows above (forward primers) or below (reverse primers) the graph. B, Amino acid sequence and predicted organization of structural domains in the MC1R and MC1R‐203 proteins. The 7 transmembrane domains, 3 intracellular loops and most of the canonical MC1R C‐terminal cytosolic extension are shared by both proteins. Amino acid residues known to be associated with frequent RHC polymorphisms are highlighted (red circles for high penetrance alleles, and orange circles for low penetrance variants). The C‐terminal Trp317 in MC1R is shown in dark blue and the extra 65 amino acids in MC1R‐203 in green. C, Relative expression of MC1R and MC1R‐203 mRNA in HBL human melanoma cells. Total RNA from HBL cells was reverse‐transcribed and amplified by PCR with common forward (5’‐GATCGAATTCGCCGCCATGGCTGTGCAGGGAT) and reverse primers (5’‐GATCCTCGAGCTAGGGGGGCTCCTGCAAACCTG). PCR conditions were as follows: initial denaturation at 95°C for 2 min, 30 cycles of denaturation (95°C, 1 min), annealing (68°C, 1 min) and extension (72°C, 2 min) and one final 10 min extension at 72°C. Isoform‐specific amplicons were identified by their size (1556 bp for MC1R and 1175 bp for MC1R‐203, as analysed by agarose gel electrophoresis). The GAPDH gene was employed as control (forward, 5’‐ACCACAGTCCATGCCATCAC; reverse 5’‐TCCACCACCCTGTTGCTGTA). D, Electrophoretic pattern of MC1R splice isoforms. HEK293T cells were transfected to express Flag epitope‐tagged MC1R isoforms and detergent‐solubilized. Aliquots with comparable total protein contents were analysed by Western blot probed with an anti‐Flag antibody. ERK2 was used as loading control. The position of de novo bands is shown
Structure and expression of MC1R alternative splicing products. A, Structure of the MC1R gene splice variants. Exons are depicted in coloured boxes (empty for UTRs, filled for coding sequences), and the number of nucleotides in the corresponding ORFs is shown below. The position of PCR primers is shown by arrows above (forward primers) or below (reverse primers) the graph. B, Amino acid sequence and predicted organization of structural domains in the MC1R and MC1R‐203 proteins. The 7 transmembrane domains, 3 intracellular loops and most of the canonical MC1R C‐terminal cytosolic extension are shared by both proteins. Amino acid residues known to be associated with frequent RHC polymorphisms are highlighted (red circles for high penetrance alleles, and orange circles for low penetrance variants). The C‐terminal Trp317 in MC1R is shown in dark blue and the extra 65 amino acids in MC1R‐203 in green. C, Relative expression of MC1R and MC1R‐203 mRNA in HBL human melanoma cells. Total RNA from HBL cells was reverse‐transcribed and amplified by PCR with common forward (5’‐GATCGAATTCGCCGCCATGGCTGTGCAGGGAT) and reverse primers (5’‐GATCCTCGAGCTAGGGGGGCTCCTGCAAACCTG). PCR conditions were as follows: initial denaturation at 95°C for 2 min, 30 cycles of denaturation (95°C, 1 min), annealing (68°C, 1 min) and extension (72°C, 2 min) and one final 10 min extension at 72°C. Isoform‐specific amplicons were identified by their size (1556 bp for MC1R and 1175 bp for MC1R‐203, as analysed by agarose gel electrophoresis). The GAPDH gene was employed as control (forward, 5’‐ACCACAGTCCATGCCATCAC; reverse 5’‐TCCACCACCCTGTTGCTGTA). D, Electrophoretic pattern of MC1R splice isoforms. HEK293T cells were transfected to express Flag epitope‐tagged MC1R isoforms and detergent‐solubilized. Aliquots with comparable total protein contents were analysed by Western blot probed with an anti‐Flag antibody. ERK2 was used as loading control. The position of de novo bands is shown
… 
Functional analysis of MC1R alternative splicing variants. A, Activation of cAMP production downstream of MC1R splice variants. HEK293T cells were transfected to express MC1R or MC1R‐203, stimulated with NDP‐MSH (10⁻⁷ mol/L, 30 or 180 min) and lysed in hot HCl. cAMP was determined with an enzyme immunoassay kit (R&D Systems) as per instructions. Results (mean ± SEM, n = 2, quadruplicates in each independent experiment) are normalized for protein contents. B, Activation of ERK1/2. Cells were co‐transfected with either MC1R or MC1R‐203 in combination with cKIT as reported,[9] stimulated with NDP‐MSH (10⁻⁷ mol/L) and detergent‐solubilized after times ranging from 2 to 10 min. Comparable amounts of total protein were analysed by Western blot probed for active ERKs with a phosphospecific antibody recognizing the active phosphorylated forms of the kinases. A representative blot out of 4 independent experiments with similar results is shown. C, MC1R‐dependent ubiquitylation of ARRB2. HEK293T cells were transfected with the individual MC1R spliceoforms, ARRB2 and MGRN1, alone or in suitable combinations, as shown on top of each lane. Detergent‐solubilized extracts were analysed by Western blot probed for ARRB2 to detect ubiquitylated (high molecular weight) forms, and for MGRN1 or MC1R as controls. A representative blot out of two independent experiments is shown
Functional analysis of MC1R alternative splicing variants. A, Activation of cAMP production downstream of MC1R splice variants. HEK293T cells were transfected to express MC1R or MC1R‐203, stimulated with NDP‐MSH (10⁻⁷ mol/L, 30 or 180 min) and lysed in hot HCl. cAMP was determined with an enzyme immunoassay kit (R&D Systems) as per instructions. Results (mean ± SEM, n = 2, quadruplicates in each independent experiment) are normalized for protein contents. B, Activation of ERK1/2. Cells were co‐transfected with either MC1R or MC1R‐203 in combination with cKIT as reported,[9] stimulated with NDP‐MSH (10⁻⁷ mol/L) and detergent‐solubilized after times ranging from 2 to 10 min. Comparable amounts of total protein were analysed by Western blot probed for active ERKs with a phosphospecific antibody recognizing the active phosphorylated forms of the kinases. A representative blot out of 4 independent experiments with similar results is shown. C, MC1R‐dependent ubiquitylation of ARRB2. HEK293T cells were transfected with the individual MC1R spliceoforms, ARRB2 and MGRN1, alone or in suitable combinations, as shown on top of each lane. Detergent‐solubilized extracts were analysed by Western blot probed for ARRB2 to detect ubiquitylated (high molecular weight) forms, and for MGRN1 or MC1R as controls. A representative blot out of two independent experiments is shown
… 
Figures - available from: Experimental Dermatology
This content is subject to copyright. Terms and conditions apply.
A preview of this full-text is provided by Wiley.
Learn more
Content available from Experimental Dermatology 
This content is subject to copyright. Terms and conditions apply.
610  
|
  Experimental Dermatology. 2020;29:610–615.wileyonlinelibrary.com/journal/exd
1 | BACKGROUND
The melanocortin 1 receptor (MC1R) is a major determinant of skin
pigmentation and sensitivity to ultraviolet radiation (UVR).[1] When
stimulated by its natural agonists, the melanocortin peptides αMSH
and ACTH, it promotes the switch from synthesis of poorly photo-
protective and lightly coloured pheomelanins to production of pho-
toprotective and darker eumelanins. Several common variants of the
Received: 16 March 2020 
|
  Revised: 10 May 2020 
|
  Accepted: 24 May 2020
DOI : 10.1111/exd .14118
CONCISE COMMUNICATION
Functional characterization of a C-terminal splice variant of the
human melanocortin 1 receptor
Idoya Martínez-Vicente | Marta Abrisqueta  | Cecilia Herraiz  | Celia Jiménez-
Cervantes  | Jose Carlos García-Borrón  | Concepción Olivares
© 2020 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
Department of Biochemistry, Molecular
Biolog y and Imm unolog y, School of
Medicine, Unive rsity of Murcia an d Instituto
Murciano de Investigacion Biosanitaria
(IMIB), Murcia, Spain
Correspondence
Department of Biochemistry, Molecular
Biolog y and Imm unolog y, School of
Medicine, Unive rsity of Murcia an d Instituto
Murciano de Investigacion Biosanitaria
(IMIB), L AIB Building, Room 1.52, Campus
de Ciencias de la Salud, Ca rreter a
Buenavista s/n, 30120 El Palmar, Murcia,
Spain.
Email: gborron@um.es
Funding information
Fundación Senec a, CARM, Grant/Award
Number : 19875/GERM/15; Ministerio de
Economía y Competitividad, Grant/Award
Number: SAF2018_RTI2018-094929-B-I00
Abstract
The melanocortin 1 receptor (MC1R) is a major determinant of skin pigmentation
and sensitivity to ultraviolet radiation. When stimulated by its natural agonists, it
promotes the switch from synthesis of poorly photoprotective and lightly colored
pheomelanins to production of photoprotective and darker eumelanins. In addition
to an unusually high number of single nucleotide polymorphisms, the MC1R is ex-
pressed as 3 protein-coding splice variants. Two transcripts display different 5’ un-
translated sequences but yield the same open reading frame corresponding to the
canonical 317 aminoacids protein (termed MC1R). An alternative transcript named
MC1R-203 encodes for a 382 amino acids protein of poorly characterized functional
properties containing an additional 65 aminoacids C-terminal extension. Given the
known roles of the MC1R C-terminal extension in forward trafficking, coupling to
intracellular effectors and desensitization, the different structure of this domain in
MC1R and MC1R-203 may lead to significant functional alteration(s). We have as-
sessed the functional proper ties of MC1R-203, as compared with the canonical MC1R
form. We show that unstimulated HBL human melanoma cells express the MC1R-203
spliceoform, although at much lower levels than canonical MC1R. When expressed in
heterologous HEK293 cells, the presence of the 65 aminoacid-long cytosolic exten-
sion immediately after Cys316 in MC1R-203 did not impair the intracellular stability
of the protein, but it interfered with functional coupling to the cAMP cascade and
with the ubiquitylation of ARRB2 associated with MC1R desensitization. Conversely,
MC1R-203 retained full capacity to activate ERK1/2 signaling. Accordingly, MC1R-
203 displays biased signaling when expressed in HEK293 cells.
KEY WORDS
desensitization, functional coupling, Melanocor tin 1 receptor, melanoma, splice variants
... the MC1R-203 spliceoform in heterologous HEK293 cells revealed the disturbance with functional coupling to the cAMP cascade and with the ubiquitylation of ARRB2 associated with MC1R desensitization, and contrariwise, the activation ERK1/2 signalling. 105 Martínez-Vicente et al. 105 concluded that MC1R-203 demonstrates biased signalling when expressed in HEK293 cells. PPI plays a significant role in cellular functions and biological processes. ...
... the MC1R-203 spliceoform in heterologous HEK293 cells revealed the disturbance with functional coupling to the cAMP cascade and with the ubiquitylation of ARRB2 associated with MC1R desensitization, and contrariwise, the activation ERK1/2 signalling. 105 Martínez-Vicente et al. 105 concluded that MC1R-203 demonstrates biased signalling when expressed in HEK293 cells. PPI plays a significant role in cellular functions and biological processes. ...
Polymorphisms in corticotrophin‐releasing hormone–proopiomalanocortin (CRH–POMC) system genes: Neuroimmune contributions to psoriasis disease
Article
Full-text available
Background Skin is a target organ and source of the corticotropin‐releasing hormone–proopiomelanocortin (CRH‐POMC) system, operating as a coordinator and executor of responses to stress. Environmental stress exacerbates and triggers inflammatory skin diseases through modifying the cellular components of the immune system supporting the importance of CRH‐POMC system in the pathogenesis of psoriasis. The aim of this study was to analyse the association of CRH‐POMC polymorphisms with psoriasis and evaluate transcript expression of lesional psoriatic and normal skin in RNA‐seq data. Methods Samples of 104 patients with psoriasis and 174 healthy controls were genotyped for 42 single nucleotide polymorphisms (SNPs) of CRH‐POMC using Applied Biosystems SNPlex™ method. The transcript quantification was performed using Salmon software v1.3.0. Results This study demonstrated the associations between melanocortin 1 receptor (MC1R) polymorphisms rs2228479, rs3212369, dopachrome tautomerase (DCT) polymorphisms rs7987802, rs2031526, rs9524501 and psoriasis in the Tatar population. Very strong association was evident for the SNP rs7987802 in the DCT gene (pc = 5.95е‐006) in psoriasis patients. Additionally, the haplotype analysis provided AT DCT (rs7992630 and rs7987802) and AGA MC1R (rs3212358, 2228479 and 885479) haplotypes significantly associated (pc ˂ 0.05) with psoriasis in the Tatar population, supporting the involvement of DCT and MC1R to the psoriasis susceptibility. Moreover, MC1R‐203 and DCT‐201 expression levels were decreased in psoriasis lesional skin compared with healthy control skin. Conclusions This study is the first to identify genetic variants of the MC1R and DCT genes significantly associated with psoriasis in Tatar population. Our results support potential roles of CRH‐POMC system genes and DCT in the pathogenesis of psoriasis.
View
... The MC1R gene may exhibit splice variants, giving rise to two forms of intergenic splicing, yielding MC1R-TUBB3 (β-tubulin III) chimera and at least two forms of alternative splicing [13,14]. In all cases, the proteins encoded by the non-canonical mRNAs preserve the general architecture of GPCRs and differ from canonical MC1R for a longer C-terminal extension [14,15]. ...
... The MC1R gene may exhibit splice variants, giving rise to two forms of intergenic splicing, yielding MC1R-TUBB3 (β-tubulin III) chimera and at least two forms of alternative splicing [13,14]. In all cases, the proteins encoded by the non-canonical mRNAs preserve the general architecture of GPCRs and differ from canonical MC1R for a longer C-terminal extension [14,15]. Once MC1R mRNA is translated, the receptor undergoes post-translational modifications that include oligomerization, N-glycosylation (Asn15, Asn29), palmitoylation (Cys315) and phosphorylation (Thr157, Thr308, Ser316) [11,[16][17][18][19], contributing to receptor structure, localization, trafficking, internalization, desensitization. ...
Behind the Scene: Exploiting MC1R in Skin Cancer Risk and Prevention
Article
Full-text available
  • Jul 2021
Melanoma and non-melanoma skin cancers (NMSCs) are the most frequent cancers of the skin in white populations. An increased risk in the development of skin cancers has been associated with the combination of several environmental factors (i.e., ultraviolet exposure) and genetic background, including melanocortin-1 receptor (MC1R) status. In the last few years, advances in the diagnosis of skin cancers provided a great impact on clinical practice. Despite these advances, NMSCs are still the most common malignancy in humans and melanoma still shows a rising incidence and a poor prognosis when diagnosed at an advanced stage. Efforts are required to underlie the genetic and clinical heterogeneity of melanoma and NMSCs, leading to an optimization of the management of affected patients. The clinical implications of the impact of germline MC1R variants in melanoma and NMSCs’ risk, together with the additional risk conferred by somatic mutations in other peculiar genes, as well as the role of MC1R screening in skin cancers’ prevention will be addressed in the current review.
View
... [27,28] Other examples include unexpected twists of research on melanocortin peptides, its derivatives and receptors. [29,30] For instance, a C-terminal splice variant of the human melanocortin 1 receptor, a well-established key regulator of skin pigmentation, has recently been highlighted. [29] However, the expression of the splice variant may change the signalling properties of the co-expressed non-splicoform. ...
... [29,30] For instance, a C-terminal splice variant of the human melanocortin 1 receptor, a well-established key regulator of skin pigmentation, has recently been highlighted. [29] However, the expression of the splice variant may change the signalling properties of the co-expressed non-splicoform. This unexpected finding could kick-off subsequent research on other cutaneous cell types expressing the above receptor. ...
View
... Five known members of the melanocortin receptors, MC1R to MC5R, are concerned with different activities in vertebrates [2]. The MC1R gene is located on chromosome number 16q24.3, comprising 4 exons, which gives rise to many intra/ intergenic splice variants [3]. The MC1R is a well-known receptor for α-MSH expressed in the skin and hair follicles, where it controls pigmentation. ...
Exploring the role of MC1R protein in Zebrafish Danio rerio by Molecular Modeling, Dynamics and Simulation Studies
Article
Full-text available
  • Dec 2024
The melanocortin-1 receptor protein (MC1R) is a G-protein-coupled receptor that plays an important role in anti-inflammatory and melanogenic activities, making it a promising therapeutic agent. Considering its functional diversity, we initially focus on predicting Zebrafish MC1R protein structure using EasyModeller v.4.0 to gain structural insights. Next, we describe the structure to highlight the importance of serine-threonine (ST) and aspartic acid-arginine-tyrosine (DRY) motifs, which are crucial for receptor activation and protein stability. Then, we demonstrate the molecular dynamics (MD) simulation of protein in an aqueous environment at 300 and 350 temperatures and present the trajectory analysis of receptor proteins in the dynamic system. We identify that the receptor protein had a significant conformational change with deviations at 300 K at 35 ps and 350 K at 55 ps, respectively. Notably, stability of the receptor protein was obtained at 300 K between 2.7 and 2.8 Å (400 and 600 ps) and at 350 K from 3.1 to 3.2 Å (400 and 600 ps), while this is the first report of the thermostability of the Zebrafish MC1R protein using MD as the main impact. Finally, we discuss how the receptor can be exploited as a therapeutic target for developing new peptides and drugs to improve skin pigmentation and treat pigmentary disorders.
View
... The extracellular section interacts with the α-MSH ligand, whereas the intracellular portion engages with the G protein. Notably, residue 317 on the C-terminal chain includes a palmitoylation site, which is crucial for the receptor's functionality [12][13][14]. Additionally, residues C267 and C275 in EL3 form disulfide bonds with TM6 and TM7, influencing the receptor's tertiary structure [1,12]. ...
Molecular Basis of MC1R Activation: Mutation‐Induced Alterations in Structural Dynamics
Article
Full-text available
The MC1R protein is a receptor found in melanocytes that plays a role in melanin synthesis. Mutations in this protein can impact hair color, skin tone, tanning ability, and increase the risk of skin cancer. The MC1R protein is activated by the alpha‐melanocyte‐stimulating hormone (α‐MSH). Previous studies have shown that mutations affect the interaction between MC1R and α‐MSH; however, the mechanism behind this process is poorly understood. Our study aims to shed light on this mechanism using molecular dynamics (MD) simulations to analyze the Asp84Glu and Asp294His variants. We simulated both the wild‐type (WT) protein and the mutants with and without ligand. Our results reveal that mutations induce unique conformations during state transitions, hindering the switch between active and inactive states and decreasing cellular levels of cAMP. Interestingly, Asp294His showed increased ligand affinity but decreased protein activity, highlighting that tighter binding does not always lead to increased activation. Our study provides insights into the molecular mechanisms underlying the impact of MC1R mutations on protein activity.
View
... β-arrestin2 is able to bias MC1R signaling by promoting activation of the MAPK pathway towards that of cAMP-dependent signaling [279]. A transcript of the MC1R (MC1R-203) naturally promotes such biased signaling toward the MAPK pathway [280]. Mutants of metabolic glutamate receptors (mGluR3 G848E ) can promote such biased signaling, characterized by prolonged internalization of the receptor [281]. ...
Targeting GPCRs and Their Signaling as a Therapeutic Option in Melanoma
Article
Full-text available
  • Jan 2022
Simple Summary Sixteen G-protein-coupled receptors (GPCRs) have been involved in melanogenesis or melanomagenesis. Here, we review these GPCRs, their associated signaling, and therapies. Abstract G-protein-coupled receptors (GPCRs) serve prominent roles in melanocyte lineage physiology, with an impact at all stages of development, as well as on mature melanocyte functions. GPCR ligands are present in the skin and regulate melanocyte homeostasis, including pigmentation. The role of GPCRs in the regulation of pigmentation and, consequently, protection against external aggression, such as ultraviolet radiation, has long been established. However, evidence of new functions of GPCRs directly in melanomagenesis has been highlighted in recent years. GPCRs are coupled, through their intracellular domains, to heterotrimeric G-proteins, which induce cellular signaling through various pathways. Such signaling modulates numerous essential cellular processes that occur during melanomagenesis, including proliferation and migration. GPCR-associated signaling in melanoma can be activated by the binding of paracrine factors to their receptors or directly by activating mutations. In this review, we present melanoma-associated alterations of GPCRs and their downstream signaling and discuss the various preclinical models used to evaluate new therapeutic approaches against GPCR activity in melanoma. Recent striking advances in our understanding of the structure, function, and regulation of GPCRs will undoubtedly broaden melanoma treatment options in the future.
View
... -arrestin2 is able to bias MC1R signaling by promoting activation of the MAPK pathway towards that of cAMP-dependent signaling [270]. A transcript of the MC1R (MC1R-203) naturally promotes such biased signaling toward the MAPK pathway [271]. Mutants of metabolic glutamate receptors (mGluR3 G848E ) can promote such biased signaling, characterized by prolonged internalization of the receptor [272]. ...
Targeting GPCRs & their Signaling as a Therapeutic Option in Melanoma
Preprint
  • Jan 2022
G protein-coupled receptors (GPCRs) serve prominent roles in melanocyte lineage physiology, with an impact at all stages of development, as well as on mature melanocyte functions. GPCR ligands are present in the skin and regulate melanocyte homeostasis, including pigmentation. The role of GPCRs in the regulation of pigmentation and, consequently, protection against external aggression, such as ultraviolet radiation, has long been established. However, evidence of new functions of GPCRs directly in melanomagenesis has been highlighted in recent years. GPCRs are coupled, through their intracellular domains, to heterotrimeric G proteins, which induce cellular signaling through various pathways. Such signaling modulates essential cellular processes of melanomagenesis, such as proliferation and migration. GPCR-associated signaling in melanoma can be activated by the binding of paracrine factors to their receptors or directly by activating mutations. In this review, we present melanoma-associated alterations of GPCRs and their downstream signaling and discuss the various preclinical models used to evaluate new therapeutic approaches against GPCR activity in melanoma. Recent striking advances in our understanding of the structure, function, and regulation of GPCRs will undoubtedly broaden treatment options in melanoma in the future.
View
The multifaceted roles of peptides in “always-on” near-infrared fluorescent probes for tumor imaging
Article
  • Oct 2022
  • BIOORG CHEM
Tumor-targeted near-infrared (NIR) fluorescence imaging by using NIR fluorescent probes has attracted extensive attentions in the field of tumor imaging and is becoming an attractive strategy for early cancer diagnosis and surgical guidance for the past few decades. Especially, due to the high affinity and low toxicity, the peptide-based NIR fluorescent probes play an important role in the field of tumor-targeted imaging and therapy. Extensive attempts have been made to develop a set of nontoxic and efficacious “always-on” peptide-based NIR fluorescent probes. In this review, we give a comprehensive analysis of the “always-on” peptide-based NIR fluorescent probes for tumor-targeting for the past 5 years, highlighting the design strategy, chemical synthesis, therapeutical applications, spectroscopic and pharmacological characterization, as well as the multifaceted roles of peptides. A comprehensive understanding of the tumor-targeted, “always-on” peptide-based NIR fluorescent probes will increase our knowledge of cancer diagnosis and benefit clinical cancer therapeutics.
View
The α-Melanocyte Stimulating Hormone/Melanocortin-1 receptor interaction: a driver of pleiotropic effects beyond pigmentation
Article
  • Apr 2021
  • PIGM CELL MELANOMA R
Melanocortin 1 Receptor (MC1R), when stimulated by alpha-melanocyte stimulating hormone (α-MSH), is a driver of eu-melanogenesis. Brown/black eumelanin is an effective filter against ultraviolet radiation (UVR) and is a scavenger of free radicals. Several polymorphic variants of MC1R are frequent in red-head people. These polymorphisms reduce the ability of MC1R to promote eu-melanogenesis after its activation and spontaneous pheomelanogenesis takes place. Since pheomelanin can act as an endogenous photosensitizer, people carrying MC1R polymorphisms are more susceptible to skin cancer. Here, we summarize current knowledge on the biology of MC1R beyond its ability to drive eumelanogenesis. We analyze its capacity to cope with oxidative insult and consequent DNA damage. We describe its ability to transduce through different pathways. We start from the canonical pathway, the cAMP/protein kinase A (PKA) pathway mainly involved in promoting eumelanogenesis and protection from oxidative damage and we then move on to describe more recent knowledge concerning ERK pathways, phosphoinositide 3-kinase (PI3K) pathway/AKT and α-MSH/Peroxisome proliferators activated receptor-γ (PPAR-γ) connection. We describe MC1R polymorphic variants associated with melanoma risk which represent an open window of clinical relevance.
View
cAMP-independent non-pigmentary actions of variant melanocortin 1 receptor: AKT-mediated activation of protective responses to oxidative DNA damage
Article
Full-text available
  • Jul 2018
The melanocortin 1 receptor gene (MC1R), a well-established melanoma susceptibility gene, regulates the amount and type of melanin pigments formed within epidermal melanocytes. MC1R variants associated with increased melanoma risk promote the production of photosensitizing pheomelanins as opposed to photoprotective eumelanins. Wild-type (WT) MC1R activates DNA repair and antioxidant defenses in a cAMP-dependent fashion. Since melanoma-associated MC1R variants are hypomorphic in cAMP signaling, these non-pigmentary actions are thought to be defective in MC1R-variant human melanoma cells and epidermal melanocytes, consistent with a higher mutation load in MC1R-variant melanomas. We compared induction of antioxidant enzymes and DNA damage responses in melanocytic cells of defined MC1R genotype. Increased expression of catalase (CAT) and superoxide dismutase (SOD) genes following MC1R activation was cAMP-dependent and required a WT MC1R genotype. Conversely, pretreatment of melanocytic cells with an MC1R agonist before an oxidative challenge with Luperox decreased (i) accumulation of 8-oxo-7,8-dihydro-2′-deoxyguanine, a major product of oxidative DNA damage, (ii) phosphorylation of histone H2AX, a marker of DNA double-strand breaks, and (iii) formation of DNA breaks. These responses were comparable in cells WT for MC1R or harboring hypomorphic MC1R variants without detectable cAMP signaling. In MC1R-variant melanocytic cells, the DNA-protective responses were mediated by AKT. Conversely, in MC1R-WT melanocytic cells, high cAMP production downstream of MC1R blocked AKT activation and was responsible for inducing DNA repair. Accordingly, MC1R activation could promote repair of oxidative DNA damage by a cAMP-dependent pathway downstream of WT receptor, or via AKT in cells of variant MC1R genotype.
View
Functional Characterization of MC1R-TUBB3 Intergenic Splice Variants of the Human Melanocortin 1 Receptor
Article
Full-text available
The melanocortin 1 receptor gene (MC1R) expressed in melanocytes is a major determinant of skin pigmentation. It encodes a Gs protein-coupled receptor activated by α-melanocyte stimulating hormone (αMSH). Human MC1R has an inefficient poly(A) site allowing intergenic splicing with its downstream neighbour Tubulin-β-III (TUBB3). Intergenic splicing produces two MC1R isoforms, designated Iso1 and Iso2, bearing the complete seven transmembrane helices from MC1R fused to TUBB3-derived C-terminal extensions, in-frame for Iso1 and out-of-frame for Iso2. It has been reported that exposure to ultraviolet radiation (UVR) might promote an isoform switch from canonical MC1R (MC1R-001) to the MC1R-TUBB3 chimeras, which might lead to novel phenotypes required for tanning. We expressed the Flag epitope-tagged intergenic isoforms in heterologous HEK293T cells and human melanoma cells, for functional characterization. Iso1 was expressed with the expected size. Iso2 yielded a doublet of Mr significantly lower than predicted, and impaired intracellular stability. Although Iso1- and Iso2 bound radiolabelled agonist with the same affinity as MC1R-001, their plasma membrane expression was strongly reduced. Decreased surface expression mostly resulted from aberrant forward trafficking, rather than high rates of endocytosis. Functional coupling of both isoforms to cAMP was lower than wild-type, but ERK activation upon binding of αMSH was unimpaired, suggesting imbalanced signaling from the splice variants. Heterodimerization of differentially labelled MC1R-001 with the splicing isoforms analyzed by co-immunoprecipitation was efficient and caused decreased surface expression of binding sites. Thus, UVR-induced MC1R isoforms might contribute to fine-tune the tanning response by modulating MC1R-001 availability and functional parameters.
View
Human Melanocortin 1 receptor-mediated ubiquitination of nonvisual Arrestins. Role of Mahogunin ring finger 1 E3 ligase
Article
  • Sep 2017
  • BBA-MOL CELL RES
Signaling from the melanocortin 1 receptor (MC1R), a Gs protein-coupled receptor (GPCR) crucial for melanocyte proliferation and differentiation, is regulated by cytosolic β-arrestins (ARRBs). MC1R signaling is also negatively modulated by the E3-ubiquitin ligase Mahogunin Ring Finger-1 (MGRN1), whose mutation causes hyperpigmentation, congenital heart defects and neurodegeneration in mice. We showed previously that although MC1R interacts stably with human ARRB1 or ARRB2, only ARRB2 mediates receptor desensitization and internalization. We analyzed MC1R-dependent ARRB ubiquitination, and the possible role of MGRN1. ARRB1 expressed in heterologous cells or human melanoma cells migrated in SDS-PAGE as a 55kDa protein whereas ARRB2 migrated as two major bands of apparent molecular weight near 45 and 55kDa, with an intermediate mobility band occasionally detected. These forms were related by post-translational modification rather than by proteolysis. Presence of MC1R favored expression of the 45kDa protein, the form that interacted preferentially with MC1R. MC1R also mediated poly- or multimonoubiquitination of ARRB2. Ubiquitination was agonist-independent, but required a native MC1R conformation and/or normal receptor trafficking to the plasma membrane, as it was not observed for loss-of-function MC1R variants. In a heterologous expression system, MC1R-dependent ARRB ubiquitination was enhanced by overexpression of MGRN1 and was impaired by siRNA-mediated MGRN1 knockdown thus pointing to MGRN1 as the responsible E3-ligase. Co-immunoprecipitation experiments demonstrated interaction of MGRN1 and ARRBs in the presence of MC1R, suggesting a scaffolding role for the GPCR that may determine the selectivity of E3-ubiquitin ligase engagement and the functional outcome of ARRB ubiquitination.
View
Palmitoylation-dependent activation of MC1R prevents melanomagenesis
Article
  • Sep 2017
  • NATURE
The melanocortin-1 receptor (MC1R), a G-protein-coupled receptor, has a crucial role in human and mouse pigmentation. Activation of MC1R in melanocytes by α-melanocyte-stimulating hormone (α-MSH) stimulates cAMP signalling and melanin production and enhances DNA repair after ultraviolet irradiation. Individuals carrying MC1R variants, especially those associated with red hair colour, fair skin and poor tanning ability (denoted as RHC variants), are associated with higher risk of melanoma. However, how MC1R activity is modulated by ultraviolet irradiation, why individuals with red hair are more prone to developing melanoma, and whether the activity of RHC variants might be restored for therapeutic benefit are unknown. Here we demonstrate a potential MC1R-targeted intervention strategy in mice to rescue loss-of-function MC1R in MC1R RHC variants for therapeutic benefit by activating MC1R protein palmitoylation. MC1R palmitoylation, primarily mediated by the protein-acyl transferase ZDHHC13, is essential for activating MC1R signalling, which triggers increased pigmentation, ultraviolet-B-induced G1-like cell cycle arrest and control of senescence and melanomagenesis in vitro and in vivo. Using C57BL/6J-Mc1r(e/e)J mice, in which endogenous MC1R is prematurely terminated, expressing Mc1r RHC variants, we show that pharmacological activation of palmitoylation rescues the defects of Mc1r RHC variants and prevents melanomagenesis. The results highlight a central role for MC1R palmitoylation in pigmentation and protection against melanoma.
View
MC1R signaling. Intracellular Partners and Pathophysiological Implications
Article
  • Mar 2017
  • BBA-MOL BASIS DIS
The melanocortin-1 receptor (MC1R) preferentially expressed in melanocytes is best known as a key regulator of the synthesis of epidermal melanin pigments. Its paracrine stimulation by keratinocyte-derived melanocortins also activates DNA repair pathways and antioxidant defenses to build a complex, multifaceted photoprotective response. Many MC1R actions rely on cAMP-dependent activation of two transcription factors, MITF and PGC1α, but pleiotropic MC1R signaling also involves activation of mitogen-activated kinases and AKT. MC1R partners such as β-arrestins, PTEN and the E3 ubiquitin ligase MGRN1 differentially regulate these pathways. The MC1R gene is complex and polymorphic, with frequent variants associated with skin phenotypes and increased cancer risk. We review current knowledge of signaling from canonical MC1R, its splice isoforms and natural polymorphic variants. Recently discovered intracellular targets and partners are also discussed, to highlight the diversity of mechanisms that may contribute to normal and pathological variation of pigmentation and sensitivity to solar radiation-induced damage.
View
Mahogunin Ring Finger-1 (MGRN1), a Multifaceted Ubiquitin Ligase: Recent Unraveling of Neurobiological Mechanisms
Article
  • Aug 2015
  • MOL NEUROBIOL
In healthy cell, inappropriate accumulation of poor or damaged proteins is prevented by cellular quality control system. Autophagy and ubiquitin proteasome system (UPS) provides regular cytoprotection against proteotoxicity induced by abnormal or disruptive proteins. E3 ubiquitin ligases are crucial components in this defense mechanism. Mahogunin Ring Finger-1 (MGRN1), an E3 ubiquitin ligase of the Really Interesting New Gene (RING) finger family, plays a pivotal role in many biological and cellular mechanisms. Previous findings indicate that lack of functions of MGRN1 can cause spongiform neurodegeneration, congenital heart defects, abnormal left-right patterning, and mitochondrial dysfunctions in mice brains. However, the detailed molecular pathomechanism of MGRN1 in cellular functions and diseases is not well known. This article comprehensively represents the molecular nature, characterization, and functions of MGRN1; we also summarize possible beneficiary aspects of this novel E3 ubiquitin ligase. Here, we review recent literature on the role of MGRN1 in the neuro-pathobiological mechanisms, with precise focus on the processes of neurodegeneration, and thereby propose new lines of potential targets for therapeutic intervention.
View
MC1R, the cAMP pathway and the response to solar UV: Extending the horizon beyond pigmentation
Article
  • May 2014
  • PIGM CELL MELANOMA R
The melanocortin 1 receptor (MC1R) is a G protein-coupled receptor crucial for the regulation of melanocyte proliferation and function. Upon binding melanocortins, MC1R activates several signaling cascades, notably the cAMP pathway leading to synthesis of photoprotective eumelanin. Polymorphisms in the MC1R gene are a major source of normal variation of human hair color and skin pigmentation, response to ultraviolet radiation (UVR) and skin cancer susceptibility. The identification of a surprisingly high number of MC1R natural variants strongly associated with pigmentary phenotypes and increased skin cancer risk has prompted research on the functional properties of the wild-type receptor and frequent mutant alleles. We summarize current knowledge on MC1R structural and functional properties, as well as on its intracellular trafficking and signaling. We also review the current knowledge about the function of MC1R as a skin cancer, particularly melanoma, susceptibility gene and how it modulates the response of melanocytes to UVR.This article is protected by copyright. All rights reserved.
View
Differential and competitive regulation of human melanocortin 1 receptor signaling by -arrestin isoforms
Article
  • Jun 2013
  • J CELL SCI
The melanocortin 1 receptor (MC1R) is a G protein-coupled receptor (GPCR) crucial for the regulation of melanocyte proliferation and differentiation. MC1R activation by melanocortin hormones triggers the cAMP pathway and stimulates the extracellular signal-regulated protein kinases ERK1 and ERK2 to promote synthesis of photoprotective eumelanin pigments among other effects. Signaling from most GPCRs is regulated by the β-arrestin (ARRB) family of cytosolic multifunctional adaptor proteins which mediate signal termination and endocytosis of GPCR-agonist complexes. The ubiquitously expressed non-visual β-arrestin1 (ARRB1) and β-arrestin2 (ARRB2) are highly homologous but not functionally equivalent. Their role in the regulation of MC1R is unknown. Using a combination of co-immunoprecipitation, gel filtration chromatography, confocal microscopy, siRNA-mediated knockdown and functional assays, we demonstrated agonist-independent competitive interactions of ARRB1 and ARRB2 with MC1R, which might also be independent of phosphorylation of MC1R C-terminal Ser/Thr residues. The effects of ARRBs were isoform-specific. ARRB2 inhibited MC1R agonist-dependent cAMP production but not ERK activation, stimulated internalization and showed prolonged co-localization with the receptor in endocytic vesicles. Conversely, ARRB1 had no effect on internalization or functional coupling, but competed with ARRB2 for binding MC1R, which might increase signaling by displacement of inhibitory ARRB2. These data suggest a novel mechanism of MC1R functional regulation based on the relative expression of ARRB isoforms, with possible activatory ARRB1-dependent effects arising from partial relief of inhibitory ARRB2-MC1R interactions. Thus, competitive displacement of inhibitory ARRBs by functionally neutral ARRB isoforms might exert a paradigm-shifting signal-promoting effect to fine-tune signaling downstream of certain GPCRs.
View
Central role for cAMP signaling in pigmentation and UV resistance
Article
Comment on: Khaled M, et al. Genes Dev 2010; 24:2276-81.
View
Signaling from the Human Melanocortin 1 Receptor to ERK1 and ERK2 Mitogen-Activated Protein Kinases Involves Transactivation of cKIT
Article
  • Nov 2010
  • MOL ENDOCRINOL
Melanocortin 1 receptor (MC1R), a Gs protein-coupled receptor expressed in melanocytes, is a major determinant of skin pigmentation, phototype and cancer risk. Upon stimulation by αMSH, MC1R triggers the cAMP and ERK1/ERK2 MAPK pathways. In mouse melanocytes, ERK activation by αMSH binding to Mc1r depends on cAMP, and melanocytes are considered a paradigm for cAMP-dependent ERK activation. However, human MC1R variants associated with red hair, fair skin [red hair color (RHC) phenotype], and increased skin cancer risk display reduced cAMP signaling but activate ERKs as efficiently as wild type in heterologous cells, suggesting independent signaling to ERKs and cAMP in human melanocytes. We show that MC1R signaling activated the ERK pathway in normal human melanocytes and melanoma cells expressing physiological levels of endogenous RHC variants. ERK activation was comparable for wild-type and mutant MC1R and was independent on cAMP because it was neither triggered by stimulation of cAMP synthesis with forskolin nor blocked by the adenylyl cyclase inhibitor 2',5'-dideoxyadenosine. Stimulation of MC1R with αMSH did not lead to protein kinase C activation and ERK activation was unaffected by protein kinase C inhibitors. Conversely, pharmacological interference, small interfering RNA studies, expression profiles, and functional reconstitution experiments showed that αMSH-induced ERK activation resulted from Src tyrosine kinase-mediated transactivation of the stem cell factor receptor, a receptor tyrosine kinase essential for proliferation, differentiation, and survival of melanocyte precursors, thus demonstrating a functional link between the stem cell factor receptor and MC1R. Moreover, this transactivation phenomenon is unique because it is unaffected by natural mutations impairing canonical MC1R signaling through the cAMP pathway.
View