Access to this full-text is provided by Frontiers.
Content available from Frontiers in Microbiology
This content is subject to copyright.
fmicb-11-01114 May 28, 2020 Time: 13:20 # 1
ORIGINAL RESEARCH
published: 28 May 2020
doi: 10.3389/fmicb.2020.01114
Edited by:
Siu Mui Tsai,
University of São Paulo, Brazil
Reviewed by:
Jianqiao Xu,
Sun Yat-sen University, China
Carsten T. Muller,
Cardiff University, United Kingdom
*Correspondence:
Xiao-Qin Wu
xqwu@njfu.edu.cn;
xqwu_njfu@163.com
Specialty section:
This article was submitted to
Fungi and Their Interactions,
a section of the journal
Frontiers in Microbiology
Received: 12 March 2020
Accepted: 04 May 2020
Published: 28 May 2020
Citation:
Kong W-L, Rui L, Ni H and
Wu X-Q (2020) Antifungal Effects
of Volatile Organic Compounds
Produced by Rahnella aquatilis
JZ-GX1 Against Colletotrichum
gloeosporioides in Liriodendron
chinense ×tulipifera.
Front. Microbiol. 11:1114.
doi: 10.3389/fmicb.2020.01114
Antifungal Effects of Volatile Organic
Compounds Produced by Rahnella
aquatilis JZ-GX1 Against
Colletotrichum gloeosporioides in
Liriodendron chinense ×tulipifera
Wei-Liang Kong1,2, Lin Rui1,2, Hang Ni1,2 and Xiao-Qin Wu1,2*
1Co-Innovation Center for Sustainable Forestry in Southern China, College of Forestry, Nanjing Forestry University, Nanjing,
China, 2Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing,
China
The use of volatile organic compounds (VOCs) produced by microorganisms for the
biological control of plant diseases has attracted much attention in recent years. In this
study, the antifungal activity and identity of VOCs produced by Rahnella aquatilis JZ-
GX1 isolated from the rhizosphere soil of pine were determined and analyzed. The effect
of the VOCs on the mycelial growth of Colletotrichum gloeosporioides, the pathogen
of Liriodendron chinense ×tulipifera black spot, was determined by a joined-petri
dish fumigation method. An in vitro leaf inoculation method was used to determine
the fumigation effect of the VOCs on Liriodendron black spot. VOCs with antifungal
activity were collected by headspace solid-phase microextraction (SPME), and their
components were analyzed by gas chromatography-mass spectrometry (GC-MS). The
results showed that the VOCs secreted by JZ-GX1 inhibited the mycelial growth of the
tested pathogen. The VOCs destroyed the morphology of the mycelium, significantly
increased the permeability of the cell membrane and downregulated the expression
of pathogenicity-related genes during mycelial infection, thus inhibiting the expansion
of anthracnose disease spots in leaves. In the volatile compound profile, 3-methyl-
1-butanol and 2-phenylethyl methyl ether significantly inhibited the mycelial growth
and spore germination of C. gloeosporioides. This work provides a new strategy for
the research and application of microorganisms and bioactive compounds to control
plant anthracnose.
Keywords: Rahnella aquatilis, VOCs, Colletotrichum gloeosporioides, mycelial growth, spore germination
INTRODUCTION
Biological control of plant diseases is an important measure to reduce the use of chemical
pesticides and improve plant health (Eva et al., 2019). Research based on the interaction
between antagonistic microorganisms and pathogens has always been the focus of biocontrol
research. Studies have shown that biocontrol agents such as Bacillus,Pseudomonas,Burkholderia,
and Streptomyces play important roles in plant pathogen inhibition (Jiang et al., 2018;
Frontiers in Microbiology | www.frontiersin.org 1May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 2
Kong et al. Biological Control
Roxane et al., 2018;Randa et al., 2019;Jeon et al., 2019).
Biocontrol mechanisms mainly include the production of
antibiotics, occupation of active sites, and nutrient or mineral
competition, of which the most common strategy is the secretion
of antifungal metabolites (Huang et al., 2017). At present, the
most well-studied antifungal metabolites are antibiotics, cell wall-
degrading enzymes and volatile organic compounds (VOCs), and
the VOCs produced during microbial metabolism are particularly
important biocontrol factors (Tagele et al., 2019).
In recent years, attention to VOC research has increased.
Compared with other secondary metabolites of microorganisms,
VOCs have many desirable properties, such as low molecular
weight, low polarity, high vapor pressure, low boiling point, and
lipophilicity (Sharifi and Ryu, 2018). VOCs at low concentrations
can be sensed and can be transmitted over long distances,
mediating indirect interactions between organisms; thus, VOCs
have been used for the biological control of plant diseases
(Sharifah et al., 2019). Wan et al. (2008) detected phenylethyl
alcohol in the volatile profile of Streptomyces platensis F-1, and the
application of phenylethyl alcohol slowed the growth of Botrytis
cinerea and maintained the aroma in strawberry. The VOCs
produced by Pseudomonas aureofaciens SPS-41 can be used as
a biological fumigant to control disease in sweet potato tuber
roots (Zhang et al., 2019). The volatiles produced by Enterobacter
asburiae Vt-7 inhibited aflatoxin production in peanut during
storage (Gong et al., 2019).
Colletotrichum gloeosporioides is widely distributed in tropical
and subtropical regions and can infect mango, peaches,
Liriodendron chinense ×tulipifera, Cunninghamia lanceolata,
and Camellia sinensis, causing anthracnose in leaves and fruits
(Huang et al., 2018;Tang et al., 2019;Wu et al., 2019;
Zhu et al., 2019;Shang et al., 2020). The conidia of this
pathogen can infect the tender leaves, twigs, flowers and fruits
of the host, causing leaves, flowers and fruits to fall, and
fruit to decay during storage, resulting in serious economic
losses. At present, chemical application is the main control
strategy for plant anthracnose. However, with the widespread
application of chemical pesticides, the selection pressure on
pathogens increases. Anthracnose in many areas also has varying
degrees of drug resistance. Wang et al. (2019) found significant
differences in the sensitivity of 13 Colletotrichum anthracnose
isolates from walnut fruits and leaves on walnut plantations
in China to the same fungicide. Mancozeb, which is used to
control anthracnose in mango orchards, has had similar effects
(Chanchaichaovivat et al., 2007). Therefore, reducing the drug
resistance of pathogens through biological control has become an
important issue in the prevention and control of agricultural and
forestry diseases.
Rahnella aquatilis JZ-GX1 is a plant growth-promoting
bacterium isolated from the rhizosphere of Pinus massoniana
in our laboratory. Previous studies have shown that it has
strong inhibitory activity against poplar canker pathogen
(Cytospora chrysosperma) and seedling quenching pathogen
(Rhizoctonia solani) (Song et al., 2017;Kong et al., 2019b)
and can promote the growth of Cinnamomum camphora
and Pinus massoniana (Li et al., 2013;Kong et al., 2019a).
However, it is not clear whether the strain can produce volatile
compounds and whether its VOCs have inhibitory effects on
plant pathogens. In this study, the antagonistic effect of the
VOCs emitted by the JZ-GX1 strain against the anthracnose
pathogen Liriodendron chinense ×tulipifera was evaluated
to isolate and identify individual volatile compounds with
antifungal activity, to reveal the antagonistic mechanism behind
the effect of the volatile compounds against plant pathogens,
and to develop new microbial resources to control plant diseases
caused by C. gloeosporioides.
MATERIALS AND METHODS
Tested Bacterial and Fungal Strains
Rahnella aquatilis JZ-GX1 is a plant growth-promoting
bacterium isolated from the rhizosphere soil of a 28-year-old
P. massoniana in Nanning, Guangxi. It is now stored in the
typical Culture Preservation Center of China (CCTCC, No:
M2012439). After activation, the JZ-GX1 strain was cultured
overnight on LB liquid medium at 28◦C.
The pathogen C. gloeosporioides was isolated from a
susceptible Liriodendron chinense ×tulipifera on the campus of
Nanjing Forestry University. The strain was cultured on potato
glucose agar (PDA) medium at 25◦C for 7 days.
Determination of the Antagonistic Effect
of VOCs Produced by Strain JZ-GX1 on
C. gloeosporioides
The antifungal activity of VOCs produced by JZ-GX1 was
detected after culturing on two sealed petri dishes (Gao et al.,
2017). One petri dish contained 20 mL LB medium, and the
other 20 mL PDA medium. The LB medium was coated with
100 µL JZ-GX1 suspension, and a 6 mm diameter plug of
C. gloeosporioides was placed on the PDA plate. Then, the
bottoms of the two petri dishes were sealed with Parafilm
and cultured in a constant-temperature incubator at 25◦C for
5 days. Each experiment was repeated three times. The inhibition
rate = (Cd - Td) ×100%/Cd, where Cd is the colony diameter
on the control PDA plate and Td is the colony diameter on the
treated PDA plate.
Scanning Electron Microscopy (SEM)
Observation of the Mycelium of
C. gloeosporioides
The mycelium morphology of C. gloeosporioides was observed
and analyzed by SEM (Quanta 200FEIJI, United States) in
C. gloeosporioides after 5 days of VOC treatment and in
C. gloeosporioides that had not been exposed to the JZ-GX1 strain.
A mycelium sample was fixed in 4% glutaraldehyde solution for
24 h and washed with pH = 7.2 phosphate buffer (Edgar et al.,
2019). The mycelium samples were dehydrated with an ethanol
gradient (70, 80, 90%, and anhydrous ethanol). Then, the gold
layer was sputtered with liquid CO2in a critical point dryer
(EMITECH K850) for 15 min. The specimens were subsequently
mounted on stubs and sputtered with gold (HITACH E-1010).
The scanning voltage was 20 kV (Li et al., 2013).
Frontiers in Microbiology | www.frontiersin.org 2May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 3
Kong et al. Biological Control
Determination of Nucleic Acid
Exosmosis by Pathogenic Mycelium
To evaluate the effect of VOCs on the nucleic acid leakage
of C. gloeosporioides, the OD260 of a mycelial cell suspension
was determined by ultraviolet spectrophotometry. LB medium
was added to one petri dish, onto which 100 µL JZ-GX1
bacterial suspension was coated, and PDA medium was poured
into another petri dish. After cooling, sterilized cellophane was
spread on the PDA medium, and 100 µL of a spore suspension
(108cfu/mL) of C. gloeosporioides was evenly coated on the
cellophane. Then, the bottoms of the two dishes were sealed
with Parafilm. The plates were cultured at 25◦C, and mycelial
cells were removed at 12, 24, 36, 48, and 60 h and washed with
5 mL aseptic water. After centrifugation, the OD260 value of the
supernatant was determined by an ultraviolet spectrophotometer
(Zhang, 2015). The experiment was carried out three times in
parallel and repeated three times.
Determination of Malondialdehyde
(MDA) and Soluble Sugar in Pathogenic
Mycelium
A total of 0.5 g mycelium of C. gloeosporioides fumigated with
VOCs, 0.1 g quartz sand and 2 mL 10% trichloroacetic acid
were fully ground into a homogenate with a mortar and pestle.
Then, 8 mL 10% trichloroacetic acid was added, and grinding
continued. The homogenate was centrifuged at 4000 rpm for
10 min, and MDA was recovered in the supernatant. Next, 2 mL
supernatant was added to a clean test tube, and a control tube
was filled with 2 mL distilled water; 2 mL 0.6% thiobarbituric
acid solution was added to each tube. The tubes were shaken
and allowed to react in a boiling water bath for 15 min. The
tubes were quickly cooled and then centrifuged. The absorbance
(A) of the final supernatant was determined at 532, 600, and
450 nm, and the MDA concentration was calculated as follows: c
(MDA) (µM) = 6.45 (A532 - A600) - 0.56A450; c (soluble sugar)
(µM) = 11.71A450 (Song et al., 2017).
RNA Extraction and RT-qPCR Analysis of
Pathogenic Mycelium
The mycelium of C. gloeosporioides was inoculated in CMC
liquid medium and shaken at 25◦C and 150 rpm for 48 h. The
suspension was filtered through monolayer gauze and diluted
to obtain a 106cfu/mL fresh spore suspension. Then, 100
µL conidial suspension was coated on a PDA plate. The LB
plate inoculated with JZ-GX1 was joined with the PDA plate
containing the conidial suspension of C. gloeosporioides. The
bottoms of the two culture dishes were sealed with Parafilm
and cultured in the dark at 28◦C. Conidia on PDA without
JZ-GX1 treatment were used as a control. C. gloeosporioides
was collected 24 h later for RNA extraction. Total RNA was
extracted with TRIzol reagent according to the manufacturer’s
instructions. After DNaseI treatment, 2 µg ribonucleic acid
was added to the 20 µL reaction system, and first-strand
cDNA was synthesized by reverse transcription according to the
manufacturer’s instructions. HiScript II Q Select RT Supermix
was used to prepare cDNA samples for qPCR (China). Using 1.0
µL cDNA diluted 1:10 as the template, the whole reaction system
was carried out in an ABI 7500 system (Applied Biosystems,
United States). Three pathogenicity-related genes, polyketone
synthase (PKS), endotoxin galacturonase (PG), and cysteine
dehydratase (SCD), were selected for RT-qPCR analysis (Table 1).
The actin gene was used as an internal reference gene because of
its relatively stable expression level. The relative quantification of
gene expression changes was carried out by the 2−1 1 CT method
(Li Z.Q. et al., 2017;Su et al., 2018).
Determination of Anthracnose Spot on
Liriodendron chinense ×tulipifera
Treated With VOCs
A petri dish with a diameter of 15 cm was coated with JZ-
GX1 bacterial solution, and a blank LB plate was used as the
control. Medium-sized hybrid Liriodendron leaves were placed
at the bottom of another petri dish, and the petioles were
wrapped with wet cotton balls for moisturization. Then, the
leaf surfaces were sprayed and disinfected with 75% alcohol,
and two inoculation points were selected on each side of the
main vein. After puncture of the leaf surface, the wound was
inoculated with C. gloeosporioides plugs (8= 6 mm), with
10 dishes per treatment and three replicates. Each petri dish
inoculated with JZ-GX1 and each petri dish inoculated with
pathogenic fungal leaves were joined together and sealed with
Parafilm. After 2 and 4 days of confrontation culture at 25◦C,
the expansion of lesions on the leaves was observed, and
the diameter of each lesion was measured (Xu et al., 2017;
Wang et al., 2018).
Identification of VOCs and Inhibitory
Analysis
The analysis of VOCs emitted by JZ-GX1 was performed
with headspace solid-phase microextraction (HS-SPME) coupled
with gas chromatography-mass spectrometry (GC-MS). A single
colony of JZ-GX1 was inserted into a 200 mL flask containing
50 mL of liquid LB medium and fermented at 28◦C with shaking
at 180 rpm for 2 days. LB liquid medium without bacterial
inoculation was used as the control. A 65 µm PDMS/DVB fiber
was selected for the determination of VOCs. The SPME fiber was
inserted into the flask and cultured at 40◦C for 30 min. After the
TABLE 1 | Primers used in RT-qPCR analysis.
Gene
name
Gene functions Primers
PKS Polyketone synthesis TGCTCATGATGGAGACGGAAG
GCGGGTGATGAAGTTACGGAT
PG Degraded cell wall ATCAAGACCATCGCTAAGAAGACC
TCCTGCTGGATCACGATGC
SCD Melanin synthesis CACCCAAGTTCGCCATATCC
CGAGAAGAACGATGTCAAGGTTG
ACT Endogenous control,
Reference gene
AGCGGAAAGCCTCGCAGT
TGTCGTTACCATCTCGACCCA
Frontiers in Microbiology | www.frontiersin.org 3May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 4
Kong et al. Biological Control
extraction, the fiber was quickly retracted, and the needle was
pulled out and immediately inserted into the GC inlet (TraceISQ,
Thermo Fisher Scientific, United States). The fiber was pushed
down into the inlet at 230◦C desorption for 3 min. The CK and
JZ-GX1 treatments were tested three times.
Gas chromatographic conditions: DB-5MS capillary column
(30 m ×0.25 mm ×0.25 µm), He carrier gas; injector port
temperature of 230◦C; initial temperature of 40◦C, maintained
for 3 min, raised to 95◦C at 10◦C/min, then to 230◦C at 3◦C/min,
and maintained for 5 min.
Mass spectrometry conditions: EI ion source; electron energy
of 70 eV; ion source temperature of 250◦C; interface temperature
of 250◦C; data acquisition rate, 0.2 s/time and spectrum retrieval
using the NIST 05 and NIST 05s libraries (Zhang, 2013).
To test the antifungal activity of JZ-GX1 VOCs, we
used authentic reference standard compounds purchased from
Rongshide Trading Co., Ltd. (Nanjing, China). PDA medium
(20 ml) was added to a petri dish; 7-day-old anthracnose plugs
(6 mm) and conidia (100 µL of conidia at 108cfu/mL) were
inoculated in the center of the PDA medium with a punch.
Another petri dish was added with authentic standard to final
concentrations of 10, 20, 100, and 200 µL/L (compound volume
to airspace volume). The bottoms of the two petri dishes
were joined together and sealed with film. After culturing at
25◦C for 3 days, the inhibition by the standard was observed;
anthrax was inoculated alone as the control. Each process was
repeated three times.
Statistical Analysis
The data were analyzed by analysis of variance and Duncan’s
multiple comparison with SPSS 22.0 software, and the standard
errors of all mean values were calculated (P<0.05).
RESULTS
Antagonistic Effect of VOCs Produced by
JZ-GX1 Against C. gloeosporioides
The determination of the mycelial growth inhibition rate showed
that the VOCs produced by JZ-GX1 had a good inhibitory effect
on the colony growth of C. gloeosporioides. Compared with that
of the control group, the colony diameter of C. gloeosporioides
treated with JZ-GX1 was significantly inhibited (Figure 1A).
With extension of the culture time, the relative rate of inhibition
by the VOCs produced by JZ-GX1 to C. gloeosporioides gradually
increased (Figure 1B), reaching 63.16% after 5 days of culture.
Morphological Changes of Mycelium
After Coculture of C. gloeosporioides
and Strain JZ-GX1
To observe the effect of the VOCs produced by JZ-GX1 on
the mycelium morphology of C. gloeosporioides, changes in
mycelium morphology were observed by SEM. The results
showed that the surface of the pathogenic mycelium treated with
JZ-GX1 VOCs was rough, with obvious wrinkles and collapsed
FIGURE 1 | Effect of R. aquatilis JZ-GX1 on the mycelial growth of
C. gloeosporioides.(A) Colony morphology of C. gloeosporioides in vitro.
(B) Colony diameter of C. gloeosporioides. Vertical bars represent the
standard deviation of the average. One-way ANOVA analysis was performed
and Duncan’s post hoc test was applied. Asterisks indicate statistically
significant differences (p<0.05) among treatments.
areas, while the surface of the mycelium without JZ-GX1 VOCs
treated was neat, plump and smooth (Figure 2).
Effect of VOCs Released by JZ-GX1 on
the Cell Membrane Permeability of
C. gloeosporioides
After the VOCs produced by JZ-GX1 were incubated with
C. gloeosporioides for 36 h, the OD260 of the centrifuged mycelial
suspension was significantly higher than that of the blank control
group (Figure 3A). The longer the incubation time with the
VOCs produced by JZ-GX1 was, the higher the OD260 value
of the centrifuged mycelial suspension, indicating that the cell
membrane of C. gloeosporioides was greatly damaged, that is, high
leakage of nucleic acids, by the VOCs.
The damage to C. gloeosporioides lipids by JZ-GX1 VOCs was
determined by measuring the MDA content. Compared with
that in the control, the content of MDA in the mycelium of
C. gloeosporioides increased after treatment with JZ-GX1 VOCs
for 60 h (Figure 3B), indicating that the VOCs produced by
JZ-GX1 enhanced the oxidative damage in the mycelium of
C. gloeosporioides. In addition, the soluble sugar concentration in
C. gloeosporioides in the treatment group was significantly lower
than that in the control group (Figure 3C), which also reflected
the hydrolysis of the mycelial cell wall of C. gloeosporioides.
R. aquatilis JZ-GX1 Inhibited the
Expression of Pathogenicity-Related
Genes in C. gloeosporioides
To better understand the effect of JZ-GX1 VOCs on the infection
of Liriodendron chinense ×tulipifera leaves by C. gloeosporioides,
the differential expression of pathogenicity-related genes in
C. gloeosporioides was analyzed. Compared with the expression
in the control, the selected genes were downregulated in the
presence of JZ-GX1 VOCs. In particular, the expression of
the PG gene was downregulated 19.61-fold. The expression
of PKS and SCD decreased 3.50- and 2.35-fold, respectively,
Frontiers in Microbiology | www.frontiersin.org 4May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 5
Kong et al. Biological Control
FIGURE 2 | Morphological observation of C. gloeosporioides via SEM. CK: untreated control group; JZ-GX1: treated with VOCs produced by R. aquatilis JZ-GX1.
FIGURE 3 | Effects of R. aquatilis JZ-GX1 on nucleic acid leakage (A), the MDA content (B), and the soluble sugar content (C) in the mycelia of C. gloeosporioides.
The vertical bars represent the standard deviation of the average. One-way ANOVA analysis was performed and Duncan’s post hoc test was applied. Different letters
indicate statistically significant differences (p<0.05) among treatments.
Frontiers in Microbiology | www.frontiersin.org 5May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 6
Kong et al. Biological Control
which was significantly different from their expression in the
control (Figure 4).
Inhibition by the VOCs Produced by
R. aquatilis JZ-GX1 of Infection by
C. gloeosporioides
The VOCs produced by JZ-GX1 significantly inhibited
leaf anthracnose on Liriodendron chinense ×tulipifera
caused by C. gloeosporioides (Figure 5A). Two days after
inoculation with C. gloeosporioides, the control leaves
of Liriodendron chinense ×tulipifera were completely
infected, while the incidence in leaves treated with the JZ-
GX1 strain was 45.7% (Figure 5B). After 2 and 4 days
of inoculation, the average spot diameters of leaves
treated with the JZ-GX1 strain were 5.67 and 15 mm,
respectively, while those of control leaves were 28.33 and
66 mm, respectively (Figure 5C). These results showed
that VOCs from the JZ-GX1 strain could significantly
inhibit the expansion of anthracnose spots in Liriodendron
chinense ×tulipifera leaves.
Collection and Identification of VOCs
From R. aquatilis JZ-GX1
The VOCs from JZ-GX1 were collected by an SPME syringe
and analyzed by a GC-MS/MS system. VOCs that were
also detected in the LB medium and VOCs with relative
contents less than 0.5% were filtered out. As shown in
Figure 6, there is a very obvious difference between the
control and strain JZ-GX1 (Supplementary Data Sheets S1,
S2). Eight VOCs released by JZ-GX1 were identified: two
acids, two alcohols, two ketones, one ester, and one ether.
The most abundant VOCs were 2-Phenylethyl methyl ether
(22.87 ±12.34% by GC), followed by phenylethyl alcohol
(16.67 ±6.61%). To evaluate their potential biological activity,
we purchased the reference materials in Table 2 and determined
their antagonistic activities against mycelium and conidia
of C. gloeosporioides.
FIGURE 4 | Relative expression of pathogenicity-related genes in
C. gloeosporioides treated with R. aquatilis JZ-GX1 VOCs. The vertical bars
represent the standard deviation of the average. One-way ANOVA analysis
was performed and Duncan’s post hoc test was applied. Different letters
indicate statistically significant differences (p<0.05) among treatments.
Determination of Antifungal VOCs and
Analysis of the Minimum Inhibitory
Concentration (MIC) of JZ-GX1 Against
C. gloeosporioides
Standards for 8 VOCs released by JZ-GX1 were used to determine
the antifungal activity against C. gloeosporioides. None of the
standards except phenylethyl alcohol, 3-methyl-1-butanol and
2-phenylethyl methyl ether exhibited antifungal activity. These
three standards were diluted to different concentrations and
cocultured with C. gloeosporioides in a sealed petri dish to detect
their antagonistic activity. In the concentration range of 10–
200 µL/L, all three standards easily volatilized and inhibited
mycelium growth and conidia germination. Among them, 3-
methyl-1-butanol showed the best antagonistic activity, with
MICs against anthracnose mycelium and conidia of 100 and
10 µL/L, respectively, followed by 2-phenylethyl methyl ether,
with MICs of 100 and 50 µL/L, respectively. For phenylethyl
alcohol, the inhibitory effect on C. gloeosporioides mycelium
growth and germination was not ideal, as its MIC was above
200 µL/L (Figure 7).
DISCUSSION
The VOCs from microorganisms are generally lipophilic and
have low boiling points. Therefore, they can be freely released
into the external environment from biofilms. Some VOCs can
act as signal transducers to communicate with other organisms
(Adam et al., 2017;Avalos et al., 2020). In recent years, an
increasing number of studies have shown that VOCs produced
by beneficial microorganisms will affect the growth of plant
pathogenic fungi. However, to date, there has been no report
on the production of VOCs with antifungal activity by Rahnella
spp. Moreover, there are few reports regarding the biological
activity of Rahnella spp. It has been reported that R. aquatilis
ZF7 has a strong rhizosphere colonization ability and broad-
spectrum plant growth-promoting activity (Yuan et al., 2019).
R. aquatilis HX2 can control grape root cancer by producing
bacteriocin (Li et al., 2014). In this study, we reported for
the first time that the VOCs produced by R. aquatilis JZ-
GX1 can inhibit the mycelium growth and spore germination
of C. gloeosporioides.
Understanding the antagonistic characteristics of volatile
microbial metabolites is helpful to further reveal the biological
mechanism of antagonistic bacteria. The cell membrane is the
basis for maintaining cell integrity and normal material and
energy metabolism. When the cell membrane is destroyed,
some intracellular proteins, phosphates, carbonates, DNA and
RNA will be released, and these nuclear substances strongly
absorb UV at 260 nm (Vitro et al., 2005). Chen and Cooper
(2002) reported that some antimicrobial substances can destroy
the cell membrane of microorganisms and increase their cell
membrane permeability to achieve bacteriostasis. Therefore,
a change in cell membrane integrity can be inferred by
detecting the ultraviolet absorption of a suspension. In this
study, as the treatment time with R. aquatilis JZ-GX1 VOCs
Frontiers in Microbiology | www.frontiersin.org 6May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 7
Kong et al. Biological Control
FIGURE 5 | Inhibition by JZ-GX1 of spot expansion on Liriodendron chinense ×tulipifera leaves. (A) Symptoms of anthracnose in leaves, (B) incidence of
anthracnose in leaves, and (C) spot diameter of anthracnose. One-way ANOVA analysis was performed and Duncan’s post hoc test was applied. The vertical bars
represent the standard deviation of the mean. Different letters indicate statistically significant differences (p<0.05) among treatments.
FIGURE 6 | GC-MS/MS spectra of the VOCs emitted from JZ-GX1 incubated in LB medium for 48 h (JZ-GX1) and non-inoculated LB medium (CK).
increased, more nucleic acids leaked out of C. gloeosporioides.
Similarly, MDA is one of the most important products of
membrane lipid peroxidation. The degree of membrane lipid
peroxidation can be determined by measuring the content of
MDA, and the damage degree of the membrane system can
be determined indirectly (Xu et al., 2017). Some studies have
shown that the fermentation broth of Trichoderma virens T43
can hydrolyze the proteins and sugars of pathogenic fungi,
increase the content of MDA, and eventually lead to cell
death (Yin et al., 2014). In this study, the MDA content in
the mycelium of C. gloeosporioides treated with JZ-GX1 VOCs
for 4 days was significantly higher than that of the control
group, and the soluble sugar content decreased in the mycelia
of C. gloeosporioides stressed by JZ-GX1 VOCs. Therefore,
Frontiers in Microbiology | www.frontiersin.org 7May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 8
Kong et al. Biological Control
TABLE 2 | GC-MS/MS VOC profile of strain JZ-GX1.
Retention
time (min)
Relative peak
area (%)
CAS# Compound
4.11 ±0.00 0.78 ±0.65 123-51-3 1-Butanol, 3-methyl-
5.05 ±0.01 0.51 ±0.16 123-92-2 1-Butanol, 3- methyl-,
acetate
6.21 ±0.01 1.52 ±0.39 6068-76-4 3,20-Dihydroxyflavone
8.62 ±0.01 22.87 ±12.34 3558-60-9 2-Phenylethyl methyl
ether
8.95 ±0.01 1.52 ±0.44 2078-13-9 4-Hydroxybenzoic acid
9.38 ±0.01 16.67 ±6.61 60-12-8 Phenylethyl Alcohol
12.05 ±0.00 0.55 ±0.33 53044-27-2 Phosphonoacetic Acid,
3TMS derivative
13.27 ±0.02 1.23 ±0.53 112-12-9 2-Undecanone
Data are presented as means of three replicates ±standard deviation (SD).
it is speculated that one of the targets of JZ-GX1 VOCs
is a location on the C. gloeosporioides cell membrane, and
antagonistic effects can be achieved by destroying the integrity
of the cell membrane.
In the process of infecting a host, a pathogen will efficiently
regulate the expression of its own pathogenicity-related genes,
thus regulating the growth of conidia or hyphae in a direction
conducive to its own infection, realizing the smooth colonization
of the pathogen and causing the host to be susceptible to
disease (Lin et al., 2012;Upadhyay et al., 2013). For this reason,
we further discussed the expression of three pathogenicity-
related genes, SCD,PG, and PKS. Some studies have shown
that the appressorium plays an important role in infection
by C. gloeosporioides: melanin synthesis and accumulation can
increase the swelling and pressure of the appressorium, thus
promoting successful pathogen infection. SCD is one of the key
enzymes in the melanin biosynthesis pathway, and the expression
of this gene will affect the infection efficiency of C. gloeosporioides
(Nosanchuk and Casadevall, 2006). PG in the pathogen can
degrade pectin in the cell wall of the host and promote host
colonization (Alkan et al., 2015). PKS is a key enzyme that
regulates the synthesis of polyketones, secondary metabolites
involved in defense or cell-to-cell communication (Noar et al.,
2019). In this study, qPCR assays showed that all three key genes
were downregulated by VOCs, which suggested that the VOCs of
JZ-GX1 interfered with the infection activity, colonization ability
and host resistance of C. gloeosporioides, thus reducing the degree
of infection in the leaves of Liriodendron chinense ×tulipifera.
To determine which VOCs produced by R. aquatilis JZ-
GX1 inhibited the growth of C. gloeosporioides, the commonly
used headspace SPME and GC-MS techniques were used to
analyse individual VOCs. The main VOCs produced by JZ-
GX1 included eight compounds: ketones, hydrocarbons, ethers,
esters, and alcohols. Among them, 3-methyl-1-butanol and 2-
phenylethyl methyl ether had the best antagonistic effects against
C. gloeosporioides. Previous studies have reported the antifungal
properties of 3-methyl-1-butanol. For example, the VOCs
produced by the endophytic fungus Phaeosphaeria nodorum
include 3-methyl-1-butanol, which inhibits the growth of the
mycelium of peach brown rot and leads to mycelial disintegration
FIGURE 7 | Three individual compounds, 2-phenylethyl methyl ether,
phenylethyl alcohol and 3-methyl-1-butanol, at different concentrations were
assayed for their inhibitory activity against the mycelial growth and conidial
germination of C. gloeosporioides.
(Pimenta et al., 2012). The median effective dose of 3-methyl-
1-butanol produced by Muscodor suthepensis CMUCib462 was
250.29 ±0.29 µL/L against Penicillium digitatum growth
(Suwannarach et al., 2016). 2-Phenylethyl methyl ether has a
pleasant floral fragrance, so it is widely used as an ingredient
and flavoring in the food and cosmetics industries (Pan et al.,
2013;Li H. H. et al., 2017). However, there are no reports
about this compound in the antifungal volatile components
of plants or microorganisms in the existing literature. In this
study, we first reported that 2-phenylethyl methyl ether has
strong inhibitory activity against C. gloeosporioides, but whether
it has antagonistic effects against other pathogens remains to
be further studied. Although the relative content of 3-methyl-
1-butanol in JZ-GX1 VOCs is relatively low, 10 µL of the pure
compound can inhibit the germination of C. gloeosporioides
spores. However, phenylethyl alcohol, which accounts for a
relatively high percentage of the VOC profile, did not show
antifungal activity. The content of each VOC produced by a
microorganism is not directly related to its inhibitory effect
on pathogenic fungi: some compounds are abundant, but their
inhibitory effect on pathogenic fungi is not obvious, while
the content of some compounds is low, but their inhibitory
effect is significant.
In summary, this study proved for the first time that
VOCs produced by Rahnella spp. could directly inhibit the
spore germination and mycelial growth of C. gloeosporioides,
significantly reduce the contents of nucleic acids and soluble
sugars in pathogenic mycelia, increase the content of MDA,
destroy the integrity of the cell membrane and decrease the
expression of pathogenic genes. As a result, the infection activity
and vitality of the pathogen were reduced, and the occurrence
and damage degree of black spot in the leaves of Liriodendron
chinense ×tulipifera were reduced. Two VOCs with antifungal
activity in JZ-GX1 were studied and identified. Considering the
wide host range of C. gloeosporioides, which can infect the leaves
Frontiers in Microbiology | www.frontiersin.org 8May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 9
Kong et al. Biological Control
and fruits of many plants, the discovery of these antifungal
compounds is of practical significance for the development of
new fungicides. Furthermore, the application of strain JZ-GX1
to the storage and preservation of postharvest fruit and the
biological fumigation of soil-borne diseases will also have good
application prospects.
DATA AVAILABILITY STATEMENT
All datasets generated for this study are included in the
article/Supplementary Material.
AUTHOR CONTRIBUTIONS
W-LK completed the data analysis and the first draft of the
manuscript. W-LK and LR were the finishers of the experimental
research. HN participated in the experimental result analysis.
X-QW directed experimental design, data analysis, manuscript
writing and revision. All authors read and agreed on the final text.
FUNDING
This work was supported by the National Key Research and
Development Program of China (2017YFD0600104) and the
Priority Academic Program Development of the Jiangsu Higher
Education Institutions (PAPD).
ACKNOWLEDGMENTS
We would like to thank Dr. Xiao-Yue Ji of the Modern Analysis
and Testing Center of Nanjing Forestry University for his
technical assistance in gas chromatography analysis.
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found
online at: https://www.frontiersin.org/articles/10.3389/fmicb.
2020.01114/full#supplementary-material
DATA SHEET S1 | Report of GC-MS spectra from CK.
DATA SHEET S2 | Report of GC-MS spectra from JZ-GX1.
REFERENCES
Adam, O., Sylwia, J., and Paolina, G. (2017). The antimicrobial volatile power of
the rhizospheric isolate Pseudomonas donghuensis P482. PLoS One 12:e0174362.
doi: 10.1371/journal.pone.0174362
Alkan, N., Friedlander, G., and Ment, D. (2015). Simultaneous transcriptome
analysis of Colletotrichum gloeosporioides and tomato fruit pathosystem reveals
novel fungal pathogenicity and fruit defense strategies. New Phytol. 205:801.
doi: 10.1111/nph.13087
Avalos, M., Garbeva, P., and Raaijmakers, J. M. (2020). Production of ammonia as
a low-cost and long-distance antibiotic strategy by Streptomyces species. ISME
J. 14, 569–583. doi: 10.1038/s41396-019- 0537-2
Chanchaichaovivat, A., Ruenwongsa, P., and Panijpan, B. (2007). Screening and
identification of yeast strains from fruits and vegetables: potential for biological
control of postharvest chilli anthracnose (Colletotrichum capsica). Biol. Control
42, 326–335. doi: 10.1016/j.biocontrol.2007.05.016
Chen, C. Z., and Cooper, S. L. (2002). Interactions between dendrimer biocides and
bacterial membranes. Biomaterials 23, 3359–3368. doi: 10.1016/S0142-9612(02)
00036-4
Edgar, G. A., Adriana, B. A., Ana-Luisa, K. M., Mónica, R. V., Alfonso, M. B.,
Aguirre, W. E., et al. (2019). Avocado rhizobacteria emit volatile organic
compounds with antifungal activity against Fusarium solani,Fusarium sp.
associated with Kuroshio shot hole borer, and Colletotrichum gloeosporioides.
Microbiol. Res. 219, 74–83. doi: 10.1016/j.micres.2018.11.009
Eva, A., Sandra, T., Carmen, V., Antonio, V., and Francisco, C. M. (2019). Fitness
features involved in the biocontrol interaction of Pseudomonas chlororaphis
with host plants: the case study of PcPCL1606. Front. Microbiol. 10:719. doi:
10.3389/fmicb.2019.00719
Gao, Z. F., Zhang, B. J., Liu, H. P., Han, J. C., and Zhang, Y. J. (2017). Identification
of endophytic Bacillus velezensis ZSY-1 strain and antifungal activity of its
volatile compounds against Alternaria solani and Botrytis cinerea.Biol. Control
105, 27–39. doi: 10.1016/j.biocontrol.2016.11.007
Gong, A. D., Dong, F. Y., Hu, M. J., Kong, X. W., Wei, F. F., Gong, S. J., et al.
(2019). Antifungal activity of volatile emitted from Enterobacter asburiae Vt-7
against Aspergillus flavus and aflatoxins in peanuts during storage. Food Control
106:106718. doi: 10.1016/j.foodcont.2019.106718
Huang, L., Li, Q. C., Hou, Y., Li, G. Q., Yang, J. Y., Li, D. W., et al. (2017). Bacillus
velezensis strain HYEB5-6 as a potential biocontrol agent against anthracnose
on Euonymus japonicus.Biocontrol Sci. Technol. 27, 636–653. doi: 10.1080/
09583157.2017.1319910
Huang, L., Zhu, Y. N., Yang, J. Y., Li, D. W., Li, Y., Bian, L. M., et al.
(2018). Shoot blight on Chinese fir (Cunninghamia lanceolata) is caused
by Bipolaris oryzae.Plant Dis. 102, 500–506. doi: 10.1094/PDIS-07-1
7-1032-RE
Jeon, C. W., Kim, D. R., and Kwak, Y. S. (2019). Valinomycin, produced
by Streptomyces sp. S8, a key antifungal metabolite in large patch disease
suppressiveness. World J. Microbiol. Biotechnol. 35:128. doi: 10.1007/s11274-
019-2704- z
Jiang, C. H., Liao, M. J., Wang, H. K., Zheng, M. Z., Xu, J. J., and Guo, J. H.
(2018). Bacillus velezensis, a potential and efficient biocontrol agent in control
of pepper gray mold caused by Botrytis cinereal.Biol. Control 26, 147–157.
doi: 10.1016/j.biocontrol.2018.07.017
Kong, W. L., Wu, X. Q., and Zhao, Y. J. (2019a). Effects of Rahnella aquatilis JZ-
GX1 on treat chlorosis induced by iron deficiency in Cinnamomum camphora.
J. Plant Growth Regul. doi: 10.1007/s00344-019-10029-8
Kong, W. L., Zhou, M., and Wu, X. Q. (2019b). Characteristics of siderophores
production by Rahnella aquatilis JZ-GX1 and its antagonism against forest
pathogens, (in Chinese). Microbiol. China 46, 3278–3285. doi: 10.13344/j.
microbiol.china.190070
Li, G. E., Wu, X. Q., Ye, J. R., Hou, L., Zhou, A. D., and Zhao, L. (2013).
Isolation and identification of phytate-degrading rhizobacteria with activity of
improving growth of poplar and Masson pine. World J. Microbiol. Biotechnol.
29, 2181–2193. doi: 10.1007/s11274-013- 1384-3
Li, H. H., Hu, X. M., Li, A. J., Sun, J. Y., Huang, M. Q., Sun, X. T., et al.
(2017). Comparative analysis of volatile components in gujinggong liquor
by headspace solid-phase microextraction and stir bar sorptive extraction,
(in Chinese). Food Sci. 38, 155–164. doi: 10.7506/spkx1002-6630-201
704025
Li, L., Jiao, Z. W., Hale, L., Wu, W. L., and Guo, Y. B. (2014). Disruption of
gene pqqA or pqqB reduces plant growth promotion activity and biocontrol
of crown gall disease by Rahnella aquatilis HX2. PLoS One 9:e115010. doi:
10.1371/journal.pone.0115010
Li, Z. Q., Ding, B., Zhou, X. P., and Wang, G. L. (2017). The rice dynamin-related
protein OsDRP1E negatively regulates programmed cell death by controlling
the release of cytochrome c from mitochondria. PLoS Pathog. 13:e1006157.
doi: 10.1371/journal.ppat.1006157
Frontiers in Microbiology | www.frontiersin.org 9May 2020 | Volume 11 | Article 1114
fmicb-11-01114 May 28, 2020 Time: 13:20 # 10
Kong et al. Biological Control
Lin, S. Y., Okuda, S., and Ikeda, K. (2012). LAC2 encoding a secreted
laccase is involved in appressorial melanization and conidial pigmentation in
Colletotrichum orbiculare.Mol. Plant Microb. Interact. 25, 1552–1561. doi: 10.
1094/MPMI-05- 12-0131- R
Noar, R. D., Thomas, E., and Daub, M. E. (2019). A novel polyketide synthase
gene cluster in the plant pathogenic fungus Pseudocercospora fijiensis.PLoS One
14:e0212229. doi: 10.1371/journal.pone.0212229
Nosanchuk, J. D., and Casadevall, A. (2006). Impact of melanin on microbial
virulence and clinical resistance to antimicrobial compounds. Antimicrob.
Agents Chemother. 50, 3519–3528. doi: 10.1128/AAC.00545-06
Pan, L. J., Wan, J. J., Huang, Y. F., and Li, X. C. (2013). Study on analysis of Michelia
Flower and Michelia leaf oil by GC/MS and their application in Fragrances, (in
Chinese). Flav. Frag. Cosmet. 2, 1–6.
Pimenta, R. S., Silva, J. F., Buyer, J. S., and Janisiewicz, W. J. (2012). Endophytic
fungi from plums (Prunus domestica) and their antifungal activity against
Monilinia fructicola.J. Food Prot. 75, 1883–1889. doi: 10.4315/0362-028X.JFP-
12-156
Randa, Z., Zahoor, U. H., Roda, A. T., Quirico, M., and Samir, J. (2019). In-vitro
application of a Qatari Burkholderia cepacia strain (QBC03) in the biocontrol
of Mycotoxigenic fungi and in the reduction of ochratoxin a biosynthesis by
Aspergillus carbonarius.Toxins 11:700. doi: 10.3390/toxins11120700
Roxane, R., Amy, N., and Tanya, A. (2018). Transcriptome alteration in
Phytophthora infestans in response to phenazine-1-carboxylic acid production
by Pseudomonas fluorescens strain LBUM223. BMC Genomics 19:474. doi: 10.
1186/s12864-018- 4852-1
Shang, J., Liu, B. L., and Xu, Z. (2020). Efficacy of Trichoderma asperellum TC01
against anthracnose and growth promotion of Camellia sinensis seedlings. Biol.
Control 143:104205. doi: 10.1016/j.biocontrol.2020.104205
Sharifah, F. S., Lilia, C. C., Elvis, T. C., Fong, Y. C., Peter, M. M., Eladl, G. E.,
et al. (2019). Soil bacterial diffusible and volatile organic compounds inhibit
Phytophthora capsica and promote plant growth. Sci. Total Environ. 692, 267–
280. doi: 10.1016/j.scitotenv.2019.07.061
Sharifi, R., and Ryu, C. M. (2018). Revisiting bacterial volatile-mediated plant
growth promotion: lessons from the past and objectives for the future. Ann.
Bot. 122, 349–358. doi: 10.1093/aob/mcy108
Song, F. X., Wu, X. Q., and Zhao, Q. (2017). Antagonism of plant growth-
promoting bacteria Rahnella aquatilis JZ-GX1 to canker in poplar,(in C hinese).
J. Nanjing Forest. Univ. 41, 42–48. doi: 10.3969/j.issn.1000-2006.201603054
Su, C. L., Kang, H., Mei, Z. D., Yang, S. Y., Liu, X. M., Pu, J. J., et al. (2018).
Expression analysis of pathogenic genes during the infection of Colletotrichum
gloeosporioides to mango, (in Chinese). Biotechnol. Bull. 34, 182–186. doi: 10.
13560/j.cnki.biotech.bull.1985.2018-0295
Suwannarach, N., Bussaban, B., Nuangmek, W., Pithakpol, W., Jirawattanakul,
B., Matsui, K., et al. (2016). Evaluation of Muscodor suthepensis strain
CMU-Cib462 as a postharvest biofumigant for tangerine fruit rot caused
by Penicillium digitatum.J. Sci. Food Agric. 96, 339–345. doi: 10.1002/jsfa.
7099
Tagele, S. B., Lee, H. G., Kim, S. W., and Lee, Y. S. (2019). Phenazine
and 1-undecene producing Pseudomonas chlororaphis subsp. aurantiaca
Strain KNU17Pc1 for growth promotion and disease suppression in Korean
maize cultivars. J. Microbiol. Biotechnol. 29, 66–78. doi: 10.4014/jmb.1808.
08026
Tang, L. H., Mo, J. Y., Guo, T. X., Huang, S. P., Li, Q. L., Ning, P., et al.
(2019). In vitro antifungal activity of dimethyl trisulfide against Colletotrichum
gloeosporioides from mango. World J. Microbiol. Biotechnol. 36:4. doi: 10.1007/
s11274-019- 2781-z
Upadhyay, S., Torres, G., and Lin, X. R. (2013). Laccases involved in 1,8-
Dihydroxynaphthalene melanin biosynthesis in Aspergillus fumigatus are
regulated by developmental factors and copper homeostasis. Eukaryot. Cell 12,
1641–1652. doi: 10.1128/EC.00217-13
Vitro, R., Manas, P., and Alvarez, I. (2005). Membrane damage and microbial
inactivation by chlorine in the absence and presence of a chlorine-demanding
substrate. Appl. Environ. Microbiol. 71, 5022–5028. doi: 10.1128/AEM.71.9.
5022-5028.2005
Wan, M., Li, G., Zhang, J., Jiang, D., and Huang, H. C. (2008). Effect of volatile
substances of Streptomyces platensis F-1 on control of plant fungal diseases. Biol.
Control 46, 552–559. doi: 10.1016/j.biocontrol.2008.05.015
Wang, J., Cao, J. M., Chen, D. X., Qiu, J., Wang, X. Q., Feng, C., et al. (2018).
Antimicrobial effect and components analysis of volatile organic compounds
from Bacillus pumilus AR03, (in Chinese). Sci. Agric. Sin. 51, 1908–1919. doi:
10.3864/j.issn.0578-1752.2018.10.010
Wang, Q. H., Fan, K., and Li, D. W. (2019). Identification, virulence and
fungicide sensitivity of Colletotrichum gloeosporioides s.s. responsible for walnut
anthracnose disease in China. Plant Dis. 104, 1358–1368. doi: 10.1094/PDIS-
12-19- 2569-RE
Wu, S. Y., Zhen, C. Y., Wang, K., and Gao, H. Y. (2019). Effects of Bacillus
Subtilis CF-3 VOCs combined with heat treatment on the control of Monilinia
fructicola in peaches and Colletotrichum gloeosporioides in litchi fruit. J. Food
Sci. 84, 3418–3428. doi: 10.1111/1750-3841.14949
Xu, X. B., Lei, H. H., Ma, X. Y., Lai, T. F., Song, H. M., Shi, X. Q., et al. (2017).
Antifungal activity of 1-methylcyclopropene (1-MCP) against anthracnose
(Colletotrichum gloeosporioides) in postharvest mango fruit and its possible
mechanisms of action. Int. J. Food Microbiol. 241, 1–6. doi: 10.1016/j.
ijfoodmicro.2016.10.002
Yin, D. C., Deng, X., Ilan, C. H. E. T., and Song, R. Q. (2014). Inhibitory effect and
mechanism of Trichoderma virens T43 on four important forest pathogens, (in
Chinese). Chin. J. Ecol. 33, 1911–1919. doi: 10.13292/j.1000-4890.20140429.009
Yuan, L. F., Li, L., Zheng, F., Shi, Y. X., Xie, X. W., Chai, A., et al. (2019). The
complete genome sequence of Rahnella aquatilis ZF7 reveals potential beneficial
properties and stress tolerance capabilities. Arch. Microbiol. 202, 483–499. doi:
10.1007/s00203-019- 01758-1
Zhang, C. H. (2015). Study on the Inhibiting of Volites Produced by Streptomyces
Alboflavus TD-1 on Botrytis Cinerea: (in Chinese). Ph.D. thesis, Tianjin
University of Science &Technology, Tianjin.
Zhang, P. P. (2013). Effects of Some Plant Growth-Promotion Rhizobacteria Volites
on Arabidopsis and Antagonistic Properties: (in Chinese). Ph.D. thesis, Shandong
Agricultural University, Taian.
Zhang, Y., Li, T. J., Liu, Y. F., Li, X. Y., Zhang, C. M., Feng, Z. Z., et al. (2019).
Volatile organic compounds produced by Pseudomonas chlororaphis subsp.
aureofaciens SPS-41 as biological fumigants to control Ceratocystis fimbriata in
postharvest sweet potato. J. Agric. Food Chem. 67, 3702–3710. doi: 10.1021/acs.
jafc.9b00289
Zhu, L. H., Wan, Y., and Zhu, Y. N. (2019). First report of species of colletotrichum
causing leaf spot of Liriodendron chinense ×tulipifera in China. Plant Dis.
103:1431. doi: 10.1094/PDIS-12- 18-2265-PDN
Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Copyright © 2020 Kong, Rui, Ni and Wu. This is an open-access article distributed
under the terms of the Creative Commons Attribution License (CC BY). The use,
distribution or reproduction in other forums is permitted, provided the original
author(s) and the copyright owner(s) are credited and that the original publication
in this journal is cited, in accordance with accepted academic practice. No use,
distribution or reproduction is permitted which does not comply with these terms.
Frontiers in Microbiology | www.frontiersin.org 10 May 2020 | Volume 11 | Article 1114
Available via license: CC BY
Content may be subject to copyright.
