Content uploaded by Ali Javadmanesh
Author content
All content in this area was uploaded by Ali Javadmanesh on May 07, 2020
Content may be subject to copyright.
E-NAMTILA Publishing DYSONA - Life Science
DLS 1 (2020) 20-24 DOI: 10.30493/dls.2020.105085
20
All published articles in DYSONA - Life Science
journal are distributed under a Creative Commons Attribution 4.0
International License.
DYSONA Applied Science ISSN: xxxx-xxxx
Genetic similarity comparison between some
Iranian and Middle Eastern sheep breeds
using mitochondrial control region
sequencing
Abdulaziz Hamadalahmad 1,2; Mohie Almeziad 2; Ali Javadmanesh 1*
1, Department of Animal Science, Faculty of Agriculture, Ferdowsi University of Mashhad, Iran
2, Department of Animal Science, Faculty of Agriculture, University of Aleppo, Syria
Abstract
E-mail:
javadmanesh@um.ac.ir
Received: 01/11/2019
Acceptance: 13/12/2019
Available Online: 18/03/2020
Published: 01/04/2020
Sheep has been an essential source of food to the inhabitants of the Iranian
plateau for centuries. Furthermore, this geographic area is considered the
original place of sheep domestication. Phylogenetic studies are highly
important in understanding the evolutionary relationships among species. This
understanding assists in decision making and planning for genetic resources
conservation programs. Analyzing sequences of mitochondrial genome regions
provides more reliable evidence regarding the genetic diversity and
evolutionary origin of the species, due to the high rate of mitochondrial genome
evolution compared to the nucleus. The aim of this study was to use the
sequence of mitochondrial control region to investigate the phylogenetic
relationship and genetic distances between some domestic sheep breeds of Iran
and other Middle Eastern countries. For this purpose, blood samples were
collected from Zel, Dalagh, and Mehrabani sheep breeds. After DNA extraction,
polymerase chain reaction (PCR) was carried out using specific primers for the
targeted mitochondrial genome. Then, PCR products were purified and a
standard sequencing was performed. Sequences obtained from this study were
compared with other (NCBI) registered sequences of Middle Eastern breeds.
Analysis of phylogenetic tree of the main haplotypes of sheep revealed that Zel
breed was grouped in the haplotype B with other thin-tailed breeds, such as
Karayaka and Sakiz. On the other hand, Mehrabani sheep breed was placed in
the haplotype A along with other Middle Eastern fat-tailed breeds such as
Naeimi and Saidi. This study provided additional proof for the use of control
region sequence as a precise method of genetic distance estimation among
sheep breeds.
Keywords: Control region,
genetic distance, Iranian
sheep, Middle East sheep,
mitochondrial genome
1. Introduction
The contribution of sheep (Ovis aries) as a source of meat, wool, skin, and milk in Iran and worldwide is undeniable.
The studies of genetic characteristics for different sheep breeds provide the guiding information for breeding and
conservation programs to maintain and improve production efficiency. Mitochondrial DNA has previously shown the
good potential of use in genetic and population evolution studies [1]. Iran is considered the primary sheep
domestication place in the world with high sheep numbers (50 million) and diversity in breeds and ecotypes (27
different breeds and ecotypes) [2]. Sheep domestication initially took place in the broad area north of the Zagros
mountains range of Iran to the southeast of Anatolia in Turkey. A geographical connection between Asia and Europe
was found due to the regions of Asia Minor and the Middle East, which helped the gene flow, mixing, and
differentiation since sheep domestication to happen [3]. There are already over two hundred known breeds of sheep
DYSONA – Life Science 1 (2020) 20-24 Hamadalahmad et al.
21
throughout the world, which is considered a diversity barely seen in other animals. Furthermore, some animal
scientists believe that domesticated sheep was originated from the European and Asian wild sheep [4].
Indigenous breeds of a certain country are considered a national and strategic resource of that country's economy and
prosperity. Due to the low selection, the high number of breeders, and the limited use of artificial insemination, these
breeds are often highly genetically diverse. The increasing awareness of indigenous breeds' importance as a genetic
source to introduce new breeds of desirable traits has necessitated the preservation of genetic diversity of the native
livestock [5]. Furthermore, it is reported that by decreasing the genetic diversity within a species, it becomes l ess
likely to adapt to biotic and abiotic stresses [6]. Therefore, indigenous breeds’ genetic diversity should be carefully
calculated in order to perform efficient conservation that relies on a base of in-depth Genetics knowledge [7].
The mammalian mitochondrial genome is a circular double-stranded DNA molecule of about 16 Kb that contains the
ribosomal, transporter, and messenger RNAs genes. In sheep, the mitochondrial genome comprises 16.58 kb with a
gene layout and organize similar to those of other mammals [8].
The evolution rate of mtDNA is approximately 6 times faster than nuclear DNA [9]. Furthermore, maternal mtDNA is
inherited, haploid, and non-recombinant [10]. These features rendered mtDNA as a useful tool to determine
relationships between individuals within and between species [9][11] and a useful marker for cross-sectional
diagnosis among groups that have been separated for 100-1000 years [12].
Iran has diverse phenotypes of sheep regarding morphology of the tail. Several studies investigated the genetic
distances between some domestic breeds, although there was not a comparison between fat-tailed, thin-tailed and
semi fat-tailed breeds. In light of the previous hypotheses, we tried to use the sequence of mitochondrial control
region to investigate the phylogenetic relationship between some domestic sheep breeds of Iran, Middle Eastern
countries and major mitochondrial haplotypes.
2. Materials and Methods
2.1. Blood samples and DNA extraction
Three Iranian sheep breeds (Zel, Dalagh, and Mehrabani) were chosen for the study, and five blood samples were
collected from each breed. These breeds were selected for this study based on their tail size and shape as presented in
(Table 1) along with other breeds’ characteristics. The total DNA extraction was performed using NEXprepTM Blood
DNA Mini Kit (NEX Diagnostics- South Korea). DNA quality and quantity were determined using gel electrophoresis
(Gel Red stained 1% agarose) and Epoch microplate reader (BioTek, USA), respectively.
Table 1. Main characteristics for the three Iranian sheep breeds used in the study
Sheep
Breed
Type
Main production region
Numbers
(million)a [14]
Production
system
Main
products
Dalagh
Semi Fat-tailed [13]
North [14] (Golestan [13] )
0.1
Semi-nomadic,
mixed crop
livestock and
village [14]
Meat [14]
Mehrabani
Fat-tailed [14]
Centre [14]
1
Zel
Thin-tailed [15]
North [14]
2
a. Numbers as of 2000 [14]
2.2. Primer design and Polymerase Chain Reaction (PCR)
To amplify the mitochondrial control region, a primer pair was designed according to the reference sequence
(accession number NC_001941.1) (Table 2) and using Primer Premier 5 software (PREMIER Biosoft, USA). The primer
pair was then evaluated with primer BLAST against the NCBI database.
DYSONA – Life Science 1 (2020) 20-24 Hamadalahmad et al.
22
Table 2. Specific primer sequences, amplicon size, and the annealing temperature
GenBank source
NCBI Reference
Sequence
Primer pair
Annealing
temperature
(○C)
PCR
amplicon
size (bp)
Ovis aries mitochondrion
complete genome
NC_001941.1
5' AACTTGCTAAAACTCCCAAACATAC 3'
58
1075
5' GTTGGAGTATGAATTTGAGTATTGAG 3'
PCR was performed using the T-Personal thermocycler (Biometra, Germany). The PCR program consisted of 10 min
initial enzyme activation period at 95 ○C followed by 38 cycles of denaturation (95 ○C for 45 seconds), annealing (58
○C for 30 seconds), and amplification (72 ○C for 90 seconds); the program was concluded with a final amplification
step of 10 minutes at 72 ○C.
After electrophoresis, PCR products were analyzed by electrophoresis on 1% agarose gel and the amplified products
were purified using the Gel extraction kit (Dena Zist Asia, Iran); Then, 20 μL of the purified PCR products were sent to
be bi-directional sequenced. The quality of the obtained sequences was evaluated using BioEdit 5.2.7 and Chromas
Lite 2.01 software.
2.3. Sequences alignment and phylogenetic tree plotting
To determine the phylogenetic relationships and overlap, all the sequences were aligned against the haplotype
sequences (Haplotype A: AY829400, B: HM236176, C: DQ903302, D: HM236180, and E: HM236183) in addition to
Middle Eastern sheep sequences (Turkey: Herik (KF677119), Sakiz (KF677172) and Karayaka (JN574157), Saudi
Arabia: Naeimi (JN574177), Egypt: Saidi (KC461241) and Ossimi (JN573952), Iraq: Karadi (FJ545136), Hamdani
(FJ545135), and Syria: Awassi (FJ545134)). The phylogenetic tree was plotted and genetic distances estimated using
CLC Sequence Viewer 7.6 software (Qiagen, Germany).
3. Results and Discussion
DNA was successfully extracted from all samples. The results of spectroscopy and agarose gel electrophoresis showed
that the extracted DNA samples were free of contaminations and with high integrity. After PCR, electrophoresis of the
reaction product on 1% agarose gel showed that the designed primers amplified the targeted template efficiently and
the 1075 bp amplicons bands were sharp and specific (Fig. 1 A)
All the amplified fragments were sequenced, and the results were evaluated in terms of sequencing quality and
accuracy. The low-quality nucleotides were trimmed from both ends of the target amplicons. The final sequences were
recorded in the NCBI Nucleotide database under GenBank accession numbers: (Zel: MH699973, Dalag: MH699967,
and Mehrabani: MH553570).
The phylogenetic tree (Fig. 1 B) showed that the Mehrabani breed was placed along with other breeds (Saeedi, Naimi,
and Haryk) in haplotype A, and all of which were fat-tailed. On the other hand, Zel breed was located in Haplotype B
alongside the European thin-tailed breeds, which was in agreement with other reports regarding the domestication of
Iranian sheep, which illustrated that most of the Iranian sheep breeds such as Moghani, Lori Bakhtiari, Sangsari,
Baluchi, Kermani, Shal, Karakul, and Kordi are located in haplotype A. [1][16][17]. Interestingly, phylogenetic results
showed that Dalagh breed was close to Zel breed, probably due to their close herding locations distribution in
Mazandaran and Golestan provinces, North of Iran. The Awassi breed was found in haplotype E, which is consistent
with the results of [3]. Our results also showed that Iranian sheep breeds are closer to those of neighboring countries
(Iraq and Syria) than those of more distant locations (Turkey, Egypt, and Saudi Arabia), which was an expected result
due to geographical distances.
In a study of European, Caucasian and Asian sheep mitochondrial genome diversity, it was reported that most Asian
sheep breeds were located in haplotypes B and A with 72% and 22% of the studied breeds, respectively [18].
DYSONA – Life Science 1 (2020) 20-24 Hamadalahmad et al.
23
So far, five haplotypic sheep groups have been identified (A-E)
[19] where haplotypes A and B breeds are mainly located in Asia
and Europe, haplotype breeds C in China, Caucasus, Turkey, and
Portugal, haplotype D in the Caucasus, Karachi, and Romania,
while haplotypes group E in the Middle East region.
The geographical locations of both haplotypes A and B were first
reported by Wood and Phua [20]. Following, Hiendleder et al
[21], carried out a complete sequencing of the domestic sheep
mitochondrial genome and compared several different European
and Asian breeds, and reported two major haplotype groups A
and B originated from Asian and European sheep. They also
suggested that the emergence of these two groups was due to the
fact that present-day sheep breeds were derived from two
different maternal ancestors and occurred almost simultaneously
in the Near East.
4. Conclusion
Based on previous reports, most fat-tailed breeds of Iran
categorized as haplotype A which is mainly originated in Asia and
the Middle East. The Zel breed, the only thin tailed sheep of Iran,
placed closer to haplotype B which might indicate a different
domestication history. Therefore, further research is required to
assess the divergence time of Iranian native sheep breeds.
5. Acknowledgments
This study was supported by the Ferdowsi University of Mashhad;
Grant number: 3/44590.
References
1. Rafia P, Tarang A. Sequence variations of mitochondrial DNA displacement-loop in Iranian indigenous sheep
breeds. Iran J Appl Anim Sci. 2016;6(2):363-8.
2. Zamani P, Akhondi M, Mohammadabadi MR, Saki AA, Ershadi A, Banabazi MH, Abdolmohammadi AR. Genetic
variation of Mehraban sheep using two intersimple sequence repeat (ISSR) markers. Afr. J. Biotechnol.
2011;10(10):1812-7.
3. Meadows JR, Hiendleder S, Kijas JW. Haplogroup relationships between domestic and wild sheep resolved using a
mitogenome panel. Heredity. 2011;106(4):700. DOI
4. Saadat Nouri M, Siah Mansoor P. Principles of sheep keeping and breeding. Ashraf Publications; 1996
5. Frankham R. Conservation of genetic diversity for animals. The proceedings of the 5th world congress on genetics
Applied to livestock production, University of Guelph, Ontario, Canada 1994;21: 385-392.
6. Askari N, Mohamad Abadi M, Baghizadeh A. ISSR markers for assessing DNA polymorphism and genetic
characterization of cattle, goat and sheep populations. Iran. J. Biotechnol. 2011;9(3):222-9
Figure 1. (A) Electrophoresis of polymerase chain
reaction products on 1 % agarose gel showed
amplified fragments of 1075 bp. (B) Phylogenetic
tree of the control region between the studied
breeds (1, 2, and 3) and various Middle Eastern
breeds with different haplotypes of sheep.
Mehrabani sheep breed was observed among A
haplotype breeds while Zel among B haplotype.
DYSONA – Life Science 1 (2020) 20-24 Hamadalahmad et al.
24
7. Shojaei M, Mohamad Abadi M, Asadi Fozi M, Dayani O, Khezri A, Akhondi M. Association of growth trait and Leptin
gene polymorphism in Kermani sheep. J. Mol. Cell Biol 2011;2(2):67-73. DOI
8. Villalta M, Fernández-Silva P, Beltrán B, Enguita L, López-Pérez MJ, Montoya J. Molecular characterization and
cloning of sheep mitochondrial DNA. Curr. Genet. 1992;21(3):235-40. DOI
9. Brown WM, George M, Wilson AC. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. U.S.A.
1979;76(4):1967-71. DOI
10. Avise JC, Lansman RA, Shade RO. The use of restriction endonucleases to measure mitochondrial DNA sequence
relatedness in natural populations. I. Population structure and evolution in the genus Peromyscus. Genetics.
1979;92(1):279-95.
11. Abdullah T, Nassiri M, Safari O, Javadmanesh A. Genetic diversity for three populations of Rainbow Trout
(Oncorhynchus mykiss) based on sequencing of mtDNA genes. Marsh Bulletin. 2019;14(1):1-10.
12. Lalouei F, Rezvani GS, Pourkazemi M. Genetic variation of Barbus capito in the southern Caspian Sea by PCR-RFLP
method. Iran. J. Fish. Sci. 2003;117-130.
13. Saadatnooi MS. S. 1990. Sheep husbandry and management. Forth ed. Ashrafi publication, Tehran; 1990. P. 494.
14. Porter V, Alderson L, Hall SJ, Sponenberg DP. Mason's World Encyclopedia of Livestock Breeds and Breeding, 2
Volume Pack. Cabi; 2016.
15. Kiyanzad MR, Panandam JM, Emamjomeh Kashan N, Jelan ZA, Dahlan I. Reproductive performance of three
Iranian sheep breeds. Asian-australas. J. Anim. Sci. 2003;16(1):11-4. DOI
16. Javanmanesh A, Nasiri MR, Azgandi M. Sequencing of HVR-III region of mtDNA in Iranian sheep breeds. Animal
Science Research (Agricultural Knowledge). 2017;27(2):133-41.
17. Bahri Binabaj F, Bihamta G, Pirkhezranian Z. Genetic Diversity and Phylogenetic Analysis of D-loop Region of
mtDNA in Baluchi Sheep Breed. Iran J Anim Sci Res. 2017;10(1), 131-139. DOI
18. Tapio M. Origin and maintenance of genetic diversity in northern European sheep. PhD dissertation, University of
Oulu, Finland, 2006.
19. Othman OE, Payet-Duprat N, Harkat S, Laoun A, Maftah A, Lafri M, Da Silva A. Sheep diversity of five Egyptian
breeds: Genetic proximity revealed between desert breeds: Local sheep breeds diversity in Egypt. Small Rumin.
Res. 2016;144:346-52. DOI
20. Wood NJ, Phua SH. Variation in the control region sequence of the sheep mitochondrial genome. Anim. Genet.
1996;27(1):25-33. DOI
21. Hiendleder S, Mainz K, Plante Y, Lewalski H. Analysis of mitochondrial DNA indicates that domestic sheep are
derived from two different ancestral maternal sources: no evidence for contributions from urial and argali sheep.
J. Hered. 1998;89(2):113-20. DOI
