Content uploaded by Boris Levin
Author content
All content in this area was uploaded by Boris Levin on Mar 18, 2022
Content may be subject to copyright.
135
ISSN 0032-9452, Journal of Ichthyology, 2020, Vol. 60, No. 2, pp. 135–153. © Pleiades Publishing, Ltd., 2020.
Cobitis derzhavini sp. nova—a New Spined Loach Species
(Teleostei: Cobitidae) Discovered in the Transcaucasia
E. D. Vasil’evaa, *, E. N. Solovyevaa, B. A. Levinb, c and V. P. Vasil’evd
aZoological Museum, Moscow State University, Moscow, Russia
bPapanin Institute for Biology of Inland Waters, Russian Academy of Sciences, Borok, Russia
cCherepovets State University, Vologda oblast, Cherepovets, Russia
dSevertsov Institute of Ecology and Evolution, Russian Academy of Sciences, Moscow, Russia
*e-mail: vas_katerina@mail.ru
Receive d November 11, 2019; revis ed November 21, 2019; accepted November 21, 2019
Abstract—The study of spined loaches from the southwestern Caspian Sea basin revealed one new species.
Cobitis derzhavini sp. nova is described from the lower Kura River drainage in the Ganja-Qazakh region of
Azerbaijan. It is distinguished from the most of its congeners distributed in the Caucasus and in the Caspian
Sea basin (C. saniae, C. faridpaki, C. satunini, and C. taenia) by the absence of an obvious dark spot at the
uppermost caudal-fin base, as well as by a combination of other morphological features, none of them
unique. In the Agstafa River Cobitis derzhavini sp. nova is found sympatrically distributed with C. saniae, its
closest relatives in our molecular dataset. These species form separate phylogenetic lineages with high support
(PP 0.9 for COI and 1.0 for RAG1). In addition, their reproductive isolation is confirmed by the karyological
differences: C. derzhavini sp. nova has 8 meta- and 12 submetacentric chromosomes in its karyotype against
6 meta- and 14 submetacentric chromosomes in C. saniae. Besides the dark spot at the uppermost caudal-fin
base developed in the C. saniae, C. derzhavini sp. nova differs from this species by having the plate of lamina
circularis reaching in front of ¾ of the third segment of the attached ray, blotches in Z4 smaller than eye diam-
eter, shallow adipose crests on the caudal peduncle, and a shorter caudal peduncle (10–14% SL).
Keywords: phylogeny, freshwater fishes, Caucasus, new species, Cobitis saniae, Cobitis derzhavini
DOI: 10.1134/S0032945220020198
INTRODUCTION
The spined loaches from the genus Cobitis repre-
sent a species-rich group of small fishes distributed in
Europe, Northern Africa, and Asia, where new species
are still discovering (Nakajima, 2016; Vasil’eva et al.,
2016; Erk’akan et al., 2017; Eagderi et al., 2017; Chen
et al., 2018; Freyhof et al., 2018). However, the only
species Cobitis satunini Gladkov, 1935 (also treated as
Cobitis taenia Linnaeus, 1758 or its subspecies) was
recognized in Azerbaijan and Georgia (Transcaucasia)
until the last years (Baraсh, 1941; Abdurakhmanov,
1962; Kasymov, 1965; Kazancheev, 1981; Elanidze,
1983; Ninua and Japoshvili, 2008; Naseka, 2010).
Recent studies described two new species in the south-
eastern Caspian Sea basin: Cobitis amphilekta Vasil’eva
et Vasil’ev, 2012 from the Lankaran region of Azerbai-
jan, and C. saniae Eagderi, Jouladeh-Roudbar, Jalili,
Sayyadzadeh et Esmaeili, 2017 from the Guilan prov-
ince of Iran. Another species, Cobitis faridpaki
Mousavi-Sabet, Vasil’eva, Vatandoust et Vasil’ev 2011,
was described from the southeastern Caspian Sea
basin. Besides, C. melanoleuca Nichols, 1925 as well as
C. taenia s. stricto are known from the northern Cas-
pian Sea basin (Vasil’eva, 1998; Kottelat and Freyhof,
2007; Freyhof et al., 2018).
Our intensive sampling in the Caucasus in the last
years, as well as preliminary molecular examinations
(Vasilyeva et al., 2019), revealed an additional new
species, which is described in this study based on mor-
phological and molecular characters.
MATERIALS AND METHODS
After anesthesia, fishes were fixed in 4% formalde-
hyde, 75% ethanol or directly in 96% ethanol, and fur-
ther transferred into 75% ethanol for morphological
investigation. All measurements were made point to
point and recorded with precision of 0.1 mm. Methods
for counts and measurements follow Kottelat and
Freyhof (2007). The last two branched rays articulat-
ing on a single pterygiophore in the dorsal and anal
fins are counted as “1½”. Similar, the last normal
branched and closely related undeveloped unbranched
ray in the pectoral and pelvic fins are counted as “1½”.
The total length (TL), standard length (SL) and 23
morphometric characters (following Vasil’eva, 1988)
were measured for the type specimens of the new spe-
136
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS I L’EVA et al .
cies. Within all studied samples we analyzed charac-
ters accepted in spined loach descriptions (see Freyhof
et al., 2018). Colour pattern is described as organized
in four zones accepted from Gambetta (1934), starting
with Z1 as the narrow line immediately below the mid-
dorsal row of blotches till Z4 as the mid-lateral row of
blotches. We distinguish two pigment layers for spots
at the caudal-fin base, namely the surface (in the der-
mis) and the deeper layer following Saitoh and Aizawa
(1987).
Abbreviations used: SL, standard length; AzPAS,
Azerbaijan Production Acclimatization Station; A.R,
autonomous republics, subdivisions of Georgia. Col-
lection codes: ZMMU, Zoological Museum of the
Moscow State University, Moscow; IBIW, Papanin
Institute for Biology of Inland Waters Russian Acad-
emy of Sciences in Borok.
Genomic DNA was extracted from pectoral fin tis-
sue dissected (usually from the right side) in the fresh
fishes under anesthesia (and fixed in 96% ethanol) or
in specimens fixed in 96% ethanol. Pectoral fin’ tis-
sues were digested with proteinase K, and total
genomic DNA was extracted using a standard phenol-
chloroform extraction protocol followed with ethanol
precipitation of DNA (Sambrook et al., 1989).
We amplified a fragment of the cytochrome c oxi-
dase gene (COI) of mitochondrial DNA and the sec-
ond exon of recombination activating gene (RAG1) of
nuclear DNA. PCR amplification was performed
using Evrogen ScreenMix-HS under conditions
described by Ivanova et al. (2006) and Perdices et al.
(2016). Following combinations of primers were used:
FishF2-t1 5′GTAAAACGACGGCCAGTC-
GACTAATCATAAAGATATCGGCAC3′, FishR2-
t1 5′ CAGGAAACAGCTATGACACTTCAGGGT-
GACCGAAGAATCAGAA3′, VF2-t1 5′ TGTA-
AAACGACGGCCAGTCAACCAACCACAAAGA-
CATTGGCAC3′, FR1d-t1 5′ CAGGAAACAGC-
TATGACACCTCAGGGTGTCCGAARAAYCARA
A3′ for COI (Ivanova et al., 2006); RAG-1F 5′ AGCT-
GTAGTCAGTAYCACAARATG3′, RAG-RV1 5′-
TCCTGRAAGATYTTGTAGAA-3′ for RAG1 (Perd-
ices et al., 2016).
PCR products were visualized on a 1% agarose gel.
PCR product was sequenced via Evrogen on ABI
PRISM 3500xl sequencer. Totally we obtained DNA
samples from 69 individuals of spined loaches col-
lected from 23 sampling sites of drainages of the Black
and Caspian Seas. The map of sampling (Fig. 1) was
created using the online tool SimpleMappr (Short-
house, 2010). Occurrence data in the map are based on
our own material. All obtained sequences are depos-
ited in GenBank under the following accession num-
bers: MK506126–MK506188 for COI and
MK506189–MK506235 for RAG1.
Molecular data analysis. Along with our data we
included in the analysis the sequences of COI and
RAG1 of spined loach species from Central and East-
ern Europe and the Asian Black Sea basin resolved as
a monophyletic group of taxa described for the West-
ern Palearctic and identified as “major Clade 2” in the
phylogenetic trees based on the complete cyt b dataset
Fig. 1. Map of sampling locations. Locality numbers: 1—Kara-Su at Tsadokhly, 2—Kara-Su at Niyazy. 3—Agstafa, 4—Archivan-
chay, 5—Pensarchay; 6, 7—Vilashchay ; 8—Haftoni, 9—Siyaku, 10—Goytapa, 11—Bolgarchay, 12—Astara, 13—Alazan, 14—
Kurakhchay; 15, 16—Sefidrud, 17—Gisum, 18—Babolrud, 19—Ta j an , 20—Skurdumi, 21—Supsa, 22—Rioni, 23—Khobi
(detailed description is presented in materials).
40°
40°45°50°
110 km
CASPIAN SEA
BLACK SEA
Russia
Georgia
Turkey
Iran
Azerbaijan
Armenia
Van Lake
Sevan Lake
Urmia Lake
Kura
Kura
Araks
Sefidrud
Astara
12
17
15
16
4
9
5
7
18
19
6
10
11
8
14
3
2
1
13
22
23
21
20
)—C. saniae
)—C. satunini
)—C. derzhavini
)—C. faridpaki
(
(
(
(
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 137
as well as RAG1 by Perdices et al. (2018). This group
combined at least twelve previously described species
including Caucasian Cobitis saniae and C. satunini.
Totally 44 sequences of COI and 25 sequences of
RAG1 presented in Genbank were included (Table 1;
Figs. 2, 3). Sequences of Sabanejewia baltica Witkow-
ski, 1994 (KM287070) and S. balcanica (Karaman,
1922) (KJ554693, KJ554702, EF056336, KP161199,
KP161198) were used as outgroups.
All sequences were first aligned in BioEdit
Sequence Alignment Editor 7.1.3.0 (Hall, 1999) with
default parameters. Subsequently, the alignment was
checked and manually revised if necessary using
Seqman 5.06 (Burland, 1999). P-distances were cal-
culated using MEGA 6.1 (Tamura et al., 2011). Parti-
tionFinder v1.0.1 (Lanfear et al., 2012) was used to
estimate the optimal evolutionary models for Bayesian
inference analysis. The preferred models as suggested
by the Akaike information criterion (AIC) for COI
alignment were: GTR+G for 1st positions,
SYM+I+G for 2d positions and F81 for 3d positions;
for RAG1 alignment preferred model was HKY+G.
Bayesian phylogenetic analysis was performed using
MrBayes v.3.1.2 (Ronquist and Huelsenbeck, 2003)
with two simultaneous runs, each with four chains, for
5 millions of generations for COI dataset and 3 mil-
lions of generations for RAG1 dataset, 10% of genera-
tions were cut as burn in. We checked the convergence
of the runs and made sure that the effective sample
sizes (ESS) were all above 200 by examining the likeli-
hood plots using TRACER v 1.5 (Rambaut and
Drummond, 2007).
RESULTS AND DISCUSSION
Sequence characteristics. The length of the
obtained fragments of COI was 684 bp, of RAG1—909 bp.
Nucleotide composition analysis showed similar pro-
portions per nucleotide for RAG1 24.6 (T), 24.0 (C),
23.6 (A), and 27.8% (G), but a G bias for COI (17.9%)
and high T(33.2%) (Table 2). The transition-transver-
sion bias (R) was estimated to be 3.16 and 1.20 for COI
and RAG1, respectively (all data given for in-group
only). Fragments of COI contained more phylogenet-
ically informative positions (136 positions or 19.9%)
compared to nuclear gene RAG1 (36 positions or
4.0%).
Phylogenetic relationships. The results of phyloge-
netic analysis are presented on Figs. 2 and 3. As a
whole, mtDNA and nuDNA trees show similar inter-
species relations.
Phylogenetic reconstruction based on COI
sequences of the spined loach species incorporated in
the same monophyletic group of the Western Palearc-
tic Cobitis (Perdices et al., 2018) reveals the presence of
six major clades among these taxa (Fig. 2): (1) Turkish
Cobitis fahireae Erk’akan, Atalay-Ekmekçi et Nal-
bant, 1998; (2) well-resolved clade of European
C. elongatoides Băcescu et Mayer, 1969—C. taenia—
C. tanaitica Băcescu et Mayer, 1969—C. puncticulata
Erk’akan, Atalay-Ekmekçi et Nalbant, 1998—
C. splendens Erk’akan, Atalay-Ekmekçi et Nalbant,
1998; (3) European C. vardarensis Karaman, 1928 and
C. stephanidisi Economidis, 1992; (4) Georgian C. sat-
unini; (5) Western Asian C. avicennae Mousavi-Sabet,
Vatandoust, Esmaeili, Geiger et Freyhof, 2015;
(6) Asian species that live in the basin of the Caspian
Sea in Azerbaijan and northern Iran. The last highly
supported clade (PP = 1) is divided into two phyloge-
netic lineages: (1) the southeast Caspian Cobitis farid-
paki, and (2) the west Caspian populations repre-
sented by two monophyletic groups. The first group
(PP = 1) includes most of the sequences studied, as
well as the sequences of C. saniae type specimens
(KY646321, KY646322). Whereas the second, related,
unidentified group (PP = 0.9) combines the speci-
mens inhabiting the Lower Kura River drainage
(Agstafa River and Kara-Su River system) in the
restricted Ganja-Qazakh region area in Azerbaijan
only. P-distances of COI between this unidentified
group of Cobitis and other species vary from 6.53% (p-
distance to C. stephanidisi + C. vardarensis clade) to
0.8% (to C. saniae). The latter value is small, but it
exceeds the P-distances within the groups and is quite
similar to the p-distance (0.7%) between C. tanaitica
and the group C. taenia – C. elongatoides (Table 3); all
of them are recognized species, which is confirmed by
both karyological and morphological differences.
These results suggest that the unidentified phyloge-
netic Cobitis group is a separate species, C. derzhavini
sp. nova. They also support the previous conclusion
(Freyhof et al., 2018), about the widespread occur-
rence of Cobitis saniae in the southwestern Caspian.
The analysis of RAG1 (Fig. 3) confirms the mono-
phyly of Cobitis derzhavini sp. nova (PP = 1) within the
phylogenetic lineage which combines the unseparated
sequences of C. saniae and C. faridpaki (PP = 1). In
contrast to COI tree this phylogenetic lineage is more
related to European C. taenia, C. tanaitica, C. splen-
dens and Georgian C. satunini, than to Iranian C. avi-
cennae.
P-distances of RAG1 between Cobitis derzhavini sp.
nova and other species range from 0.71–0.74% (to
C. faridpaki and to C. saniae) to 1.62% (to C. stephan-
idisi), while p-distance between C. faridpaki and
C. saniae is only 0.12%, and between C. avicennae and
C. tanaitica is 0.8% (Table 4).
Based on the morphological studies of genetically
identified specimens of C. saniae and C. derzhavini sp.
nova, we developed a system of diagnostic features and
prepared the description of a new species presented
below.
138
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
Table 1. List of COI and RAG1 sequences of Cobitis species downloaded from NCBI GenBank
Species Drainage Country GenBank Acc. No Reference
COI RAG1
Cobitis avicennae Tigris Iran KP050516 – Mousavi-Sabet et al., 2015
KP050520 –
KP050525 –
MH795336 – Geiger https://www.fredie.eu/
– MH843004 Perdices et al., 2018
– MH893758
C. elongatoides Danube Slovenia MH795344 – Geiger https://www.fredie.eu/
Morava Czech Republic HQ961002 – IBOL https://ibol.org/
Danube Romania – EF672422 Perdices et al., 2008
–EF672423
C. fahireae Bakir Turkey – EF672424
–EF672425
Manyas – KJ885734 Choleva et al., 2014
Bakir – KP161147 Bohlen et al., 2006
Madra KJ553185 – Freyhof et al., 2018
KJ553276 –
C. faridpaki Tajan Iran KP050508 – Mousavi-Sabet et al., 2015
KP050524 –
Siah KY476334 – Jouladeh-Roudbar et al., 2017
KY476335 –
KY476336 –
KY476337 –
Keselian KY476338 –
KY476339 –
KY476340 –
Karaj KY646316 – Eagderi et al., 2017
KY646317 –
KY646318 –
C. pincticulata Çapraz Turkey KJ552795 – Freyhof et al., 2018
KJ553296 –
Simav – MH843011 Perdices et al., 2018
– MH843014
C. saniae Chalavand Iran KP050506 – Mousavi-Sabet et al., 2015
Qareh-Sou KP050509 –
Aras KP050518 –
Sefidrud KP050528 –
Kargan KY646319 – Eagderi et al., 2017
KY646320 –
Sefidrud KY646321 –
KY646322 –
Aras Azerbaijan – KP161167 Bohlen et al., 2006
–KP161168
–KP161169
C. satunini Rioni Georgia KP050504 – Mousavi-Sabet et al., 2015
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 139
KP050505 –
KP050519 –
– MH843017 Perdices et al., 2018
–MH843018
C. splendens Kovukkavla Turkey KJ552919 – Freyhof et al., 2018
KJ553059 –
KP050522 – Mousavi-Sabet et al., 2015
– MH843019 Perdices et al., 2018
C. stephanidisi Karla Greece MF464584 – Stamatis et al., 2017
MF464587 –
Velestino – KP161175 Bohlen et al., 2006
– KP161177
C. taenia Rhine Germany KR477019 – Thalinger et al., 2016
KR477020 –
Weser – EF056334 Šlechtová et al., 2008
– EF672438 Perdices and Doadrio, 2001
C. tanaitica Don Russia MH795405 – Geiger https://www.fredie.eu/
MH795406 –
Sinoe Roumania – KP161181 Bohlen et al., 2006
– KP161182
C. vardarensis Pinios Greece KJ553250 – Geiger et al., 2014
KJ553280 –
Vardar – EF672442 Perdices and Doadrio, 2001
–EF672443
Sabaneijewia bal-
canica
Danube Roumania – KP161198 Perdices et al., 2016
–KP161198
Ublianka Slovakia – EF056336 Šlechtová et al., 2007
Vardar Greece KJ554693 – Geiger et al., 2014
KJ554702 –
S. baltica Odra Germany KM287070 – Knebelsberger et al., 2015
Species Drainage Country GenBank Acc. No Reference
COI RAG1
Table 1. (Contd.)
Table 2. Sequence characteristics
Cons.—conservative sites, Var.—variative sites, Pars.-Inf.—parsimony informative sites.
Locus Length, bp Cons. Var. Pars.-Inf.
Nucleotide frequencies , %
TCAG
COI 684 548 136 115 33.2 25.9 23.0 17.9
RAG1 909 873 36 27 24.6 24.0 23.6 27.8
140
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
Fig. 2. BI estimation of the phylogenetic relationships based on the fragments of the mitochondrial COI gene with values on branch es corresponding to Bayesian pos terior prob-
abilities, a star denotes highest possible PP = 1.
0.9
0.98
Cobitis fahireae Turkey Madra KJ553276
Cobitis fahireae Turkey Madra KJ553185
Cobitis elongatoides Slovenia Danube MH795344
Cobitis taenia Germany Rhine KR477020
Cobitis taenia Gennany Rhine KR477019
Cobitis elongatoides Czech Republic Morava HQ961002
Cobitis tanaitica Russia Don MH795405
Cobitis tanaitica Russia Don MH795406
Cobitis puncticuiata Turkey Çapraz KJ553296
Cobitis puncticuiata Turkey Çapraz KJ552795
Cobitis splendens Turkey Kovukkavla KJ552919
Cobitis splendens Turkey Kovukkavla KJ050522
Cobitis splendens Turkey Kovukkavla KJ553059
Cobitis satunim Georgia Rioni KP050504
Cobitis satunini Georgia Rioni KP050505
Cobitis satunini Georgia Rioni KP050519
Cobitis satunini Georgia Khobi MK506187
Cobitis satunini Georgia Skurdumi MK506181
Cobitis satunini Georgia Rioni MK506186
Cobitis satunini Georgia Rioni MK506185
Cobitis satunini Georgia Supsa MK506182
Cobitis satunini Georgia Supsa MK506183
Cobitis stephanidisi Greece Karla MF464587
Cobitis stephanidisi Greece Karla MF464584
Cobitis vardarensis Greece Pinios KJ553250
Cobitis vardarensis Greece Pinios KJ553280
Cobitis avicennae Iran Tigris KP050525
Cobitis avicennae Iran Tigris KP050516
Cobitis avicennae Iran Tigris KP050520
Cobitis avicennae Iran Tigris MH795336
Cobitis saniae Iran Qareh-Sou KP050509
Cobitis saniae Iran Aras KP050518
Cobitis saniae Iran Sefidrud MK506142
Cobitis saniae Iran Sefidrud MK506148
Cobitis saniae Iran Sefidrud MK506156
Cobitis saniae Iran Sefidrud MK506157
Cobitis saniae Azerbaijan Bolgarchay MK506168
Cobitis saniae Azerbaijan Bolgarchay MK506167
Cobitis saniae Azerbaijan Bolgarchay MK506169
Cobitis saniae Azerbaijan Astara MK506128
Cobitis saniae Azerbaijan Astara MK506130
Cobitis saniae Azerbaijan Bolgarchay MK506180
Cobitis saniae Georgia AlazanMK506184
Cobitis saniae Iran Chalavand KP050506
Cobitis saniae Iran Kargan KY646319
Cobitis saniae Iran Sefidrud KY646322
Cobitis saniae Iran Sefidrud KP0S0528
Cobitis saniae Iran Sefidrud KY646321
Cobitis saniae Iran Kargan KY646320
Cobitis saniae Azerbaijan Haftoni MK506133
Cobitis saniae Azerbaijan Haftoni MK506134
Cobitis saniae Azerbaijan Haftoni MK506135
Cobitis saniae Azerbaijan Haftoni MK506136
Cobitis saniae Azerbaijan Sjyaku MK506137
Cobitis saniae Azerbaijan Siyaku MK506138
Cobitis saniae Azerbaijan Siyaku MK506138
Cobitis saniae Azerbaijan Siyaku MK506141
Cobitis saniae Azerbaijan Siyaku MK506140
Cobitis saniae Iran Sefidrud MK506149
Cobitis avicennae
Cobitis satunini
Cobitis saniae
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 141
Fig. 2. (Contd.)
0.02
0.9
Cobitis saniae Iran Sefiarud MK506150
Cobitis saniae Azerbaijan Haftoni MK506151
Cobitis saniae Azerbaijan Haftoni MK506152
Cobitis saniae Azerbaijan Siyaku MK506153
Cobitis saniae Iran Gisum МК506154
Cobitis saniae Azerbaijan Goitapa MK506164
Cobitis saniae Azerbaijan Vilashchay MK506162
Cobitis saniae Azerbaijan Vilashchay MK506163
Cobitis saniae Azerbaijan Goitapa MK506165
Cobitis saniae Azerbaijan Vilashchay MK506170
Cobitis saniae Azerbaijan Agstafa MK506173
Cobitis saniae Azerbaijan Agtara MK506129
Cobitis saniae Azerbaijan Archivanchay MK506126
Cobitis saniae Azerbaijan Archivanchay MK506127
Cobitis saniae Azerbaijan Pensarchay MK506132
Cobitis saniae Azerbaijan Pensarchay MK506131
Cobitis saniae Azerbaijan Kurakhchay MK506188
Cobitis saniae Azerbaijan Goitapa MK506177
Cobitis saniae Azerbaijan Goitapa MK506175
Cobitis saniae Azerbaijan Goitapa MK506176
Cobitis saniae Azerbaijan Bolgarchay MK506166
Cobitis derzhavini Azerbaijan Kara-Su MK506159
Cobitis derzhavini Azerbaijan Kara-Su MK506160
Cobitis derzhavini Azerbaijan Kara-Su MK506161
Cobitis derzhavini Azerbaijan Kara-Su MK506172
Cobitis derzhavini Azerbaijan Kara-Su MK506173
Cobitis derzhavini Azerbaijan Kara-Su MK506174
Cobitis derzhavini Azerbaijan Agstafa MK506178
Cobitis derzhavini Azerbaijan Agstafa MK506179
Cobitis faridpaki Iran Karaj KY646317
Cobitis faridpaki Iran Karaj KY646316
Cobitis faridpaki Iran Karaj KY646318
Cobitis faridpaki Iran Babolrud MK506143
Cobitis faridpaki Iran Babolrud MK506144
Cobitis faridpaki Iran Babolrud MK506158
Cobitis faridpaki Iran Babolrud MK506145
Cobitis faridpaki Iran Babolrud MK506146
Cobitis faridpaki Iran Babolrud MK506147
Cobitis faridpaki Iran Tajan KP050508
Cobitis faridpaki Iran Tajan KP050524
Cobitis faridpaki
Cobitis derzhavini
sp. nova
Cobitis faridpaki Iran Tajan MK506155
Cobitis faridpaki Iran Kesrlian KY476338
Cobitis faridpaki Iran Siah KY476336
Cobitis faridpaki Iran Siah KY476335
Cobitis faridpaki Iran Siah KY476334
Cobitis faridpaki Iran Siah KY476337
Cobitis faridpaki Iran Keselian KY476339
Cobitis faridpaki Iran Keselian KY4763 40
Sabanejewia baitica KM287070
Sabanejewia balcanica KJ554693
Sabanejewia balcanica KJ554702
142
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
Fig. 3. BI estimation of the phylogenetic relationships based on the fragments of the exon of RAG1 nuclear gene with values on
branches corresponding to Bayesian posterior probabilities, a star denotes highest possible PP = 1.
0.82
0.82 0.98
0.94
0.003
Cobitis fahireae Turkey Bakir EF672424
Cobitis fahireae
Cobitis fahireae Turkey Bakir EF672425
Cobitis fahireae Turkey Bakir KJ885734
Cobitis fahireae Turkey Bakir KP161147
Cobitis taenia Germany Weser EF672438
Cobitis taenia Germany Weser EF056334
Cobitis satunini Georgia Rioni MH843018
Cobitis satunini Georgia Rioni MH843017
Cobitis splendens Turkey Kovukkavla MH843019
Cobitis tanaitica Romania Sinoe KP161182
Cobitis tanaitica Romania Sinoe KP161181
Cobitis elongatoides Romania Danube EF672422
Cobitis elongatoides Romania Danube EF672423
Cobitis puncticulata Turkey Simav MH843011
Cobitis puncticulata Turkey Simav MH843014
Cobitis stephanidisi Greece Velestino KP161175
Cobitis stephanidisi Greece Velestino KP161177 Cobitis stephanidisi +
Cobitis vardarensis
Cobitis stephanidisi Greece Vardar EF672442
Cobitis stephanidisi Greece Vardar EF672443
Cobitis avicennae Iran Tigris MH843004
Cobitis avicennae Iran Tigris MH893758 Cobitis avicennae
Cobitis saniae Azerbaijan Pensarchay MK506195
Cobitis saniae Azerbaijan Pensarchay MK506195
Cobitis saniae Azerbaijan Pensarchay MK506195
Cobitis saniae Azerbaijan Archivanchay MK506189
Cobitis saniae Azerbaijan Archivanchay MK506190
Cobitis saniae Azerbaijan Archivanchay MK506191
Cobitis saniae Azerbaijan Astara MK506194
Cobitis saniae Azerbaijan Astara MK506193
Cobitis saniae Azerbaijan Haftoni MK506211
Cobitis saniae Azerbaijan Haftoni MK506212
Cobitis saniae Azerbaijan Astara MK506192
Cobitis saniae Azerbaijan Haftoni MK506198
Cobitis saniae Azerbaijan Haftoni MK506200
Cobitis saniae Azerbaijan Haftoni MK506199
Cobitis saniae Azerbaijan Sivaku MK506202
Cobitis saniae Iran Sefidrud MK506201
Cobitis saniae Iran Sefidrud MK506203
Cobitis faridpaki Iran Babolrud MK506204
Cobitis faridpaki Iran Babolrud MK506205
Cobitis faridpaki Iran Babolrud MK506206
Cobitis faridpaki Iran Babolrud MK506208
Cobitis faridpaki Iran Sefidrud MK506210
Cobitis saniae Iran Gisum MK506213
Cobitis saniae Iran Sefidrud MK506215
Cobitis saniae Iran Sefidrud MK506216
Cobitis saniae Iran Babolrud MK506217
Cobitis saniae Azerbaijan Vilashchay MK506231
Cobitis saniae Azerbaijan Vilashchay MK506223
Cobitis saniae Azerbaijan Vilashchay MK506230
Cobitis saniae Azerbaijan Bolgarchay MK506229
Cobitis saniae Azerbaijan Bolgarchay MK506228
Cobitis derzhavini Azerbaijan Kara-Su MK506220
Cobitis derzhavini Azerbaijan Kara-Su MK506222
Cobitis derzhavini Azerbaijan Kara-Su MK506221
Cobitis derzhavini Azerbaijan Kara-Su MK506232
Cobitis derzhavini Azerbaijan Kara-Su MK506233 Cobitis derzhavini
sp. nova
Cobitis saniae +
Cobitis faridpaki
Cobitis derzhavini Azerbaijan Kara-Su MK506218
Cobitis derzhavini Azerbaijan Kara-Su MK506219
Cobitis faridpaki Iran Babolrud MK506207
Cobitis faridpak Iran Tajan MK506214
Cobitis faridpak Iran Sefidrud KP506209
Cobitis saniae Aras KP161168
Cobitis saniae Aras KP161169
Cobitis saniae Aras KP161167
Cobitis saniae Azerbaijan Bolgarchay MK506226
Cobitis saniae Azerbaijan Bolgarchay MK506227
Cobitis saniae Azerbaijan Agstafa MK506235
Cobitis saniae Azerbaijan Agstafa MK506234
Cobitis saniae Azerbaijan Goytapa MK506225
Cobitis saniae Azerbaijan Goytapa MK506224
0.81
0.91
Sabanejewia balcanica EF56336
Sabanejewia balcanica KP161199
Sabanejewia balcanica KP161195
Cobitis derzhavini Vasil’eva, Solovyeva,
Levin et Vasil’ev, sp. nova (Fig. 4–8; Table 5)
Cobitis taenia satunini (not of Gladkov, 1935):
Abdurakhmanov, 1962: 291 (partim); Kasymov, 1965:
329 (partim).
Holotype. ZMMU P-24184, male, 50.5 mm SL;
Azerbaijan: Ganja-Qazakh region: tributary of Kara-
Su River at Tsadokhly, 41°22′48.6′′ N 45°09′24.5′′ E;
04.10.2012, coll. B. Levin, N. Mustafaev, D. Kara-
banov, M. Matveev.
Paratypes. ZMMU P-24183, 10 males, 40.9–
54.0 mm SL; 7 females, 41.0–63.5 mm SL; same data
as holotype.
Non-type specimens. ZMMU P-24185, 1 male,
50 mm SL; Azerbaijan: Ganja-Qazakh region: Ahmaz
at Mingechaur; 28.05.1985, coll. V.P. Vasil’ev.—P-
24186, 1 male, 63 mm SL; 1 female, 80 mm SL; Azer-
baijan: Ganja-Qazakh region: channels of AzPAS,
Mingechaur; 15–19.05.1985, coll. V.P. Vasil’ev.—P-
24187, 1 male, 57 mm SL and 1 juvenile specimen,
34 mm SL; Azerbaijan: Ganja-Qazakh region: Kara-
Su River at Niyazy, 41°16′51.2′′ N 45°15′49.9′′ E;
04.10.2012, coll. B. Levin etc.—P-24188, 1 female,
76 mm SL; Azerbaijan: Balaken region: Katekh River
at Balaken; 30.09.1988, coll. J. Sedă.—P-24189,
3 males, 52–61 mm SL, 1 female, 64.5 mm SL; Azer-
baijan: Ganja-Qazakh region: channels of AzPAS,
Mingechaur; 29.05.1985, coll. V.P. Vasil’ev.—P-24190,
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 143
13 males, 48.5–59 mm SL, 25 females, 48–83 mm SL;
Azerbaijan: Ganja-Qazakh region: Mingechaur Res-
ervoir; 05.1983, coll. V.P. Vasil’ev.—P-24201,
1 female, 43 mm SL; Azerbaijan: Ganja-Qazakh
region: Agstafa River at Qıraq Kesemen, 41°13′38.0′′ N
45°26′14.8′′ E; 05.10.2012, coll. B. Levin etc.
Material used in molecular genetic analysis.
ZMMU P-24183-AZ103/AZ213-214; Azerbaijan:
Table 3. Uncorrected p-distances for sequences of COI mtDNA gene for groups (below the diagonal), %
Values on the diagonal correspond to average uncorrected ingroup p-distances. Standard error estimates are shown above the diagonal.
Groups
C. avicennae
C. derzhavini sp. nova
C. fahireae
C. faridpaki
C. puncticulata
C. tanaitica
C. taenia +
C. elongatoides
C. saniae
C. satunini
C. splendens
C. stephanidisi +
C. vardarensis
C. avicennae 0.08 0.95 0.94 0.89 0.88 0.87 0.87 0.91 0.92 0.91 1.06
C. derzhavini sp. nova 5.72 0.09 0.94 0.53 0.98 0.86 0.86 0.33 0.92 0.98 1.01
C. fahireae 6.31 6.47 0.17 0.96 0.83 0.75 0.71 0.92 0.78 0.84 0.95
C. faridpaki 5.35 1.97 6.75 0.17 0.93 0.80 0.81 0.58 0.89 0.92 1.01
C. puncticulata 5.76 6.29 5.23 6.22 00.59 0.59 0.97 0.82 0.74 1.11
C. tanaitica 5.14 5.31 3.99 5.12 2.35 00.27 0.85 0.79 0.61 0.93
C. taenia +
C. elongatoides
5.39 5.40 3.80 5.26 2.53 0.70 0.51 0.86 0.79 0.59 0.91
C. saniae 5.50 0.80 6.43 2.33 6.81 5.50 5.66 0.12 0.88 0.96 1.00
C. satunini 5.63 6.24 4.99 6.17 5.48 4.65 4.76 5.85 0.28 0.85 0.98
C. splendens 5.45 6.17 4.76 5.89 3.91 2.47 2.58 6.33 5.11 00.99
C. stephanidisi +
C. vardarensis
6.77 6.53 6.36 6.95 6.68 4.83 5.00 6.70 5.59 6.03 0.59
Table 4. Uncorrected p-distances for sequences of RAG1 nuDNA gene for groups (below the diagonal), %
Values on the diagonal correspond to average uncorrected ingroup p-distances. Standard error estimates are shown above the diagonal.
Groups
C. avicennae
C. derzhavini sp. nova
C. fahireae
C. faridpaki
C. tanaitica
C. taenia +
C. tanaitica +
C. splendens +
C. satunini
C. saniae
C. stephanidisi
C. saniae +
C. derzhavini sp. nova +
C. faridpaki
C. avicennae 0.23 0.32 0.29 0.26 0.28 0.31 0.28 0.35 0.27
C. derzhavini sp. nova 1.16 0.14 0.35 0.24 0.35 0.34 0.25 0.42 –
C. fahireae 0.94 1.19 00.30 0.33 0.34 0.32 0.32 0.31
C. faridpaki 0.78 0.71 1.02 0.06 0.28 0.27 0.05 0.39 –
C. tanaitica 0.80 1.29 1.28 0.77 – 0.14 0.28 0.36 0.26
C. taenia + C. tanaitica +
C. splendens + C. satunini
1.08 1.36 1.40 0.83 0.32 0.14 0.28 0.37 0.26
C. saniae 0.87 0.74 1.15 0.12 0.79 0.89 0.11 0..0 –
C. stephanidisi 1.3 4 1.62 1.09 1.62 1.31 1.46 1.65 00.38
C. saniae + C. derzhavini sp. nova +
C. faridpaki
0.90 – 1.14 – 0.86 0.95 – 1.64 0.26
144
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
Ganja-Qazakh region: tributary of Kara-Su River at
Tsadokhly, 41°22′48.6′′ N 45°09′24.5′′ E (GenBank
accession numbers: MK506159–MK506161,
MK506171, MK50 6172 COI, MK506220-MK506222,
MK506232, MK506233 RAG1).—ZMMU P-24187-
130; Azerbaijan: Ganja-Qazakh region: Kara-Su
River at Niyazy, 41°16′51.2′′ N 45°15′49.9′′ E (Gen-
Bank accession number: MK506218 RAG1).—
ZMMU P-24201-230; Azerbaijan: Ganja-Qazakh
region: Agstafa River at Qıraq Kesemen, 41°13′38.0′′ N
45°26′14.8′′ E (GenBank accession number:
MK506219 RAG1).—IBIW GA294; Azerbaijan:
Ganja-Qazakh region: Kara-Su River at Niyazy
(GenBank accession number: MK506174 COI).—
IBIW L90-91; Azerbaijan: Ganja-Qazakh region:
Agstafa River at Qıraq Kesemen (GenBank accession
numbers: MK506178, MK506179 COI).
Diagnosis. Cobitis derzhavini sp. nova is distin-
guished from all other Cobitis species in the Caucasus
region and in the Caspian Sea basin by the absence of
a black or dark-brown spot on the surface layer of the
uppermost caudal-fin base (vs. present in other spe-
cies, except strongly de-pigmented in C. amphilekta
specimens from old museum collections). Besides this
unique feature, C. derzhavini has elongated sub-dorsal
scales with a small eccentric focal zone about 1/7 of
the maximum scale diameter or less (vs. a large focal
zone about 1/3 of the maximum scale diameter or
more, slightly displaced towards the anterior margin of
the scale in C. amphilekta, C. taenia and C. melano-
leuca). In C. derzhavini the blotches in Z4 usually
small, equal or less than the horizontal eye diameter
(vs. the blotches in Z4 noticeably larger than the hori-
zontal eye diameter in C. amphilekta, C. satunini,
C. taenia, most individuals of C. saniae, and most
populations of C. melanoleuca).
Cobitis derzhavini is distinguished from C. amphilekta,
C. satunini, C. faridpaki and C. saniae by having a
poorly developed adipose crests on the caudal pedun-
cle (vs. well developed). The plate of lamina circularis
in C. derzhavini reaches in front of ¾ of the third seg-
ment of the attached ray (vs. usually reaches the end of
the third segment, or more, until the end of the fifth
one in C. faridpaki, C. taenia and C. saniae, or the end
of the sixth segment in C. satunini). C. derzhavini is
further distinguished from C. amphilekta and C. saniae
by having a shorter caudal peduncle (10–14% SL vs.
14–18% SL in C. amphilekta and 13–17% in
C. saniae), and by m ore numerous blotch es in Z4 (15–
23) it is distinguished from C. amphilekta (11–14 Z4
blotches).
Molecular data (Figs. 2, 3) place C. derzhavini in
the same group with C. saniae and C. faridpaki well
separated from all other Cobitis included. In this
group, C. derzhavini forms a distinct lineage with p-
distances of COI of 0.8% to C. saniae and 1.97 to
C. faridpaki. P-distances of RAG1 between C. derzha-
vini and the same species vary from 0.71 to 0.74% sig-
nificantly exceeding p-distance of 0.12% between
C. faridpaki and C. saniae.
Description. See Figs. 4–8 for general appearance
of the holotype and 9 paratypes and Table 5 for mor-
phometric data. Body elongated, laterally compressed.
Greatest body depth at or slightly anterior to dorsal-
fin origin, decreasing towards caudal-fin base. Head
profile slightly convex, head length 1.2–1.6 times in
body depth. Snout pointed, its length 0.7–0.9 times in
postorbital length. Eye diameter 0.3–0.5 times in head
depth at eye, 1.1–1.6 times in interorbital width. Cau-
dal peduncle 1.1–1.6 times longer than deep, much
shorter than head, well compressed, with very shallow
dorsal and ventral adipose crests at the caudal fin base.
Suborbital spine bifurcate, slightly curved, with short
external thorn, reaching slightly to or beyond center of
eye. No pelvic axillary lobe or pad. Margin of dorsal
and anal fin convex. Caudal fin slightly rounded or
truncate. Largest recorded female 86.3 mm SL and
largest male 67.0 mm SL.
Dorsal fin with 2 unbranched and 7½ (14), 7 (2) or
8½ (2) branched rays. Anal fin with 1–2 unbranched
and 5½ (17) or 6 (1) branched rays. Caudal fin with
7+7 (15), 6+6 (1) or 8+8 (1) branched rays (one
deformed paratype is lacking the tail). Pectoral fin
with 1 unbranched and 7½ (6), 8½ (7), 8 (3) or 7 (2)
branched rays. Pelvic fin with 1 (16) or 2 (2)
unbranched and 5½ (14), 5 (2) or 6 (2) branched rays.
The holotype has 7½ branched rays in dorsal fin, 5½—
in anal fin, 7½—in pectoral, 5½—in pelvic and 7+7—
in caudal fin.
Body covered with small embedded scales, very
thin and poor visible on belly and breast. Sub-dorsal
scales elongated with a small eccentric focal zone
about 1/7 of the maximum scale diameter (Fig. 6a) or
less (up to 1/30 in larger specimens). Lateral line
short, with 5–7 pores, sometimes an open slit in skin
along lateral line present (1). Lamina circularis at base
of the second pectoral-fin ray in adult males with
wide, hatchet-like plate, reaching from ½ of the sec-
ond up to ½ of the third segment of the attached ray
(Fig. 6b).
Mouth small, inferior, with fleshy lips (Fig. 7).
Lower lip with well separated short mental lobes.
Short rostral barbels not reaching base of maxillary
barbels in half of individuals. Maxillary barbels reach-
ing to or beyond vertical of anterior edge of nostril
(14), sometimes reaching its posterior edge (4). Man-
dibular barbels reaching vertical of front border of eye
in most type specimens (12), but not reaching center
of eye.
Sexual dimorphism. Females grow larger. Males
have a lamina circularis at base of the second pectoral
fin ray, and longer pectoral and pelvic fins (Table 5).
Colouration in alcohol. Background colour yellow-
ish with dark-brown pigmentation pattern. Mid-dor-
sal pigmentation consisting in a series of 11–20 dark-
brown, elongated blotches, 5–11 predorsal and 5–9
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 145
Fig. 4. Cobit is derzhavini sp. nova, ZMMU P-24184, holotype, male, 50.5 mm SL (a), and the pigmentation of its caudal part (b).
(a)
(b)
Fig. 5. Paratypes of Cobitis derzhavini sp. nova, ZMMU P-24183: (a) female, 52.5 mm SL (voucher for MK 506171 COI,
MK506232 RAG1); (b) female, 60.3 mm SL (voucher for MK506159 COI , MK506220 RAG1); (c) female, 51.0 mm SL; (d)
female, 63.5 mm SL (voucher for MK506160 COI, MK506221 RAG1); (e) female, 50.2 mm SL (voucher for MK506172 COI,
MK506233 RAG1); (f) male, 50.0 mm SL; (g) male, 54.0 mm SL; (h) male, 49.0 mm SL; (i) male, 50.3 mm SL. For the last three
specimens with left pectoral fins removed for DNA analysis, the right side is presented.
(a)
(b)
(c)
(d)
(f)
(g)
(h)
(i)
(e)
behind the dorsal fin base. Pigmentation in Z1 repre-
sented by small dark speckles surrounding blotches on
back. Z2 consists of small roundish spots or horizon-
tally elongated blotches separated by small gaps with-
out dark speckles or with rare speckles. Pigmentation
in Z2 often present only on preanal part of flank,
indistinguishable from Z3 on posterior flank. Pigmen-
tation in Z3 formed by small dark speckles, usually
146
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
Fig. 6. Cobitis derzhavini sp. nova, predorsal scale (a) and
cleaned lamina circularis of the paratype, ZMMU P-2418 (b).
(a) (b)
Fig. 7. Cobitis derzhavini sp. nova, bottom view of the head
in two paratypes, ZMMU P-2418: (a) female, 63.5 mm
SL; (b) male, 54.0 mm SL.
(a) (b)
fused in small spots and blotches. Pigmentation in Z4
formed by a series of 15–23 (5–11 predorsal, 2–3 sub-
dorsal, and 8–14 postdorsal) blotches, roundish,
square or elongated. Usually the blotches in Z4 are
small, equal or less than the horizontal eye diameter;
in some specimens they fused to adjacent neighbors
forming a dark line. The bold black spot on the surface
(dermal) layer is absent on the uppermost caudal-fin
base, as well as on the lower caudal-fin base. Instead,
small black speckles merge into a fuzzy comma-like
blotch in the surface layer on the uppermost base of
the caudal fin and in a poorly visible specular blotch
formed by sparse speckles on the lower caudal-fin
base. At the same time, two merged bracket-like dark
shadow of blotches with intermediate forward running
dark short line are viewed in the deeper layer of the
caudal-fin base (Figs. 4, 5, 8). In transmitted light in
living and fixed individuals, all pigment drops merge
into two vertically joined brackets (Fig. 8a), similar to
ones in C. melanoleuca (see Vasil’eva, 1984. Fig. 3;
Bogutskaya et al., 2008. Fig. 27). Upper part of head,
opercle and snout covered by small speckles. A dark-
brown stripe between eye and snout and between eye
and nape; rarely indistinct stripes present on cheek
and opercle. Caudal fin with 4–5 and dorsal fin with
3–4 dark, irregular shaped bars. Small dark speckles
scattered on pectoral fins; barbels whitish.
Etymology. Named for the Russian ichthyologist
and hydrobiologist Alexander Nikolaevich Derzhavin
(1878–1963) who made a significant contribution to
the study of the ichthyofauna of Azerbaijan and fishes
of the Caspian Sea basin and prepared the first “Cat-
alog of freshwater fish of Azerbaijan” (Derzhavin,
1949).
Distribution. Cobitis derzhavini is known only from
the lower Kura River drainage. In 2012 it was collected
in the Ganja-Qazakh region of Azerbaijan: in the
Kara-Su River and its tributaries, as well as in the
Agstafa River (Fig. 1). In the Agstafa River, C. derzha-
vini is sympatric to C. saniae. After the development of
species diagnosis based on these genetically studied
specimens other samples of the new species were
revealed in ZMMU collection. They include popula-
tions from the Mingechaur Reservoir system and the
Katekh River in the Balaken region of Azerbaijan.
Karyological data. Previous studies on karyology of
spined loaches from Azerbaijan and Georgia revealed
a high karyological variability (Vasil’ev, 1995). The
specimens from the Mingechaur Reservoir and neigh-
boring waters identified here as C. derzhavini have
a karyotype with a diploid chromosome number 2n =
50 and 70 chromosome arms (NF). It includes 8 meta-,
12 submeta- and 30 subtelo- and acrocentric chromo-
somes (Fig. 9). Cobitis saniae from the Malyi Kyz-
ylagach Bay has 6 meta-, 14 submeta- and 30 subtelo-
and acrocentric chromosomes; 2n = 50 and NF = 70
(Vasil’ev, 1995). Both species differ from C. satunini
from the Nogella River in the Rioni River drainage
which has 2n = 50 but NF = 72 with 8 meta-, 14 sub-
meta- and 28 subtelo- and acrocentric chromosomes
(Vasil’ev, 1995). Based on these data we consider that
the karyotype structure, namely the ratio of meta-,
submeta- and subtelo- and acrocentric chromosomes,
represents an additional diagnostic feature of C. der-
zhavini.
Remarks. Our study demonstrates that Cobitis der-
zhavini represents the divergent monophyletic lineage
in the COI phylogenetic tree, separated from closely
related C. saniae and C. faridpaki with significant
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 147
Fig. 8. Cobitis derzhavini sp. nova, alive male, 57 mm SL from the Kara-Su River at Niyazy with two merged bracket-like dark
shadow of blotches viewed in the deeper layer of the caudal-fin base (a) and the same specimen fixed in 96% ethanol, and further
transferred into 75% ethanol, ZMMU P-24187 (voucher for MK506218 RAG1) (b).
(a)
(b)
degree of support (PP = 0.9). The consensus nuclear
phylogeny was less informative for these species; how-
ever, p-distances of RAG1 between C. derzhavini and
C. faridpaki and C. saniae vary from 0.71 to 0.74%, sig-
nificantly exceeding p-distance of 0.12% between the
last two species. Considering the fact that C. derzha-
vini and C. saniae are sympatric in the Agstafa River,
these results prove a separate species state of C. der-
zhavini. Another genetic confirmation of reproductive
isolation between these sympatrically coexisting spe-
cies is their species-specific karyotype structures
described above.
Fig. 9. The karyotype of Cobitis derzhavini sp. nova from the Mingechaur Reservoir, m—meta-, sm—submeta- and sta—subtelo-
and acrocentric chromosomes.
msm
sta
12 3 4 56
78 9 10 1112
13 14 15 16 17 18 19
20 21 22 23 24 25
148
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
Table 5. Morphometric characters (range—above the line and Mean ± SD—below the line) for the type specimens of
Cobitis derzhavini sp. nova and the conspecific sample from the Mingechaur Reservoir
Characters Type specimens, Kara-Su River Mingechaur Reservoir
Females (n = 7) Males (n = 10) Females (n = 7) Males (n = 15)
SL, mm
In % SL
Predorsal length
Postdorsal lenght
Prepelvic length
Preanal length
Length of caudal peduncle
Body depth at dorsal-fin origin
Depth of caudal peduncle
Body width at dorsal-fin origin
Length from pectoral-fin base to pelvic-fin base
Pectoral-fin length
Pelvic-fin length
Length of dorsal-fin base
Length of anal-fin base
Dorsal-fin depth
Anal-fin depth
––
Head length
In % head length
Rostral barbel length
Mandibular barbel length
41.0–63.5
52.4
40.9–54.0*
47.6 4.05
±
52.0–86.3
78.3
52.0–67.0
61.1 4.45
±
51.9–58.3
53.9
50.4–55.9
53.3 1.58
±
51.2–55.8
53.6
50.3–55.6
53.6 1.42
±
34.2–37.1
35.8
34.6–38.0
36.5 1.20
±
34.2–40.1
37.5
35.4–40.9
37.7 1.60
±
52.4–58.5
55.1
50.9–57.7
53.9 1.90
±
51.5–56.7
54.4
51.2–57.9
54.6 1.72
±
75.7–84.2
80.1
74.7–81.7
78.6 2.24
±
78.4–83.8
81.1
78.0–83.3
80.7 1.50
±
10.0–12.8
11.7
9.9–14.1
12.2 1.04
±
11.0–14.8
13.1
10.0–15.9
12.8 1.55
±
13.2–15.8
14.0
12.3–16.3
14.0 1.42
±
14.7–18.3
16.3
16.6–18.1
17.4 0.50
±
8.0–8.6
8.3
8.1–10.0
9.3 0.66
±
8.9–10.5
9.7
10.0–11.6
10.9 0.47
±
4.4–7.6
6.0
4.9–6.9
5.7 0.69
±
9.5–11.9
10.6
9.4–11.2
10.6 0.48
±
32.9–39.5
35.2
30.0–36.0
33.3 1.76
±
32.0–38.1
35.3
31.2–35.8
33.6 1.38
±
13.6–16.4
14.9
17.7–20.3
18.9 1.00
±
12.0–15.4
13.8
16.0–20.0
18.3 1.30
±
10.3–13.9
12.4
11.9–14.8
13.8 0.79
±
9.3–12.3
11.2
12.1–14.4
13.5 0.68
±
9.1–11.6
10.6
9.5–12.2
10.8 0.96
±
8.3–10.4
9.4
8.4–11.0
9.6 0.66
±
6.9–9.4
7.9
6.9–9.8
8.0 0.87
±
5.1–7.0
6.3
6.4–8.3
7.1 0.66
±
13.0–16.1
14.5
13.2–16.4
15.4 0.98
±
10.5–13.4
12.0
13.0–15.7
14.3 0.80
±
10.3–14.2
12.3
11.6–14.8
12.9 0.91
±
18.4–20.7
19.8
19.3–21.1
20.1 0.60
±
19.0–21.4
20.0
20.0–22.8
21.8 0.78
±
8.1–10.6
9.7
7.7–12.3*
9.8 1.26
±
7.6–16.5
12.7
12.8 16.8
15.0 1.12
−
±
12.9–19.1
16.3
11.8–20.0*
16.9 2.43
±
18.4–27.5
21.9
17.2–27.1
23.1 2.78
±
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 149
Morphological analysis of genetically confirmed
specimens of Cobitis derzhavini, C. saniae, C. faridpaki
and C. satunini resulted in the discovery of the unique
diagnostic feature of the first species, namely the
absence of the bold black or dark-brown spot on the
surface (dermal) layer of the uppermost caudal-fin
base (see diagnosis). This feature is observed in living
specimens of C. derzhavini (Fig. 8a), in specimens
fixed in 96% ethanol, further transferred into 75% eth-
anol and stored for less than 10 years (Figs. 4, 5, 8b),
as well as in specimens fixed in 4% formaldehyde, fur-
ther transferred into 75% ethanol and stored for more
than 30 years (Fig. 10). Unlike this species, C. saniae,
C. faridpaki, C. satunini, C. amphilekta and other spe-
cies considered in this study posses bold black or dark-
brown spot on the uppermost caudal-fin base. This
spot is clearly visible on living specimens (Fig. 11), as
well as on specimens after the first fixation, in both
96% ethanol (Fig. 12) and 4% formaldehyde with fur-
ther storage in 75% ethanol for a long time (see figures
in Mousavi-Sabet et al., 2011; Vasil’eva and Vasil’ev,
2012, 2019), with the exception of a few depigmented
individuals. In addition to this unique color pattern of
the caudal peduncle, other diagnostic morphological
characters were developed (see diagnosis), and they
were successfully employed to re-identify Azerbaija-
nian Cobitis samples stored in ZMMU since the 1930s.
As a result, more than 20 samples (besides recently
collected samples included in the “Comparative
material”) were identified as C. saniae. And only sam-
ples collected in the Mingechaur Reservoir system and
in the Katekh River in 1980s belong to C. derzhavini,
because their specimens have specific pigmentation
on the uppermost caudal-fin base, poorly developed
shallow adipose crests on the caudal peduncle, small
blotches in Z4, smaller than eye diameter (Fig. 10),
and their morphometric characters are similar to those
in the type specimens of the new species (Table 5).
These loaches are further distinguished from C. saniae
by having the plate of lamina circularis never reaching
¾ of the third segment of the attached ray (Fig. 13) and
a shorter caudal peduncle: in C. saniae from the Malyi
Kyzylagach Bay the length of caudal peduncle varied
from 12.6 up to 16.3% SL with medium values 14.2 in
females and 14.3 in males (Vasil’eva and Vasil’ev,
2019).
Cobitis derzhavini and C. saniae were found coexist
in the Agstafa River, the right tributary of the lower
Kura River. Probably, these species are sympatric in
other parts of the Kura River drainage. Another spe-
cies recorded in Azerbaijan, Cobitis amphilekta, has
historically been found in rivers flowing into the Kyz-
ylagach Bay (Vasil’eva and Vasil’ev, 2012), far from the
range of C. derzhavini. These allopatric species demon-
strate significant differences in their color pattern, the
shape of scales, the number of blotches in Z4 and the
length of caudal peduncle (see diagnosis).
COMPARATIVE MATERIAL
Cobitis amphilekta (paratypes), ZMMU: P-3737; 2,
48–54 mm SL: Azerbaijan: Lankaran region: off old
bed of Kumbashi River.—P-3741; 4, 36–61 mm SL:
Azerbaijan: Lankaran region: Caspian Sea near Port
Il’icha between old bed of Kumbashi River and state
farm.—P-3751; 6, 44–64 mm SL: Azerbaijan: Lan-
karan region: between Kyzylagach village and Kum-
bashi River. – P-22795, 5, 35–41 mm SL; Azerbaijan:
Lankaran region: Kumbashi River, station 100.
Cobitis faridpaki, ZMMU: P-22694, 2 paratypes,
50–63 mm SL; Iran: Mazandaran prov.: Siahrud,
36°15′36′′ N 52°33′36′′ E.—P-23656, 20, 38–66 mm
SL; Iran: Mazandaran prov.: Babolrud, 36°24′ N
52°42′ E.—P-23671, 11, 34–72 mm SL; Iran, Mazan-
daran prov.: Tajan River, 36°18′10′′ N 53°10′57′′ E.
Material used in molecular genetic analysis.
ZMMU P-23656-Cob7_1-5,23; Iran: Mazandaran
*Based on 11 examined specimens (n).
Snout length
Eye diameter
Postorbital distance
Head depth
Interorbital width
Characters Type specimens, Kara-Su River Mingechaur Reservoir
Females (n = 7) Males (n = 10) Females (n = 7) Males (n = 15)
32.9–42.7
39.5
31.8–41.0*
38.1 3.02
±
40.5–48.1
44.1
39.4–47.8
42.7 2.34
±
17.1–22.4
19.8
17.0–24.1*
19.9 2.53
±
12.5–16.4
14.0
13.5–16.9
15.1 1.02
±
47.1–54.5
50.3
44.9–51.0*
48.1 2.01
±
50.0–57.1
53.5
50.4–56.3
53.2 1.85
±
52.4–61.1
56.5
53.0–61.6*
57.8 2.33
±
50.3–59.5
55.3
51.8–61.1
55.6 2.62
±
11.4–17.7
15.3
13.0–18.9*
16.2 2.05
±
15.2–20.4
18.0
17.5–23.0
20.1 1.92
±
Table 5. (Contd.)
150
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
prov.: Babolrud (GenBank accession numbers:
MK506143—MK506147, MK506158 COI,
MK506204—MK506208, MK506217 RAG1).—
ZMMU P-23671-Cob.20; Iran, Mazandaran prov.:
Tajan River (GenBank accession numbers:
MK506155 COI, MK506214 RAG1).
Cobitis melanoleuca, ZMMU: P-23305, 4, 74–
103 mm SL; Russia: Saratov region: Bol’shoy Uzen
River at Krepost Uzen.—P-23352; 87, 54–95 mm SL;
Russia: Lipetsk region: Don River at Donskoye.
Cobitis saniae: P-22310, 4, 36–53 mm SL; Azerbai-
jan: Lankaran region: Haftoni village.—P-23665, 1, 60
mm SL; Iran: Gilan prov.: Sefidrud, 37°00′36′′ N
49°22′12′′ E.—P-23666, 6, 33–63 mm SL; Iran: Gilan
prov.: Sefidrud, 36°30′ N 49°21′ E.—P-23668, 32,
30–66 mm SL; Iran: Gilan prov.: Sefidrud, 36°30′ N
49°21′ E.—P-23669, 13, 30–62 mm SL; Iran: Gilan
prov.: Sefidrud, 37°00′36′′ N 49°22′12′′ E.—P-23670,
17, 26–69 mm SL; Azerbaijan: Astara region: Siyaku
River at Takhtakeran.—P-23672, 23, 31–56 mm SL;
Iran; Gilan prov.: Gisum River, 37°24′ N 49°01′48′′ E.—
P-24124, 79, 36–73 mm SL; Azerbaijan: Astara
region: Archivanсhay River at Archivan, 38°17′24′′ N
48°30′ E.—P-24125, 1, 65 mm SL; Azerbaijan: Lan-
karan region: Narimanabad-2, the channel to the sea,
38°33′36′′ N 48°32′24′′ E.—P-24126, 5, 50–63 mm
SL; Azerbaijan: Astara region: Pensarchay River at
Siyaku, 38°21′ N 48°28′48′′ E.—P-24127, 13, 52–60 mm
SL; Azerbaijan: Astara region Astara River at Astara,
38°16′12′′ N 48°28′12′′ E.—P-24129, 3 42–59 mm SL;
Azerbaijan; Masalla region: Vilashchay River at
Arkivan, 39°00′43.4′′ N 48°35′48.7′′ E.—P-24130, 3,
40–53 mm SL; Azerbaijan: Masalla region: Vilash-
chay River at Arkivan, 39°01′03.8′′ N 48°42′08.9′′ E.—
P-24131, 4, 47–54 mm SL; Azerbaijan: Jalilabad
Fig. 10. Cobitis derzhavini sp. nova from the Mingechaur Reservoir basin: (a) ZMMU P-24189, male, 54 mm SL; (b) ZMMU P-
24190, female, 70 mm SL.
(a)
(b)
Fig. 11. Cobitis saniae, alive female from the Vilashchay River.
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 151
region: Goytapa River at Goytapa, 39°07′05.5′′ N
48°35′47.5′′ E.—P-24132, 5, 44–69 mm SL; Azerbai-
jan; Ganja-Qazakh region: Agstafa River at Qıraq
Kesemen, 41°13′38.0′′ N 45°26′14.8′′ E.—P-24133, 1,
56 mm SL; Azerbaijan: Jalilabad region: Bolgarchay
River at Shorbachi, 39°25′34.3′′ N 48°28′35.59′′ E.—
P-24134, 4, 45–49 mm SL; Azerbaijan: Jalilabad
region: Bolgarchay River at Shorbachi, 39°27′36.4′′ N
48°39′01.0′′ E.
Material used in molecular genetic analysis. ZMMU
P-22310-Cob4-5, 17; Azerbaijan: Lankaran region:
Haftoni village (GenBank accession numbers:
MK506133—MK506136, MK50 6151, MK50 6152
COI, MK506198—MK506200, MK506211,
MK506212 RAG1).—ZMMU P-23665-Cob6_43;
Iran: Gilan prov.: Sefidrud (GenBank accession num-
bers: MK506142 COI, MK506203 RAG1).—ZMMU
P-23666-Cob6_30; Iran: Gilan prov.: Sefidrud (Gen-
Bank accession numbers: MK506137—MK506140
COI, MK506201 RAG1).—ZMMU P-23668-
Cob8_1-3; Iran: Gilan prov.: Sefidrud (GenBank
accession numbers: MK506148—MK506150 COI,
MK506209, MK506210 RAG1).—ZMMU P-23669-
Cob22; Iran: Gilan prov.: Sefidrud (GenBank acces-
sion numbers: MK506156, MK50 6157 COI,
MK506215, MK506216 RAG1).—ZMMU P-23670-
Cob6_1-4, 18; Azerbaijan: Astara region: Siyaku River
at Takhtakeran (GenBank accession numbers:
MK506137—MK50 6139, MK506141, MK506153
COI, MK506202 RAG1).—ZMMU P-23672-Cob19;
Iran; Gilan prov.: Gisum River (GenBank accession
numbers: MK506154 COI, MK506213 RAG1).—
ZMMU P-24124-Archivanchai_1-3; Azerbaijan:
Astara region: Archivanсhay River at Archivan (Gen-
Bank accession numbers: MK506126, MK506127
COI, MK506189—MK506191 RAG1).—P-24126-
Pensarchay_1-3; Azerbaijan: Astara region: Pen-
sarchay River at Siyaku (GenBank accession numbers:
MK506131, MK50 6132 COI, MK506195—
MK506197 RAG1).—P-24127-Astara_1-3, Azerbai-
jan: Astara region: Astara River at Astara (GenBank
accession numbers: MK506128—MK506130 COI,
MK506192—MK506194 RAG1).—P-24129-AZ116;
Azerbaijan: Masalla region: Vilashchay River at
Arkivan (GenBank accession numbers: MK506162,
MK506163 COI, MK506223 RAG1).—P-24130-
AZ209-210; Azerbaijan: Masalla region: Vilashchay
River at Arkivan (GenBank accession numbers:
MK506170 COI, MK506230, MK506231 RAG1).—
P-24131-AZ200-201; Azerbaijan: Jalilabad region:
Goytapa River at Goytapa (GenBank accession num-
bers: MK506164, MK506165 COI, MK506224,
Fig. 12. Cobitis saniae, ZMMU P-24132, male, 69 mm SL (voucher for MK506173 COI, MK506234 RAG1) (a), and the pigmen-
tation of its caudal part (b).
(a)
(b)
Fig. 13. Cobitis derzhavini sp. nova from the Mingechaur
Reservoir, cleaned lamina circularis in three males, used
for craniological studies.
152
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
VAS IL’EVA et al.
MK506225 RAG1).—P-24132–AZ215-216; Azerbai-
jan; Ganja-Qazakh region: Agstafa River at Qıraq
Kesemen (GenBank accession numbers: MK506173
COI, MK506234, MK506235 RAG1).—P-24134–
AZ205-208; Azerbaijan: Jalilabad region: Bolgarchay
River at Shorbachi (GenBank accession numbers:
MK506166–MK506169 COI, MK506226–
MK506229 RAG1).—IBIW L85-87; Azerbaijan:
Jalilabad region: Goytapa River at Goytapa. (Gen-
Bank accession numbers: MK506175–MK506177
COI).—IBIW L99; Azerbaijan: Jalilabad region: Bol-
garchay River at Shorbachi (GenBank accession num-
ber: MK506180 COI).—IBIW ML99; Georgia:
Kakheti A.R.; Alazan River (Kura River drainage) at
Matani, 42o03′32′′ N 45o14′03′′ E (GenBank acces-
sion number: MK506124 COI).—IBIW ZR196; Azer-
baijan: Azerbaijan; Ganja-Qazakh region: Kurakh-
chay River at Nadirkend, 40o39′31′′ N 46o37′53′′ E
(GenBank accession number: MK506188 COI).
Cobitis satunini, ZMMU: P-2852, holotype, 74
mm SL; Georgia: Adjara A.R.: lower Kintrish River.—
P-2313, 2 paratypes, 69–83 mm SL; Georgia:
Adjara A.R.: lower Kintrish River.—P-2264, 4, 37–59
mm SL; Georgia: Adjara A.R.: lower Kintrish River.—
P-2851, 1, 54 mm SL; Georgia: Adjara A.R.: lower
Kintrish River.
Material used in molecular genetic analysis. IBIW
ML164; Georgia: Guria A.R.: Skurdumi River at
Tsikisperdi 41°56′57′′ N 41°55′54′′ E (GenBank
accession number: MK506181 COI).—IBIW ML 172-
173; Georgia: Guria A.R.: Supsa River at Akhalsopeli,
41°59′07′′ N 41°58′36′′ E (GenBank accession num-
bers: MK506182, MK506183 COI).—IBIW ML362-
363; Georgia: Imareti A.R.: Gubistskali River (Rioni
River drainage) at Ianeti, 42°11′10′′ N 41°25′52′′ E
(GenBank accession numbers: MK506185,
MK506186 COI).—IBIW ML367; Georgia: Same-
grelo-Zemo Svaneti A.R.: stream, a tributary of Khobi
River at Bia, 42°21′27′′ N 41°55′04′′ E (GenBank
accession number: MK506187 COI).
Cobitis taenia, ZMMU: P-21194, 4, 57–72 mm SL;
Russia: Penza region: Moksha River at Chernozerye.—
P-21445, 18, 51–78 mm SL; Russia: Smolensk region:
Dnepr River at Bilino, 55°13′28.6′′ N 33°29′03.8′′ E.
ACKNOWLEDGMENTS
The authors are deeply grateful to Artem Kidov for sev-
eral samples of spined loaches from Azerbaijan provided by
him as well as to Namig Mustafayev for his help in the field.
FUNDING
Scientific investigations of EV and ES are supported by
the State Project of ZMMU АААА-А16- 116021660077-3,
BL was supported by grant of Russian Foundation for Basic
Research (19-04-00719).
COMPLIANCE WITH ETHICAL STANDARDS
Conf lict of interests. The authors declare that they have
no conflict of interest.
Statement on the welfare of animals. All applicable inter-
national, national, and/or institutional guidelines for the
care and use of animals were followed.
REFERENCES
Abdurakhmanov, Yu.A., Ryby presnykh vod Azerbaidzhana
(Freshwater Fishes of Azerbaijan), Baku: Akad. Nauk
AzSSR, 1962.
Barach, G.P., Fauna Gruzii. Tom 1. Presnovodnye ryby (Fau-
na of Georgia, Vol. 1: Freshwater Fishes), Tbilisi: Akad.
Nauk GruzSSR, 1941.
Bohlen, J., Perdices, A., Doadrio, I., and Economidis, P.S.,
Vicariance, colonization, and fast local speciation in Asia
Minor and the Balkans as revealed from the phylogeny of
spined loaches (Osteichthyes; Cobitidae), Mol. Phylogenet.
Evol., 2006, vol. 39, pp. 552–561.
Bogutskaya, N.G., Naseka, A.M., Shedko, S.V., et al., The
fishes of the Amur River: updated check-list and zoogeog-
raphy, Ichthyol. Explor. Freshwaters, 2008, vol. 19, no 4,
pp. 301–366.
Burland, T.G., DNASTAR’s Lasergene sequence analysis
software, Methods Mol. Biol., 1999, vol. 132, pp. 71–91.
Chen, Y.-X., Chen, H., He, D.-K., and Chen, Y.-F., Two
new species of the genus Cobitis (Cypriniformes: Cobitidae)
from South China, Zool. Syst., 2018, vol. 43, no. 2, pp. 156–
168.
Choleva, L., Musilova, Z., Kohoutova-Sediva, et al., Dis-
tinguishing between incomplete lineage sorting and genom-
ic introgressions: complete fixation of allospecific mito-
chondrial DNA in a sexually reproducing fish (Cobitis; Te-
leostei), despite clonal reproduction of hybrids, PLoS One,
2014, vol. 9, no. 6, p. E80641
Derzhavin, A.N., Katalog presnovodnykh ryb Azerbaidzhana
(Catalog of Freshwater Fish of Azerbaijan), Baku: Akad.
Nauk AzSSR, 1949.
Eagderi, S., Jouladeh-Roudbar, A., Jalili, P., et al., Taxo-
nomic status of the genus Cobitis Linnaeus, 1758 (Teleostei:
Cobitidae) in the southern Caspian Sea basin, Iran with de-
scription of a new species, FishTaxa, 2017, vol. 2, no. 1,
pp. 48–61.
Elanidze, R.F., Ryby rek i ozer Gruzii (Ichthyofauna of Riv-
ers and Lakes of Georgia), Tbilisi: Metsniereba, 1983.
Erk’akan, F., Özdemir, F., and Özeren, S.C., Two new spe-
cies of the genus Cobitis Linnaeus (Teleostei: Cobitidae)
from Turkey, FishTaxa, 2017, vol. 2, no. 2, pp. 82–89.
Freyhof, J., Bayçelebí, E., and Geiger, M., Review of the
genus Cobitis in the Middle East, with the description of
eight new species (Teleostei: Cobitidae), Zootaxa, 2018,
vol. 4535, no 1, pp. 1–75.
Geiger, M.F., Freshwater Diversity Identification for Eu-
rope (FREDIE). https://www.fredie.eu/.
Geiger, M.F., Herder, F., Monaghan, M.T., et al., Spatial
heterogeneity in the Mediterranean Biodiversity Hotspot
affects barcoding accuracy of its freshwater fishes, Mol.
Ecol. Res., 2014, vol. 14, pp. 1210–1221.
Hall, T.A., BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows
JOURNAL OF ICHTHYOLOGY Vol. 60 No. 2 2020
Cobitis derzhavini SP. NOVA—A NEW SPINED LOACH SPECIES 153
95/98/NT, Nucleic Acids Symp. Ser., 1999, vol. 41, pp. 95–
98.
International barcode of life (IBOL). https://ibol.org/.
Ivanova, N.V., DeWaard, J., and Hebert, P.D.N., An inex-
pensive, automation friendly protocol for recovering high
quality DNA, Mol. Ecol. Notes, 2006, vol. 6, pp. 998–1002.
Jouladeh-Roudbar, A., Eagderi, S., Sayyadzadeh, G., and
Esmaeili, H.R., Cobitis keyvani, a junior synonym of Cobitis
faridpaki (Teleostei: Cobitidae), Zootaxa, 2017, vol. 4244,
no. 1, pp. 118 –126.
Kasymov, A.G., Gidrofauna Nizhnei Kury i Mingechaursko-
go vodokhranilitsha (Hydrofauna of the lower Kura and
Mingechaur Reservoir), Baku: Akad. Nauk AzSSR, 1965.
Kazancheev, E.N., Ryby Kaspiiskogo morya (Fishes of the
Caspian Sea), Moscow: Legkaya Pishchevaya Prom-st,
1981.
Knebelsberger, T., Dunz, A.R., Neumann, D., and Gei-
ger, M.F., Molecular diversity of Germany’s freshwater
fishes and lampreys assessed by DNA, Mol. Ecol. Res., 2015,
vol. 15, no. 3, pp. 562–572.
Kottelat, M. and Freyhof, J., Handbook of European Fresh-
water Fishes, Berlin: Kottelat, Cornol and Freyhof, 2007.
Lanfear, R., Calcott, B., Ho, S.Y.W., and Guindon, S.,
PartitionFinder: combined selection of partitioning
schemes and substitution models for phylogenetic analyses,
Mol. Biol. Evol., 2012, vol. 29, no. 6, pp. 1695–1701.
Mousavi-Sabet, H., Vasil’eva, E.D., Vatandoust, S., and
Vasil’ev, V.P., Cobitis faridpaki sp. nova—a new spined
loach species (Cobitidae) from the southern Caspian Sea
basin (Iran), J. Ichthyol., 2011, vol. 51, no. 10, pp. 925–931.
Mousavi-Sabet, H., Vatandoust, S., Esmaeili, H.R., et al.,
Cobitis avicennae, a new species of spined loach from the Ti-
gris River drainage (Teleostei: Cobitidae), Zootaxa, 2015,
vol. 3914, no. 5, pp. 558–568.
Nakajima, J., Cobitis takenoi sp. n. (Cypriniformes, Cobiti-
dae): a new spined loach from Honshu Island, Japan, Zoo-
Keys, 2016, vol. 568, pp. 119–128.
Naseka, A.M., Zoogeographical freshwater divisions of the
Caucasus as a part of the West Asian transitional region, Tr.
Zool. Inst., Ross. Akad. Nauk, 2010, vol. 314, no. 4, pp. 469–
492.
Ninua, N.Sh. and Japoshvili, B.O., Check list of fishes of
Georgia, Tr. Inst. Zool., Tbilisi, 2008, vol. 23, pp. 163–176.
Perdices, A. and Doadrio, I., The molecular systematics
and biogeography of the European cobitids based on mito-
chondrial DNA sequences, Mol. Phylogenet. Evol., 2001,
vol. 19, pp. 468–478.
Perdices, A., Bohlen, J., and Doadrio, I., The molecular di-
versity of Adriatic spined loaches (Teleostei, Cobitidae),
Mol. Phylogenet. Evol., 2008, vol. 46, pp. 382–390.
Perdices, A., Bohlen, J., Šlechtová, V., and Doadrio, I.,
Molecular evidence for multiple origins of the European
spined loaches (Teleostei, Cobitidae), PLoS One, 2016, vol. 11,
no. 1. pp. 1–18.
Perdices, A., Ozeren, C.S., Erkakan, F., and Freyhof, J.,
Diversity of spined loaches from Asia Minor in a phylogenetic
context (Teleostei: Cobitidae), PLoS One, 2018, vol. 13,
no. 10, p. e0205678.
Rambaut, A. and Drummond, A.J., Tracer v1.5, 2007.
http://www.beast.bio.ed.ac.uk/Tracer.
Ronquist, F. and Huelsenbeck, J.P., MrBayes 3: Bayesian
phylogenetic inference under mixed models, Bioinformatics,
2003, vol. 19, no. 12, pp. 1572–1574.
Saitoh, K. and Aizawa, H., Local differentiation within the
striated spined loach (the striata type of Cobitis taenia com-
plex), Jpn. J. Ichthyol., 1987, vol. 34, no. 3, pp. 334–345.
Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular
Cloning: a Laboratory Manual, New York: Cold Spring Har-
bor Lab., 1989, 2nd ed.
Shorthouse, D.P., SimpleMappr, an online tool to produce
publication-quality point maps, 2010. https://www.simple-
mappr.net. Accessed June 23, 2019.
Šlechtová, V., Jr., Bohlen, J., and Tan, H.H., Families of
Cobitoidea (Teleostei: Cypriniformes) as revealed from nu-
clear genetic data and the position of the mysterious genera
Barbucca, Psilorhynchus, Serpenticobitis, and Vaillantella,
Mol. Phylogenet. Evol., 2007, vol. 44, pp. 1358–1365.
Šlechtová, V., Bohlen, J., and Perdices, A., Molecular phy-
logeny of the freshwater fish family Cobitidae (Cyprini-
formes: Teleostei): Delimitation of genera, mitochondrial
introgression and evolution of sexual dimorphism, Mol.
Phylogenet. Evol., 2008, vol. 47, pp. 812–831.
Stamatis, C., Ketsetzi, A., Chamoglou, M., et al., The Ge-
netics of Genus Cobitis of Lake Karla, Thessaly: Univ. of
Thessaly, 2017.
Tamura, K., Peterson, D., Peterson, N., et al., MEGA5:
molecular evolutionary genetics analysis using maximum
likelihood, evolutionary distance, and maximum parsimo-
ny methods, Mol. Biol. Evol., 2011, vol. 28, pp. 2731–2739.
Thalinger, B., Oehm, J., Mayr, H. et al., Molecular prey
identif ication in Central European piscivores, Mol. Ecol.
Res., 2016, vol. 16, no. 1, pp. 123–137.
Vasil’ev, V.P., Karyological diversity and taxonomic het-
erogeneity of Cobitis “taenia” (Cobitidae), Dokl. Ross.
Akad. Nauk, 1995, vol. 342, no. 6, pp. 839–842
Vasil’eva, E.D., Comparative morphological analysis of two
spined loach (genus Cobitis, Cobitidae) populations differ in
a number of spots at the base of the caudal fin, Vopr. Ikhtiol.,
1984, vol. 24, no. 1, pp. 43–53.
Vasil’eva, E.D., Redescription, morpho-ecological charac-
teristics and distribution of Cobitis granoei (Teleostei, Co-
bitidae), Zool. Zh., 1988, vol. 67, no. 7, pp. 1025–1037.
Vasil’eva, E.D., Fam. 16. Cobitidae Swainson, 1839—co-
bitids, in Annotirovannyi katalog kruglorotykh i ryb kontinen-
tal’nykh vod Rossii (Annotated Check-List of Cyclostomata
and Fishes of the Continental Waters of Russia), Moscow:
Nauka, 1998.
Vasil’eva, E.D. and Vasil’ev, V.P., Cobitis amphilekta sp. no-
va, a new species of spined loaches (Cobitidae, Cyprini-
formes) from the Caspian Sea basin, J. Ichthyol., 2012,
vol. 52, no. 3, pp. 200–206.
Vasil’eva, E.D. and Vasil’ev, V.P., Natural hybridization be-
tween spined loaches from the genera Cobitis and Sabane-
jewia (Cobitidae), J. Ichthyol., 2019, vol. 59, no. 5, pp. 776–
785.
Vasil’eva, E.D., Kim, D., Vasil’ev, V.P. et al., Cobitis nal-
banti, a new species of spined loach from South Korea, and
redescription of Cobitis lutheri (Teleostei: Cobitidae), Zoot-
axa, 2016, vol. 4208, no. 6, pp. 577–591.
Vasilyeva, E.D., Solovyeva, E.N., Levin, B.A., and Vasil’ev, V.P.
Taxonomic diversity of spined loaches (Cobitidae: Cobitis)
in the Caucasus, Proc. XVI European Congr. of Ichthyology,
Lausanne, Switzerland, 2019.
https://doi.org/10.3389/conf.fmars.2019.07.00097.
