ArticlePDF Available

White tea and its active polyphenols lower cholesterol through reduction of very-low-density lipoprotein production and induction of LDLR expression

Authors:

Abstract and Figures

Emerging in vivo and vitro data suggest that white tea extract (WTE) is capable of favourably modulating metabolic syndrome, especially by ameliorating abnormal lipid metabolism. Microarray-based gene expression profiling was performed in HepG2 cells to analyze the effects of WTE from a systematic perspective. Gene Ontology and pathway analysis revealed that WTE significantly affected pathways related to lipid metabolism. WTE significantly downregulated apolipoprotein B (APOB) and microsomal triglyceride transfer protein (MTTP) expression and thereby reduced the production of very-low-density lipoprotein. In the meanwhile, WTE stimulated low-density lipoprotein-cholesterol (LDL-c) uptake through targeting low-density lipoprotein receptor (LDLR), as a consequence of the activation of sterol regulatory element-binding protein 2 (SREBP2) and peroxisome proliferator-activated receptor δ (PPARδ). Furthermore, WTE significantly downregulated triglycerides synthetic genes and reduced intracellular triglycerides accumulation. Besides, we demonstrated that the tea catechins epigallocatechin-3-gallate (EGCG) and epicatechin-3-gallate (ECG) are abundant in WTE and contribute to the regulation of cholesterol metabolism related genes, including LDLR, MTTP and APOB. Our findings suggest white tea plays important roles in ameliorating abnormal lipid metabolism in vitro.
Content may be subject to copyright.
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy
journal homepage: www.elsevier.com/locate/biopha
White tea and its active polyphenols lower cholesterol through reduction of
very-low-density lipoprotein production and induction of LDLR expression
Kun Luo
a,b,c
, Chengmei Ma
d
, Shaofang Xing
d
, Yannan An
d
, Juan Feng
a,b,c
, Honglei Dang
d
,
Wenting Huang
a,b,c
, Liansheng Qiao
a,b,c
, Jing Cheng
a,b,c,d,
*, Lan Xie
a,b,c,d,
*
a
State Key Laboratory of Membrane Biology, School of Medicine, Tsinghua University, Beijing, 100084, China
b
Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Hangzhou, 310003, China
c
Medical Systems Biology Research Center, School of Medicine, Tsinghua University, Beijing, 100084, China
d
National Engineering Research Center for Beijing Biochip Technology, Beijing, 102206, China
ARTICLE INFO
Keywords:
White tea extract
Lipid metabolism
Microarray
APOB
MTTP
LDLR
PPARδ
ABSTRACT
Emerging in vivo and vitro data suggest that white tea extract (WTE) is capable of favourably modulating me-
tabolic syndrome, especially by ameliorating abnormal lipid metabolism. Microarray-based gene expression
proling was performed in HepG2 cells to analyze the eects of WTE from a systematic perspective. Gene
Ontology and pathway analysis revealed that WTE signicantly aected pathways related to lipid metabolism.
WTE signicantly downregulated apolipoprotein B (APOB) and microsomal triglyceride transfer protein (MTTP)
expression and thereby reduced the production of very-low-density lipoprotein. In the meanwhile, WTE sti-
mulated low-density lipoprotein-cholesterol (LDL-c) uptake through targeting low-density lipoprotein receptor
(LDLR), as a consequence of the activation of sterol regulatory element-binding protein 2 (SREBP2) and per-
oxisome proliferator-activated receptor δ(PPARδ). Furthermore, WTE signicantly downregulated triglycerides
synthetic genes and reduced intracellular triglycerides accumulation. Besides, we demonstrated that the tea
catechins epigallocatechin-3-gallate (EGCG) and epicatechin-3-gallate (ECG) are abundant in WTE and con-
tribute to the regulation of cholesterol metabolism related genes, including LDLR,MTTP and APOB. Our ndings
suggest white tea plays important roles in ameliorating abnormal lipid metabolism in vitro.
1. Introduction
Originated from China, tea has gained the worlds taste in the past
2000 years. Abundant evidence has shown that tea plants, as the pri-
mary component of one of the most consumed beverages in the world,
provide health benets through mediating energy metabolism via their
bioactive components [1]. Tea and tea polyphenols have been shown to
inhibit tumorigenesis in animal models for cancers of lung, skin, pros-
tate, mammary glands, oral cavity, esophagus, stomach, small intestine,
colon, liver, pancreas, and bladder [2]. The cardioprotective eect of
green tea has been demonstrated in several animal studies and it may
involve multiple mechanisms, including anti-oxidative, anti-in-
ammatory, anti-hypertensive, anti-thrombogenic and lipid lowering
eects [3,4]. White tea comes from the same plant (Camellia sinensis)as
other types of teas. Unlike green or black tea, which is prepared from
mature tea leaves, white tea is made from silvery buds and young tea
leaves. In addition, only a few steps are needed to prepare white tea: the
young buds and leaves are pan-fried to inactivate polyphenol oxidase
and then dried [5]. Hence, the average concentrations of total poly-
phenols and catechins are higher in white tea than in other teas [6].
Disordered energy metabolism seriously aects people's lives. An
abnormal increase in lipids leads to hypercholesterolemia, an important
modiable risk factor that contributes substantially to the development
of cardiovascular diseases. Importantly, the global prevalence of car-
diovascular disease was estimated to be 422.7 million in 2015 [7].
Interestingly, teas are eective in lowering blood glucose and lipid
accumulation with less toxicity and fewer side eects [8].
The most prominent feature of white tea is its antioxidant capacity.
Indeed, white tea shows strong antioxidant activity in vivo and in vitro
[9,10] and was validated to have the highest antioxidant capacity
among 21 plants (including green tea) [11]. In addition, evidence has
shown that white tea plays a critical role in regulating lipid metabolism.
Although there is no clinical research for white tea, animal studies have
validated its benecial eects. Islam et al. found that white tea extract
(WTE) eectively reduced lipid-associated parameters in rats [12].
Specically, total cholesterol and low-density lipoprotein-cholesterol
https://doi.org/10.1016/j.biopha.2020.110146
Received 18 January 2020; Received in revised form 2 April 2020; Accepted 4 April 2020
Corresponding authors at: State Key Laboratory of Membrane Biology, School of Medicine, Tsinghua University, Beijing, 100084, China.
E-mail addresses: jcheng@tsinghua.edu.cn (J. Cheng), xielan@tsinghua.edu.cn (L. Xie).
Biomedicine & Pharmacotherapy 127 (2020) 110146
0753-3322/ © 2020 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
T
(LDL-c) were all ameliorated by WTE [12]. In addition to animal ex-
periments, in vitro experiments have also been carried out to identify
the hypolipidaemic activities of white tea. Söhle et al.found that WTE
possessed strong lipolytic and antiadipogenic activity in human sub-
cutaneous preadipocytes [13]. Transcription factors involved in adi-
pogenesis, such as CCAAT-enhancer binding protein α(C/EBPα), adi-
pocyte determination and dierentiation factor 1 (ADD1), and sterol
regulatory element-binding protein 1-c (SREBP1-c), were all down-
regulated by WTE treatment [13]. Tenore et al.reported that WTE
treatment increased low-density lipoprotein receptor (LDLR) binding
activity and reduced lipase activity [14]. Meanwhile, apolipoprotein A1
(ApoA1), the major protein component of high-density lipoprotein
(HDL) particles, was found to be upregulated at the protein level [14].
In summary, recent studies have revealed the hypolipidaemic activities
of WTE. However, there is a lack of systematic analysis of WTE in lipid
regulation and the direct mechanism remains to be explored.
The current study aimed to explore the molecular mechanisms of
WTE in regulating lipid metabolism from a systematic perspective. We
use the liver derived cancer cell line HepG2 to study the transcriptome
changes in response to WTE treatment based on gene expression array.
Gene ontology (GO) and pathway enrichment analysis was performed
to study the target pathways of WTE. Potential targets of WTE revealed
by transcriptome analysis were further validated by molecular and
cellular assays in HepG2 and more cell lines, including HL-7702
(Normal human hepatic cell line) and 293 T (a mutant version of
Human embryonic kidney 293 cells).
2. Materials and methods
2.1. Materials
White tea leaves were purchased from Fuding White Tea Co., Ltd
(Fuding, China). HepG2, HL-7702 and 293 T cell lines were obtained
from the Cell Resource Center, Peking Union Medical College. High-
glucose DMEM, fetal bovine serum (FBS), and other cell culture re-
agents were purchased from HyClone (Logan, UT). Primary antibodies
against SREBP2, LDLR, PPARδand glyceraldehyde 3-phosphate dehy-
drogenase (GAPDH) were purchased from Cell Signaling Technology
(Beverly, MA). ECG, EC and C were purchased from National Drug
Reference Standards (Beijing, China). GA, EGC and EGCG were pur-
chased from Shanghaiyuanye Bio-Technology (Shanghai, China).
2.2. Preparation of WTE
A total of 10 g white tea leaves were milled and extracted with 150
mL of 90 % ethanol in a Soxhlet extractor. The temperature of extrac-
tion for solvents was kept at 80 °C for 3 h. Raw extract was concentrated
at 45 °C for 2 h, and then collected. Finally, the collection was lyo-
philized at -45 °C and 80 Pa for 24 h to obtain the nal WTE. WTE was
dissolved in DMSO before use.
2.3. Cell culture and viability assay
The human carcinoma cell line HepG2 was used for gene expression
proling because it reects hepatic characteristics and has been de-
monstrated as a useful experimental model to study lipid metabolism
[15,16]. However, dierences in cellular responses between normal
and cancerous cell lines may exist. The human normal liver cell line HL-
7702 was selected to further identify the hypolipidemic activities of
WTE. The 293 T cell line (a mutant version of human embryonic kidney
293 cells) was commonly used in luciferase assay because it was easy to
transfect, and rarely expresses endogenous receptors and reduces in-
terference during experiment.
HepG2, HL-7702 and 293 T cells were grown in high-glucose DMEM
contained 10 % (v/v) FBS, 100 units/mL penicillin and 100 μg/mL
streptomycin. Cell viability was measured using cell counting kit-8
(Dojindo Molecular Technologies, Kumamon, Japan). Cells were seeded
on 96-well plates and treated with various concentrations of WTE for 24
h. Each well was incubated with 100 μl 10 % CCK-8 working solution
for 2 h at 37 °C. The absorbance at 450 nm was read using a SpectroMax
spectrophotometer (Spectromax Solutions Ltd, London, United
Kingdom).
2.4. Gene expression array
SurePrint G3 Human GE v3 8 × 60 K microarray chip (Agilent
Technologies, Santa Clara, CA) representing all putative genes of the
human genome was used for gene expression proling of HepG2 cells.
HepG2 cells were treated with WTE or DMSO for 24 h (one sample in
each group) and subject to transcriptome analysis. Total RNA was
prepared with Trizol reagent (Invitrogen, Carlsbad, CA). To avoid
genomic DNA contamination, total RNA samples were treated with
RNase-free DNase Kit (Invitrogen) according to the manufacturers in-
structions. The puried total RNA was used to produce Cy3-labeled
cDNA using Agilent Low Input Quick Amp Labeling Kit (Agilent
Technologies). Microarrays were scanned with an Agilents Microarray
Scanner System, and the resulting images were analyzed with the
Agilent Feature Extraction software. Microarray data was analyzed by
LIMMA, a type of R software package that was used for microarray data
normalization, calculation and fold change determination. Genes were
considered dierentially expressed with a 2-fold change in the WTE
treated samples compared to the control sample.
2.5. Gene ontology and pathway analysis
Dierentially expressed genes (DEGs) were annotated by GO, KEGG
and Reactome respectively. GO, KEGG and Reactome analysis were
performed using the DAVID online database (DAVID, http://david.
ncifcrf.gov).
2.6. Isolation of RNA and analysis of mRNA expression
RNA was isolated by Trizol (Invitrogen) and reverse-transcribed
using a High Capacity RNA-to-cDNA Kit (Thermo Fisher Scientic,
Rochester, NY). Quantitative real-time PCR (qPCR) was performed by
incorporating SYBR green (Kapa Biosystems, Woburn, MA) using a BIO-
RAD real-time system (BIO-RAD, Hercules, CA), and the results were
normalized to GAPDH. The relative gene expression data were analysed
using the ΔΔCT method [17]. The primers used in this study are listed
in supplemental Table 1.
2.7. Determination of apolipoprotein B (APOB) concentration
APOB concentrations were determined using the human APOB
ELISA kit (Abcam, Cambridge, United Kingdom). All experimental steps
were carried out following the manufacturers protocol.
2.8. LDL uptake assay
HepG2 cells were plated in 12-well plates and incubated with DMSO
or WTE for 24 h. Cells were washed 3 times with PBS and cultured with
FBS-free DMEM containing 10 μg/mL Alexa Fluor 488-labelled human
LDL-c (Invitrogen) for 4 h. Finally, cells were analysed by ow cyto-
metry (FACSAriaIII, BD Biosciences, San Jose, CA). The uorescence
indicated the LDL-c uptake capacity of cells.
2.9. Construction of luciferase reporter
The promoter regions of human APOB gene (-155 to +131 bp),
MTTP gene (-165 to +30 bp) and LDLR gene (-1100 to +187 bp) were
cloned and recombined into the KpnI/HindIII sites of the pGL3-basic
luciferase vector (Promega, Madison, WI). The pGL3-PPRE reporter
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
2
(PPRE sequence: TCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAC
TCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAC) was purchased
from Yeasen Biotech (Shanghai, China) and pGL3-SRE reporter (SRE
sequence: GACATTTGAAAATCACCCCACTGCAAACTCCTCCCCCTG)
was constructed by Genewiz (Suzhou, China). The pGL3-LDLR-PPRE
mutant (AAGTTCAA ACCAACAA), pGL3-LDLR-SRE mutant (ATCAC
CCC ATCATTCC), and pGL3-LDLR-PPRE&SRE double mutant re-
porter plasmids were constructed by QuikChange®lightning site-di-
rected mutagenesis kits (Stratagene, San Diego, CA).
2.10. Luciferase reporter assay
The 293 T cells were co-transfected with 1000 ng of the indicated
luciferase plasmids (pGL3-APOB, pGL3-MTTP, pGL3-LDLR, pGL3-LDLR-
PPRE mutant, pGL3-LDLR-SRE mutant and PGL3-LDLR-PPRE&SRE
double mutant) and 100 ng pRL-TK Renilla plasmid using the JetPEI kit
(Polyplus, New York, NY). At 24 h post transfection, the cell medium
was switched to medium supplemented with DMSO or 200 μg/mL WTE.
After another 24 h, luciferase activity was measured using the Dual-
Luciferase Reporter Assay System (Promega). Renilla activity was used
to normalize for transfection eciency. All transfection experiments
were performed in duplicate and repeated independently for at least
three times.
2.11. Western blot analysis
Cells were lysed using cell lysis buer, and cell debris was removed
by centrifugation at 28,340 gfor 15 min at 4 °C. Equal amounts of
protein (30 μg) were subjected to SDS-PAGE and transferred onto 0.2
μm PVDF membranes. After the membranes were blocked with 7% skim
milk, they were incubated with primary antibodies at 4 °C overnight
and then with horseradish peroxidase-conjugated secondary antibodies
for 1 h. After each incubation, the membranes were washed 3 times
with TBST. Finally, the membranes were developed with ECL reagents
(General Electric, Boston, MA), and the results were recorded on X-ray
lm.
2.12. Oil Red O (ORO) staining and determination of total triglyceride
(TG)
HepG2 cells were seeded on 6-well plates and cultured with or
without 60 μg/mL sodium oleate (MACKLIN, Beijing, China) for 24 h.
Cells were then washed twice and incubated with DMSO or the in-
dicated concentrations of WTE for another 24 h. Cells were rinsed twice
and xed in 10 % paraformaldehyde for 30 min. Cells were then wa-
shed with 60 % isopropanol and stained with freshly prepared working
solution of ORO (0.3 g per 100 mL of isopropanol, Beijing Chemical
Works, Beijing, China) for 30 min at room temperature. After the
staining solution was removed, the cells were washed sequentially with
60 % isopropanol and PBS. Pictures were captured with a light micro-
scope (Olympus, Tokyo, Japan) and was quantied by Image J (Version
1.8.0, National Institutes of Health).
To determine TG concentration, cells were washed and lysed with
200 μL cell lysis buer. TGs in the cell lysate were extracted by a
commercial triglyceride assay kit (Applygen Technologies, Beijing,
China) and evaluated using a glycerophosphate oxidase-peroxidase
method as per kit protocol. The TG concentration was normalized to the
protein amount.
2.13. Determination of polyphenols content in WTE
A chromatographic analysis was performed using an Agilent 1260
LC system equipped with a variable wavelength detector (VWD).
Separation was carried out in a Symmetry 300 T M C18 column (5 μm,
4.6 × 250 mm; Waters, Milford, MA). The mobile phase was composed
of 0.4 % phosphoric acid aqueous solution (A) and methanol (B). The
gradient program was used as follows: 5% B to 10 % B (010 min), 10
% B to 13 % B (1012 min), 13 % B (1222 min), 13 % B to 18 % B
(2223 min), 18 % B to 25 % B (2335 min), 25 % B to 5% B (3538
min). The ow rate was 1 mL/min and the temperature was maintained
at 40 °C. The detection wavelength was set at 278 nm and the injection
volume was 20 μL. Data acquisition and quantication were performed
using Agilent OpenLAB software. Standards of GA, C, EC, EGC, ECG and
EGCG with the purity of 98.0 % were dissolved in 10 % methanol.
The calibration curves were acquired for each polyphenol at the con-
centrations of 7.81, 15.63, 31.25, 62.5, 125, 250, 500 and 1000 μg/mL.
White tea samples were diluted to 5 mg/mL in 10 % methanol and
passed through a 0.22 μmlter. Each prepared sample was sealed in a
vial and kept in a refrigerator at 4 °C until use. The candidate com-
pounds from tea samples were identied by comparing the retention
times with those of the authentic standards. The contents of the six
polyphenols in the test samples were calculated by using regression
parameters obtained from the standard curves. All analyte concentra-
tions were within linearity.
2.14. Statistical analysis
When comparing WTE-treated group vs. DMSO-treated group, the
results are expressed as the mean ± standard deviation (SD), followed
by paired Studentst-test using Excel (TTEST function for Students T-
test and STDEVP function for standard deviation analysis). A p
value < 0.05 was considered statistically signicant. Linear regression
analysis was performed by Graphpad Prism software (version 8.0,
GraphPad Software, San Diego, CA) for analyzing dose-responsive re-
lationships. In all gures, *p < 0.05, **p < 0.01 as indicated.
3. Results
3.1. Transcriptome analysis of HepG2 cells treated with WTE
Microarray-based gene expression proling was performed to ex-
plore the role of WTE in HepG2 cells (GEO number: GSE123402). The
WTE concentration of 200 μg/mL had no obvious eect on HepG2 cell
viability (half maximal inhibitory concentration = 337.5 μg/mL) based
on a proliferation assay (Supplemental Figure S1A). Transcriptome
analysis revealed that a total of 1093 genes were dierentially ex-
pressed after WTE treatment, using 2-fold as a cut-o. Among them,
808 genes were upregulated and 285 were downregulated. DEGs were
annotated by GO and pathway enrichment analysis was performed to
identify the prominent signalling pathways and biological processes
associated with WTE treatment.
The GO analyses of upregulated and downregulated genes are
shown in Fig. 1A. Genes that were upregulated by the WTE treatment
were mainly involved in single-organism process, lipid metabolic pro-
cess and lipid biosynthetic process, while downregulated genes were
enriched in negative regulation of macromolecule biosynthetic process,
negative regulation of gene expression and cell dierentiation. The
results of KEGG analysis indicated that pathways enriched by the up-
regulated genes included cytokine-cytokine receptor interaction, PPAR
signalling pathway and glycolysis/gluconeogenesis, while the down-
regulated genes were highly enriched in the tumour growth factor
(TGF)-βsignalling pathway, metabolism of xenobiotics by cytochrome
P450 and cell cycle (Fig. 1B). Reactome analysis revealed that the top
hits enriched in WTE-induced DEGs included cholesterol biosynthesis,
regulation of insulin-like growth factor (IGF) transport and uptake by
insulin-like growth factor-binding proteins (IGFBPs), triglyceride bio-
synthesis, interleukin (IL)-6-type cytokine receptor ligand interactions,
and glycolysis (Fig. 1C). Taken together, these observations indicated
that WTE treatment interfered with cellular metabolism in HepG2 cells.
DEGs involved in the top ranked KEGG signalling pathways were
selected as representative genes for validation by RT-qPCR. INHBB is
involved in cytokine-cytokine receptor interactions, PFKFB1 is involved
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
3
in fructose and mannose metabolism, ACSS2 is involved in glycolysis/
gluconeogenesis, SMAD6 and SMAD9 are involved in the TGF-βsig-
nalling pathway and CCNA2 is involved in cell cycling. The RT-qPCR
results agreed well with the microarray results (Supplemental Figure
S1B).
Based on the transcriptome analysis, we assumed that WTE plays an
essential role in lipid metabolism. We selected some key genes asso-
ciated with cholesterol and triglyceride metabolism and determined
their expression after WTE treatment by RT-qPCR. As shown in Fig. 1D,
lipid transport and metabolism related genes, such as FABP1 and
LIPIN1, genes inhibiting cholesterol synthesis, such as INSIG1, and
cholesterol transport-related genes, including NPC1L1 and ABCA3 were
upregulated, while triglyceride synthesis gene such as FADS2, genes
enhancing cholesterol synthesis such as CEL, and cholesterol transport
gene such as ABCG1 were downregulated by WTE treatment. These
results indicate that WTE plays an important role in lipid transport and
synthesis.
3.2. WTE downregulated VLDL production related genes APOB and MTTP
LDL is one of the key lipid-protein complexes in the blood and a
crucial component of metabolism responsible for the transport of lipids
throughout the body [18]. Excessive low-density lipoprotein cholesterol
(LDL-c) is a major risk factor for progression of cardiovascular diseases
[19]. The LDL particles in circulation are derived from VLDL, which is
packaged in the liver through MTTP to load lipids onto newly synthe-
sized APOB and secreted into the blood. Considering that WTE treat-
ment aected many genes related to lipid transport and synthesis, we
evaluated whether WTE treatment altered the expression of VLDL
production related genes.
WTE treatment downregulated APOB expression (Fig. 2A). Based on
enzyme-linked immunosorbent assay (ELISA), the concentration of
APOB-containing particles in HepG2 cell culture medium was sig-
nicantly suppressed by WTE treatment, indicating the inhibitory eect
of WTE on the secretion of APOB, which is the major protein compo-
nent of very low-, intermediate-, and low-density lipoproteins (Fig. 2B).
Luciferase reporter assay was further performed to explore the tran-
scriptional regulation of WTE on APOB. The promoter activity of APOB
was signicantly decreased by 24 h WTE treatment (Fig. 2C).
Similarly, we demonstrated that WTE decreased MTTP expression
(Fig. 2D) and the downregulation was mediated by the regulatory eect
of WTE on MTTP promoter (Fig. 2E). Therefore, WTE aects APOB and
MTTP expression through transcriptional regulation. WTE attenuates
VLDL assembly to some extent.
3.3. WTE promotes LDL-c uptake through transcriptional upregulation of
LDLR
LDL delivers cholesterol and fatty acids to peripheral cells through
receptor-mediated endocytosis, which mainly occurs through LDLR
Fig. 1. Systematic transcriptome analysis of WTE treated HepG2 cells. (A) The top 10 GO biological processes signicantly enriched by up-regulated genes of WTE
(pink) and down-regulated genes of WTE (blue). (B) Signicantly enriched KEGG pathways by up-regulated genes of WTE (pink) and down-regulated genes of WTE
(blue). (C) Signicantly enriched Reactome pathways by DEGs of WTE. GO, KEGG and Reactome analysis were performed by DAVID online database (DAVID, http://
david.ncifcrf.gov). (D) qRT-PCR results of a set of lipid metabolism related genes regulated by WTE (n = 3). In Fig. 1D, data are shown in mean ± SD. Statistical
analyses were conducted using paired Students t test. *p < 0.05 vs. dimethyl sulfoxide (DMSO)-treated group; **p < 0.01 vs. DMSO-treated group (For inter-
pretation of the references to colour in this gure legend, the reader is referred to the web version of this article).
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
4
[20]. Additionally, LDL-c is a well-established risk factor for hyperli-
pidaemia-induced diseases; hence, the improvement of LDL-c clearance
capacity is of vital importance. Interestingly, dierent types of teas,
including green, oolong, black, dark, yellow, and white teas, have been
validated to enhance LDL-c clearance capacity in vivo [12,2123].
Specically, green, black, dark teas have been shown to improve LDL-c
clearance capacity via upregulating LDLR expression, but other types of
teas have been less studied [2426]. The expression of LDLR has also
been conrmed to be increased by treatment with tea catechin
()-epigallocatechin gallate (EGCG) [27,28]. Considering that white tea
Fig. 2. WTE interferes with VLDL assembly through down-regulation of APOB and MTTP. (A) Inhibitory eects of WTE on mRNA expression of APOB (n = 3). (B)
APOB secretion by HepG2 cells under WTE treatment determined by ELISA (n = 3). (C) Luciferase activity of APOB promoter in exposure to WTE for 24 h in HepG2
cells (n = 3). (D) Inhibitory eects of WTE on mRNA expression of MTTP (n = 3). (E) Luciferase activity of MTTP promoter in exposure to WTE for 24 h in HepG2
cells (n = 3). Data are shown in mean ± SD. Statistical analyses were conducted using paired Students t test. *p < 0.05, **p < 0.01 vs. DMSO-treated group.
Fig. 3. WTE promotes LDL-c uptake through up-regulation of LDLR. (A) LDL-c uptake of HepG2 cells treated with dierent concentrations of WTE respectively (100,
200, 300 μg/mL) (n = 3). (B) qPCR results of LDLR in HepG2 cells treated with 100, 200, 300 μg/mL WTE for 24 h respectively (n = 3). Data were processed using
linear regression to analyse dose-responsive relationships. (C) qPCR results of LDLR in HepG2 cells treated with 200 μg/mL WTE for 0, 4, 6, 12, 24 h respectively (n =
3). (D) Western blot of LDLR in HepG2 cells treated with DMSO or WTE. Results were quantied by Image J software (n = 3). (E) LDLR expression in HL-7702 cell
line treated with WTE (n = 3). (F) LDLR transcriptional activity treated with WTE (n = 3). Data are shown in mean ± SD. Statistical analyses were conducted using
paired Students t test. *p < 0.05, **p < 0.01 vs. DMSO-treated group.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
5
contains high levels of catechins, we tested whether WTE stimulated
LDL-c uptake capacity using human LDL-c particles labelled with Alexa
Fluor. As expected, cellular LDL-c uptake was signicantly enhanced by
WTE treatment in a dose-dependent manner (Fig. 3A).
The molecular mechanisms by which WTE stimulates LDL-c uptake
are still not clear, hence eorts have been made toward it in the present
study. One possible explanation for the observed LDL-c uptake could be
the upregulation of LDLR. Consistent with the above phenomenon, we
found that LDLR mRNA was increased by WTE in a dose-dependent
manner (Fig. 3B). A time-course assay revealed that LDLR expression
was increased by WTE in a time-dependent manner, reaching a peak of
2.5-fold increase in expression at 12 h and remaining at 2-fold at 24 h
(Fig. 3C). Western blot results indicated that LDLR was upregulated not
only at the mRNA level but also at the protein level by WTE (Fig. 3D).
The regulation of LDLR by WTE was also conrmed in another hepa-
tocyte cell line, HL-7702 (Fig. 3E), using a concentration with no ob-
vious eect on cell viability (Supplemental Figure S1C). To explore how
WTE regulated LDLR expression, an endogenous LDLR promoter (-1100
bp to +187 bp) was cloned into a luciferase reporter system. We ob-
served a 1.5-fold increase in the luciferase activity induced by WTE
(Fig. 3F), indicating that WTE regulated LDLR expression at the tran-
scriptional level.
3.4. WTE upregulated LDLR expression via two transcription factors,
SREBP2 and PPARδ
Several transcription factors have been reported to play vital roles in
regulating LDLR expression. SREBP2 is believed to be a dominant reg-
ulator of LDLR [29] and PPARδhas been reported to function on LDLR
promoter recently [29,30]. We then examined the expression of
SREBP2 and PPARδafter WTE treatment. It was observed that both
factors were induced by WTE treatment at both the mRNA and protein
levels (Fig. 4A and B).
The binding sites of PPARδand SREBP2 on the LDLR promoter are
peroxisome proliferator response element (PPRE) and sterol regulatory
element (SRE) respectively [30,31]. Not surprisingly, we found that
WTE activated reporters harbouring articial PPRE or SRE regulatory
motifs (Fig. 4C and D). Since we observed the induction eect of WTE
on the endogenous LDLR promoter (Fig. 3F), we then performed a
mutation assay to verify whether the PPRE and SRE sites are indis-
pensable for WTE function on the endogenous LDLR promoter. As
shown in Fig. 4E, mutation of either the PPRE or SRE site diminished
the eect of WTE-stimulated LDLR promoter activity. The eect was
nearly abolished when both the PPRE and SRE sites were mutated
(Fig. 4E).
Taken together, we concluded that PPRE and SRE were both im-
portant in WTE-induced LDLR promoter activity. WTE stimulates LDLR
expression through the PPAR signalling pathway and the SREBP2 sig-
nalling pathway via the PPRE site and the SRE site simultaneously.
3.5. WTE attenuates sodium oleate induced triglyceride accumulation
In addition to LDL-c lowering function, the eect of WTE on tri-
glyceride accumulation was investigated in vitro. HepG2 cells were
exposed to sodium oleate for 24 h to induce cellular triglyceride ac-
cumulation, and the total cellular triglyceride levels were determined
with or without WTE treatment for another 24 h. Oil Red O (ORO)
staining was performed to observe the total lipid amount inner HepG2
cells. ORO-stained lipids were signicantly increased after sodium
oleate induction while signicantly decreased after WTE treatment
(Fig. 5A). The data was quantied by ImageJ (Fig. 5B).
In addition, the concentration of intracellular triglycerides among
dierent treatment groups were determined by a triglyceride assay kit.
Cells treated with sodium oleate exhibited a 2-fold increase in trigly-
ceride accumulation, and WTE treatment for 24 h signicantly de-
creased triglyceride levels by 42.04 % (Fig. 5C). Furthermore, we found
genes involved in triglyceride synthetic pathway, including hepatocyte
nuclear factor 4 alpha (HNF4α), fatty acid synthase (FASN), patatin like
Fig. 4. The transcriptional upregulation of LDLR by WTE is mediated by two transcription factors, SREBP2 and PPARδ. (A) mRNA expression levels of SREBP2 and
PPARδtreated with WTE (n = 3). (B) Western blot of SREBP2 and PPARδ. Results were quantied by Image J software (n = 3). (C) Determination of the
transcriptional activity of PPRE and (D) SRE via luciferase assay (n = 3). Data are shown in mean ± SD. Statistical analyses were conducted using paired Studentst
test. *p < 0.05, **p < 0.01 compared with DMSO. (E) Transcriptional activity of dierent mutation on LDLR promoter (PPRE mutation, SRE mutation, PPRE&SRE
double mutation) treated with WTE (n = 3). In Fig. 4E, induced fold change of luciferase activity (WTE vs DMSO) are shown in mean ± SD. Statistical analyses were
conducted using paired Students t test. *p <0.05, **p < 0.01 compared with wildtype LDLR promoter.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
6
phospholipase domain containing 3 (PNPLA3) and ATP citrate lyase
(ACLY) were down-regulated by WTE. All above results suggest that
WTE is of vital importance in reducing intracellular triglycerides.
3.6. Determination of the eective components in WTE
Considering polyphenols are the main functional components in tea,
HPLC analysis was performed to determine the concentration of poly-
phenols in WTE. Polyphenols standards including Catechin (C), epica-
techin (EC), epicatechin gallate (ECG), gallic acid (GA), epigalloca-
techin (EGC) and epigallocatechin gallate (EGCG) were mixed at a
concentration of 1000 μg/mL followed by gradient dilution to 7.815
μg/mL to create a standard curve. WTEs from three dierent batches
were used for content determination. Fig. 6A and B shows the chro-
matographic prole of mixed standards and WTE extracts. Polyphenols
concentration were calculated according to the standard curve. The
relative abundant catechins in WTE were EGCG and ECG, at a con-
centration of 14.50 μg/mg and 4.07 μg/mg respectively (Fig. 6C). Be-
sides, the concentration of gallic acids was the highest among the de-
tected standards in WTE, up to 17.91 μg/mg. However, the
concentrations of EGC, C, and EC were too low to detect.
Next, RT-qPCR was performed to validate the cholesterol lowering
eects of detected components in WTE. HepG2 cells were incubated
with 50 μM GA, ECG and EGCG for 24 h followed by RNA extraction,
reverse transcription and qPCR. The results showed that both ECG and
EGCG were eective in LDLR upregulation and MTTP,APOB down-
regulation, which were consistent with WTE function (Fig. 6D). Al-
though GA was the highest content among detected standards in WTE,
it didntaect LDLR expression, and led to a mild downregulation of
MTTP and APOB. Above results indicate that ECG and EGCG are ef-
fective catechin components in WTE.
4. Discussion
To obtain the whole picture of WTE induced transcriptional reg-
ulation, we treated hepatic cells with WTE and performed global gene
expression proling. GO and pathway analysis revealed that WTE in-
duced DEGs were enriched mainly in lipid metabolism-related path-
ways, indicating that WTE is crucial in regulating lipid homeostasis. A
set of genes involved in lipid transport and synthesis were conrmed to
be targets of WTE. Consistently, the results show that indeed WTE is
involved in the regulation of lipid metabolic genes.
Although the rst line anti-hypercholesterolemic drugs statins are
well-tolerated by most people, they can cause muscle and joint aches
and become useless when treating patients with familial hypercholes-
terolemia [32]. Novel lipid lowering drugs are emerged as com-
plementary treatments, including Mipomersen, a type of antisense oli-
gonucleotides targeting APOB [33], and Lomitapide, an inhibitor of
MTTP [34]. Since APOB and MTTP play crucial roles during VLDL as-
sembly, inhibition of APOB and MTTP reduces LDL production in the
circulation. In this study, we found WTE down-regulates APOB and
MTTP gene expression through transcriptional regulation simulta-
neously. This indicates WTE can realize lipid lowering eect through
regulating multiple targets.
LDL-c is a major risk factor for progression of cardiovascular dis-
eases and the ability to clear circulated LDL-c is considered an eective
indicator of a drug. Consistent with a previous study [14], our study
indicated that WTE is ecient in stimulating human LDL-c particle
uptake in hepatic cells. Importantly, the molecular mechanisms of
WTE-mediated LDL uptake and LDLR expression were revealed in our
study. LDLR is well accepted to be predominantly regulated at the
transcriptional level through a negative feedback mechanism mediated
by the depletion of intracellular cholesterol [35]. The transcriptional
regulation is mainly controlled by specic interactions of SRE located
on the LDLR promoter and SREBP2. Under cholesterol-depleted condi-
tions, SREBP cleavage-activating protein (SCAP) transports the SREBP2
Fig. 5. WTE ameliorates sodium oleate induced intracellular lipid accumulation in HepG2 cells. (A) ORO staining of sodium oleate induced cellular TG accumulation,
cells were treated with DMSO or WTE respectively. (B) The stained lipid content was quantied by ImageJ (n = 3). (C) The inhibitory eect of WTE on total
triglyceride levels in HepG2 cells (n = 3). (D) qPCR results of triglyceride synthetic related genes in HepG2 cells treated with WTE (n = 3). Data are shown in
mean ± SD. Statistical analyses were conducted using paired Students t test. *p < 0.05, **p < 0.01 compare with DMSO.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
7
precursor to the Golgi apparatus to release mature SREBP2 through
specic cleavages [36]. Mature SREBP2 translocates to the nucleus,
binds to LDLR and regulates its transcriptional activity. Recently,
Shende et al. identied the PPRE motif which responds to PPARδac-
tivation on the LDLR promoter [30]. PPARδis a ubiquitously expressed
transcription factor and is considered the most crucial regulator for
executing key cellular functions in the liver, intestine, kidneys and
skeletal muscle [37]. Thus, eorts have been made to validate whether
SREBP2 and PPARδare both critical targets of WTE. Our data suggest
that SREBP2 and PPARδare both of vital importance in WTE-mediated
LDLR transcriptional activity. WTE not only upregulated the expression
of SREBP2 and PPARδat the gene and protein levels but also stimulated
their transcriptional activities. Moreover, mutation of either SRE or
PPRE on the LDLR promoter diminished WTE-stimulated LDLR pro-
moter activity, and the eect was nearly abolished when both PPRE and
SRE sites were mutated, suggesting that SREBP2 and PPARδare crucial
regulators.
EGCG, one of the most abundant content in tea, has been demon-
strated with eects on cancer, obesity, dyslipidemia, blood pressure and
glycaemia [38]. However, as another type of catechin, ECG was less
studied and its hypolipidemic function remains to be explored. In the
present study, we found both EGCG and ECG are eective components
in WTE and involved in the regulation of cholesterol metabolism re-
lated genes expression, including LDLR,MTTP and APOB. The function
of ECG is worthy of further exploration.
White tea is well accepted to provide health benets for humans as a
result of the high concentration of natural antioxidants due to its
minimal processing. Our in vitro results provide novel insights into
WTE-mediated lipid homeostasis. Taken together, WTE may be con-
sidered a potential hypolipidaemic drink.
Author contributions
K. Luo, L. Xie, J. Cheng designed research. K. Luo, C. M. Ma, S.F.
Xing and Y. N. An conducted research. J. Feng, H. L. Dang, W. T. Huang
and L. S. Qiao analyzed data. K. Luo, L. Xie and J. Cheng wrote and/or
revised the manuscript and had primary responsibility for nal content.
Declaration of Competing Interest
The authors declare no conict of interest.
Acknowledgements
We are grateful to Jiahua Han for providing cDNA library and
Xiurui Zhu for statistical consulting respectively. This study was sup-
ported by the Beijing Talents Foundation (2017000021223ZK30) and
Beijing Lab Foundation.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.biopha.2020.110146.
Fig. 6. Determination of eective polyphenols in WTE. Chromatographic prole of (A) mixed polyphenol standards and (B) WTE at 278 nm. (C) Quantitative analysis
of each polyphenol in WTE according to standard curve. GA, gallic acids; EGCG, epigallocatechin gallate; ECG, epicatechin gallate; EGC, epigallocatechin; C,
catechin; EC, epicatechin. (D) qPCR results of LDLR,MTTP and APOB in HepG2 cells treated with 50 μM GA, ECG and EGCG for 24 h (n = 3). Data are shown in
mean ± SD. Statistical analyses were conducted using paired Students t test. *p < 0.05, **p < 0.01 compare with DMSO.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
8
References
[1] Y.H. Kao, H.H. Chang, M.J. Lee, C.L. Chen, Tea, obesity, and diabetes, Mol. Nutr.
Food Res. 50 (2) (2006) 188210, https://doi.org/10.1002/mnfr.200500109.
[2] C.S. Yang, H. Wang, Cancer preventive activities of tea catechins, Molecules 21 (12)
(2016), https://doi.org/10.3390/molecules21121679.
[3] Y.-J. Zhang, R.-Y. Gan, S. Li, et al., Antioxidant phytochemicals for the prevention
and treatment of chronic diseases, Molecules 20 (12) (2015) 2113821156, https://
doi.org/10.3390/molecules201219753.
[4] A. Babu, V. Pon, D. Liu, Green tea catechins and cardiovascular health: an update,
Curr. Med. Chem. 15 (18) (2008) 18401850, https://doi.org/10.2174/
092986708785132979.
[5] J.T. Mao, White Tea: The Plants, Processing, Manufacturing, and Potential Health
Benets, Tea in Health and Disease Prevention, Elsevier, 2013, pp. 3340.
[6] Y. Hilal, U. Engelhardt, Characterisation of white tea - comparison to green and
black tea, J. Verbrauch. Lebensm. 2 (4) (2007) 414421, https://doi.org/10.1007/
s00003-007-0250-3.
[7] G.A. Roth, C. Johnson, A. Abajobir, et al., Global, regional, and national burden of
cardiovascular diseases for 10 causes, 1990 to 2015, J. Am. Coll. Cardiol. 70 (1)
(2017) 125, https://doi.org/10.1016/j.jacc.2017.04.052.
[8] C.J. Dufresne, E.R. Farnworth, A review of latest research ndings on the health
promotion properties of tea, J. Nutr. Biochem. 12 (7) (2001) 404421, https://doi.
org/10.1016/s0955-2863(01)00155-3.
[9] T. Dias, G. Tomás, N. Teixeira, et al., White tea (Camellia sinensis (L.)): antioxidant
properties and benecial health eects, Int. J. Food Sci. Nutr. Diet. 2 (2) (2013)
1926.
[10] A.E. Koutelidakis, K. Argiri, M. Serani, et al., Green tea, white tea, and Pelargonium
purpureum increase the antioxidant capacity of plasma and some organs in mice,
Nutrition 25 (4) (2009) 453458, https://doi.org/10.1016/j.nut.2008.10.007.
[11] T.S.A. Thring, P. Hili, D.P. Naughton, Anti-collagenase, anti-elastase and anti-oxi-
dant activities of extracts from 21 plants, BMC Complement. Altern. Med. 9 (2009)
2736, https://doi.org/10.1186/1472-6882-9-27.
[12] M.S. Islam, Eects of the aqueous extract of white tea (Camellia sinensis) in a
streptozotocin-induced diabetes model of rats, Phytomedicine 19 (1) (2011) 2531,
https://doi.org/10.1016/j.phymed.2011.06.025.
[13] J. Söhle, A. Knott, U. Holtzmann, et al., White Tea extract induces lipolytic activity
and inhibits adipogenesis in human subcutaneous (pre)-adipocytes, Nutr. Metab. 6
(2009), https://doi.org/10.1186/1743-7075-6-20.
[14] G.C. Tenore, P. Stiuso, P. Campiglia, E. Novellino, In vitro hypoglycaemic and
hypolipidemic potential of white tea polyphenols, Food Chem. 141 (3) (2013)
23792384, https://doi.org/10.1016/j.foodchem.2013.04.128.
[15] N. Dashti, G. Wolfbauer, Secretion of lipids, apolipoproteins, and lipoproteins by
human hepatoma cell line, HepG2: eects of oleic acid and insulin, J. Lipid Res. 28
(4) (1987) 423436.
[16] N.B. Javitt, Hep G2 cells as a resource for metabolic studies: lipoprotein, choles-
terol, and bile acids, FASEB J. 4 (2) (1990) 161168.
[17] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(T)(-Delta Delta C) method, Methods 25 (4) (2001)
402408, https://doi.org/10.1006/meth.2001.1262.
[18] R.A. Hegele, Plasma lipoproteins: genetic inuences and clinical implications, Nat.
Rev. Genet. 10 (2) (2009) 109121, https://doi.org/10.1038/nrg2481.
[19] L.H. Kuller, Hyperlipidemia and cardiovascular disease, Curr. Opin. Lipidol. 18 (2)
(2007) 230233, https://doi.org/10.1097/MOL.0b013e32805dfb47.
[20] E. Ikonen, Cellular cholesterol tracking and compartmentalization, Nat. Rev. Mol.
Cell Biol. 9 (2) (2008) 125138, https://doi.org/10.1038/nrm2336.
[21] K.L. Kuo, M.S. Weng, C.T. Chiang, et al., Comparative studies on the hypolipidemic
and growth suppressive eects of oolong, black, pu-erh, and green tea leaves in rats,
J. Agric. Food Chem. 53 (2) (2005) 480489, https://doi.org/10.1021/jf049375k.
[22] L. Zhang, Z. Zhang, Y. Zhou, T. Ling, X. Wan, Chinese dark teas: postfermentation,
chemistry and biological activities, Food Res. Int. 53 (2) (2013) 600607, https://
doi.org/10.1016/j.foodres.2013.01.016.
[23] Y. Teng, D. Li, P. Guruvaiah, N. Xu, Z. Xie, Dietary supplement of large yellow tea
ameliorates metabolic syndrome and attenuates hepatic steatosis in db/db mice,
Nutrients 10 (1) (2018) 7591, https://doi.org/10.3390/nu10010075.
[24] C. Bursill, P.D. Roach, C.D.K. Bottema, S. Pal, Green tea upregulates the low-density
lipoprotein receptor through the sterol-regulated element binding protein in HepG2
liver cells, J. Agric. Food Chem. 49 (11) (2001) 56395645, https://doi.org/10.
1021/jf010275d.
[25] H. Pan, Y. Gao, Y. Tu, Mechanisms of body weight reduction by black tea poly-
phenols, Molecules 21 (12) (2016) 16591669.
[26] Q. Li, Z. Liu, J. Huang, et al., Anti-obesity and hypolipidemic eects of Fuzhuan
brick tea water extract in high-fat diet-induced obese rats, J. Sci. Food Agric. 93 (6)
(2013) 13101316, https://doi.org/10.1002/jsfa.5887.
[27] K. Kitamura, Y. Okada, K. Okada, Y. Kawaguchi, S. Nagaoka, Epigallocatechin
gallate induces an up-regulation of LDL receptor accompanied by a reduction of
PCSK9 via the annexin A2-independent pathway in HepG2 cells, Mol. Nutr. Food
Res. 61 (8) (2017) 16008361600847, https://doi.org/10.1002/mnfr.201600836.
[28] C.A. Bursill, P.D. Roach, Modulation of cholesterol metabolism by the green tea
polyphenol (-)-epigallocatechin gallate in cultured human liver (HepG2) cells, J.
Agric. Food Chem. 54 (5) (2006) 16211626, https://doi.org/10.1021/jf051736o.
[29] W. Luu, L.J. Sharpe, I.C. Gelissen, A.J. Brown, The role of signalling in cellular
cholesterol homeostasis, J. Int. Union Biochem. Mol. Biol. Life 65 (8) (2013)
675684, https://doi.org/10.1002/iub.1182.
[30] V.R. Shende, A.B. Singh, J. Liu, A novel peroxisome proliferator response element
modulates hepatic low-density lipoprotein receptor gene transcription in response
to PPAR delta activation, Biochem. J. 472 (2015) 275286, https://doi.org/10.
1042/bj20150666.
[31] J.L. Goldstein, M.S. Brown, A century of cholesterol and coronaries: from plaques to
genes to statins, Cell 161 (1) (2015) 161172, https://doi.org/10.1016/j.cell.2015.
01.036.
[32] F.J. Raal, R.D. Santos, D.J. Blom, et al., Mipomersen, an apolipoprotein B synthesis
inhibitor, for lowering of LDL cholesterol concentrations in patients with homo-
zygous familial hypercholesterolaemia: a randomised, double-blind, placebo-con-
trolled trial, Lancet 375 (9719) (2010) 9981006.
[33] R.S. Geary, B.F. Baker, S.T. Crooke, Clinical and preclinical pharmacokinetics and
pharmacodynamics of mipomersen (Kynamro®): a second-generation antisense
oligonucleotide inhibitor of apolipoprotein B, Clin. Pharmacokinet. 54 (2) (2015)
133146.
[34] M. Cuchel, E.A. Meagher, H. du Toit Theron, et al., Ecacy and safety of a mi-
crosomal triglyceride transfer protein inhibitor in patients with homozygous fa-
milial hypercholesterolaemia: a single-arm, open-label, phase 3 study, Lancet 381
(9860) (2013) 4046.
[35] L. Zhang, K. Reue, L.G. Fong, S.G. Young, P. Tontonoz, Feedback regulation of
cholesterol uptake by the LXR-IDOL-LDLR axis, Arterioscler. Thromb. Vasc. Biol. 32
(11) (2012) 25412546, https://doi.org/10.1161/atvbaha.112.250571.
[36] D. Eberle, B. Hegarty, P. Bossard, P. Ferre, F. Foufelle, SREBP transcription factors:
master regulators of lipid homeostasis, Biochimie 86 (11) (2004) 839848, https://
doi.org/10.1016/j.biochi.2004.09.018.
[37] B. Grygiel-Gorniak, Peroxisome proliferator-activated receptors and their ligands:
nutritional and clinical implications - a review, Nutr. J. 13 (2014) 1726, https://
doi.org/10.1186/1475-2891-13-17.
[38] R.-Y. Gan, H.-B. Li, Z.-Q. Sui, H. Corke, Absorption, metabolism, anti-cancer eect
and molecular targets of epigallocatechin gallate (EGCG): an updated review, Crit.
Rev. Food Sci. Nutr. 58 (6) (2018) 924941.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
9
... Tea extract stimulated LDL-cholesterol (LDL-c) uptake through activating the LDL receptor (LDLR). Furthermore, this extract significantly downregulated TG synthesizing enzyme genes and reduced intracellular TG accumulation (Luo et al., 2020). It has been reported that the catechins such as epigallocatechin-3-gallate (EGCG) and epicatechin-3-gallate (ECG) are abundant in white tea extract and contribute to the regulation of cholesterol metabolism (Luo et al., 2020). ...
... Furthermore, this extract significantly downregulated TG synthesizing enzyme genes and reduced intracellular TG accumulation (Luo et al., 2020). It has been reported that the catechins such as epigallocatechin-3-gallate (EGCG) and epicatechin-3-gallate (ECG) are abundant in white tea extract and contribute to the regulation of cholesterol metabolism (Luo et al., 2020). ...
... Downregulated TG synthetic genes and reduced intracellular TG accumulation. Luo et al. (2020) White tea extract 15 mg/d or 45 mg/d Rats Improved antioxidant activity and the fatty acid profiles of the liver and heart microsomes on Adriamycin-induced hepatotoxicity Espinosa et al. (2015) White tea extract 5% Mice Reduced water intake and food consumption and lowered the serum total LDLc and TG levels. Reduced lipid synthesis related to gene fatty acid synthase and blood glucose level, but increased glucose tolerance. ...
Article
Full-text available
Objective: Metabolic disorders (MD) can disturb intracellular metabolic processes. A metabolic disorder can be resulted from enzyme deficits or disturbances in function of various organs including the liver, kidneys, pancreas, cardiovascular system, and endocrine system. Some herbs were used traditionally for spices, food additives, dietary, and medicinal purposes. Medicinal plants possess biological active compounds that enhance human health. We aimed to provide evidence about therapeutic effects of some medicinal herbs on MD. Data Sources: PubMed, Scopus, and Google Scholar were explored for publications linked to MD until February 2021. The most literature reports that were published in the last 10 years were used. All types of studies such as animal studies, clinical trials, and in vitro studies were included. The keywords included “Metabolic disorders,” “ Nigella sativa L.,” “Thymoquinone,” “White tea”OR “ Camellia sinensis L.” “catechin,” and “ Allium sativum L.” OR “garlic” were searched. Results: Based on the results of scientific studies, the considered medicinal plants and their active components in this review have been able to exert the beneficial therapeutic effects on obesity, diabetes mellitus and non-alcoholic fatty liver disease. Conclusions: These effects are obvious by inhibition of lipid peroxidation, suppression of inflammatory reactions, adjustment of lipid profile, reduction of adipogenesis and regulation of blood glucose level.
... It is involved in the body's energy metabolism and the synthesis of cytoplasmic membranes, steroid hormones, and bile acids. TG is a component of lipids, whose function is to supply and store energy, and LDL-C is a lipoprotein particle that carries cholesterol into peripheral tissue cells and can be oxidized to oxidize LDL-C [19]. However, excessive levels of oxidized LDL-C can accumulate in the arterial wall, and an increase in both levels can lead to worsening of acute ischemic stroke. ...
Article
Full-text available
Fructus Gleditsiae Abnormalis (FGA) has been used as a traditional Chinese medicine (TCM) for the treatment of stroke caused by phlegm and blood stasis. However, its substance basis and mechanism of action are currently unknown. (is study is aimed to analyze the constituents of the volatile oil in FGA (VOFGA) using gas chromatography coupled with mass spectrometry (GC-MS) and explore the underlying effects and mechanisms of VOFGA in the prevention and treatment of ischemia stroke. An in vivo ischemia model was constructed by combination treatment of high-fat diet (HFD) and middle cerebral artery occlusion (MCAO) method. After administration, the cerebral infarction volume, the brain water content, hemorheology, blood lipids, inflammatory factors, oxidative stress indicators, Bax, Bcl-2, and cleaved caspase-3 and histological examination (HE) were determined and observed to explore the underlying effects and mechanisms of VOFGA against ischemia stroke. (e results showed that forty components were determined after analyzed by GC-MS, and the percentage content of palmitate, paeonol, violetone, linalool, salpinol, citral, and methyleugenol were 4.69%, 5.2%, 3.56%, 3.31%, 2.42%, 2.65%, and 1.67%, respectively. (e high dose of VOFGA could inhibit neurological damage; reduce the cerebral infarction volume and brain water content; improve whole blood viscosity and red blood cell aggregation index at various shear rates; reduce the levels of TG, TC, LDL-C, TNF-α, IL-1β, MDA, and NO; increase the contents of HDL-C, IL-10, and SOD; downregulate the expressions of Bax and cleaved caspase-3 in the ischemic regions; and upregulate the expressions of Bcl-2. (ese effects implied that VOFGA may exert neuroprotective effects via inhibiting ischemia-triggered oxidative damage-regulating blood lipid factors and reducing the production of proinflammatory mediators against cerebral I/R injury and neuronal apoptosis. (e VOFGA presents a potential treatment value for cerebral ischemic stroke, and it may offer insights into discovering new active compounds for the treatment of ischemic stroke.
... Possible mechanisms for the cholesterol lowering effects of black and green tea may be that tea catechins (Epigallocatechin-3-Gallate (EGCG) and Epicatechin-3-Gallate (ECG)) limit cholesterol absorption in the intestine, improve antioxidant status and contribute to the regulation of cholesterol metabolism related genes, for example targeting Low-Density Lipoprotein Receptor (LDLR), and down regulating Microsomal Triglyceride Transfer Protein (MTTP) and Apolipoprotein B (APOB), thereby regulating the synthesis of cholesterol [31]. ...
Article
Full-text available
Tea (Camellia sinensis) is the most commonly consumed beverage globally after water, with black tea being the most popular type of tea drunk in Britain by people of all ages. The potential for tea to contribute to health and wellness throughout life is worthy of consideration. Tea is a low calorie drink with several bioactive polyphenol ingredients which are well known to have antioxidant activity. Black tea in particular is a source of the amino acid L-theanine which has been linked with benefits for mental, immune and cardiovascular health. Prevalence of poor health, including poor cardiovascular, metabolic, mental, brain, bone and immune health, which may result in serious outcomes, including heart disease, type 2 diabetes, osteoporosis, cognitive decline and an inability to fight infection, is high in the UK and the European region. Interest in safe, natural ingredients for promoting health and wellness is growing. Whilst tea has been consumed for centuries, its health benefits have emerged more powerfully during recent decades giving scientific credence to the traditional perception that tea makes those who include it in their pattern of daily life feel good. This review collates evidence from human studies which evaluate the health and wellness impacts of tea consumption throughout life including into old age. It explores the evidence available on tea and mental and cognitive health, cardiovascular health, metabolic health, bone health, gut health and immune health. It identifies the bioactive ingredients which are likely contributors to these health impacts and includes evidence from laboratory studies that help to explain the mechanisms by which these benefits may occur. Overall, this review concludes that tea consumption contributes to health and wellness throughout life and that everyone should be encouraged to enjoy three cups daily as part of a healthy lifestyle pattern.
... Polyphenols play protective roles in chronic diseases, such as diabetes (Nagulapalli Venkata et al. 2017;Omodanisi et al. 2017), cardiovascular diseases (Reboredo-Rodríguez et al. 2017), neurodegenerative diseases (Ben Mansour et al. 2017;González-Sarrías et al. 2017), and cancer , Mileo et al. 2019. Besides, polyphenols act as anti-asthmatic (Shaw et al. 2016), cholesterol-lowering (Luo et al. 2020), antiseptic (Le Sage et al. 2017), and antihypertensive agents (Cheng et al. 2017). A great number of studies have reported that polyphenols are able to interrupt the molecular pathways involved in aging by targeting different signaling pathways, such as mTOR, NF-jB, and cAMP Pazoki-Toroudi et al. 2016;Serreli and Deiana 2020). ...
Article
Full-text available
Age is an important risk factor for different diseases. The same mechanisms that promote aging are involved in the development and progression of age-associated diseases. Polyphenols are organic compounds found in fruits and vegetables. Due to their beneficial properties (e.g. antioxidant and anti-inflammatory), polyphenols have been extensively used for treating chronic diseases. To exert their functions, polyphenols target various molecular mechanisms and signaling pathways, such as mTOR, NF-κB, and Wnt/β-catenin. Wnt signaling is a critical pathway for developmental processes. Besides, dysregulation of this signaling pathway has been observed in various diseases. Several investigations have been conducted on Wnt inhibitors at pre-clinical stages, showing promising results. Herein, we review the studies dealing with the role of polyphenols in targeting the Wnt signaling pathways in aging processes and age-associated diseases, including cancer, diabetes, Alzheimer’s disease, osteoporosis, and Parkinson’s disease.
Article
Non-alcoholic fatty liver disease (NAFLD) is one of the leading causes of liver disease, which lacks effective treatments. Abnormal lipid metabolism and inflammation are the most prominent pathological manifestations of NAFLD. Recently, it has been reported that white tea extract (WTE) can regulate lipid metabolism in human adipocytes and liver cancer cells in vitro. However, its beneficial effects on NAFLD and the underlying mechanisms remain largely unknown. Here, we showed that WTE alleviated obesity, lipid accumulation, hepatic steatosis, and liver injury in a mouse model of NAFLD. Mechanistically, we demonstrated that WTE exerted the anti-NAFLD effect by decreasing the expression of genes involved in lipid transport and synthesis processes while activating genes associated with energy expenditure. In addition, a comparison of the transcriptional responses of WTE with that of green tea extract (GTE) revealed that WTE can not only regulate lipid metabolism and stress response like GTE but also regulate antioxidant and inflammatory pathways more effectively. Taken together, our findings demonstrate that WTE inhibits the progression of NAFLD in a mouse model and indicate that WTE can be a potential dietary intervention for NAFLD.
Preprint
Full-text available
Epigallocatechin gallate (EGCG), a green tea catechin, has gained the attention of current study due to its excellent health‐promoting effects. It possesses anti‐obesity, antimicrobial, anticancer, anti‐inflammatory activities, and is under extensive investigation in functional foods for improvement. It is susceptible to lower stability, lesser bioavailability, and lower absorption rate due to various environmental, processing, formulations, and gastrointestinal conditions of the human body. Therefore, it is the foremost concern for the researchers to enhance its bioactivity and make it the most suitable therapeutic compound for its clinical applications. In the current review, factors affecting the bioavailability of EGCG and the possible strategies to overcome these issues are reviewed and discussed. This review summarizes structural modifications and delivery through nanoparticle‐based approaches including nano‐emulsions, encapsulations, and silica‐based nanoparticles for effective use of EGCG in functional foods. Moreover, recent advances to enhance EGCG therapeutic efficacy by specifically targeting its molecules to increase its bioavailability and stability are also described. The main green tea constituent EGCG possesses several health‐promoting effects making EGCG a potential therapeutic compound to cure ailments. However, its low stability and bioavailability render its uses in many disorders. Synthesizing EGCG prodrugs by structural modifications helps against its low bioavailability and stability by overcoming premature degradation and lower absorption rate. This review paper summarizes various strategies that benefit EGCG under different physiological conditions. The esterification, nanoparticle approaches, silica‐based EGCG‐NPs, and EGCG formulations serve as ideal EGCG modification strategies to deliver superior concentrations with lesser toxicity for its efficient penetration and absorption across cells both in vitro and in vivo. As a result of EGCG modifications, its bioactivities would be highly improved at lower doses. The protected or modified EGCG molecule would have enhanced potential effects and stability that would contribute to the clinical applications and expand its use in various food and cosmetic industries. EGCG is a bioactive compound present in green tea. EGCG contains pyrogallol as B‐rings while it contains an additional gallate moiety as a D‐ring, which increases the number of hydroxyl groups. The EGCG, due to galloyl moieties increasing in their hydroxyl groups, possesses more excellent antioxidant activities than EC and EGC. Considerable challenges in EGCG utilization are the low systemic bioavailability, less stability in alkaline media, temperature, high oxidative degradation, metabolic transformations, as well as toxicity at higher concentrations. Hence, some effective strategies are introduced to overcome its lower bioavailability and stability issues.
Article
Full-text available
Cardiovascular disease is a chronic multifactorial health complication that is either directly or indirectly associated with pathophysiological mechanisms, including pro-oxidation, pro-inflammation, vascular and endothelial dysfunction, impaired platelet function, thrombosis, and others. The therapeutic options to circumvent cardiovascular complications include several phytomedicines, including green tea polyphenols. However, while many experimental and clinical studies report distinct mechanisms by which the polyphenols of green tea elicit a beneficial role in cardiometabolic health, the translation and applications of green tea polyphenols in clinics have yet to gain their optimal use on the broader population. This review critically appraises the various reported mechanisms of green tea polyphenols in modulating cardio-metabolic health and associated phyto-genomic challenges. Further, our review highlights the probability of gene polymorphic associated therapeutic variations in individuals using green tea for cardio-metabolic effects and the necessity to personalize green tea for clinical use, thereby improvising the risk-benefit ratio.
Article
Perchlorate is known as a thyroid disrupter. Its contamination in various tea samples was monitored, and 286 samples belonging to four types of tea leaves were analysed. The detection rate of perchlorate in tea was 99.3%. The mean concentration in different tea types decreased in order from green tea, oolong tea, white tea to black tea. A probabilistic approach was performed to evaluate the dietary exposure of perchlorate for six different subpopulations. The daily intakes (EDIs) for consumers over the age of 41 were higher than that of other subpopulations. The hazard quotient for six groups was lower than 1 even at the extreme percentile (P99). It indicates that the risk of dietary exposure to perchlorate from tea consumption for Fujian people is acceptable without considering other foodstuffs. However, the high occurrence of perchlorate in tea samples suggested that the actual source of this contaminant should be further investigated.
Article
White tea has been of increasing public interest worldwide owing to its health benefits. Based on 2 years of surveillance, the long-term and cumulative chronic exposure risks of pesticide residues through white tea drinking were assessed for different subpopulations in Fujian, China. Twenty-five different pesticides were found, and 74.8% of samples contained at least one pesticide residue. The most frequently detected pesticide was bifenthrin with detection rates of 61.6%. Risk assessment was performed using both the deterministic approach and semiprobabilistic model under the best-case and the worst-case scenarios. The results demonstrated that the dietary risks were extremely low for six different subpopulations in which the risks for adults over the age of 41 were relatively higher. The risk ranking scheme indicated that isocarbophos and triazophos were considered to be of medium risk. The different use suggestions for the 25 positive pesticides are proposed to further minimize the exposure risk to consumer health. Practical Application Tea is the second most popular nonalcoholic beverage throughout the world. Pesticides are used to improve the yield of tea. Pesticide residues in tea could be one of the exposure pathways for consumers. Monitoring residual levels and assessing the health risk assessment in tea are thus in an urge.
Article
Depression is a prevalent neuropsychiatric disease with a high recurrence rate, affecting over 350 million people worldwide. Intestinal flora disorders and gut-brain-axis (GBA) dysfunction may cause mental disorders. Alterations in the intestinal flora composition could increase the permeability of the gut barrier, activate systemic inflammation and immune responses, regulate the release and efficacy of monoamine neurotransmitters, alter the activity and function of the hypothalamic-pituitary-adrenal (HPA) axis, and modify the abundance of the brain-derived neurotrophic factor (BDNF); all of these showed a close correlation with the occurrence of depression. In addition, the disturbance of the intestinal flora is related to circadian rhythm disorders, which aggravate the symptoms of depression. Tea polyphenols (TPs) have been found to have antidepressant effects. Therefore, the close reciprocity between the intestinal flora and circadian rhythm provides a new opportunity for TPs to regulate depression relying on the intestinal flora. In this review, we discussed the relationship between intestinal flora dysbiosis and the pathogenesis of depression and the mechanism of TPs relieving depression via the GBA.
Article
Full-text available
Yellow tea has been widely recognized for its health benefits. However, its effects and mechanism are largely unknown. The current study investigated the mechanism of dietary supplements of large yellow tea and its effects on metabolic syndrome and the hepatic steatosis in male db/db mice. Our data showed that dietary supplements of large yellow tea and water extract significantly reduced water intake and food consumption, lowered the serum total and low-density lipoprotein cholesterol and triglyceride levels, and significantly reduced blood glucose level and increased glucose tolerance in db/db mice when compared to untreated db/db mice. In addition, the dietary supplement of large yellow tea prevented the fatty liver formation and restored the normal hepatic structure of db/db mice. Furthermore, the dietary supplement of large yellow tea obviously reduced the lipid synthesis related to gene fatty acid synthase, the sterol regulatory element-binding transcription factor 1 and acetyl-CoA carboxylase α, as well as fatty acid synthase and sterol response element-binding protein 1 expression, while the lipid catabolic genes were not altered in the liver of db/db mice. This study substantiated that the dietary supplement of large yellow tea has potential as a food additive for ameliorating type 2 diabetes-associated symptoms.
Article
Full-text available
Background: The burden of cardiovascular diseases (CVDs) remains unclear in many regions of the world. Objectives: The GBD (Global Burden of Disease) 2015 study integrated data on disease incidence, prevalence, and mortality to produce consistent, up-to-date estimates for cardiovascular burden. Methods: CVD mortality was estimated from vital registration and verbal autopsy data. CVD prevalence was estimated using modeling software and data from health surveys, prospective cohorts, health system administrative data, and registries. Years lived with disability (YLD) were estimated by multiplying prevalence by disability weights. Years of life lost (YLL) were estimated by multiplying age-specific CVD deaths by a reference life expectancy. A sociodemographic index (SDI) was created for each location based on income per capita, educational attainment, and fertility. Results: In 2015, there were an estimated 422.7 million cases of CVD (95% uncertainty interval: 415.53 to 427.87 million cases) and 17.92 million CVD deaths (95% uncertainty interval: 17.59 to 18.28 million CVD deaths). Declines in the age-standardized CVD death rate occurred between 1990 and 2015 in all high-income and some middle-income countries. Ischemic heart disease was the leading cause of CVD health lost globally, as well as in each world region, followed by stroke. As SDI increased beyond 0.25, the highest CVD mortality shifted from women to men. CVD mortality decreased sharply for both sexes in countries with an SDI >0.75. Conclusions: CVDs remain a major cause of health loss for all regions of the world. Sociodemographic change over the past 25 years has been associated with dramatic declines in CVD in regions with very high SDI, but only a gradual decrease or no change in most regions. Future updates of the GBD study can be used to guide policymakers who are focused on reducing the overall burden of noncommunicable disease and achieving specific global health targets for CVD.
Article
Full-text available
Catechins are widely occurring in our diet and beverages. The cancer-preventive activities of catechins have been extensively studied. Of these, (-)-epigallocatechin-3-gallate (EGCG), the principal catechin in green tea, has received the most attention. The inhibitory activities of tea catechins against carcinogenesis and cancer cell growth have been demonstrated in a large number of laboratory studies. Many mechanisms for modulating cancer signaling and metabolic pathways have been proposed based on numerous studies in cell lines with EGCG, the most active tea catechin. Nevertheless, it is not known whether many of these mechanisms indeed contribute to the anti-cancer activities in animals and in humans. Human studies have provided some results for the cancer preventive activities of tea catechins; however, the activities are not strong. This article reviews the cancer preventive activities and mechanisms of action of tea catechins involving their redox activities, biochemical properties and binding to key enzymes or signal transduction proteins. These mechanisms lead to suppression of cell proliferation, increased apoptosis and inhibition of angiogenesis. The relevance of the proposed mechanisms for cancer prevention are assessed in the light of the situation in vivo. The potential and possible problems in the application of tea and tea-derived products for cancer prevention are discussed.
Article
Full-text available
Obesity is one of the most common nutritional diseases worldwide. This disease causes health problems, such as dyslipidemia, hyperglycemia, hypertension and inflammation. There are drugs used to inhibit obesity. However, they have serious side effects outweighing their beneficial effects. Black tea, commonly referred to as “fermented tea”, has shown a positive effect on reducing body weight in animal models. Black tea polyphenols are the major components in black tea which reduce body weight. Black tea polyphenols are more effective than green tea polyphenols. Black tea polyphenols exert a positive effect on inhibiting obesity involving in two major mechanisms: (i) inhibiting lipid and saccharide digestion, absorption and intake, thus reducing calorie intake; and (ii) promoting lipid metabolism by activating AMP-activated protein kinase to attenuate lipogenesis and enhance lipolysis, and decreasing lipid accumulation by inhibiting the differentiation and proliferation of preadipocytes; (iii) blocking the pathological processes of obesity and comorbidities of obesity by reducing oxidative stress. Epidemiological studies of the health relevance between anti-obesity and black tea polyphenols consumption remain to be further investigated.
Article
Full-text available
Overproduction of oxidants (reactive oxygen species and reactive nitrogen species) in the human body is responsible for the pathogenesis of some diseases. The scavenging of these oxidants is thought to be an effective measure to depress the level of oxidative stress of organisms. It has been reported that intake of vegetables and fruits is inversely associated with the risk of many chronic diseases, and antioxidant phytochemicals in vegetables and fruits are considered to be responsible for these health benefits. Antioxidant phytochemicals can be found in many foods and medicinal plants, and play an important role in the prevention and treatment of chronic diseases caused by oxidative stress. They often possess strong antioxidant and free radical scavenging abilities, as well as anti-inflammatory action, which are also the basis of other bioactivities and health benefits, such as anticancer, anti-aging, and protective action for cardiovascular diseases, diabetes mellitus, obesity and neurodegenerative diseases. This review summarizes recent progress on the health benefits of antioxidant phytochemicals, and discusses their potential mechanisms in the prevention and treatment of chronic diseases.
Article
Full-text available
The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at -768 to -752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression.
Article
Scope: In animal studies, epigallocatechin gallate (EGCG), the dominant catechin in green tea, has been shown to improve cholesterol metabolism. However, the molecular mechanisms of EGCG underlying these functions have not been fully understood. In this study, we aimed to clarify the molecular mechanisms of the effect of EGCG on cholesterol metabolism mainly in HepG2 cells. Methods and results: We found that EGCG induced a reduction of the extracellular proprotein convertase subtilisin/kexin 9 (PCSK9) level accompanied by an up-regulation of the LDL receptor (LDLR) in HepG2 cells. The EGCG-induced up-regulation of LDLR occurred via the extracellular signal-regulated kinase (ERK) signaling pathway. Moreover, we showed that EGCG induced a significant early reduction of the extracellular PCSK9 protein level. However, there were no significant changes in the PCSK9 mRNA and the intracellular PCSK9 protein levels induced by EGCG. Annexin A2 knockdown affected the basal LDLR expression and did not affect the EGCG-induced reduction of the extracellular PCSK9 protein level or the up-regulation of LDLR. Conclusion: Annexin A2 possesses an essential function for the basal LDLR expression in HepG2 cells. But, EGCG induces the suppression of PCSK9 accompanied by an up-regulation of LDLR in an annexin A2-independent manner. EGCG attenuates the statin-induced an increase in PCSK9 level. This article is protected by copyright. All rights reserved.
Article
Green tea is one of the most popular beverages in the world, especially in Asian countries. Consumption of green tea has been demonstrated to possess many health benefits, which mainly attributed to the main bioactive compound epigallocatechin gallate (EGCG), a flavone-3-ol polyphenol, in green tea. EGCG is mainly absorbed in the intestine, and gut microbiota play a critical role in its metabolism prior to absorption. EGCG exhibits versatile bioactivities, with its anti-cancer effect most attracting due to the cancer preventive effect of green tea consumption, and a great number of studies intensively investigated its anti-cancer effect. In this review, we therefore, first stated the absorption and metabolism process of EGCG, and then summarized its anti-cancer effect in vitro and in vivo, including its manifold anti-cancer actions and mechanisms, especially its anti-cancer stem cell effect, and next highlighted its various molecular targets involved in cancer inhibition. Finally, the anti-cancer effect of EGCG analogs and nanoparticles, as well as the potential cancer promoting effect of EGCG were also discussed. Understanding of the absorption, metabolism, anti-cancer effect and molecular targets of EGCG can be of importance to better utilize it as a chemopreventive and chemotherapeutic agent.
Article
White tea is a rare tea that is derived from the same plant ( Camellia sinensis ) as green, oolong and black tea. Originating from and predominantly produced in southern China, it was virtually unknown to the western world until the late 1800s. Primarily consisting of the silvery buds and young leaves of the plant, it is hand-picked, steamed and dried without further, elaborate processing, which accounts for the whitish appearance. It is the least processed of all tea. The minimal processing is believed to result in the preservation of high amounts of phytochemicals that confer health benefits and its advantage over other types of tea. This chapter provides a general overview of the origin, the major varieties, processing, manufacturing and production of white tea. A summary of published studies that support the potential health promoting benefits of white tea, including its anticancer, antiobesity, antioxidant and antiaging properties is also provided.
Article
One-fourth of all deaths in industrialized countries result from coronary heart disease. A century of research has revealed the essential causative agent: cholesterol-carrying low-density lipoprotein (LDL). LDL is controlled by specific receptors (LDLRs) in liver that remove it from blood. Mutations that eliminate LDLRs raise LDL and cause heart attacks in childhood, whereas mutations that raise LDLRs reduce LDL and diminish heart attacks. If we are to eliminate coronary disease, lowering LDL should be the primary goal. Effective means to achieve this goal are currently available. The key questions are: who to treat, when to treat, and how long to treat. Copyright © 2015 Elsevier Inc. All rights reserved.