Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy
journal homepage: www.elsevier.com/locate/biopha
White tea and its active polyphenols lower cholesterol through reduction of
very-low-density lipoprotein production and induction of LDLR expression
Kun Luo
a,b,c
, Chengmei Ma
d
, Shaofang Xing
d
, Yannan An
d
, Juan Feng
a,b,c
, Honglei Dang
d
,
Wenting Huang
a,b,c
, Liansheng Qiao
a,b,c
, Jing Cheng
a,b,c,d,
*, Lan Xie
a,b,c,d,
*
a
State Key Laboratory of Membrane Biology, School of Medicine, Tsinghua University, Beijing, 100084, China
b
Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Hangzhou, 310003, China
c
Medical Systems Biology Research Center, School of Medicine, Tsinghua University, Beijing, 100084, China
d
National Engineering Research Center for Beijing Biochip Technology, Beijing, 102206, China
ARTICLE INFO
Keywords:
White tea extract
Lipid metabolism
Microarray
APOB
MTTP
LDLR
PPARδ
ABSTRACT
Emerging in vivo and vitro data suggest that white tea extract (WTE) is capable of favourably modulating me-
tabolic syndrome, especially by ameliorating abnormal lipid metabolism. Microarray-based gene expression
profiling was performed in HepG2 cells to analyze the effects of WTE from a systematic perspective. Gene
Ontology and pathway analysis revealed that WTE significantly affected pathways related to lipid metabolism.
WTE significantly downregulated apolipoprotein B (APOB) and microsomal triglyceride transfer protein (MTTP)
expression and thereby reduced the production of very-low-density lipoprotein. In the meanwhile, WTE sti-
mulated low-density lipoprotein-cholesterol (LDL-c) uptake through targeting low-density lipoprotein receptor
(LDLR), as a consequence of the activation of sterol regulatory element-binding protein 2 (SREBP2) and per-
oxisome proliferator-activated receptor δ(PPARδ). Furthermore, WTE significantly downregulated triglycerides
synthetic genes and reduced intracellular triglycerides accumulation. Besides, we demonstrated that the tea
catechins epigallocatechin-3-gallate (EGCG) and epicatechin-3-gallate (ECG) are abundant in WTE and con-
tribute to the regulation of cholesterol metabolism related genes, including LDLR,MTTP and APOB. Our findings
suggest white tea plays important roles in ameliorating abnormal lipid metabolism in vitro.
1. Introduction
Originated from China, tea has gained the world’s taste in the past
2000 years. Abundant evidence has shown that tea plants, as the pri-
mary component of one of the most consumed beverages in the world,
provide health benefits through mediating energy metabolism via their
bioactive components [1]. Tea and tea polyphenols have been shown to
inhibit tumorigenesis in animal models for cancers of lung, skin, pros-
tate, mammary glands, oral cavity, esophagus, stomach, small intestine,
colon, liver, pancreas, and bladder [2]. The cardioprotective effect of
green tea has been demonstrated in several animal studies and it may
involve multiple mechanisms, including anti-oxidative, anti-in-
flammatory, anti-hypertensive, anti-thrombogenic and lipid lowering
effects [3,4]. White tea comes from the same plant (Camellia sinensis)as
other types of teas. Unlike green or black tea, which is prepared from
mature tea leaves, white tea is made from silvery buds and young tea
leaves. In addition, only a few steps are needed to prepare white tea: the
young buds and leaves are pan-fried to inactivate polyphenol oxidase
and then dried [5]. Hence, the average concentrations of total poly-
phenols and catechins are higher in white tea than in other teas [6].
Disordered energy metabolism seriously affects people's lives. An
abnormal increase in lipids leads to hypercholesterolemia, an important
modifiable risk factor that contributes substantially to the development
of cardiovascular diseases. Importantly, the global prevalence of car-
diovascular disease was estimated to be 422.7 million in 2015 [7].
Interestingly, teas are effective in lowering blood glucose and lipid
accumulation with less toxicity and fewer side effects [8].
The most prominent feature of white tea is its antioxidant capacity.
Indeed, white tea shows strong antioxidant activity in vivo and in vitro
[9,10] and was validated to have the highest antioxidant capacity
among 21 plants (including green tea) [11]. In addition, evidence has
shown that white tea plays a critical role in regulating lipid metabolism.
Although there is no clinical research for white tea, animal studies have
validated its beneficial effects. Islam et al. found that white tea extract
(WTE) effectively reduced lipid-associated parameters in rats [12].
Specifically, total cholesterol and low-density lipoprotein-cholesterol
https://doi.org/10.1016/j.biopha.2020.110146
Received 18 January 2020; Received in revised form 2 April 2020; Accepted 4 April 2020
⁎
Corresponding authors at: State Key Laboratory of Membrane Biology, School of Medicine, Tsinghua University, Beijing, 100084, China.
E-mail addresses: jcheng@tsinghua.edu.cn (J. Cheng), xielan@tsinghua.edu.cn (L. Xie).
Biomedicine & Pharmacotherapy 127 (2020) 110146
0753-3322/ © 2020 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
T
(LDL-c) were all ameliorated by WTE [12]. In addition to animal ex-
periments, in vitro experiments have also been carried out to identify
the hypolipidaemic activities of white tea. Söhle et al.found that WTE
possessed strong lipolytic and antiadipogenic activity in human sub-
cutaneous preadipocytes [13]. Transcription factors involved in adi-
pogenesis, such as CCAAT-enhancer binding protein α(C/EBPα), adi-
pocyte determination and differentiation factor 1 (ADD1), and sterol
regulatory element-binding protein 1-c (SREBP1-c), were all down-
regulated by WTE treatment [13]. Tenore et al.reported that WTE
treatment increased low-density lipoprotein receptor (LDLR) binding
activity and reduced lipase activity [14]. Meanwhile, apolipoprotein A1
(ApoA1), the major protein component of high-density lipoprotein
(HDL) particles, was found to be upregulated at the protein level [14].
In summary, recent studies have revealed the hypolipidaemic activities
of WTE. However, there is a lack of systematic analysis of WTE in lipid
regulation and the direct mechanism remains to be explored.
The current study aimed to explore the molecular mechanisms of
WTE in regulating lipid metabolism from a systematic perspective. We
use the liver derived cancer cell line HepG2 to study the transcriptome
changes in response to WTE treatment based on gene expression array.
Gene ontology (GO) and pathway enrichment analysis was performed
to study the target pathways of WTE. Potential targets of WTE revealed
by transcriptome analysis were further validated by molecular and
cellular assays in HepG2 and more cell lines, including HL-7702
(Normal human hepatic cell line) and 293 T (a mutant version of
Human embryonic kidney 293 cells).
2. Materials and methods
2.1. Materials
White tea leaves were purchased from Fuding White Tea Co., Ltd
(Fuding, China). HepG2, HL-7702 and 293 T cell lines were obtained
from the Cell Resource Center, Peking Union Medical College. High-
glucose DMEM, fetal bovine serum (FBS), and other cell culture re-
agents were purchased from HyClone (Logan, UT). Primary antibodies
against SREBP2, LDLR, PPARδand glyceraldehyde 3-phosphate dehy-
drogenase (GAPDH) were purchased from Cell Signaling Technology
(Beverly, MA). ECG, EC and C were purchased from National Drug
Reference Standards (Beijing, China). GA, EGC and EGCG were pur-
chased from Shanghaiyuanye Bio-Technology (Shanghai, China).
2.2. Preparation of WTE
A total of 10 g white tea leaves were milled and extracted with 150
mL of 90 % ethanol in a Soxhlet extractor. The temperature of extrac-
tion for solvents was kept at 80 °C for 3 h. Raw extract was concentrated
at 45 °C for 2 h, and then collected. Finally, the collection was lyo-
philized at -45 °C and 80 Pa for 24 h to obtain the final WTE. WTE was
dissolved in DMSO before use.
2.3. Cell culture and viability assay
The human carcinoma cell line HepG2 was used for gene expression
profiling because it reflects hepatic characteristics and has been de-
monstrated as a useful experimental model to study lipid metabolism
[15,16]. However, differences in cellular responses between normal
and cancerous cell lines may exist. The human normal liver cell line HL-
7702 was selected to further identify the hypolipidemic activities of
WTE. The 293 T cell line (a mutant version of human embryonic kidney
293 cells) was commonly used in luciferase assay because it was easy to
transfect, and rarely expresses endogenous receptors and reduces in-
terference during experiment.
HepG2, HL-7702 and 293 T cells were grown in high-glucose DMEM
contained 10 % (v/v) FBS, 100 units/mL penicillin and 100 μg/mL
streptomycin. Cell viability was measured using cell counting kit-8
(Dojindo Molecular Technologies, Kumamon, Japan). Cells were seeded
on 96-well plates and treated with various concentrations of WTE for 24
h. Each well was incubated with 100 μl 10 % CCK-8 working solution
for 2 h at 37 °C. The absorbance at 450 nm was read using a SpectroMax
spectrophotometer (Spectromax Solutions Ltd, London, United
Kingdom).
2.4. Gene expression array
SurePrint G3 Human GE v3 8 × 60 K microarray chip (Agilent
Technologies, Santa Clara, CA) representing all putative genes of the
human genome was used for gene expression profiling of HepG2 cells.
HepG2 cells were treated with WTE or DMSO for 24 h (one sample in
each group) and subject to transcriptome analysis. Total RNA was
prepared with Trizol reagent (Invitrogen, Carlsbad, CA). To avoid
genomic DNA contamination, total RNA samples were treated with
RNase-free DNase Kit (Invitrogen) according to the manufacturer’s in-
structions. The purified total RNA was used to produce Cy3-labeled
cDNA using Agilent Low Input Quick Amp Labeling Kit (Agilent
Technologies). Microarrays were scanned with an Agilent’s Microarray
Scanner System, and the resulting images were analyzed with the
Agilent Feature Extraction software. Microarray data was analyzed by
LIMMA, a type of R software package that was used for microarray data
normalization, calculation and fold change determination. Genes were
considered differentially expressed with a 2-fold change in the WTE
treated samples compared to the control sample.
2.5. Gene ontology and pathway analysis
Differentially expressed genes (DEGs) were annotated by GO, KEGG
and Reactome respectively. GO, KEGG and Reactome analysis were
performed using the DAVID online database (DAVID, http://david.
ncifcrf.gov).
2.6. Isolation of RNA and analysis of mRNA expression
RNA was isolated by Trizol (Invitrogen) and reverse-transcribed
using a High Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific,
Rochester, NY). Quantitative real-time PCR (qPCR) was performed by
incorporating SYBR green (Kapa Biosystems, Woburn, MA) using a BIO-
RAD real-time system (BIO-RAD, Hercules, CA), and the results were
normalized to GAPDH. The relative gene expression data were analysed
using the ΔΔCT method [17]. The primers used in this study are listed
in supplemental Table 1.
2.7. Determination of apolipoprotein B (APOB) concentration
APOB concentrations were determined using the human APOB
ELISA kit (Abcam, Cambridge, United Kingdom). All experimental steps
were carried out following the manufacturer’s protocol.
2.8. LDL uptake assay
HepG2 cells were plated in 12-well plates and incubated with DMSO
or WTE for 24 h. Cells were washed 3 times with PBS and cultured with
FBS-free DMEM containing 10 μg/mL Alexa Fluor 488-labelled human
LDL-c (Invitrogen) for 4 h. Finally, cells were analysed by flow cyto-
metry (FACSAria™III, BD Biosciences, San Jose, CA). The fluorescence
indicated the LDL-c uptake capacity of cells.
2.9. Construction of luciferase reporter
The promoter regions of human APOB gene (-155 to +131 bp),
MTTP gene (-165 to +30 bp) and LDLR gene (-1100 to +187 bp) were
cloned and recombined into the KpnI/HindIII sites of the pGL3-basic
luciferase vector (Promega, Madison, WI). The pGL3-PPRE reporter
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
2
(PPRE sequence: TCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAC
TCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAC) was purchased
from Yeasen Biotech (Shanghai, China) and pGL3-SRE reporter (SRE
sequence: GACATTTGAAAATCACCCCACTGCAAACTCCTCCCCCTG)
was constructed by Genewiz (Suzhou, China). The pGL3-LDLR-PPRE
mutant (AAGTTCAA →ACCAACAA), pGL3-LDLR-SRE mutant (ATCAC
CCC →ATCATTCC), and pGL3-LDLR-PPRE&SRE double mutant re-
porter plasmids were constructed by QuikChange®lightning site-di-
rected mutagenesis kits (Stratagene, San Diego, CA).
2.10. Luciferase reporter assay
The 293 T cells were co-transfected with 1000 ng of the indicated
luciferase plasmids (pGL3-APOB, pGL3-MTTP, pGL3-LDLR, pGL3-LDLR-
PPRE mutant, pGL3-LDLR-SRE mutant and PGL3-LDLR-PPRE&SRE
double mutant) and 100 ng pRL-TK Renilla plasmid using the JetPEI kit
(Polyplus, New York, NY). At 24 h post transfection, the cell medium
was switched to medium supplemented with DMSO or 200 μg/mL WTE.
After another 24 h, luciferase activity was measured using the Dual-
Luciferase Reporter Assay System (Promega). Renilla activity was used
to normalize for transfection efficiency. All transfection experiments
were performed in duplicate and repeated independently for at least
three times.
2.11. Western blot analysis
Cells were lysed using cell lysis buffer, and cell debris was removed
by centrifugation at 28,340 gfor 15 min at 4 °C. Equal amounts of
protein (30 μg) were subjected to SDS-PAGE and transferred onto 0.2
μm PVDF membranes. After the membranes were blocked with 7% skim
milk, they were incubated with primary antibodies at 4 °C overnight
and then with horseradish peroxidase-conjugated secondary antibodies
for 1 h. After each incubation, the membranes were washed 3 times
with TBST. Finally, the membranes were developed with ECL reagents
(General Electric, Boston, MA), and the results were recorded on X-ray
film.
2.12. Oil Red O (ORO) staining and determination of total triglyceride
(TG)
HepG2 cells were seeded on 6-well plates and cultured with or
without 60 μg/mL sodium oleate (MACKLIN, Beijing, China) for 24 h.
Cells were then washed twice and incubated with DMSO or the in-
dicated concentrations of WTE for another 24 h. Cells were rinsed twice
and fixed in 10 % paraformaldehyde for 30 min. Cells were then wa-
shed with 60 % isopropanol and stained with freshly prepared working
solution of ORO (0.3 g per 100 mL of isopropanol, Beijing Chemical
Works, Beijing, China) for 30 min at room temperature. After the
staining solution was removed, the cells were washed sequentially with
60 % isopropanol and PBS. Pictures were captured with a light micro-
scope (Olympus, Tokyo, Japan) and was quantified by Image J (Version
1.8.0, National Institutes of Health).
To determine TG concentration, cells were washed and lysed with
200 μL cell lysis buffer. TGs in the cell lysate were extracted by a
commercial triglyceride assay kit (Applygen Technologies, Beijing,
China) and evaluated using a glycerophosphate oxidase-peroxidase
method as per kit protocol. The TG concentration was normalized to the
protein amount.
2.13. Determination of polyphenols content in WTE
A chromatographic analysis was performed using an Agilent 1260
LC system equipped with a variable wavelength detector (VWD).
Separation was carried out in a Symmetry 300 T M C18 column (5 μm,
4.6 × 250 mm; Waters, Milford, MA). The mobile phase was composed
of 0.4 % phosphoric acid aqueous solution (A) and methanol (B). The
gradient program was used as follows: 5% B to 10 % B (0−10 min), 10
% B to 13 % B (10−12 min), 13 % B (12−22 min), 13 % B to 18 % B
(22−23 min), 18 % B to 25 % B (23−35 min), 25 % B to 5% B (35−38
min). The flow rate was 1 mL/min and the temperature was maintained
at 40 °C. The detection wavelength was set at 278 nm and the injection
volume was 20 μL. Data acquisition and quantification were performed
using Agilent OpenLAB software. Standards of GA, C, EC, EGC, ECG and
EGCG with the purity of ≥98.0 % were dissolved in 10 % methanol.
The calibration curves were acquired for each polyphenol at the con-
centrations of 7.81, 15.63, 31.25, 62.5, 125, 250, 500 and 1000 μg/mL.
White tea samples were diluted to 5 mg/mL in 10 % methanol and
passed through a 0.22 μmfilter. Each prepared sample was sealed in a
vial and kept in a refrigerator at 4 °C until use. The candidate com-
pounds from tea samples were identified by comparing the retention
times with those of the authentic standards. The contents of the six
polyphenols in the test samples were calculated by using regression
parameters obtained from the standard curves. All analyte concentra-
tions were within linearity.
2.14. Statistical analysis
When comparing WTE-treated group vs. DMSO-treated group, the
results are expressed as the mean ± standard deviation (SD), followed
by paired Student’st-test using Excel (TTEST function for Students T-
test and STDEVP function for standard deviation analysis). A p
value < 0.05 was considered statistically significant. Linear regression
analysis was performed by Graphpad Prism software (version 8.0,
GraphPad Software, San Diego, CA) for analyzing dose-responsive re-
lationships. In all figures, *p < 0.05, **p < 0.01 as indicated.
3. Results
3.1. Transcriptome analysis of HepG2 cells treated with WTE
Microarray-based gene expression profiling was performed to ex-
plore the role of WTE in HepG2 cells (GEO number: GSE123402). The
WTE concentration of 200 μg/mL had no obvious effect on HepG2 cell
viability (half maximal inhibitory concentration = 337.5 μg/mL) based
on a proliferation assay (Supplemental Figure S1A). Transcriptome
analysis revealed that a total of 1093 genes were differentially ex-
pressed after WTE treatment, using 2-fold as a cut-off. Among them,
808 genes were upregulated and 285 were downregulated. DEGs were
annotated by GO and pathway enrichment analysis was performed to
identify the prominent signalling pathways and biological processes
associated with WTE treatment.
The GO analyses of upregulated and downregulated genes are
shown in Fig. 1A. Genes that were upregulated by the WTE treatment
were mainly involved in single-organism process, lipid metabolic pro-
cess and lipid biosynthetic process, while downregulated genes were
enriched in negative regulation of macromolecule biosynthetic process,
negative regulation of gene expression and cell differentiation. The
results of KEGG analysis indicated that pathways enriched by the up-
regulated genes included cytokine-cytokine receptor interaction, PPAR
signalling pathway and glycolysis/gluconeogenesis, while the down-
regulated genes were highly enriched in the tumour growth factor
(TGF)-βsignalling pathway, metabolism of xenobiotics by cytochrome
P450 and cell cycle (Fig. 1B). Reactome analysis revealed that the top
hits enriched in WTE-induced DEGs included cholesterol biosynthesis,
regulation of insulin-like growth factor (IGF) transport and uptake by
insulin-like growth factor-binding proteins (IGFBPs), triglyceride bio-
synthesis, interleukin (IL)-6-type cytokine receptor ligand interactions,
and glycolysis (Fig. 1C). Taken together, these observations indicated
that WTE treatment interfered with cellular metabolism in HepG2 cells.
DEGs involved in the top ranked KEGG signalling pathways were
selected as representative genes for validation by RT-qPCR. INHBB is
involved in cytokine-cytokine receptor interactions, PFKFB1 is involved
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
3
in fructose and mannose metabolism, ACSS2 is involved in glycolysis/
gluconeogenesis, SMAD6 and SMAD9 are involved in the TGF-βsig-
nalling pathway and CCNA2 is involved in cell cycling. The RT-qPCR
results agreed well with the microarray results (Supplemental Figure
S1B).
Based on the transcriptome analysis, we assumed that WTE plays an
essential role in lipid metabolism. We selected some key genes asso-
ciated with cholesterol and triglyceride metabolism and determined
their expression after WTE treatment by RT-qPCR. As shown in Fig. 1D,
lipid transport and metabolism related genes, such as FABP1 and
LIPIN1, genes inhibiting cholesterol synthesis, such as INSIG1, and
cholesterol transport-related genes, including NPC1L1 and ABCA3 were
upregulated, while triglyceride synthesis gene such as FADS2, genes
enhancing cholesterol synthesis such as CEL, and cholesterol transport
gene such as ABCG1 were downregulated by WTE treatment. These
results indicate that WTE plays an important role in lipid transport and
synthesis.
3.2. WTE downregulated VLDL production related genes APOB and MTTP
LDL is one of the key lipid-protein complexes in the blood and a
crucial component of metabolism responsible for the transport of lipids
throughout the body [18]. Excessive low-density lipoprotein cholesterol
(LDL-c) is a major risk factor for progression of cardiovascular diseases
[19]. The LDL particles in circulation are derived from VLDL, which is
packaged in the liver through MTTP to load lipids onto newly synthe-
sized APOB and secreted into the blood. Considering that WTE treat-
ment affected many genes related to lipid transport and synthesis, we
evaluated whether WTE treatment altered the expression of VLDL
production related genes.
WTE treatment downregulated APOB expression (Fig. 2A). Based on
enzyme-linked immunosorbent assay (ELISA), the concentration of
APOB-containing particles in HepG2 cell culture medium was sig-
nificantly suppressed by WTE treatment, indicating the inhibitory effect
of WTE on the secretion of APOB, which is the major protein compo-
nent of very low-, intermediate-, and low-density lipoproteins (Fig. 2B).
Luciferase reporter assay was further performed to explore the tran-
scriptional regulation of WTE on APOB. The promoter activity of APOB
was significantly decreased by 24 h WTE treatment (Fig. 2C).
Similarly, we demonstrated that WTE decreased MTTP expression
(Fig. 2D) and the downregulation was mediated by the regulatory effect
of WTE on MTTP promoter (Fig. 2E). Therefore, WTE affects APOB and
MTTP expression through transcriptional regulation. WTE attenuates
VLDL assembly to some extent.
3.3. WTE promotes LDL-c uptake through transcriptional upregulation of
LDLR
LDL delivers cholesterol and fatty acids to peripheral cells through
receptor-mediated endocytosis, which mainly occurs through LDLR
Fig. 1. Systematic transcriptome analysis of WTE treated HepG2 cells. (A) The top 10 GO biological processes significantly enriched by up-regulated genes of WTE
(pink) and down-regulated genes of WTE (blue). (B) Significantly enriched KEGG pathways by up-regulated genes of WTE (pink) and down-regulated genes of WTE
(blue). (C) Significantly enriched Reactome pathways by DEGs of WTE. GO, KEGG and Reactome analysis were performed by DAVID online database (DAVID, http://
david.ncifcrf.gov). (D) qRT-PCR results of a set of lipid metabolism related genes regulated by WTE (n = 3). In Fig. 1D, data are shown in mean ± SD. Statistical
analyses were conducted using paired Student’s t test. *p < 0.05 vs. dimethyl sulfoxide (DMSO)-treated group; **p < 0.01 vs. DMSO-treated group (For inter-
pretation of the references to colour in this figure legend, the reader is referred to the web version of this article).
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
4
[20]. Additionally, LDL-c is a well-established risk factor for hyperli-
pidaemia-induced diseases; hence, the improvement of LDL-c clearance
capacity is of vital importance. Interestingly, different types of teas,
including green, oolong, black, dark, yellow, and white teas, have been
validated to enhance LDL-c clearance capacity in vivo [12,21–23].
Specifically, green, black, dark teas have been shown to improve LDL-c
clearance capacity via upregulating LDLR expression, but other types of
teas have been less studied [24–26]. The expression of LDLR has also
been confirmed to be increased by treatment with tea catechin
(–)-epigallocatechin gallate (EGCG) [27,28]. Considering that white tea
Fig. 2. WTE interferes with VLDL assembly through down-regulation of APOB and MTTP. (A) Inhibitory effects of WTE on mRNA expression of APOB (n = 3). (B)
APOB secretion by HepG2 cells under WTE treatment determined by ELISA (n = 3). (C) Luciferase activity of APOB promoter in exposure to WTE for 24 h in HepG2
cells (n = 3). (D) Inhibitory effects of WTE on mRNA expression of MTTP (n = 3). (E) Luciferase activity of MTTP promoter in exposure to WTE for 24 h in HepG2
cells (n = 3). Data are shown in mean ± SD. Statistical analyses were conducted using paired Student’s t test. *p < 0.05, **p < 0.01 vs. DMSO-treated group.
Fig. 3. WTE promotes LDL-c uptake through up-regulation of LDLR. (A) LDL-c uptake of HepG2 cells treated with different concentrations of WTE respectively (100,
200, 300 μg/mL) (n = 3). (B) qPCR results of LDLR in HepG2 cells treated with 100, 200, 300 μg/mL WTE for 24 h respectively (n = 3). Data were processed using
linear regression to analyse dose-responsive relationships. (C) qPCR results of LDLR in HepG2 cells treated with 200 μg/mL WTE for 0, 4, 6, 12, 24 h respectively (n =
3). (D) Western blot of LDLR in HepG2 cells treated with DMSO or WTE. Results were quantified by Image J software (n = 3). (E) LDLR expression in HL-7702 cell
line treated with WTE (n = 3). (F) LDLR transcriptional activity treated with WTE (n = 3). Data are shown in mean ± SD. Statistical analyses were conducted using
paired Student’s t test. *p < 0.05, **p < 0.01 vs. DMSO-treated group.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
5
contains high levels of catechins, we tested whether WTE stimulated
LDL-c uptake capacity using human LDL-c particles labelled with Alexa
Fluor. As expected, cellular LDL-c uptake was significantly enhanced by
WTE treatment in a dose-dependent manner (Fig. 3A).
The molecular mechanisms by which WTE stimulates LDL-c uptake
are still not clear, hence efforts have been made toward it in the present
study. One possible explanation for the observed LDL-c uptake could be
the upregulation of LDLR. Consistent with the above phenomenon, we
found that LDLR mRNA was increased by WTE in a dose-dependent
manner (Fig. 3B). A time-course assay revealed that LDLR expression
was increased by WTE in a time-dependent manner, reaching a peak of
2.5-fold increase in expression at 12 h and remaining at 2-fold at 24 h
(Fig. 3C). Western blot results indicated that LDLR was upregulated not
only at the mRNA level but also at the protein level by WTE (Fig. 3D).
The regulation of LDLR by WTE was also confirmed in another hepa-
tocyte cell line, HL-7702 (Fig. 3E), using a concentration with no ob-
vious effect on cell viability (Supplemental Figure S1C). To explore how
WTE regulated LDLR expression, an endogenous LDLR promoter (-1100
bp to +187 bp) was cloned into a luciferase reporter system. We ob-
served a 1.5-fold increase in the luciferase activity induced by WTE
(Fig. 3F), indicating that WTE regulated LDLR expression at the tran-
scriptional level.
3.4. WTE upregulated LDLR expression via two transcription factors,
SREBP2 and PPARδ
Several transcription factors have been reported to play vital roles in
regulating LDLR expression. SREBP2 is believed to be a dominant reg-
ulator of LDLR [29] and PPARδhas been reported to function on LDLR
promoter recently [29,30]. We then examined the expression of
SREBP2 and PPARδafter WTE treatment. It was observed that both
factors were induced by WTE treatment at both the mRNA and protein
levels (Fig. 4A and B).
The binding sites of PPARδand SREBP2 on the LDLR promoter are
peroxisome proliferator response element (PPRE) and sterol regulatory
element (SRE) respectively [30,31]. Not surprisingly, we found that
WTE activated reporters harbouring artificial PPRE or SRE regulatory
motifs (Fig. 4C and D). Since we observed the induction effect of WTE
on the endogenous LDLR promoter (Fig. 3F), we then performed a
mutation assay to verify whether the PPRE and SRE sites are indis-
pensable for WTE function on the endogenous LDLR promoter. As
shown in Fig. 4E, mutation of either the PPRE or SRE site diminished
the effect of WTE-stimulated LDLR promoter activity. The effect was
nearly abolished when both the PPRE and SRE sites were mutated
(Fig. 4E).
Taken together, we concluded that PPRE and SRE were both im-
portant in WTE-induced LDLR promoter activity. WTE stimulates LDLR
expression through the PPAR signalling pathway and the SREBP2 sig-
nalling pathway via the PPRE site and the SRE site simultaneously.
3.5. WTE attenuates sodium oleate induced triglyceride accumulation
In addition to LDL-c lowering function, the effect of WTE on tri-
glyceride accumulation was investigated in vitro. HepG2 cells were
exposed to sodium oleate for 24 h to induce cellular triglyceride ac-
cumulation, and the total cellular triglyceride levels were determined
with or without WTE treatment for another 24 h. Oil Red O (ORO)
staining was performed to observe the total lipid amount inner HepG2
cells. ORO-stained lipids were significantly increased after sodium
oleate induction while significantly decreased after WTE treatment
(Fig. 5A). The data was quantified by ImageJ (Fig. 5B).
In addition, the concentration of intracellular triglycerides among
different treatment groups were determined by a triglyceride assay kit.
Cells treated with sodium oleate exhibited a 2-fold increase in trigly-
ceride accumulation, and WTE treatment for 24 h significantly de-
creased triglyceride levels by 42.04 % (Fig. 5C). Furthermore, we found
genes involved in triglyceride synthetic pathway, including hepatocyte
nuclear factor 4 alpha (HNF4α), fatty acid synthase (FASN), patatin like
Fig. 4. The transcriptional upregulation of LDLR by WTE is mediated by two transcription factors, SREBP2 and PPARδ. (A) mRNA expression levels of SREBP2 and
PPARδtreated with WTE (n = 3). (B) Western blot of SREBP2 and PPARδ. Results were quantified by Image J software (n = 3). (C) Determination of the
transcriptional activity of PPRE and (D) SRE via luciferase assay (n = 3). Data are shown in mean ± SD. Statistical analyses were conducted using paired Student’st
test. *p < 0.05, **p < 0.01 compared with DMSO. (E) Transcriptional activity of different mutation on LDLR promoter (PPRE mutation, SRE mutation, PPRE&SRE
double mutation) treated with WTE (n = 3). In Fig. 4E, induced fold change of luciferase activity (WTE vs DMSO) are shown in mean ± SD. Statistical analyses were
conducted using paired Student’s t test. *p <0.05, **p < 0.01 compared with wildtype LDLR promoter.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
6
phospholipase domain containing 3 (PNPLA3) and ATP citrate lyase
(ACLY) were down-regulated by WTE. All above results suggest that
WTE is of vital importance in reducing intracellular triglycerides.
3.6. Determination of the effective components in WTE
Considering polyphenols are the main functional components in tea,
HPLC analysis was performed to determine the concentration of poly-
phenols in WTE. Polyphenols standards including Catechin (C), epica-
techin (EC), epicatechin gallate (ECG), gallic acid (GA), epigalloca-
techin (EGC) and epigallocatechin gallate (EGCG) were mixed at a
concentration of 1000 μg/mL followed by gradient dilution to 7.815
μg/mL to create a standard curve. WTEs from three different batches
were used for content determination. Fig. 6A and B shows the chro-
matographic profile of mixed standards and WTE extracts. Polyphenols
concentration were calculated according to the standard curve. The
relative abundant catechins in WTE were EGCG and ECG, at a con-
centration of 14.50 μg/mg and 4.07 μg/mg respectively (Fig. 6C). Be-
sides, the concentration of gallic acids was the highest among the de-
tected standards in WTE, up to 17.91 μg/mg. However, the
concentrations of EGC, C, and EC were too low to detect.
Next, RT-qPCR was performed to validate the cholesterol lowering
effects of detected components in WTE. HepG2 cells were incubated
with 50 μM GA, ECG and EGCG for 24 h followed by RNA extraction,
reverse transcription and qPCR. The results showed that both ECG and
EGCG were effective in LDLR upregulation and MTTP,APOB down-
regulation, which were consistent with WTE function (Fig. 6D). Al-
though GA was the highest content among detected standards in WTE,
it didn’taffect LDLR expression, and led to a mild downregulation of
MTTP and APOB. Above results indicate that ECG and EGCG are ef-
fective catechin components in WTE.
4. Discussion
To obtain the whole picture of WTE induced transcriptional reg-
ulation, we treated hepatic cells with WTE and performed global gene
expression profiling. GO and pathway analysis revealed that WTE in-
duced DEGs were enriched mainly in lipid metabolism-related path-
ways, indicating that WTE is crucial in regulating lipid homeostasis. A
set of genes involved in lipid transport and synthesis were confirmed to
be targets of WTE. Consistently, the results show that indeed WTE is
involved in the regulation of lipid metabolic genes.
Although the first line anti-hypercholesterolemic drugs statins are
well-tolerated by most people, they can cause muscle and joint aches
and become useless when treating patients with familial hypercholes-
terolemia [32]. Novel lipid lowering drugs are emerged as com-
plementary treatments, including Mipomersen, a type of antisense oli-
gonucleotides targeting APOB [33], and Lomitapide, an inhibitor of
MTTP [34]. Since APOB and MTTP play crucial roles during VLDL as-
sembly, inhibition of APOB and MTTP reduces LDL production in the
circulation. In this study, we found WTE down-regulates APOB and
MTTP gene expression through transcriptional regulation simulta-
neously. This indicates WTE can realize lipid lowering effect through
regulating multiple targets.
LDL-c is a major risk factor for progression of cardiovascular dis-
eases and the ability to clear circulated LDL-c is considered an effective
indicator of a drug. Consistent with a previous study [14], our study
indicated that WTE is efficient in stimulating human LDL-c particle
uptake in hepatic cells. Importantly, the molecular mechanisms of
WTE-mediated LDL uptake and LDLR expression were revealed in our
study. LDLR is well accepted to be predominantly regulated at the
transcriptional level through a negative feedback mechanism mediated
by the depletion of intracellular cholesterol [35]. The transcriptional
regulation is mainly controlled by specific interactions of SRE located
on the LDLR promoter and SREBP2. Under cholesterol-depleted condi-
tions, SREBP cleavage-activating protein (SCAP) transports the SREBP2
Fig. 5. WTE ameliorates sodium oleate induced intracellular lipid accumulation in HepG2 cells. (A) ORO staining of sodium oleate induced cellular TG accumulation,
cells were treated with DMSO or WTE respectively. (B) The stained lipid content was quantified by ImageJ (n = 3). (C) The inhibitory effect of WTE on total
triglyceride levels in HepG2 cells (n = 3). (D) qPCR results of triglyceride synthetic related genes in HepG2 cells treated with WTE (n = 3). Data are shown in
mean ± SD. Statistical analyses were conducted using paired Student’s t test. *p < 0.05, **p < 0.01 compare with DMSO.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
7
precursor to the Golgi apparatus to release mature SREBP2 through
specific cleavages [36]. Mature SREBP2 translocates to the nucleus,
binds to LDLR and regulates its transcriptional activity. Recently,
Shende et al. identified the PPRE motif which responds to PPARδac-
tivation on the LDLR promoter [30]. PPARδis a ubiquitously expressed
transcription factor and is considered the most crucial regulator for
executing key cellular functions in the liver, intestine, kidneys and
skeletal muscle [37]. Thus, efforts have been made to validate whether
SREBP2 and PPARδare both critical targets of WTE. Our data suggest
that SREBP2 and PPARδare both of vital importance in WTE-mediated
LDLR transcriptional activity. WTE not only upregulated the expression
of SREBP2 and PPARδat the gene and protein levels but also stimulated
their transcriptional activities. Moreover, mutation of either SRE or
PPRE on the LDLR promoter diminished WTE-stimulated LDLR pro-
moter activity, and the effect was nearly abolished when both PPRE and
SRE sites were mutated, suggesting that SREBP2 and PPARδare crucial
regulators.
EGCG, one of the most abundant content in tea, has been demon-
strated with effects on cancer, obesity, dyslipidemia, blood pressure and
glycaemia [38]. However, as another type of catechin, ECG was less
studied and its hypolipidemic function remains to be explored. In the
present study, we found both EGCG and ECG are effective components
in WTE and involved in the regulation of cholesterol metabolism re-
lated genes expression, including LDLR,MTTP and APOB. The function
of ECG is worthy of further exploration.
White tea is well accepted to provide health benefits for humans as a
result of the high concentration of natural antioxidants due to its
minimal processing. Our in vitro results provide novel insights into
WTE-mediated lipid homeostasis. Taken together, WTE may be con-
sidered a potential hypolipidaemic drink.
Author contributions
K. Luo, L. Xie, J. Cheng designed research. K. Luo, C. M. Ma, S.F.
Xing and Y. N. An conducted research. J. Feng, H. L. Dang, W. T. Huang
and L. S. Qiao analyzed data. K. Luo, L. Xie and J. Cheng wrote and/or
revised the manuscript and had primary responsibility for final content.
Declaration of Competing Interest
The authors declare no conflict of interest.
Acknowledgements
We are grateful to Jiahua Han for providing cDNA library and
Xiurui Zhu for statistical consulting respectively. This study was sup-
ported by the Beijing Talents Foundation (2017000021223ZK30) and
Beijing Lab Foundation.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.biopha.2020.110146.
Fig. 6. Determination of effective polyphenols in WTE. Chromatographic profile of (A) mixed polyphenol standards and (B) WTE at 278 nm. (C) Quantitative analysis
of each polyphenol in WTE according to standard curve. GA, gallic acids; EGCG, epigallocatechin gallate; ECG, epicatechin gallate; EGC, epigallocatechin; C,
catechin; EC, epicatechin. (D) qPCR results of LDLR,MTTP and APOB in HepG2 cells treated with 50 μM GA, ECG and EGCG for 24 h (n = 3). Data are shown in
mean ± SD. Statistical analyses were conducted using paired Student’s t test. *p < 0.05, **p < 0.01 compare with DMSO.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
8
References
[1] Y.H. Kao, H.H. Chang, M.J. Lee, C.L. Chen, Tea, obesity, and diabetes, Mol. Nutr.
Food Res. 50 (2) (2006) 188–210, https://doi.org/10.1002/mnfr.200500109.
[2] C.S. Yang, H. Wang, Cancer preventive activities of tea catechins, Molecules 21 (12)
(2016), https://doi.org/10.3390/molecules21121679.
[3] Y.-J. Zhang, R.-Y. Gan, S. Li, et al., Antioxidant phytochemicals for the prevention
and treatment of chronic diseases, Molecules 20 (12) (2015) 21138–21156, https://
doi.org/10.3390/molecules201219753.
[4] A. Babu, V. Pon, D. Liu, Green tea catechins and cardiovascular health: an update,
Curr. Med. Chem. 15 (18) (2008) 1840–1850, https://doi.org/10.2174/
092986708785132979.
[5] J.T. Mao, White Tea: The Plants, Processing, Manufacturing, and Potential Health
Benefits, Tea in Health and Disease Prevention, Elsevier, 2013, pp. 33–40.
[6] Y. Hilal, U. Engelhardt, Characterisation of white tea - comparison to green and
black tea, J. Verbrauch. Lebensm. 2 (4) (2007) 414–421, https://doi.org/10.1007/
s00003-007-0250-3.
[7] G.A. Roth, C. Johnson, A. Abajobir, et al., Global, regional, and national burden of
cardiovascular diseases for 10 causes, 1990 to 2015, J. Am. Coll. Cardiol. 70 (1)
(2017) 1–25, https://doi.org/10.1016/j.jacc.2017.04.052.
[8] C.J. Dufresne, E.R. Farnworth, A review of latest research findings on the health
promotion properties of tea, J. Nutr. Biochem. 12 (7) (2001) 404–421, https://doi.
org/10.1016/s0955-2863(01)00155-3.
[9] T. Dias, G. Tomás, N. Teixeira, et al., White tea (Camellia sinensis (L.)): antioxidant
properties and beneficial health effects, Int. J. Food Sci. Nutr. Diet. 2 (2) (2013)
19–26.
[10] A.E. Koutelidakis, K. Argiri, M. Serafini, et al., Green tea, white tea, and Pelargonium
purpureum increase the antioxidant capacity of plasma and some organs in mice,
Nutrition 25 (4) (2009) 453–458, https://doi.org/10.1016/j.nut.2008.10.007.
[11] T.S.A. Thring, P. Hili, D.P. Naughton, Anti-collagenase, anti-elastase and anti-oxi-
dant activities of extracts from 21 plants, BMC Complement. Altern. Med. 9 (2009)
27–36, https://doi.org/10.1186/1472-6882-9-27.
[12] M.S. Islam, Effects of the aqueous extract of white tea (Camellia sinensis) in a
streptozotocin-induced diabetes model of rats, Phytomedicine 19 (1) (2011) 25–31,
https://doi.org/10.1016/j.phymed.2011.06.025.
[13] J. Söhle, A. Knott, U. Holtzmann, et al., White Tea extract induces lipolytic activity
and inhibits adipogenesis in human subcutaneous (pre)-adipocytes, Nutr. Metab. 6
(2009), https://doi.org/10.1186/1743-7075-6-20.
[14] G.C. Tenore, P. Stiuso, P. Campiglia, E. Novellino, In vitro hypoglycaemic and
hypolipidemic potential of white tea polyphenols, Food Chem. 141 (3) (2013)
2379–2384, https://doi.org/10.1016/j.foodchem.2013.04.128.
[15] N. Dashti, G. Wolfbauer, Secretion of lipids, apolipoproteins, and lipoproteins by
human hepatoma cell line, HepG2: effects of oleic acid and insulin, J. Lipid Res. 28
(4) (1987) 423–436.
[16] N.B. Javitt, Hep G2 cells as a resource for metabolic studies: lipoprotein, choles-
terol, and bile acids, FASEB J. 4 (2) (1990) 161–168.
[17] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(T)(-Delta Delta C) method, Methods 25 (4) (2001)
402–408, https://doi.org/10.1006/meth.2001.1262.
[18] R.A. Hegele, Plasma lipoproteins: genetic influences and clinical implications, Nat.
Rev. Genet. 10 (2) (2009) 109–121, https://doi.org/10.1038/nrg2481.
[19] L.H. Kuller, Hyperlipidemia and cardiovascular disease, Curr. Opin. Lipidol. 18 (2)
(2007) 230–233, https://doi.org/10.1097/MOL.0b013e32805dfb47.
[20] E. Ikonen, Cellular cholesterol trafficking and compartmentalization, Nat. Rev. Mol.
Cell Biol. 9 (2) (2008) 125–138, https://doi.org/10.1038/nrm2336.
[21] K.L. Kuo, M.S. Weng, C.T. Chiang, et al., Comparative studies on the hypolipidemic
and growth suppressive effects of oolong, black, pu-erh, and green tea leaves in rats,
J. Agric. Food Chem. 53 (2) (2005) 480–489, https://doi.org/10.1021/jf049375k.
[22] L. Zhang, Z. Zhang, Y. Zhou, T. Ling, X. Wan, Chinese dark teas: postfermentation,
chemistry and biological activities, Food Res. Int. 53 (2) (2013) 600–607, https://
doi.org/10.1016/j.foodres.2013.01.016.
[23] Y. Teng, D. Li, P. Guruvaiah, N. Xu, Z. Xie, Dietary supplement of large yellow tea
ameliorates metabolic syndrome and attenuates hepatic steatosis in db/db mice,
Nutrients 10 (1) (2018) 75–91, https://doi.org/10.3390/nu10010075.
[24] C. Bursill, P.D. Roach, C.D.K. Bottema, S. Pal, Green tea upregulates the low-density
lipoprotein receptor through the sterol-regulated element binding protein in HepG2
liver cells, J. Agric. Food Chem. 49 (11) (2001) 5639–5645, https://doi.org/10.
1021/jf010275d.
[25] H. Pan, Y. Gao, Y. Tu, Mechanisms of body weight reduction by black tea poly-
phenols, Molecules 21 (12) (2016) 1659–1669.
[26] Q. Li, Z. Liu, J. Huang, et al., Anti-obesity and hypolipidemic effects of Fuzhuan
brick tea water extract in high-fat diet-induced obese rats, J. Sci. Food Agric. 93 (6)
(2013) 1310–1316, https://doi.org/10.1002/jsfa.5887.
[27] K. Kitamura, Y. Okada, K. Okada, Y. Kawaguchi, S. Nagaoka, Epigallocatechin
gallate induces an up-regulation of LDL receptor accompanied by a reduction of
PCSK9 via the annexin A2-independent pathway in HepG2 cells, Mol. Nutr. Food
Res. 61 (8) (2017) 1600836–1600847, https://doi.org/10.1002/mnfr.201600836.
[28] C.A. Bursill, P.D. Roach, Modulation of cholesterol metabolism by the green tea
polyphenol (-)-epigallocatechin gallate in cultured human liver (HepG2) cells, J.
Agric. Food Chem. 54 (5) (2006) 1621–1626, https://doi.org/10.1021/jf051736o.
[29] W. Luu, L.J. Sharpe, I.C. Gelissen, A.J. Brown, The role of signalling in cellular
cholesterol homeostasis, J. Int. Union Biochem. Mol. Biol. Life 65 (8) (2013)
675–684, https://doi.org/10.1002/iub.1182.
[30] V.R. Shende, A.B. Singh, J. Liu, A novel peroxisome proliferator response element
modulates hepatic low-density lipoprotein receptor gene transcription in response
to PPAR delta activation, Biochem. J. 472 (2015) 275–286, https://doi.org/10.
1042/bj20150666.
[31] J.L. Goldstein, M.S. Brown, A century of cholesterol and coronaries: from plaques to
genes to statins, Cell 161 (1) (2015) 161–172, https://doi.org/10.1016/j.cell.2015.
01.036.
[32] F.J. Raal, R.D. Santos, D.J. Blom, et al., Mipomersen, an apolipoprotein B synthesis
inhibitor, for lowering of LDL cholesterol concentrations in patients with homo-
zygous familial hypercholesterolaemia: a randomised, double-blind, placebo-con-
trolled trial, Lancet 375 (9719) (2010) 998–1006.
[33] R.S. Geary, B.F. Baker, S.T. Crooke, Clinical and preclinical pharmacokinetics and
pharmacodynamics of mipomersen (Kynamro®): a second-generation antisense
oligonucleotide inhibitor of apolipoprotein B, Clin. Pharmacokinet. 54 (2) (2015)
133–146.
[34] M. Cuchel, E.A. Meagher, H. du Toit Theron, et al., Efficacy and safety of a mi-
crosomal triglyceride transfer protein inhibitor in patients with homozygous fa-
milial hypercholesterolaemia: a single-arm, open-label, phase 3 study, Lancet 381
(9860) (2013) 40–46.
[35] L. Zhang, K. Reue, L.G. Fong, S.G. Young, P. Tontonoz, Feedback regulation of
cholesterol uptake by the LXR-IDOL-LDLR axis, Arterioscler. Thromb. Vasc. Biol. 32
(11) (2012) 2541–2546, https://doi.org/10.1161/atvbaha.112.250571.
[36] D. Eberle, B. Hegarty, P. Bossard, P. Ferre, F. Foufelle, SREBP transcription factors:
master regulators of lipid homeostasis, Biochimie 86 (11) (2004) 839–848, https://
doi.org/10.1016/j.biochi.2004.09.018.
[37] B. Grygiel-Gorniak, Peroxisome proliferator-activated receptors and their ligands:
nutritional and clinical implications - a review, Nutr. J. 13 (2014) 17–26, https://
doi.org/10.1186/1475-2891-13-17.
[38] R.-Y. Gan, H.-B. Li, Z.-Q. Sui, H. Corke, Absorption, metabolism, anti-cancer effect
and molecular targets of epigallocatechin gallate (EGCG): an updated review, Crit.
Rev. Food Sci. Nutr. 58 (6) (2018) 924–941.
K. Luo, et al. Biomedicine & Pharmacotherapy 127 (2020) 110146
9
