Access to this full-text is provided by MDPI.
Content available from International Journal of Molecular Sciences (IJMS)
This content is subject to copyright.
International Journal of
Molecular Sciences
Article
The Importance of Porins and β-Lactamase in Outer
Membrane Vesicles on the Hydrolysis of
β-Lactam Antibiotics
Si Won Kim 1, Jung Seok Lee 1, Seong Bin Park 2, Ae Rin Lee 1, Jae Wook Jung 1, Jin Hong Chun 1,
Jassy Mary S. Lazarte 1, Jaesung Kim 1, Jong-Su Seo 3, Jong-Hwan Kim 3, Jong-Wook Song 3,
Min Woo Ha 4, Kim D. Thompson 5, Chang-Ro Lee 6, Myunghwan Jung 7and
Tae Sung Jung 1, 8, *
1Laboratory of Aquatic Animal Diseases, Institute of Animal Medicine, College of Veterinary Medicine,
Gyeongsang National University, Jinju 52828, Korea; ksw0017@hanmail.net (S.W.K.);
leejs058@gmail.com (J.S.L.); gladofls@naver.com (A.R.L.); wjdwodnr0605@gmail.com (J.W.J.);
hilanamang@naver.com (J.H.C.); jassylazarte@yahoo.com (J.M.S.L.); afteru70@gmail.com (J.K.)
2Coastal Research & Extension Center, Mississippi State University, Starkville, MS 39567, USA;
9887035@hanmail.net
3Environmental Chemistry Research Center, Korea Institute of Toxicology Gyeongnam Department of
Environmental Toxicology and Chemistry, Jinju 52834, Korea; jsseo@kitox.re.kr (J.-S.S.);
jjong@kitox.re.kr (J.-H.K.); songjk@kitox.re.kr (J.-W.S.)
4College of Pharmacy, Jeju National University, 102, Jejudaehak-ro, Jeju-si, Jeju-do 63243, Korea;
beneminu_@naver.com
5Moredun Research Institute, Pentlands Science Park, Penicuik, Midlothian EH26 0PZ, UK;
kim.thompson@moredun.ac.uk
6
Department of Biological Sciences, Myongji University, Yongin, Gyeonggido 449-728, Korea; crlee@mju.ac.kr
7Department of Microbiology, Research Institute of Life Sciences, College of Medicine,
Gyeongsang National University, Jinju 52727, Korea; mjung@gnu.ac.kr
8Centre for Marine Bioproducts Development, College of Medicine and Public Health, Flinders, University,
Bedford Park, Adelaide, SA 5042, Australia
*Correspondence: jungts@gnu.ac.kr; Tel.: +82-10-8545-9310; Fax: +82-55-762-6733
Received: 13 February 2020; Accepted: 16 April 2020; Published: 17 April 2020
Abstract:
Gram-negative bacteria have an outer membrane inhibiting the entry of antibiotics.
Porins, found within the outer membrane, are involved in regulating the permeability of
β
-lactam
antibiotics.
β
-lactamases are enzymes that are able to inactivate the antibacterial properties of
β
-lactam antibiotics. Interestingly, porins and
β
-lactamase are found in outer membrane vesicles
(OMVs) of
β
-lactam-resistant Escherichia coli and may be involved in the survival of susceptible
strains of E. coli in the presence of antibiotics, through the hydrolysis of the
β
-lactam antibiotic.
In this study, OMVs isolated from
β
-lactam-resistant E. coli and from mutants, lacking porin or
β
-lactamase, were evaluated to establish if the porins or
β
-lactamase in OMVs were involved in the
degradation of
β
-lactam antibiotics. OMVs isolated from E. coli deficient in
β
-lactamase did not show
any degradation ability against
β
-lactam antibiotics, while OMVs lacking OmpC or OmpF showed
significantly lower levels of hydrolyzing activity than OMVs from parent E. coli. These data reveal an
important role of OMVs in bacterial defense mechanisms demonstrating that the OmpC and OmpF
proteins allow permeation of
β
-lactam antibiotics into the lumen of OMVs, and antibiotics that enter
the OMVs can be degraded by β-lactamase.
Keywords:
outer membrane vesicles (OMVs);
β
-lactamase; porin;
β
-lactam antibiotic; Escherichia coli;
hydrolysis
Int. J. Mol. Sci. 2020,21, 2822; doi:10.3390/ijms21082822 www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2020,21, 2822 2 of 14
1. Introduction
Since the discovery of penicillin, antibiotics have been responsible for prolonging human life
and advancing human medicine. However, antibiotic-resistant bacteria, also known as superbugs or
multi-drug resistant (MDR) bacteria, have emerged due to the indiscriminate misuse of antibiotics [
1
,
2
].
O’Neill (2014) has estimated that by 2050, 10 million deaths will have occurred each year as a result of
antibiotic resistance and this is estimated to cost up to 100 trillion USD [
3
]. In 2013, the U.S. Centers for
Disease Control and Prevention predicted that at least 2 million antibiotic-resistant bacteria infections,
resulting in a predicted 23,000 deaths, would cost around 20 billion USD in extra healthcare, leading
to an economic loss of at least 35 billion USD in the U.S. each year [
4
]. In 2016, the UK government
reported that 700,000 deaths occur worldwide each year as a result of antibiotic-resistant bacteria [
5
].
This problem is not confined to humans, but spreads across species, affecting agriculture, livestock,
fisheries, food and the environment [
6
]. Antibiotic-resistant bacteria are now regarded as the biggest
challenge facing public health and efforts to reduce MDR bacteria globally have increased substantially.
All Gram-negative bacteria secrete spherical membrane bilayer structures (10 to 250 nm),
referred to as outer membrane vesicles (OMVs), into the external environment during both
in vitro
growth and
in vivo
infection [
7
–
10
]. We now have a greater understanding of the composition,
physicochemical properties and various roles of OMVs [
8
,
10
–
17
]. OMVs consist of outer membrane
proteins, cytoplasmic proteins, periplasmic membrane proteins, phospholipids, lipopolysaccharides
and genetic
material [8,12,13]
. More recent research has focused on the role of OMVs in protecting
bacteria by directly participating in the bacteria’s development of antibiotic resistance [
7
,
9
,
18
–
21
].
However, there are few in-depth studies examining the mechanisms OMVs use to protect bacteria
against antibiotics. Although many studies have investigated the effects of
β
-lactam antibiotics on
bacteria, showing inactivation of
β
-lactamase and mutation of porin-encoding genes [
22
–
26
], the
interaction between
β
-lactamases and porins in OMVs and
β
-lactam antibiotics remains to be clarified.
Our previous work showed that OMVs from
β
-lactam-resistant E. coli can help
β
-lactam-susceptible
E. coli avoid the effects of
β
-lactam antibiotics through hydrolysis. In addition, porins (OmpC and OmpF)
and
β
-lactamase (Blc1) were seen to be upregulated in OMVs of
β
-lactam-resistant E. coli compared to
OMVs of
β
-lactam-susceptible E. coli [
7
]. Therefore, we hypothesize that the increased number of porin
proteins are able to efficiently direct the
β
-lactam antibiotics into the OMVs lumen, and the increase in
β
-lactamase actively drives the degradation of
β
-lactam antibiotics, suggesting that antibiotic hydrolysis
is commonly observed in OMVs from
β
-lactam-resistant E. coli (RC85
+
) (Figure 1). In the present study,
we attempt to demonstrate
β
-lactam antibiotic hydrolysis by OMVs by making mutants containing ompC,
ompF, or blc1 gene deletions and observing whether OMVs isolated from the mutants are able to consume
β-lactam antibiotics within the bacterial environment and within a cell-free system.
Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 3 of 15
Figure 1. Predictive mechanism of β-lactam antibiotics degradation by outer membrane vesicles
(OMVs) from β-lactam-resistant Escherichia coli (RC85+). OMVs take up β-lactam antibiotics into their
lumen through porin channels (OmpC and OmpF) and the β-lactamase (Blc1) in the lumen hydrolyzes
the β-lactam antibiotics confined in the lumen of OMVs.
2. Results
2.1. Characterization of Mutant Strains
To establish if Blc1, OmpC, or OmpF are involved in the OMVs’ ability to degrade β-lactam
antibiotics, mutants were produced from RC85+ by knocking out each of these genes. The successful
deletion of blc1, ompC, and ompF in mutant RC85+ strains was confirmed by PCR amplification shown
in Figure S1. Mutant strains grew well in LB medium, having a logarithmic phase growth simila r to
RC85+ (Figure 2). The deletion of blc1 and ompF had no distinguishable influence on growth rates,
while the growth rate of ΔompC RC85+ was slightly slower than that of RC85+. When the growth on
LB agar was observed, mutant strains formed smooth, slightly elevated, non-pigmented colonies,
similar to those of RC85+ (data not shown). An antimicrobial sensitivity test was conducted with the
mutant strains to determine whether changes in their antibiotic resistance occurred compared to
RC85+ (Table 1). In the absence of the blc1 gene, the minimum inhibitory concentration (MIC) of all β-
lactam antibiotics was reduced. In the case of ΔompC, there was no difference in MIC levels relative
to RC85+, apart from the MIC for cefazolin, which was enhanced, whereas inactivation of the ompF
gene conferred more resistance to cefoperazone, cefazolin, and cefalexin in the mutant compared
with RC85+.
Figure 1.
Predictive mechanism of
β
-lactam antibiotics degradation by outer membrane vesicles
(OMVs) from
β
-lactam-resistant Escherichia coli (RC85
+
). OMVs take up
β
-lactam antibiotics into their
lumen through porin channels (OmpC and OmpF) and the
β
-lactamase (Blc1) in the lumen hydrolyzes
the β-lactam antibiotics confined in the lumen of OMVs.
Int. J. Mol. Sci. 2020,21, 2822 3 of 14
2. Results
2.1. Characterization of Mutant Strains
To establish if Blc1, OmpC, or OmpF are involved in the OMVs’ ability to degrade
β
-lactam
antibiotics, mutants were produced from RC85+by knocking out each of these genes. The successful
deletion of blc1,ompC, and ompF in mutant RC85
+
strains was confirmed by PCR amplification shown
in Figure S1. Mutant strains grew well in LB medium, having a logarithmic phase growth similar to
RC85
+
(Figure 2). The deletion of blc1 and ompF had no distinguishable influence on growth rates,
while the growth rate of
∆
ompC RC85
+
was slightly slower than that of RC85
+
. When the growth
on LB agar was observed, mutant strains formed smooth, slightly elevated, non-pigmented colonies,
similar to those of RC85
+
(data not shown). An antimicrobial sensitivity test was conducted with
the mutant strains to determine whether changes in their antibiotic resistance occurred compared
to RC85
+
(Table 1). In the absence of the blc1 gene, the minimum inhibitory concentration (MIC) of
all
β
-lactam antibiotics was reduced. In the case of
∆
ompC, there was no difference in MIC levels
relative to RC85
+
, apart from the MIC for cefazolin, which was enhanced, whereas inactivation of the
ompF gene conferred more resistance to cefoperazone, cefazolin, and cefalexin in the mutant compared
with RC85+.
Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 4 of 15
Figure 2. Growth curves of RC85+ and isogenic mutant strains of RC85+ (Δblc1, ΔompC, and ΔompF).
The RC85+ and mutant strains were cultured on LB medium, and the growth of each strain was
investigated by measuring absorbance at 600 nm. Data are presented as means and SEMs of three
independent experiments.
Table 1. The MIC of β-lactam antibiotics and other class antibiotics against the multidrug-resistant
Escherichia coli RC85+ and isogenic mutant strains of RC85+.
Class
Antibiotics
MIC (μg/mL)a
RC85+
Δblc1
ΔompC
ΔompF
β-lactam antibiotics
Ampicillin
>1024
4
>1024
>1024
Cefotaxime
>1024
<1/2
>1024
>1024
Cefoperazone
1024
<1/2
1024
>1024
Methicillin
>1024
256
>1024
>1024
Amoxicillin
>1024
2
>1024
>1024
Cefazolin
1024
1
>1024
>1024
Cefalexin
512
8
512
1024
Cloxacillin
>1024
128
>1024
>1024
Other class antibiotics
Streptomycin
>1024
>1024
>1024
>1024
Kanamycin
>1024
>1024
>1024
>1024
Colistin
4
4
4
4
Amikacin
8
8
8
8
Nalidixic acid
>1024
>1024
>1024
>1024
aMIC indicates minimum inhibitory concentration.
2.2. Quantification of the Produced OMVs
The OMVs from the mutants and RC85+ were isolated after incubation under the same culture
conditions. Electron micrograph analysis exhibited the similarity of OMVs isolated from the mutants
and RC85+ in size with the spherical structure (Figure S2). The average diameter of the OMVs from
the Δblc1, ΔompC, and ΔompF cells was nearly identical, while RC85+ OMVs were slightly larger
than these (Figure S3). Production of OMVs was evaluated with a BCA protein assay, with the
production of OMVs slightly decreased in Δblc1, but increased by 2.2- and 1.8-fold in ΔompC and
ΔompF, respectively, relative to the level of OMVs produced by RC85+ (Figure 3).
Figure 2.
Growth curves of RC85
+
and isogenic mutant strains of RC85
+
(
∆
blc1,
∆
ompC, and
∆
ompF).
The RC85
+
and mutant strains were cultured on LB medium, and the growth of each strain was
investigated by measuring absorbance at 600 nm. Data are presented as means and SEMs of three
independent experiments.
Table 1.
The MIC of
β
-lactam antibiotics and other class antibiotics against the multidrug-resistant
Escherichia coli RC85+and isogenic mutant strains of RC85+.
Class Antibiotics MIC (µg/mL)a
RC85+∆blc1 ∆ompC ∆ompF
β-lactam
antibiotics
Ampicillin >1024 4 >1024 >1024
Cefotaxime >1024 <1/2>1024 >1024
Cefoperazone 1024 <1/2 1024 >1024
Methicillin >1024 256 >1024 >1024
Amoxicillin >1024 2 >1024 >1024
Cefazolin 1024 1 >1024 >1024
Cefalexin 512 8 512 1024
Cloxacillin >1024 128 >1024 >1024
Other class
antibiotics
Streptomycin >1024 >1024 >1024 >1024
Kanamycin >1024 >1024 >1024 >1024
Colistin 4 4 4 4
Amikacin 8 8 8 8
Nalidixic acid >1024 >1024 >1024 >1024
aMIC indicates minimum inhibitory concentration.
Int. J. Mol. Sci. 2020,21, 2822 4 of 14
2.2. Quantification of the Produced OMVs
The OMVs from the mutants and RC85
+
were isolated after incubation under the same culture
conditions. Electron micrograph analysis exhibited the similarity of OMVs isolated from the mutants
and RC85
+
in size with the spherical structure (Figure S2). The average diameter of the OMVs from
the
∆
blc1,
∆
ompC, and
∆
ompF cells was nearly identical, while RC85
+
OMVs were slightly larger
than these (Figure S3). Production of OMVs was evaluated with a BCA protein assay, with the
production of OMVs slightly decreased in
∆
blc1, but increased by 2.2- and 1.8-fold in
∆
ompC and
∆ompF, respectively, relative to the level of OMVs produced by RC85+(Figure 3).
Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 15
Figure 3. Production of OMVs isolated from RC85+ and isogenic mutant strains of RC85+ (Δblc1,
ΔompC, and ΔompF). OMVs yields were averaged and normalized to RC85+ to adjust fold change.
OMVs were purified and quantified using the BCA protein assay. Data are representative of three
independent experiments in means ± SEMs. * p < 0.05, and **** p < 0.0001.
2.3. Comparison of β-Lactamase Activity
Differences in β-lactamase activity between OMVs from RC85+ and the mutant strains were
examined, based on a change in absorbance of OD490 over time (Figure 4a). Since nitrocefin can enter
into bacteria through porins, the individual OMVs were destroyed by sonication to remove the
variables for porins in OMVs. This liberates the β-lactamase present in the lumen of the OMVs. The
absorbance obtained for mutant Δblc1 was similar to the negative control, while mutants ΔompC and
ΔompF showed higher levels of absorbance than the positive control and they exhibited similar levels
of β-lactamase activity to that of the RC85+ OMVs over the course of the experiment. The β-lactamase
activity of the respective OMVs was expressed as milliunit per milligram (mU/mg) of OMV protein
(Figure 4b). The β-lactamase activity of ΔompC and ΔompF OMVs was 72.4 mU/mg and 70.3 mU/mg
respectively, nearly identical to those of RC85+ OMVs (64.4 mU/mg). OMVs from Δblc1 cells
displayed the lowest β-lactamase activity of 2.7 mU/mg.
Figure 4. Investigation of the differences in β-lactamase activity between destroyed OMVs from RC85+
and isogenic mutant strains of RC85+ (Δblc1, ΔompC, and ΔompF). (a) β-Lactamase activity profil es
of samples were measured in a kinetic mode in 60 min. Data are representative of three independent
experiments in means ± SEMs. (b) β-Lactamase units were normalized to milligrams of total OMV
protein. The data are presented as means and SEMs of three independent experiments. * p < 0.05, ** p
< 0.01, and **** p < 0.0001.
2.4. Evaluation of the Protective Role of OMVs against β-Lactam Antibiotics
To determine if the loss of porin or β-lactamase proteins from the OMVs influences the
degradation of β-lactam antibiotics, we investigated the effect of OMVs from RC85+ and mutants
(Δblc1, ΔompC, or ΔompF) on the growth of β-lactam susceptible E. coli (RC85) cells in the presence
Figure 3.
Production of OMVs isolated from RC85
+
and isogenic mutant strains of RC85
+
(
∆
blc1,
∆
ompC,
and
∆
ompF). OMVs yields were averaged and normalized to RC85
+
to adjust fold change. OMVs were
purified and quantified using the BCA protein assay. Data are representative of three independent
experiments in means ±SEMs. * p<0.05, and **** p<0.0001.
2.3. Comparison of β-Lactamase Activity
Differences in
β
-lactamase activity between OMVs from RC85
+
and the mutant strains were
examined, based on a change in absorbance of OD
490
over time (Figure 4a). Since nitrocefin can
enter into bacteria through porins, the individual OMVs were destroyed by sonication to remove the
variables for porins in OMVs. This liberates the
β
-lactamase present in the lumen of the OMVs. The
absorbance obtained for mutant
∆
blc1 was similar to the negative control, while mutants
∆
ompC and
∆
ompF showed higher levels of absorbance than the positive control and they exhibited similar levels
of
β
-lactamase activity to that of the RC85
+
OMVs over the course of the experiment. The
β
-lactamase
activity of the respective OMVs was expressed as milliunit per milligram (mU/mg) of OMV protein
(Figure 4b). The
β
-lactamase activity of
∆
ompC and
∆
ompF OMVs was 72.4 mU/mg and 70.3 mU/mg
respectively, nearly identical to those of RC85
+
OMVs (64.4 mU/mg). OMVs from
∆
blc1 cells displayed
the lowest β-lactamase activity of 2.7 mU/mg.
Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 15
Figure 3. Production of OMVs isolated from RC85+ and isogenic mutant strains of RC85+ (Δblc1,
ΔompC, and ΔompF). OMVs yields were averaged and normalized to RC85+ to adjust fold change.
OMVs were purified and quantified using the BCA protein assay. Data are representative of three
independent experiments in means ± SEMs. * p < 0.05, and **** p < 0.0001.
2.3. Comparison of β-Lactamase Activity
Differences in β-lactamase activity between OMVs from RC85+ and the mutant strains were
examined, based on a change in absorbance of OD490 over time (Figure 4a). Since nitrocefin can enter
into bacteria through porins, the individual OMVs were destroyed by sonication to remove the
variables for porins in OMVs. This liberates the β-lactamase present in the lumen of the OMVs. The
absorbance obtained for mutant Δblc1 was similar to the negative control, while mutants ΔompC and
ΔompF showed higher levels of absorbance than the positive control and they exhibited similar levels
of β-lactamase activity to that of the RC85+ OMVs over the course of the experiment. The β-lactamase
activity of the respective OMVs was expressed as milliunit per milligram (mU/mg) of OMV protein
(Figure 4b). The β-lactamase activity of ΔompC and ΔompF OMVs was 72.4 mU/mg and 70.3 mU/mg
respectively, nearly identical to those of RC85+ OMVs (64.4 mU/mg). OMVs from Δblc1 cells
displayed the lowest β-lactamase activity of 2.7 mU/mg.
Figure 4. Investigation of the differences in β-lactamase activity between destroyed OMVs from RC85+
and isogenic mutant strains of RC85+ (Δblc1, ΔompC, and ΔompF). (a) β-Lactamase activity profiles
of samples were measured in a kinetic mode in 60 min. Data are representative of three independent
experiments in means ± SEMs. (b) β-Lactamase units were normalized to milligrams of total OMV
protein. The data are presented as means and SEMs of three independent experiments. * p < 0.05, ** p
< 0.01, and **** p < 0.0001.
2.4. Evaluation of the Protective Role of OMVs against β-Lactam Antibiotics
To determine if the loss of porin or β-lactamase proteins from the OMVs influences the
degradation of β-lactam antibiotics, we investigated the effect of OMVs from RC85+ and mutants
(Δblc1, ΔompC, or ΔompF) on the growth of β-lactam susceptible E. coli (RC85) cells in the presence
Figure 4.
Investigation of the differences in
β
-lactamase activity between destroyed OMVs from RC85
+
and isogenic mutant strains of RC85
+
(
∆
blc1,
∆
ompC, and
∆
ompF). (
a
)
β
-Lactamase activity profiles
of samples were measured in a kinetic mode in 60 min. Data are representative of three independent
experiments in means
±
SEMs. (
b
)
β
-Lactamase units were normalized to milligrams of total OMV
protein. The data are presented as means and SEMs of three independent experiments. * p<0.05,
** p<0.01, and **** p<0.0001.
Int. J. Mol. Sci. 2020,21, 2822 5 of 14
2.4. Evaluation of the Protective Role of OMVs against β-Lactam Antibiotics
To determine if the loss of porin or
β
-lactamase proteins from the OMVs influences the degradation
of
β
-lactam antibiotics, we investigated the effect of OMVs from RC85
+
and mutants (
∆
blc1,
∆
ompC, or
∆
ompF) on the growth of
β
-lactam susceptible E. coli (RC85) cells in the presence of a growth-inhibitory
dose of six
β
-lactam antibiotics (Figure 5). When RC85
+
OMVs were mixed with the antibiotics
corresponding to a growth inhibitory concentration for RC85, the cells grew at the same or slower
rate than the positive control (RC85 cells in LB medium without antibiotics). RC85 treated with
OMVs from the
∆
ompC mutant grew in all antibiotics tested, but their growth was slower than the
samples containing RC85
+
OMVs. Furthermore, RC85 incubated with
∆
ompF OMVs grew after 24 h in
cefoperazone and after 18 h in cefazolin, which was slower than that obtained with the
∆
ompC OMVs,
while no growth was detected in the presence of the other four antibiotics (ampicillin, cefotaxime,
amoxicillin, and cefalexin) over the 36 h culture period. On the other hand, RC85 incubated with
∆
blc1
OMVs did not show any growth when each of the six antibiotics was present. After the growth curve
experiment (Figure 5), all samples were plated on nutrient agar with or without each of the antibiotics in
the same concentration as was used in the growth curve experiment (data not shown). If the susceptible
strains of E. coli (RC85) received antibiotic-resistant substances through OMVs during the experiment
in Figure 5, it could grow on nutrient agar containing respective antibiotics. All samples that grew in
the above experiment were grown in nutrient agar but not in nutrient agar with respective antibiotics.
These results demonstrated that the survival rate of RC85 was not due to transfer of
β
-lactam resistant
materials to RC85 by OMVs but was due to molecules owned by OMVs that protected the RC85 from
the antibiotic environment. The colonies grown in nutrient agar were identified as E. coli at the species
level using the MALDI-Biotyper (Bruker Daltonics, Bremen, Germany, data not shown).
Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 6 of 15
of a growth-inhibitory dose of six β-lactam antibiotics (Figure 5). When RC85+ OMVs were mixed
with the antibiotics corresponding to a growth inhibitory concentration for RC85, the cells grew at
the same or slower rate than the positive control (RC85 cells in LB medium without antibiotics). RC85
treated with OMVs from the ΔompC mutant grew in all antibiotics tested, but their growth was
slower than the samples containing RC85+ OMVs. Furthermore, RC85 incubated with ΔompF OMVs
grew after 24 h in cefoperazone and after 18 h in cefazolin, which was slower than that obtained with
the ΔompC OMVs, while no growth was detected in the presence of the other four antibiotics
(ampicillin, cefotaxime, amoxicillin, and cefalexin) over the 36 h culture period. On the other hand,
RC85 incubated with Δblc1 OMVs did not show any growth when each of the six antibiotics was
present. After the growth curve experiment (Figure 5), all samples were plated on nutrient agar with
or without each of the antibiotics in the same concentration as was used in the growth curve
experiment (data not shown). If the susceptible strains of E. coli (RC85) received antibiotic-resistant
substances through OMVs during the experiment in Figure 5, it could grow on nutrient agar
containing respective antibiotics. All samples that grew in the above experiment were grown in
nutrient agar but not in nutrient agar with respective antibiotics. These results demonstrated that the
survival rate of RC85 was not due to transfer of β-lactam resistant materials to RC85 by OMVs but
was due to molecules owned by OMVs that protected the RC85 from the antibiotic environment. The
colonies grown in nutrient agar were identified as E. coli at the species level using the MALDI-
Biotyper (Bruker Daltonics, Bremen, Germany, data not shown).
Figure 5. Growth of β-lactam-susceptible Escherichia coli (RC85) cells in antibiotic-induced growth
inhibition environment to evaluate the antibiotic consumption role of intact OMVs from RC85+ and
isogenic mutant strains. The growth-inhibiting concentrations of β-lactam antibiotics were:
ampicillin, 30 μg/mL; cefotaxime, 1.25 μg/mL; cefoperazone, 4 μg/mL; amoxicillin, 12 μg/mL;
cefazolin, 8 μg/mL; cefalexin, 16 μg/mL. The data are presented as means and SEMs of three
independent experiments.
2.5. Hydrolysis of β-Lactam Antibiotics by OMVs
Concentrations of β-lactam antibiotics were measured at specific time points in a cell-free system
to determine whether β-lactam antibiotics could be hydrolyzed by the OMVs (Figure 6). Compared
with the positive control, containing antibiotics without OMVs (0% hydrolysis), there were
significant differences observed between OMVs from RC85+, Δblc1, ΔompC, and ΔompF in their
ability to degrade the different β-lactam antibiotics tested. With all six β-lactam antibiotics examined,
RC85+ OMVs showed the highest hydrolytic activity, followed by ΔompC then ΔompF OMVs, while
no change in antibiotic concentration was noted with Δblc1 OMVs. These results imply that β-
lactamase is the most important factor in the degradation of β-lactam antibiotics by RC85+ OMVs,
alongside porin, specifically OmpF, which showed higher permeability to all six β-lactam antibiotics
tested when compared to OmpC.
Figure 5.
Growth of
β
-lactam-susceptible Escherichia coli (RC85) cells in antibiotic-induced growth
inhibition environment to evaluate the antibiotic consumption role of intact OMVs from RC85
+
and
isogenic mutant strains. The growth-inhibiting concentrations of
β
-lactam antibiotics were: ampicillin,
30
µ
g/mL; cefotaxime, 1.25
µ
g/mL; cefoperazone, 4
µ
g/mL; amoxicillin, 12
µ
g/mL; cefazolin, 8
µ
g/mL;
cefalexin, 16 µg/mL. The data are presented as means and SEMs of three independent experiments.
2.5. Hydrolysis of β-Lactam Antibiotics by OMVs
Concentrations of
β
-lactam antibiotics were measured at specific time points in a cell-free system
to determine whether
β
-lactam antibiotics could be hydrolyzed by the OMVs (Figure 6). Compared
with the positive control, containing antibiotics without OMVs (0% hydrolysis), there were significant
differences observed between OMVs from RC85
+
,
∆
blc1,
∆
ompC, and
∆
ompF in their ability to degrade
the different
β
-lactam antibiotics tested. With all six
β
-lactam antibiotics examined, RC85
+
OMVs
showed the highest hydrolytic activity, followed by
∆
ompC then
∆
ompF OMVs, while no change
Int. J. Mol. Sci. 2020,21, 2822 6 of 14
in antibiotic concentration was noted with
∆
blc1 OMVs. These results imply that
β
-lactamase is the
most important factor in the degradation of
β
-lactam antibiotics by RC85
+
OMVs, alongside porin,
specifically OmpF, which showed higher permeability to all six
β
-lactam antibiotics tested when
compared to OmpC.
Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 7 of 15
Figure 6. Evaluation of the concentration of β-lactam antibiotics incubated with 5 μg/mL of intact
OMVs from RC85+ and isogenic mutant strains of RC85+ (Δblc1, ΔompC, and ΔompF). The initial
concentrations and certain time points for measurement were as follows: ampicillin, 30 μg/mL, 5 h
(a); cefotaxime, 1.25 μg/mL, 4 h (b); cefoperazone, 4 μg/mL, 3 h (c); amoxicillin, 12 μg/mL, 5 h (d);
cefazolin, 8 μg/mL, 1 h (e); cefalexin, 16 μg/mL, 11 h (f). Respective antibiotics without OMVs were
averaged and normalized as 100%, and the corresponding concentration of antibiotics with OMVs
were calculated. The data are presented as means and SEMs of three independent experiments. The
abbreviation ‘ns’ means not significant. ** p < 0.01, *** p < 0.001 and **** p < 0.0001.
3. Discussion
We previously showed that porin proteins and β-lactamase enzyme are more abundant in OMVs
isolated from β-lactam-resistant E. coli than from β-lactam-susceptible E.coli, and only OMVs from β-
lactam-resistant E. coli were found to degrade β-lactam antibiotics [7]. Therefore, here we were
interested in establishing whether the loss of porin or β-lactamase could directly influence the
hydrolysis efficiency of OMVs, especially since the mechanism by which OMVs degrade β-lactam
antibiotics is unknown. The aim of the present study was to establish what significance β-lactam
antibiotic resistance-associated proteins, such as β-lactamase and porin, had on the production and
activity of β-lactamase, and on the ability of OMVs from E. coli to degrade β-lactam antibiotics. Our
results suggest that it is not the loss of β-lactamase but the loss of porin from the outer membrane of
the OMV that influences the yield of OMVs obtained. The loss of porin does not affect the β-lactamase
activity of OMVs but the loss of β-lactamase dramatically eliminated β-lactamase activity by the
OMVs. Thus, the presence of β-lactamase and porin in the OMVs plays a significant role in the direct
hydrolysis of β-lactam antibiotics.
Many studies have demonstrated that OMVs serve as a defense by the bacterium against
antimicrobial peptides and antibiotics. For instance, OMVs from β-lactam-resistant E. coli plays an
important role in the growth of susceptible bacteria by degrading β-lactam antibiotics before they can
affect the bacteria [7]. OMVs containing β-lactamase enzymes inactivate some β-lactam antibiotics
[7,19,20,27] or sequester some antibiotics [9], both leading to the protection of bacteria against
corresponding antibiotics. OMVs can act as a vehicle for disseminating genetic material, including
antibiotic resistance genes to susceptible bacteria, thereby contributing to the production of
antibiotic-resistant bacteria [18,28,29]. These bacteria can protect susceptible bacteria by serving as
decoys or acting as a physical shield, which helps them to evade the influence of some antibiotics
[7,30–32]. Substances involved in antibiotic resistance are relatively safe from dilution and
Figure 6.
Evaluation of the concentration of
β
-lactam antibiotics incubated with 5
µ
g/mL of intact
OMVs from RC85
+
and isogenic mutant strains of RC85
+
(
∆
blc1,
∆
ompC, and
∆
ompF). The initial
concentrations and certain time points for measurement were as follows: ampicillin, 30
µ
g/mL, 5 h (
a
);
cefotaxime, 1.25
µ
g/mL, 4 h (
b
); cefoperazone, 4
µ
g/mL, 3 h (
c
); amoxicillin, 12
µ
g/mL, 5 h (
d
); cefazolin,
8
µ
g/mL, 1 h (
e
); cefalexin, 16
µ
g/mL, 11 h (
f
). Respective antibiotics without OMVs were averaged and
normalized as 100%, and the corresponding concentration of antibiotics with OMVs were calculated.
The data are presented as means and SEMs of three independent experiments. The abbreviation ‘ns’
means not significant. ** p<0.01, *** p<0.001 and **** p<0.0001.
3. Discussion
We previously showed that porin proteins and
β
-lactamase enzyme are more abundant in
OMVs isolated from
β
-lactam-resistant E. coli than from
β
-lactam-susceptible E.coli, and only OMVs
from
β
-lactam-resistant E. coli were found to degrade
β
-lactam antibiotics [
7
]. Therefore, here we
were interested in establishing whether the loss of porin or
β
-lactamase could directly influence the
hydrolysis efficiency of OMVs, especially since the mechanism by which OMVs degrade
β
-lactam
antibiotics is unknown. The aim of the present study was to establish what significance
β
-lactam
antibiotic resistance-associated proteins, such as
β
-lactamase and porin, had on the production and
activity of
β
-lactamase, and on the ability of OMVs from E. coli to degrade
β
-lactam antibiotics. Our
results suggest that it is not the loss of
β
-lactamase but the loss of porin from the outer membrane of
the OMV that influences the yield of OMVs obtained. The loss of porin does not affect the
β
-lactamase
activity of OMVs but the loss of
β
-lactamase dramatically eliminated
β
-lactamase activity by the
OMVs. Thus, the presence of
β
-lactamase and porin in the OMVs plays a significant role in the direct
hydrolysis of β-lactam antibiotics.
Many studies have demonstrated that OMVs serve as a defense by the bacterium against
antimicrobial peptides and antibiotics. For instance, OMVs from
β
-lactam-resistant E. coli plays
an important role in the growth of susceptible bacteria by degrading
β
-lactam antibiotics before
they can affect the bacteria [
7
]. OMVs containing
β
-lactamase enzymes inactivate some
β
-lactam
Int. J. Mol. Sci. 2020,21, 2822 7 of 14
antibiotics [7,19,20,27]
or sequester some antibiotics [
9
], both leading to the protection of bacteria
against corresponding antibiotics. OMVs can act as a vehicle for disseminating genetic material,
including antibiotic resistance genes to susceptible bacteria, thereby contributing to the production of
antibiotic-resistant bacteria [
18
,
28
,
29
]. These bacteria can protect susceptible bacteria by serving
as decoys or acting as a physical shield, which helps them to evade the influence of some
antibiotics [7,30–32].
Substances involved in antibiotic resistance are relatively safe from dilution
and degradation because they are packed safely inside the OMVs [
33
]. Our results show that
OMVs from RC85
+
directly degrade
β
-lactam antibiotics to protect sensitive strains from antibiotic
environments (Figures 5and 6).
Several studies have demonstrated that the loss of porins from the bacterial outer membrane can
impact the production of OMVs. For example, Mcbroom et al. (2006) indicated that relative OMV
production from an E.coli ompC mutant was significantly enhanced by almost 10-fold compared to
the wild-type E.coli [
34
]. A deletion in ompA, encoding an outer membrane
β
-barrel protein with
a periplasmic peptidoglycan-interaction domain resulted in a 26-fold hypervesiculation in E. coli
mutant [
35
]. Valeru et al. (2014) showed a 3-fold increase in the level of production of OMVs by
an OmpA mutant of Vibrio cholerae compared to the wild-type [
36
]. In line with these findings, our
results showed that a lack of porins enhances the release of OMVs (Figure 3). The E. coli cells lacking
porin proteins in their outer membrane (OmpC and OmpF) showed instability, with increased OMVs
production due to a structural deficiency of the outer membrane [
37
]. Therefore, we speculate that
a loss of porins alters the composition of the envelope membrane, which in turn affects membrane
integrity, leading to enhanced secretion of OMVs.
β
-lactam antibiotics are widely used antibiotics that are highly effective in combating bacterial
infections [
38
]. These include penicillin derivatives, cephalosporins, monobactams, and carbapenems,
and work by inhibiting cell wall biosynthesis, causing bactericidal effects for the bacteria. E. coli has
developed four major mechanisms to resist the inhibitory effect of
β
-lactam antibiotics: inactivation
of the antibiotics by enzymes, alteration of the active site of PBPs (penicillin-binding proteins),
decreased permeation of the antibiotics and increased efflux of the antibiotics [
39
,
40
].
β
-lactamases in
the periplasmic space break the structure of the
β
-lactam ring, making the molecule’s antibacterial
properties inactive so that antibiotics are unable to bind to PBPs [
41
]. Porin proteins produce
transmembrane diffusion channels in the outer membrane that enable the diffusion of small hydrophilic
molecules (e.g., sugars, amino acids, and vitamins) and
β
-lactam antibiotics to penetrate into the
periplasmic space [42–44].
An observed decreased in the resistance of the
β
-lactamase mutants to
β
-lactam antibiotics
compared with the wild-type was due to reduced
β
-lactamase activity [
45
,
46
]. Previous studies
revealed that OmpC seems to be related to the transport of some
β
-lactam antibiotics [
47
–
50
]. Choi
and Lee (2019) demonstrated that the OmpF-defective E. coli mutants showed increased resistance
to several
β
-lactam antibiotics, such as ampicillin, cefalotin, cefoxitin, ceftazidime, aztreonam, and
imipenem [
47
]. The absence of OmpF classical porin resulted in a significant increase in
β
-lactam
resistance, including ampicillin and cefoxitin [
51
]. Our findings corroborate previous reports that the
MIC against several
β
-lactam antibiotics was decreased or increased in single isogenic
β
-lactamase
or porin mutants, respectively (Table 1). Based on the available data, we speculate that the change
seen in MIC can be attributed to the reduced degradation of
β
-lactam antibiotics because of a lack of
β-lactamase activity or decreased permeability of β-lactam antibiotics due to the absence of porin.
OmpC and OmpF are considered as the leading transport porins that assist penetration of most
β
-lactam antibiotics [
47
,
51
–
53
], and both porins are known to be major protein components of E. coli
OMVs [
54
]. Diffusion rates through these channels differ according to a substance’s molecular weight
and electrical charge [
48
,
55
]. Chemicals with hydrophilic molecules up to 600–700 Da in size can
generally pass through the porin pores [
56
]. Among the six
β
-lactam antibiotics tested here (Figures 5
and 6), ampicillin with the lowest molecular weight (349 Da) and cefoperazone with the highest
(645 Da) were able to penetrate the pores of the OMVs. Compounds with one negative charged group
Int. J. Mol. Sci. 2020,21, 2822 8 of 14
(monoanionic compounds) penetrate porin channels faster than zwitterionic compounds [55]. Of the
antibiotics tested, cefotaxime, cefoperazone, and cefazolin are monoanionic compounds and ampicillin,
amoxicillin, and cefalexin are zwitterionic compounds.
The OmpF porin allows more efficient permeation of solute molecules than the OmpC porin
channel in terms of the size of the channel, in particular, OmpF channel is 7% to 9% larger than
that of the OmpC channel [
48
]. The OmpC porin showed a notably lower influx of ampicillin and
benzylpenicillin than OmpF in E. coli because of the greater number of charged residues in the OmpC
channel than in that of OmpF [
50
], and the lack of OmpF undoubtedly affects the efficiency of
β
-lactam
hyposensitivity compared with the loss of OmpC [
51
]. As shown in previous studies, the hydrolysis
rate of
∆
OmpF OMVs was found to be lower than that of
∆
OmpC OMVs against
β
-lactam antibiotics
(Figure 6). As a result, when respective OMVs were added to susceptible E. coli in the presence of
antibiotics, the group treated with
∆
OmpC OMVs grew faster than the group treated with
∆
OmpF
OMVs (Figure 5). Moya-Torres et al. (2014) demonstrated that the deletion of ompC or ompF showed
almost the same production of
β
-lactamase compared with the wild-type [
51
]. The lack of OmpF or
OmpC did not induce intrinsic
β
-lactamase activity by the OMVs (Figure 4), indicating that the reduced
hydrolysis efficiency of
β
-lactam antibiotics by OMVs was a result of the decreased permeability of
β
-lactam antibiotics due to loss of the porins (Figures 5and 6). Thus, our results indicate the crucial
role of the porins in modulating the uptake of several
β
-lactam antibiotics into the lumen of OMVs,
specifically, the influx of antibiotics is more efficient in the OmpF porin channel than the OmpC
porin channel.
In summary, OMVs are important vehicles for substances related to
β
-lactam resistance, which
help protect susceptible bacteria in the presence of
β
-lactam antibiotics. The mechanism of hydrolysis
by OMVs against
β
-lactam antibiotics is not simply a one-protein effect, but rather an interaction
between the
β
-lactamase in the lumen of OMVs and the porins on the surface of OMVs. The porin
transports
β
-lactam antibiotics into the lumen of OMVs and
β
-lactamase in the lumen plays a key role
in the direct degradation of the antibiotic. Our observation helps to elucidate the interaction of porins
and
β
-lactamase in OMVs and increases our understanding of the resistance mechanisms found in
multi-drug resistant bacteria.
4. Materials and Methods
4.1. Bacterial Strains
Antimicrobial-sensitive E. coli RC85 [
7
], antimicrobial-resistant E. coli RC85
+
[
7
], and mutant
RC85
+
were used in this study. Bacteria were grown in Luria-Bertani (LB; Oxoid, Hampshire,
UK) broth or LB agar. Broth cultures were grown at 37
◦
C with orbital shaking. Growth was
monitored by measuring absorbance at 600 nm (OD
600
) using an xMark microplate spectrophotometer
(Bio-Rad, München, Germany).
4.2. Molecular Cloning and Mutant Construction
Plasmid pRed/ET (amp) was obtained from the “Quick & Easy E. coli Gene deletion Kit”
(Gene Bridges, Heidelberg, Germany) and the chloramphenicol resistance gene (Cm
R
) was amplified
from pKINGeo/ccdB, which was designed in our laboratory [
57
]. An FRT-flanked, pro- and
eukaryotic hygromycin selection cassette was obtained from “FRT-PGK-gb2-hygro-FRT template
DNA” (Gene Bridges). The oligonucleotides (BIONEER, Daejeon, Korea) used in this study are listed
in Table 2and Table S1. The pRed/ET (amp) vector was modified by inserting the Cm
R
gene as
a selection marker, because
β
-lactam-resistant E. coli RC85
+
is resistant to ampicillin. Fragments 1
and 3 were amplified from pRed/ET (amp), while fragment 2 was amplified from pKINGeo/ccdB
(Table S1). Another round of PCR was performed to combine fragments 2 and 3 using respective
primers, and the resulting amplicons were used as a template for the last round of amplification
to attach fragment 1. The final DNA fragment flanked by Sac I and EcoRV was digested with Sac
Int. J. Mol. Sci. 2020,21, 2822 9 of 14
I/EcoRV and ligated into the Sac I/Msc I sites of pRed/ET (amp), forming the pRed/ET (Cm
R
). The
“Quick & Easy E. coli Gene Deletion Kit” was used to construct the gene deletion mutant strains
according to the manufacturer’s protocol, with some modifications [
58
]. The pRed/ET (Cm
R
) expression
plasmid was transformed into the E. coli strain RC85
+
by electroporation (Bio-Rad MicroPulser) at
1800 V with a 4 ms pulse rate. Transformants (RC85
+
+pRedET) were selected on LB agar containing
35
µ
g/mL chloramphenicol (Sigma-Aldrich, USA) and grown overnight at 30
◦
C. A bacterial colony was
selected from the plate and cultured in LB medium containing 35
µ
g/mL chloramphenicol overnight
at 30
◦
C. Transformant cultures were re-incubated in super optimal broth (SOB) conditioned with
L-arabinose (Sigma-Aldrich, St. Louis, MO, USA) at a final concentration of 0.3% (w/v) at 37
◦
C until
an OD
600
of 0.2 was obtained to induce pRedET. Induced cells were harvested by centrifugation for
30 sec at 16,000
×
gin a cooled microfuge benchtop centrifuge and re-suspended in chilled 10% (v/v)
glycerol. This process was repeated five times before electroporation. Competent RC85
+
cells were
mixed with generated hygromycin cassettes flanked by homology arms to replace the DNA fragment
(Table S1). Electroporation was performed with a Micropulser (Bio-Rad) delivering 1800 V for 4 ms.
Electroporated transformants were immediately removed from the cuvettes by mixing with 1 mL LB
medium without antibiotics and incubated at 37
◦
C for 3 h for recombination. Recombinant colonies
were grown on LB agar containing 500
µ
g/mL hygromycin (Sigma-Aldrich) overnight at 37
◦
C for
selection. Gene deletion mutants were confirmed through colony PCR using the sequencing primers
(Table 2). PCR products were visualized on a 1% agarose gel and the band size was confirmed by
comparing with the non-mutant E. coli (RC85
+
). Colonies from gene deletion mutants were identified
by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS;
Bruker Daltonik, Bremen, Germany) [59] to confirm that they were indeed E. coli.
Table 2. Oligonucleotide sequence of primers and PCR product sizes.
Primer Oligonucleotide Sequence (50to 30) Target Gene Fragment Size (bp)
blc1-F CTGGGTGTGGCATTGATTAAC blc1 374
blc1-R TAACGTCGGCTCGGTACG
ompC-F ATGAAAGTTAAAGTACTGTCCCTC ompC 1103
ompC-R TTAGAACTGGTAAACCAGACCC
ompF-F CTGACCGGTTATGGTCAGTG ompF 599
ompF-R CGTTTTGTTGGCGAAGCC
4.3. Analysis of Antibiotic Resistance
Minimum inhibitory concentration (MIC) values were used to compare relative resistance levels
of mutant strains to those of RC85
+
. Eight
β
-lactam antibiotics, namely amoxicillin, ampicillin,
cefalexin, cefazolin, cefoperazone, cefotaxime, cloxacillin, and methicillin (Sigma-Aldrich) and five
other classes of antibiotics, including amikacin, colistin, kanamycin, nalidixic acid, and streptomycin
(Sigma-Aldrich) were selected for this. The MIC of each antimicrobial agent was determined using the
broth-dilution method in 96-well plates [
60
] according to Clinical and Laboratory Standards Institute
(CLSI) guidelines, except that cation-adjusted Muller Hinton broth was substituted with LB. The listed
MIC values were presented as the mean of three independent experiments.
4.4. Isolation of Pure OMVs
Purification of OMVs was performed as previously described [
7
]. Briefly, the bacteria culture was
centrifuged at 6000
×
gfor 20 min, and the supernatant was filtered through 0.45-
µ
m pore-sized vacuum
filters. The filtered supernatant was concentrated by ultrafiltration using a QuixStand Benchtop system
(GE Healthcare, Uppsala, Sweden). This was then centrifuged at 150,000
×
gat 4
◦
C for 3 h, and the
OMVs purified on a continuous sucrose density gradient at 120,000
×
gat 4
◦
C for 18 h. The OMV
band was removed and centrifuged for 3 h at 150,000
×
gat 4
◦
C. The final OMV pellet was washed
and resuspended in 10 mM Tris-HCl (pH 8.0) and filtered through a 0.2-
µ
m filter. All purification
Int. J. Mol. Sci. 2020,21, 2822 10 of 14
steps were performed at 4
◦
C. The protein yields of OMV samples were measured using a Pierce BCA
protein assay kit (Thermo Fisher Scientific, Foster City, CA, USA). Transmission electron microscopy
(TEM) of OMVs was performed as previously described [
7
] using a Tecnai G2 Spirit Twin TEM system
(FEI, Hillsboro, OR, USA). Dynamic light scattering (DLS) of OMVs for particle size distribution was
performed as described previously [
7
] using a Nano ZS instrument (Malvern Instruments, Malvern,
UK) and the Zetasizer software (version 7.11; Malvern Instruments).
4.5. Effect of OMVs on the Growth of Bacteria in the Presence of β-Lactam Antibiotics
The effect of OMVs on the growth of bacteria in the presence of
β
-lactam antibiotics was performed
as previously described with slight modifications [
7
]. The effect of OMVs from RC85
+
,
∆
blc1 RC85
+
,
∆
ompC RC85
+
, and
∆
ompF RC85
+
cells on the cytotoxicity of
β
-lactam antibiotics was monitored
by assessing the growth of OMV-treated RC85 cells. The
β
-lactam antibiotics used were: penicillin
family (ampicillin and amoxicillin), first-generation cephalosporin (cefazolin and cefalexin), and the
third-generation cephalosporin (cefotaxime and cefoperazone). The following six antibiotics were
used at concentrations known to inhibit RC85 growth: ampicillin, 30
µ
g/mL; cefotaxime, 1.25
µ
g/mL;
cefoperazone, 4 µg/mL; amoxicillin, 12 µg/mL; cefazolin, 8 µg/mL; and cefalexin, 16 µg/mL. The MIC
of
β
-lactam antibiotics against the RC85 were listed in Table S2. Cultured RC85 cells (5
×
10
5
CFU/mL)
were inoculated into medium containing one of these antibiotics and 5 µg/mL of the respective OMV
sample. RC85 in the antibiotic-free medium was used as a positive control, while the negative control
consisted of bacteria and growth-inhibitory concentrations of the respective antibiotics. All tubes were
incubated at 37
◦
C with shaking at 150 rpm. All experiments were performed in the dark to exclude
the effect of light on the stability of the antibiotics used. The bacterial growth curves at OD
600
were
recorded at 3-h intervals up to 36 h using an xMark microplate spectrophotometer. Experiments were
performed using three independent sets of bacterial cultures. The bacterial cultures were inoculated
onto TSA with or without the respective same concentrations of antibiotics to confirm whether the
susceptible bacteria could survive by antibiotic-resistant gene transfer via OMVs. Colonies from each
cultured sample (n=5, colonies per sample) on TSA without antibiotics were randomly selected and
identified by MALDI Biotyper [59] to check contamination by other bacteria.
4.6. Quantification of β-Lactamase Activity
To test the differences in
β
-lactamase activity between OMVs from RC85
+
and mutant strains, a
colorimetric
β
-lactamase activity assay kit (BioVision, New Minas, NS, Canada) was used according to
the manufacturer’s instructions. The assay is based on the hydrolysis of nitrocefin, a chromogenic
cephalosporin producing a colored product that can be measured spectrophotometrically (OD
490
). A
buffer of 10 mM Tris-HCl (pH 8.0) was used as a negative control and lyophilized positive control
included in the kit was used. The quantity of enzyme capable of hydrolyzing 1.0
µ
M of nitrocefin/min
at 25
◦
C corresponds to 1 U of
β
-lactamase. To liberate
β
-lactamase from the lumen of OMVs, each
obtained OMVs were sonicated from 5 min (the effective sonication time on release
β
-lactamase from
E. coli) [
61
], cooled on ice for 5 min [
62
], and centrifuged at 16,000
×
gat 4
◦
C for 20 min. Equal
concentrations of each OMV sample (2.5
µ
g) were dispensed into the wells of a clear flat-bottomed
96-well, and nitrocefin and buffer (provided in the kit) were added to make a final volume of 100
µ
L.
The absorbance at OD
490
was immediately measured in kinetic mode for 60 min at 25
◦
C. For all
measurements, three independent experiments were performed. A standard curve was generated
using 0, 4, 8, 12, 16, and 20 nmol of nitrocefin, and the specific
β
-lactamase activity of each sample was
expressed in milliunits/milligram of protein.
4.7. Measurement of Antibiotic Concentrations
Measurement of
β
-lactam antibiotic concentrations was carried out as previously described [
7
],
with slight modifications. The effect of OMVs from RC85
+
and mutants on the degradation of the six
antibiotics listed above in a cell-free system were analyzed by liquid chromatography/electrospray
Int. J. Mol. Sci. 2020,21, 2822 11 of 14
ionization mass spectrometry (LC-ESI-QQQ-MS/MS; 6420 Triple Quad LC/MS; Agilent, Waldbronn,
Germany). A 5
µ
g/mL sample of respective OMV in PBS was mixed with ampicillin (30
µ
g/mL),
cefotaxime (1.25
µ
g/mL), cefoperazone (4
µ
g/mL), amoxicillin (12
µ
g/mL), cefazolin (8
µ
g/mL), or
cefalexin (16
µ
g/mL). Filtered PBS containing the respective antibiotics without OMVs was used as a
positive control. All samples were incubated at 37
◦
C with shaking at 150 rpm and diluted 20-fold prior
to analysis. The concentrations of antibiotics were recorded at specific time points (
ampicillin; 5 h
,
cefotaxime; 4 h, cefoperazone; 3 h, amoxicillin; 5 h, cefazolin; 1 h, and cefalexin; 11 h) in triplicate.
For LC-MS/MS, LC-MS grade water (Burdick & Jackson, Muskegon, MI, USA) containing 5 mM
ammonium formate (Sigma-Aldrich) and 0.1% formic acid (KANTO, Tokyo, Japan) (v/v) (solution A)
and LC grade methanol (Burdick & Jackson) containing 5 mM ammonium formate with 0.1% formic
acid (v/v) (solution B) were used as the mobile phase, at an initial A:B ratio of 30:70 or 50:50, depending
on the antibiotic of interest. The compounds were separated using a Poroshell 120 EC-C18 column
(2.1
×
100 mm, 2.7
µ
m; Agilent). Isocratic elution with phases A and B was followed by 3 min of
total chromatography. The flow rate was 0.2 mL/min, the column temperature was 30
◦
C, and 99.99%
pure nitrogen gas was used for desolvation. For the quantification of antibiotics, at least two or more
transitions were selected for each analyte and the positive electric spray ionization (ESI+) was used
with the multiple reaction monitoring (MRM) mode. The MassHunter software (version B.06.00;
Agilent) was used to process the LC-MS/MS data and quantification of the analytes.
4.8. Statistical Analysis
Statistical analysis was performed using Graphpad Prism, version 8.1.1. (GraphPad, CA, USA).
Significant differences were determined by One-way Analysis of Variance (ANOVA). Data are presented
as mean ±standard deviation (SD). The difference was considered statistically significant at p<0.05.
4.9. Data Availability
All data generated or analyzed during this study are included in this published article and its
Supplementary files.
Supplementary Materials:
Supplementary materials can be found at http://www.mdpi.com/1422-0067/21/8/2822/s1.
Author Contributions:
Conceptualization, S.W.K., J.S.L., C.-R.L., and T.S.J.; Data curation, S.W.K., J.S.L., S.B.P.,
A.R.L., J.W.J., J.H.C., J.M.S.L., J.K., and T.S.J.; Formal analysis, S.B.P., A.R.L., J.H.C., J.-S.S., J.-H.K., and J.-W.S.;
Investigation, S.W.K., A.R.L., J.W.J., and J.K.; Supervision, T.S.J.; Validation, M.J., and T.S.J.; Visualization, M.W.H.;
Writing—original draft, S.W.K., and J.M.S.L.; Writing—review & editing, S.W.K., S.B.P., K.D.T., C.-R.L., and T.S.J.
All authors have read and agreed to the published version of the manuscript.
Funding:
This research was funded by Ministry of Food and Drug Safety in 2020, grant number 19162MFDS563.
Conflicts of Interest: The authors declare no conflict interest.
References
1.
Nazir, T.; Abraham, S.; Islam, A. Emergence of potential superbug Mycobacterium tuberculosis, lessons from
New Delhi mutant-1 bacterial strains. Int. J. Health Sci. 2012,6, 87. [CrossRef]
2. Singh, S. Irrational use of antimicrobial agents. JDR Clin. Trans. Res. 2018,2, 1–2. [CrossRef]
3.
Antimicrobial Resistance: Tackling a Crisis for the Health and Wealth of Nations. Review on Antimicrobial
Resistance: Chaired by Jim O’Neill. 2014. Available online: http://amr-review.org/Publications (accessed on
1 September 2015).
4.
Centers for Disease Control and Prevention. Antibiotic resistance threats in the United States, 2013; Centres for
Disease Control and Prevention: Atlanta, GA, USA, 2013.
5.
Antimicrobial Resistance: Tackling Drug-Resistant Infections Globally: Final Report and Recommendations.
Chaired by Jim O’Neill. 2016. Available online: http://amr-review.org/sites/default/files/160518_Final%
20paper_with%20cover.pdf (accessed on 27 March 2017).
6.
Lammie, S.L.; Hughes, J.M. Antimicrobial resistance, food safety, and one health: The need for convergence.
Annu. Rev. Food Sci. Technol. 2016,7, 287–312. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2020,21, 2822 12 of 14
7.
Kim, S.W.; Park, S.B.; Im, S.P.; Lee, J.S.; Jung, J.W.; Gong, T.W.; Lazarte, J.M.S.; Kim, J.; Seo, J.-S.; Kim, J.-H.
Outer membrane vesicles from
β
-lactam-resistant Escherichia coli enable the survival of
β
-lactam-susceptible
E. coli in the presence of β-lactam antibiotics. Sci. Rep. 2018,8, 5402. [CrossRef] [PubMed]
8.
Beveridge, T.J. Structures of gram-negative cell walls and their derived membrane vesicles. J. Bacteriol.
1999
,
181, 4725–4733. [CrossRef]
9.
Kulkarni, H.M.; Nagaraj, R.; Jagannadham, M.V. Protective role of E. coli outer membrane vesicles against
antibiotics. Microbiol. Res. 2015,181, 1–7. [CrossRef]
10.
Turner, K.L.; Cahill, B.K.; Dilello, S.K.; Gutel, D.; Brunson, D.N.; Albert
í
, S.; Ellis, T.N. Porin loss impacts
the host inflammatory response to outer membrane vesicles of Klebsiella pneumoniae.Antimicrob. Agents
Chemother. 2016,60, 1360–1369. [CrossRef]
11.
Schooling, S.R.; Beveridge, T.J. Membrane vesicles: An overlooked component of the matrices of biofilms.
J. Bacteriol. 2006,188, 5945–5957. [CrossRef]
12.
Kulp, A.; Kuehn, M.J. Biological functions and biogenesis of secreted bacterial outer membrane vesicles.
Annu. Rev. Microbiol. 2010,64, 163–184. [CrossRef]
13.
Yaron, S.; Kolling, G.L.; Simon, L.; Matthews, K.R. Vesicle-mediated transfer of virulence genes from
Escherichia coli O157: H7 to other enteric bacteria. Appl. Environ. Microbiol. 2000,66, 4414–4420. [CrossRef]
14.
Kwon, S.-O.; Gho, Y.S.; Lee, J.C.; Kim, S.I. Proteome analysis of outer membrane vesicles from a clinical
Acinetobacter baumannii isolate. FEMS Microbiol. Lett. 2009,297, 150–156. [CrossRef] [PubMed]
15.
Mashburn, L.M.; Whiteley, M. Membrane vesicles traffic signals and facilitate group activities in a prokaryote.
Nature 2005,437, 422. [CrossRef] [PubMed]
16.
Schertzer, J.W.; Whiteley, M. Bacterial outer membrane vesicles in trafficking, communication and the
host-pathogen interaction. J. Mol. Microbiol. Biotechnol. 2013,23, 118–130. [CrossRef] [PubMed]
17.
Deatherage, B.L.; Cookson, B.T. Membrane vesicle release in bacteria, eukaryotes, and archaea: A conserved
yet underappreciated aspect of microbial life. Infect. Immun. 2012,80, 1948–1957. [CrossRef]
18.
Rumbo, C.; Fern
á
ndez-Moreira, E.; Merino, M.; Poza, M.; Mendez, J.A.; Soares, N.C.; Mosquera, A.;
Chaves, F.; Bou, G. Horizontal transfer of the OXA-24 carbapenemase gene via outer membrane vesicles: A
new mechanism of dissemination of carbapenem resistance genes in Acinetobacter baumannii.Antimicrob.
Agents Chemother. 2011,55, 3084–3090. [CrossRef]
19.
Lee, J.; Lee, E.-Y.; Kim, S.-H.; Kim, D.-K.; Park, K.-S.; Kim, K.P.; Kim, Y.-K.; Roh, T.-Y.; Gho, Y.S. Staphylococcus
aureus extracellular vesicles carry biologically active
β
-lactamase. Antimicrob. Agents Chemother.
2013
,57,
2589–2595. [CrossRef]
20.
Schaar, V.; Nordström, T.; Mörgelin, M.; Riesbeck, K. Moraxella catarrhalis outer membrane vesicles carry
β
-lactamase and promote survival of Streptococcus pneumoniae and Haemophilus influenzae by inactivating
amoxicillin. Antimicrob. Agents Chemother. 2011,55, 3845–3853. [CrossRef]
21.
Kulkarni, H.M.; Swamy, C.V.; Jagannadham, M.V. Molecular characterization and functional analysis of
outer membrane vesicles from the antarctic bacterium Pseudomonas syringae suggest a possible response to
environmental conditions. J. Proteome Res. 2014,13, 1345–1358. [CrossRef]
22.
Doumith, M.; Ellington, M.J.; Livermore, D.M.; Woodford, N. Molecular mechanisms disrupting porin
expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK. J. Antimicrob.
Chemother. 2009,63, 659–667. [CrossRef]
23.
Bavoil, P.; Nikaido, H.; von Meyenburg, K. Pleiotropic transport mutants of Escherichia coli lack porin, a major
outer membrane protein. Mol. Gen. Genet. 1977,158, 23–33. [CrossRef]
24.
Nikaido, H.; Song, S.A.; Shaltiel, L.; Nurminen, M. Outer membrane of Salmonella XIV. Reduced
transmembrane diffusion rates in porin-deficient mutants. Biochem. Biophys. Res. Commun.
1977
,76,
324–330. [CrossRef]
25.
Pag
è
s, J.-M.; James, C.E.; Winterhalter, M. The porin and the permeating antibiotic: A selective diffusion
barrier in Gram-negative bacteria. Nat. Rev. Microbiol. 2008,6, 893. [CrossRef] [PubMed]
26.
Lamers, R.P.; Nguyen, U.T.; Nguyen, Y.; Buensuceso, R.N.; Burrows, L.L. Loss of membrane-bound lytic
transglycosylases increases outer membrane permeability and
β
-lactam sensitivity in Pseudomonas aeruginosa.
Microbiologyopen 2015,4, 879–895. [CrossRef] [PubMed]
27.
Schaar, V.; Paulsson, M.; Mörgelin, M.; Riesbeck, K. Outer membrane vesicles shield Moraxella catarrhalis
β-lactamase from neutralization by serum IgG. J. Antimicrob. Chemother. 2012,68, 593–600. [CrossRef]
Int. J. Mol. Sci. 2020,21, 2822 13 of 14
28.
Fulsundar, S.; Harms, K.; Flaten, G.E.; Johnsen, P.J.; Chopade, B.A.; Nielsen, K.M. Gene transfer potential of
outer membrane vesicles of Acinetobacter baylyi and effects of stress on vesiculation. Appl. Environ. Microbiol.
2014,80, 3469–3483. [CrossRef]
29.
Renelli, M.; Matias, V.; Lo, R.Y.; Beveridge, T.J. DNA-containing membrane vesicles of Pseudomonas aeruginosa
PAO1 and their genetic transformation potential. Microbiology 2004,150, 2161–2169. [CrossRef]
30.
Schwechheimer, C.; Kuehn, M.J. Outer-membrane vesicles from Gram-negative bacteria: Biogenesis and
functions. Nat. Rev. Microbiol. 2015,13, 605. [CrossRef]
31.
Manning, A.J.; Kuehn, M.J. Contribution of bacterial outer membrane vesicles to innate bacterial defense.
BMC Microbiol. 2011,11, 258. [CrossRef]
32.
Andreoni, F.; Toyofuku, M.; Menzi, C.; Kalawong, R.; Shambat, S.M.; François, P.; Zinkernagel, A.S.; Eberl, L.
Antibiotics stimulate formation of vesicles in Staphylococcus aureus in both phage-dependent and-independent
fashions and via different routes. Antimicrob. Agents Chemother. 2019,63, e01439-18. [CrossRef]
33.
Quan, K.; Zhu, Z.; Cao, S.; Zhang, F.; Miao, C.; Wen, X.; Huang, X.; Wen, Y.; Wu, R.; Yan, Q. Escherichia
coli-derived outer membrane vesicles deliver galactose-1-phosphate uridyltransferase and yield partial
protection against Actinobacillus pleuropneumoniae in mice. J. Microbiol. Biotechnol.
2018
,28, 2095–2105.
[CrossRef]
34.
McBroom, A.J.; Johnson, A.P.; Vemulapalli, S.; Kuehn, M.J. Outer membrane vesicle production by Escherichia
coli is independent of membrane instability. J. Bacteriol. 2006,188, 5385–5392. [CrossRef] [PubMed]
35.
Schwechheimer, C.; Kulp, A.; Kuehn, M.J. Modulation of bacterial outer membrane vesicle production by
envelope structure and content. BMC Microbiol. 2014,14, 324. [CrossRef] [PubMed]
36. Valeru, S.P.; Shanan, S.; Alossimi, H.; Saeed, A.; Sandström, G.; Abd, H. Lack of outer membrane protein A
enhances the release of outer membrane vesicles and survival of Vibrio cholerae and suppresses viability of
Acanthamoeba castellanii.Int. J. Microbiol. 2014,2014, 610190. [CrossRef] [PubMed]
37.
Nogami, T.; Mizushima, S. Outer membrane porins are important in maintenance of the surface structure of
Escherichia coli cells. J. Bacteriol. 1983,156, 402–408. [CrossRef] [PubMed]
38.
Holten, K.B. Appropriate prescribing of oral beta-lactam antibiotics. Am. Fam. Physician
2000
,62, 611–620.
[PubMed]
39.
Jaffe, A.; Chabbert, Y.A.; Semonin, O. Role of porin proteins OmpF and OmpC in the permeation of
beta-lactams. Antimicrob. Agents Chemother. 1982,22, 942–948. [CrossRef]
40.
Drawz, S.M.; Bonomo, R.A. Three decades of
β
-lactamase inhibitors. Clin. Microbiol. Rev.
2010
,23, 160–201.
[CrossRef]
41.
Davies, J. Inactivation of antibiotics and the dissemination of resistance genes. Science
1994
,264, 375–382.
[CrossRef]
42.
Nikaido, H.; Nakae, T. The outer membrane of Gram-negative bacteria. In Advances in Microbial Physiology;
Elsevier: Amsterdam, The Netherlands, 1980; Volume 20, pp. 163–250.
43.
Nakae, T. Outer membrane of Salmonella. Isolation of protein complex that produces transmembrane
channels. J. Biol. Chem. 1976,251, 2176–2178.
44.
Nikaido, H. Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol. Biol. Rev.
2003,67, 593–656. [CrossRef]
45.
Wang, X.; Minasov, G.; Shoichet, B.K. Evolution of an antibiotic resistance enzyme constrained by stability
and activity trade-offs. J. Mol. Biol. 2002,320, 85–95. [CrossRef]
46.
Hwang, J.; Cho, K.-H.; Song, H.; Yi, H.; Kim, H.S. Deletion mutations conferring substrate spectrum extension
in the class A β-lactamase. Antimicrob. Agents Chemother. 2014,58, 6265–6269. [CrossRef] [PubMed]
47.
Choi, U.; Lee, C.-R. Distinct roles of outer membrane porins in antibiotic resistance and membrane integrity
in Escherichia coli.Front. Microbiol. 2019,10, 953. [CrossRef] [PubMed]
48.
Nikaido, H.; Rosenberg, E.; Foulds, J. Porin channels in Escherichia coli: Studies with beta-lactams in intact
cells. J. Bacteriol. 1983,153, 232–240. [CrossRef]
49.
Lou, H.; Chen, M.; Black, S.S.; Bushell, S.R.; Ceccarelli, M.; Mach, T.; Beis, K.; Low, A.S.; Bamford, V.A.;
Booth, I.R. Altered antibiotic transport in OmpC mutants isolated from a series of clinical strains of multi-drug
resistant E. coli.PLoS ONE 2011,6, e25825. [CrossRef]
50.
Kojima, S.; Nikaido, H. High salt concentrations increase permeability through OmpC channels of Escherichia
coli.J. Biol. Chem. 2014,289, 26464–26473. [CrossRef]
Int. J. Mol. Sci. 2020,21, 2822 14 of 14
51.
Moya-Torres, A.; Mulvey, M.R.; Kumar, A.; Oresnik, I.J.; Brassinga, A.K.C. The lack of OmpF, but not
OmpC, contributes to increased antibiotic resistance in Serratia marcescens.Microbiology
2014
,160, 1882–1892.
[CrossRef]
52.
Dutzler, R.; Rummel, G.; Albert
í
, S.; Hern
á
ndez-All
é
s, S.; Phale, P.; Rosenbusch, J.; Benedi, V.; Schirmer, T.
Crystal structure and functional characterization of OmpK36, the osmoporin of Klebsiella pneumoniae.Structure
1999,7, 425–434. [CrossRef]
53.
Delcour, A.H. Outer membrane permeability and antibiotic resistance. Biochim Biophys Acta Proteins Proteom
2009,1794, 808–816. [CrossRef]
54.
Lee, E.Y.; Bang, J.Y.; Park, G.W.; Choi, D.S.; Kang, J.S.; Kim, H.J.; Park, K.S.; Lee, J.O.; Kim, Y.K.; Kwon, K.H.
Global proteomic profiling of native outer membrane vesicles derived from Escherichia coli.Proteomics
2007
,
7, 3143–3153. [CrossRef]
55.
Yoshimura, F.; Nikaido, H. Diffusion of beta-lactam antibiotics through the porin channels of Escherichia coli
K-12. Antimicrob. Agents Chemother. 1985,27, 84–92. [CrossRef] [PubMed]
56.
Franklin, T.J.; Snow, G.A. Biochemistry and Molecular Biology of Antimicrobial Drug Action; Springer Science &
Business Media: Berlin/Heidelberg, Germany, 2005.
57.
Kim, J.; Im, S.P.; Lee, J.S.; Lazarte, J.M.S.; Kim, S.W.; Jung, J.W.; Kim, J.Y.; Kim, Y.R.; Lee, S.; Kim, G.J.
Globular-shaped variable lymphocyte receptors B antibody multimerized by a hydrophobic clustering in
hagfish. Sci. Rep. 2018,8, 10801. [CrossRef] [PubMed]
58.
Heermann, R.; Zeppenfeld, T.; Jung, K. Simple generation of site-directed point mutations in the Escherichia
coli chromosome using Red®/ET®Recombination. Microb. Cell Fact. 2008,7, 14. [CrossRef] [PubMed]
59.
Kim, S.W.; Jang, H.B.; Lee, J.S.; Im, S.P.; Lazarte, J.M.S.; Seo, J.P.; Lee, W.J.; Kim, J.S.; Jung, T.S. Comparison of
proteome typing and serotyping of Streptococcus parauberis isolates from olive flounder (Paralichthys olivaceus).
J. Microbiol. Methods 2015,118, 168–172. [CrossRef]
60.
Andrews, J.M. Determination of minimum inhibitory concentrations. J. Antimicrob. Chemother.
2001
,48
(Suppl. 1), 5–16. [CrossRef] [PubMed]
61.
Shokri, A.; Larsson, G. Characterisation of the Escherichia coli membrane structure and function during
fedbatch cultivation. Microb. Cell Fact. 2004,3, 9. [CrossRef]
62.
Bush, K.; Singer, S.B. Effective cooling allows sonication to be used for liberation of
β
-lactamases from
Gramnegative bacteria. J. Antimicrob. Chemother. 1989,24, 82–84. [CrossRef]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Available via license: CC BY 4.0
Content may be subject to copyright.
