Available via license: CC BY 4.0
Content may be subject to copyright.
UNCORRECTED MANUSCRIPT
- 1 -
Knockout of serine-rich single-pass membrane protein 1 (Ssmem1) causes
globozoospermia and sterility in male mice
SSMEM1 is essential for male fertility in mice
Absence of serine-rich single-pass membrane protein 1 (SSMEM1) leads to male infertility due to
globozoospermia in mice.
Keywords: Sperm, Spermatogenesis, Fertilization, Male infertility, Null mutation/knockout
Kaori Nozawa1,2, Qian Zhang3, Haruhiko Miyata3, Darius J. Devlin1,2,4, Zhifeng Yu1,2, Seiya
Oura3,5, Takayuki Koyano6, Makoto Matsuyama6, Masahito Ikawa3,5,7,8,*, and Martin M.
Matzuk1,2,*
1Center for Drug Discovery, Baylor College of Medicine, Houston, TX; 2Department of Pathology &
Immunology, Baylor College of Medicine, Houston, TX; 3Department of Experimental Genome Research,
Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan; 4Interdepartmental Program
in Translational Biology & Molecular Medicine, Baylor College of Medicine, Houston, TX; 5Graduate School
of Pharmaceutical Sciences, Osaka University, Suita, Osaka, Japan; 6Division of Molecular Genetics, Shigei
Medical Research Institute, Minami-ku, Okayama, Japan; 7Graduate School of Medicine, Osaka University,
Suita, Osaka, Japan; 8The Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo, Japan
*Correspondence to: ikawa@biken.osaka-u.ac.jp (M. I.) and mmatzuk@bcm.edu (M. M. M.)
© The Author(s) 2020. Published by Oxford University Press behalf of Society for the Study of
Reproduction.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 2 -
Grant Support
This work was supported by: the Ministry of Education, Culture, Sports, Science and Technology
(MEXT)/Japan Society for the Promotion of Science (JSPS) KAKENHI grants (JP17H04987 to H.M.,
JP17H01394 and JP19H05750JP to M.I.); Japan Agency for Medical Research and Development (AMED)
grant JP18gm5010001 to M.I.; Takeda Science Foundation grants to H.M. and M.I.; Eunice Kennedy Shriver
National Institute of Child Health and Human Development (Grants R01HD088412 and P01HD087157 to
M.M.M. and M.I.); National Institute of General Medical Sciences (T32GM088129 and T32GM120011 to
D.J.D); Japan Society for the Promotion of Science Overseas Research Fellowship and Lalor Foundation (to
K.N.), and the Bill & Melinda Gates Foundation (INV-001902 to M.M.M. and M.I.).
Abstract
Globozoospermia (sperm with an abnormally round head shape) and asthenozoospermia (defective
sperm motility) are known causes of male infertility in human patients. Despite many studies, the
molecular details of the globozoospermia etiology are still poorly understood. Serine-rich single
pass membrane protein 1 (Ssmem1) is a conserved testis-specific gene in mammals. In this study,
we generated Ssmem1 knockout (KO) mice using the CRISPR/Cas9 system, demonstrated that
Ssmem1 is essential for male fertility in mice, and found that SSMEM1 protein is expressed during
spermatogenesis but not in mature sperm. The sterility of the Ssmem1 knockout (null) mice is
associated with globozoospermia and loss of sperm motility. To decipher the mechanism causing the
phenotype, we analyzed testes with transmission electron microscopy and discovered that
Ssmem1-disrupted spermatids have abnormal localization of Golgi at steps eight and nine of
spermatid development. Immunofluorescence analysis with anti-Golgin-97 to label the trans-Golgi
network, also showed delayed movement of the Golgi to the spermatid posterior region, which
causes failure of sperm head shaping, disorganization of the cell organelles, and entrapped tails in
the cytoplasmic droplet. In summary, SSMEM1 is crucial for intracellular Golgi movement to
ensure proper spatiotemporal formation of the sperm head that is required for fertilization. These
studies and the pathway in which SSMEM1 functions have implications for human male infertility
and identifying a potential target for non-hormonal contraception.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 3 -
Introduction
Spermatozoa transmit the genetic information to the next generation and unique morphological
features specialized for fertilization. It is reported that more than 1,000 genes are dominantly
expressed in human and mouse testes [1][2]. The deficiency of those genes has been proposed to
cause spermatogenesis defects and infertility in human patients [3]. In addition, many
testis-enriched genes were reported to be evolutionarily conserved in mammals including mouse
and human [4][5]. The analysis of knockout mouse models, which carry null gene mutations, is a
powerful strategy to study male infertility pathogenesis due to the lack of in vitro culture systems of
spermatozoa [6].
The success of spermatogenesis is critical for maintenance of male fertility and requires a
well-organized process in which spermatogonia undergo mitosis, meiosis and spermiogenesis.
Furthermore, spermiogenesis can be divided into the following main phases: Golgi, acrosome
cap/elongation, and maturation phases [7]. The Golgi apparatus produces proacrosomal vesicles
during the Golgi phase, which coalesce and result in the acrosomal vesicle adjacent to the nuclear
membrane on the opposite side of the tail. The acrosome cap phase is characterized by the spread of
the acrosome over the spermatid nucleus, which coincides with tail development [8]. As the
spermatid cytoplasm and nucleus elongates, the organelles, including Golgi and mitochondria,
move from the acrosome and migrate to the caudal aspect. During the maturation phase, the
spermatozoa are fully developed and reshaped. Eventually the mitochondria locate at the midpiece
of the tail and the Golgi is discarded into cytoplasmic droplets with other organelles so that
spermatozoa obtain the morphology suitable for fertilization [9][10]. To explain elongation of the
nuclei, the current hypothesis is that the manchette, consisting of microtubules and actin filaments,
drag and compel the nucleus to become more dense and elongate toward the tail aspect [11].
Globozoospermia, which is a spermiogenesis defect, is one cause of human male
infertility [12]. The characteristic feature of globozoospermia is an abnormal nuclear shape and
arrangement of the sperm mitochondria. Some genes, such as DPY19L2, PICK1, and SPATA16,
have been found as causative genes in human patients [13][14]. Human globozoospermic
spermatozoa have also shown an incapability of natural fertilization because they are unable to bind
the zona pellucida and fuse with oocytes [12]. However, these spermatozoa also show low
fertilization rates even after intracytoplasmic sperm injection (ICSI) treatment, which is a standard
rescue option for infertile men [15], due to the oocyte activation failure [16]. While studies have
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 4 -
shown correlation between globozoospermia and the lack of acrosome, the mechanisms inducing
globozoospermia are still not fully appreciated.
In our in silico bioinformatic analysis [17][18], we identified Ssmem1 as an
evolutionarily-conserved and testis-specific gene. Here, we generated Ssmem1 knockout mice and
verified its significant role in vivo. We observed that lack of Ssmem1 in male mice alters
spermiogenesis, resulting in globozoospermia and sterility. Our ultrastructural data reveals that
absence of SSMEM1 alters transport of the Golgi during spermatid elongation, thereby uncovering
a role of SSMEM1 in this process.
Material and methods
Ethics Statement
Mice were maintained in accordance with NIH guidelines, and all animal procedures were approved
by the Institutional Animal Care and Use Committee (IACUC) at Baylor College of Medicine and
Osaka University.
Animals
B6D2F1 purchased from Japan SLC (Hamamatsu, Shizuoka, Japan) or CLEA Tokyo, B6D2F1 mice
were used for generating Ssmem1 mutant founder mice. In-house hybrid mice (C57BL/6J ×
129S5/SvEvBrd) were mated with Ssmem1 heterozygous mice to expand the line. For phenotypic
analysis, sexually mature male mice (6 weeks to 6 months old) were used. All mice were housed
with a 12 hours light cycle. All mouse experiments were performed according to the guidelines
from the Institutional Animal Care and Use Committee at Baylor College of Medicine (protocol
AN-716).
RT-PCR
Mouse cDNA was cultivated from tissues of C57BL6J/129SvEv hybrid mice. Human multiple
tissue cDNAs were purchased from BD bioscience. The following primers were used as performed
[5]: Human SSMEM1, 5′–ATGAAGGCAGTGGGACAAG–3′ and 5′–
CACTTCTGAGTTGGTTACAGGG ; Human GAPDH, 5′–AATCCCATCACCATCTTCCAG–3′
and 5′–ATGACCCTTTTGGCTCCC–3′ ; mouse Ssmem1, 5′–AGCAAACAGGACGAAGACAG–3′
and 5′–TCGGTTACTGTGGAAACTTGG–3′ ; mouse Hprt, 5′–
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 5 -
TGGATATGCCCTTGACTATAATGAG–3′ and 5′–TGGCAACATCAACAGGACTC–3′.
Generation of Ssmem1 knockout mice
The pX330 plasmids expressing hCas9 and single guide (sg)RNAs
(ACAGATGTCTGAGAGCAAAC) targeting exon 2, which shares all splicing variants of Ssmem1
were injected into pronuclei of zygotes [19]. Eggs were cultured in KSOM overnight and
subsequently transferred into the oviducts of pseudopregnant ICR females. Screening of mutant
pups was performed by direct sequencing following polymerase chain reaction (PCR) using primers
(5′–GCACTCATTTAACAGGGCTGA–3′ and 5′–GGTCTTTGCTGGCGTGATGA–3′). A founder
mouse with a 6 bp deletion and 1 bp insertion was used to expand the colony. The genotyping was
carried out by PCR with specific primers for the wild-type (WT) allele (primer a: 5′–
ATGACTAGGGAGGAGCAGAGAC–3′ and primer b: 5′–ATTCCCATGACCACTCACTACC–3′)
or KO allele (primer c: 5′–GACCACATCTTTCATGTCC–3′ and primer d: 5′–
AGCAACTGAGAATGCAACCC–3′).
Production of a monoclonal antibody against mouse SSMEM1
These procedures were performed as previously described [20]. In brief, the DNA sequence
encoding mouse SSMEM1 (aa residues 58-224, ENSMUSG00000029784) with C-terminal 8xHis
and 1D4 epitope tags were cloned into the pET15b (Novagen) plasmid vector. The plasmids were
transformed into the Rosetta Escherichia coli (E. coli) strain (Millipore). The expression of
SSMEM1-8xHis-1D4 protein was induced by adding isopropyl β-D-1-thiogalactopyranoside
(IPTG) to final concentration of 1.0 mM in LB medium. The cells were cultured at 30℃ for
overnight post-induction. After collection by centrifuge, the pellet was resuspended in Lysis buffer I
[150 mM NaCl, 20 mM Tris-HCl pH 8.0, 10 mM Imidazole, 2% (v/v) Triton X-100, 1 mM DTT,
100 µg/mL Lysozyme, protease inhibitor cocktail tablets (Merck)] and lysed by ultrasonic disruptor
(UD-201, TOMY). Triton-soluble fraction was removed by centrifugation (37,500 g, 30 min). The
purified pellet (inclusion body) was resuspended in Lysis buffer II [150 mM NaCl, 20 mM Tris-HCl
pH 8.0, 10 mM Imidazole, 8M Urea] and incubated overnight with gentle agitation. After
centrifugation (37,500 g, 30 min), the supernatant was incubated with Ni-NTA Agarose (product no.
30210, QIAGEN) for 1 hr with gentle agitation. The lysate was loaded on a column and washed
with 40 mL of column wash buffer [150 mM NaCl, 20 mM Tris-HCl pH 8.0, 40 mM Imidazole, 8M
Urea]. SSMEM1-8xHis-1D4 was eluted from the column with column elution buffer [150 mM
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 6 -
NaCl, 20 mM Tris-HCl pH 8.0, 250 mM Imidazole, 8M Urea]. Recombinant SSMEM1 was used to
produce the monoclonal antibody as previously described [21]. Specifically, purified SSMEM1
protein with Freund’s complete adjuvant was injected into female rats. After 17 days post-injection,
lymphocytes were collected from iliac lymph nodes and hybridomas generated as described in
Kishiro [22]. Supernatants from hybridoma cell cultures were collected and used as antibodies. The
candidates were screened by ELISA against recombinant mouse SSMEM1.
Western blot analysis
Testis and sperm were collected from adult mice and lysed in NP40 buffer (50 mM Tris-HCl pH 7.5,
150mM NaCl, 0.5% NP40, 10% Glycerol) followed by incubation for 1 hr at 4°C with gentle
agitation. The lysate was centrifuged at 15,000 g for 5 minutes at 4°C in a tabletop centrifuge. The
supernatant was collected and subjected SDS-PAGE under reducing condition (with 5%
2-mercaptoethanol). The proteins from the gel were transferred to a PVDF membrane. Membranes
were blocked with 10% skim milk in Tris-buffered saline-Tween 20 (TBST; 20 mM Tris-HCl pH
7.6, 150 mM NaCl, 0.1% Tween 20) for 1 hour at room temperature (RT). Primary antibodies were
diluted in blocking solution and incubated with the membranes overnight at 4°C. Membranes were
washed three times with TBST before being incubated with anti-mouse IgG-HRP-conjugated
secondary antibody for 1 hour at RT. Membranes were then developed after washing. The blotted
membrane was stained by Coomassie Brilliant Blue (CBB) for a loading control.
Histology
For histological analysis, testes were collected and fixed in Bouin’s fixative (Sigma Aldrich) for
three hours at RT. After several washes in 70% ethanol to remove excess stain, testes were
embedded in paraffin. Tissues were sectioned at 5 µm thickness and stained by Periodic Acid-Schiff
(PAS)-hematoxylin, followed by imaging with a 40x objective.
Scanning Electron Microscopy (SEM)
Spermatozoa was recovered from cauda epididymis and placed in TYH medium at 37°C, 5% CO2
for 15 min [23]. Sperm were centrifuged at 300 x g for 5min and washed in PBS. After 2nd
centrifuge, sperm were resuspended and fixed in 2.5% glutaraldehyde for 30 min at RT. Sperm were
dehydrated in ethanol from 20% to 100%, incubating for 10 min in each. Sperm were transferred
and resuspended in 50% t-butanol/50% ethanol for 15 min. The sperm samples were dried, and
sputter coated with iridium, followed by imaging using Nova NanoSEM 230 at Houston Methodist
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 7 -
Research Institute’s Electron Microscopy Core.
Sperm Analysis
Sperm number and motility were measured as previously [24]. Sperm were extracted by cutting
caudal epididymis 30 times and incubated in human tubal fluid (HTF) media (Millipore)
supplemented with 5% BSA under 5% CO2 at 37C. After 15- or 90-minutes incubation, sperm
samples were applied onto a chamber of 100 µm-depth analyzed counting slides (CellVision), and
the sperm number and motility were measured using the Hamilton Thorne CEROS II system.
Transmission Electron Microscopy (TEM)
Samples were prepared as previously described [25]. Epididymis and testes were quickly removed
from sacrificed mice and fixed in 2% paraformaldehyde, 2.5% glutaraldehyde and 2 mM CaCl2 in
0.1 M cacodylate at 4°C overnight. After staining and dehydration, tissues were embedded in
Spurr’s resin. Thin sections (80 nm) were stained with uranyl acetate and lead citrate, followed by
observation using a Hitachi H7500 transmission electron microscope (Hitachi-HTA) at 80 kV at
Baylor College of Medicine Integrated Microscopy Core.
Immunofluorescence
Testes were fixed in 4% PFA/PBS for overnight and replaced in from 10%, 20% to 30 % sucrose at
4°C. The tissues were then embedded in OCT compound, freezing at -80°C. After sectioning at 10
µm, the samples were blocked with 3% BSA + 5% Normal Donkey Serum/PBS containing 0.1%
Triton X-100 on the slides, for 1 hr at RT. Primary antibodies were incubated with sections
overnight at 4oC. Sections were washed with 3% BSA + 1% Normal Donkey Serum/PBS and
incubated with secondary antibodies for 1 hr at RT. DAPI was added in the washed buffer for 10
min in the final wash. Primary antibodies used were anti-Golgin 97 antibody at a concentration of 5
µg/ml (Abcam, #ab84340) and the lectin peanut agglutinin (PNA)-FITC at a dilution of 1:500
(Sigma-Aldrich, #L7381). (Sigma). Secondary antibody was donkey anti-rabbit AF594 (Life
Technologies). Slides were observed with Zeiss LSM 880 with Airyscan FAST Confocal
Microscope at Baylor College of Medicine Optical Imaging & Vital Microscopy Core.
Statistical Analysis
Statistical significance was evaluated by using the two-tailed unpaired Student t test assuming
unequal variances.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 8 -
Results
Ssmem1 is a highly conserved testis-specific gene
We identified Ssmem1 as a conserved testis-specific gene by a bioinformatic screen as previously
described [5]. We performed multi-tissue RT-PCR from male mice to reveal the Ssmem1 expression
profile. We obtained a single band in both human and mouse testes (Fig. 1A). To determine the
temporal expression pattern of Ssmem1, we performed RT-PCR using testis from WT mice of
increasing age from post-natal day (PND): 5, 10, 15, 20, 25, 30, 35 and 42 to capture the earliest
stage of expression of Ssmem1 in mice. Expression of Ssmem1 was observed at low levels at day 5
and became pronounced at postnatal day 15 (Fig. 1B), which is coincident with the appearance of
the first pachytene spermatocytes [26]. Protein sequence alignment analysis was performed on
representative orthologs of SSMEM1 from different species. SSMEM1, which possesses a single
transmembrane domain, is highly conserved in mammals, including human and mouse (Fig. 1C).
Generation of Ssmem1 knockout mice
To examine the physiological role of Ssmem1, we generated knockout mice using the CRISPR/Cas9
system. The gRNAs were designed to target exon 2 which is shared with all Ssmem1 splicing
variants (Fig. 2A). After an indel mutation containing a 6-bp deletion with a 1-bp insertion was
confirmed by direct sequencing analysis, specific primers for wildtype (WT) or homozygous mutant
(KO) allele were designed and used for genotyping (Fig. 2B). The net 5-bp deletion of nucleotides,
which caused a frameshift mutation, resulted in amino acid changes and a premature stop codon in
KO mice in place of the L77 residue in WT mice (Fig. 2C). We intercrossed the mouse line (-6+1
bp) to obtain subsequent generations and confirmed the absence of SSMEM1 protein in KO testes
(Fig. 2D). In addition, while SSMEM1 is present in testis, we found that the protein is absent from
mature epididymal sperm from WT mice (Fig. 2D). Observation of the KO mice revealed no
obvious developmental abnormalities or differences in sexual behavior.
Ssmem1 is required for male fertility
Beginning at 6 weeks of age, sexually mature heterozygous or homozygous mutant males were
housed with one female each for 6 months to test their fertility. The average number of offspring per
litter and the number of litters were counted. Six control mating pairs had 7.3 ± 1.8 pups on average,
whereas four homozygous mutant males exhibited sterility (Fig. 3A). This data demonstrates that
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 9 -
Ssmem1 is essential for male fertility. To determine the cause of the sterility defect, we first
analyzed the testis and sperm from controls and Ssmem1 KO mice. The sperm count from caudal
epididymis between HET and KO mice showed no significance difference (Fig. 3B). However, the
testicular size and weight from Ssmem1 KO mice were significantly reduced compared to the
control males (Fig. 3C-D). In histological analysis of testes stained with PAS-hematoxylin, most
tubules appeared normal but atrophic changes showing absence of germ cells and vacuolation in
seminiferous tubules were occasionally observed in the Ssmem1 KO (Fig. 3E), which may explain
the slight reduction in testis weight for the Ssmem1 KO males. The epididymal histology showing
the lumen filled with sperm in both HET and KO correlated with the results of the sperm count.
Ssmem1 KO results in spermiogenesis defects and motility reduction
To examine the morphology of spermatozoa, the sperm extracted from cauda epididymis were
analyzed by SEM (Fig. 4A). All KO spermatozoa showed a round or amorphous head morphology,
and some presented with the tail coiled around the head (Fig. 4A, bottom right). To further evaluate
their infertility, we collected epididymal spermatozoa from adult Ssmem1 HET and KO males and
examined the sperm motility using a Computer Assisted Sperm Analysis (CASA) system. The
percentage of motile sperm were significantly decreased in Ssmem1 KO mice (4.1% at 15 min;
3.8% at 90 min incubation in sperm capacitation medium) compared to HET mice (45.3% at 15
min; 35.3% at 90 min) (Fig. 4B). In addition, motile sperm from KO mice showed impaired
kinematic velocities after 90 minutes of incubation in capacitation medium (Fig. 4C).
Ssmem1 influences Golgi apparatus migration during spermiogenesis
The abnormalities of KO spermatogenesis were further examined by Transmission Electron
Microscopy (TEM). Epididymal observations revealed detailed abnormalities in the KO sperm:
misshapen nuclei, disorganized mitochondria and tail entrapment in cytoplasmic droplets (Fig. 5A).
In HET testis, the Golgi in step 8 spermatids localized to the caudal region of the cell. In contrast,
the Golgi failed to undergo migration to the caudal region in all spermatids at comparable stages in
Ssmem1 KO (Fig. 5B); however, the formation of the acrosome did not appear to be disturbed. In
step 9 elongating spermatids from HET controls, the Golgi and mitochondria completely migrated
to the caudal side of the cell and the acrosomal membrane made contact with the cell plasma
membrane (Fig. 5C). In the KO spermatids, however, the Golgi remained in the rostral region of the
cell and the acrosomal membrane did not attach to the plasma membrane. In step 11 spermatids
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 10 -
(maturation phase), although the migration of the Golgi to the caudal side was finally observed in
KO sperm, the shape of the nuclei and elongation of the cell were incomplete (Fig. 5D). The
abnormalities above were confirmed by immunofluorescent staining of testes, using GOLGIN-97 to
label the trans-Golgi network and PNA to label the acrosome. The delayed migration of Golgi from
acrosome side to tail side of the spermatid cytoplasm was observed in step 9 spermatids in KO
testes (Fig. 5E). These data suggest the delay of the Golgi migration during elongation of
spermatids is defective during spermatogenesis in Ssmem1 KO.
Discussion
By generating an Ssmem1 KO model, we discovered that SSMEM1 is essential for male fertility.
KO mice lacking Ssmem1, which is testis-specific and well-conserved in mammals, are sterile due
to abnormal sperm head morphology (globozoospermia) and diminished motility. Absence of
SSMEM1 causes a delay in intracellular repositioning of the Golgi during the transition from round
spermatids to elongating spermatids in steps 7 – 9 of spermiogenesis. The Golgi is found lingering
near the acrosome in step 9 spermatids of KO testes, which is followed by disrupted spermatid
elongation, disorganization of cell organelles, derangement of sperm head morphology, and
subsequent loss of sperm motility (Fig. 6). These data imply that the mechanisms for spermatid
elongation and for intracellular organelle trafficking might be independent, and that the organelle
migration should occur before the initiation of elongation for appropriate spermatogenesis.
Studies of spermatogenesis have identified many acrosome-associated genes, such as
Zpbp1, Spaca1, and Spata46 as causes of globozoospermia [25][27][28]. Knockout of these genes
in mice showed morphological defects of the acrosome during spermatogenesis, followed by
disrupted sperm morphogenesis. In addition to the role of the mature acrosome in undergoing
exocytosis (acrosome reaction) during transit through the female reproductive tract, the acrosome
has a critical role in the development of proper sperm head shape [29][30]. Unlike the previously
mentioned genes essential for acrosome biogenesis, Ssmem1 KO spermatids displayed normal
acrosome formation in the early stages of spermatogenesis. In addition, all organelles were found to
have normal morphology using ultra-structural analysis. The earliest phenotype in mouse
spermatids lacking SSMEM1 is failure of the transfer of the Golgi from the rostral region of the
polarized spermatid (near the acrosome) to the caudal region of the cell in step 7 and step 8
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 11 -
spermatids, when the spermatids begin elongation [31]. This abnormality is accompanied with the
loss of the contact between the acrosomal membrane and the plasma membrane. Although the
organelles eventually migrate to the caudal region of the cell for removal in KO testis at a later
stage, the spermatids appear to have already lost the ability to orchestrate its organelles properly by
that time, resulting in abnormal sperm morphology.
The localization and the molecular functions of SSMEM1 are not yet clear. Our RT-PCR
analysis demonstrates that Ssmem1 gene expression appears most drastically around postnatal day
15, which corresponds to period that expression of cytoskeleton genes is active [32]. Furthermore,
spe-26, which encodes a protein similar to actin-associated proteins, was reported in C. elegans
where the spe-26 mutant spermatocytes showed mislocalization of mitochondria, the endoplasmic
reticulum (ER) and ribosomes which remained in the spermatid cytoplasm [33]. Similarly, myosin
IV has been shown to be required for proper segregation of cell components including mitochondria
and ER/Golgi-derived organelle complexes during C. elegans spermatogenesis [34]. In mice,
intraflagellar transport protein 74 (IFT74)-deficient in testes caused a similar abnormal
reorganization of the cell organelles during spermatogenesis as in Ssmem1 KO mice likely due to a
failure of assembly of the cytoskeleton [35]. These data suggest SSMEM1 might associate with the
cytoskeleton in spermatids. We hypothesize that SSMEM1, a transmembrane protein, localizes to
the Golgi membrane and plays a role in the Golgi interaction with cytoskeletal proteins or
associated proteins responsible for organelle migration during spermiogenesis. Other
transmembrane proteins in the Golgi such as TM9SF3, TMED4/p25, and TMED7/p27 have been
reported to be involved in Golgi migration after acrosome formation [36]. In addition, KO of
TMF/ARA160 (TATA Element Modulatory Factor 1), which localizes to the Golgi in mouse testis
and associates with tubulin and microtubules, demonstrate spermiogenesis failure due to
disorientation of the Golgi and abnormal trafficking of the Golgi-derived proacrosomal vesicles
during early spermiogenic steps [37]. Thus, we believe that SSMEM1 functions to anchor Golgi and
cytoskeletal proteins for proper Golgi migration analogous to TMF/ARA160. Lastly, since
SSMEM1 protein expression was only detected in the testis as shown in our western blot analysis
(Fig. 2D), it is likely that SSMEM1 is discarded into residual bodies and degraded with the Golgi
before spermatids are released into the seminiferous tubule lumen during spermiation.
We show that generating KO mice using the CRISPR/Cas9 system is a powerful approach
to explore implicit causative genes for male infertility. Future studies will investigate the subcellular
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 12 -
localization of SSMEM1, and the interaction with IFT proteins and/or other cytoskeleton-associated
proteins such as TMF. In addition, polymorphisms in human SSMEM1 have been identified via the
dbSNP database (www.ncbi.nlm.nih.gov/snp), suggesting that this gene could be contributing to
human male infertility as well. The studies will have the potential for new insights into male
infertility diagnosis and treatment as well as the development of non-hormonal contraceptives.
Acknowledgements
We thank Dr. Rashieda J. Hatcher for critical reading of this manuscript, the Baylor College of
Medicine Pathology & Histology Core for processing for embedding histology samples, Jianhua Gu
and Huie Wang at Houston Methodist Research Institute’s Electron Microscopy Core for their
expertise in acquiring scanning electron microscopy images, Drs. Debra Townley and Michael
Mancini in the Integrated Microscopy Core for their advice with transmission electron microscopy
experiments, and Dr. Keisuke Shimada for shipping mice from Japan.
Reference
[1] Uhlén M, Fagerberg L, Hallström BM, Lindskog C, Oksvold P, Mardinoglu A, Sivertsson Å,
Kampf C, Sjöstedt E, Asplund A, Olsson IM, Edlund K, et al. Tissue-based map of the
human proteome. Science (80- ) 2015; 347.
[2] Schultz N, Hamra FK, Garbers DL. A multitude of genes expressed solely in meiotic or
postmeiotic spermatogenic cells offers a myriad of contraceptive targets. Proc Natl Acad Sci
U S A 2003; 100:12201–12206.
[3] Tüttelmann F, Ruckert C, Röpke A. Spermatogenesestörungen: Perspektiven für erweiterte
genetische Diagnostik nach 20 Jahren unveränderter Routine. Medizinische Genet 2018;
30:12–20.
[4] Khan M, Jabeen N, Khan T, Hussain HMJ, Ali A, Khan R, Jiang L, Li T, Tao Q, Zhang X,
Yin H, Yu C, et al. The evolutionarily conserved genes: Tex37, Ccdc73, Prss55 and Nxt2 are
dispensable for fertility in mice. Sci Rep 2018; 8:1–8.
[5] Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D,
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 13 -
Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, et al. Genome engineering
uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for
male fertility in mice. Proc Natl Acad Sci U S A 2016; 113:7704–7710.
[6] O’Bryan MK, De Kretser D, Ivell R, Skakkebæk NE, Almstrup K, Leffers H. Mouse models
for genes involved in impaired spermatogenesis. Int J Androl 2006; 29:76–89.
[7] Zakrzewski P, Lenartowski R, Rędowicz MJ, Miller KG, Lenartowska M. Expression and
localization of myosin VI in developing mouse spermatids. Histochem Cell Biol 2017;
148:445–462.
[8] Neto FTL, Bach PV, Najari BB, Li PS, Goldstein M. Spermatogenesis in humans and its
affecting factors. Semin Cell Dev Biol 2016; 59:10–26.
[9] Bloom G, Nicander L. On the ultrastructure and development of the protoplasmic droplet of
spermatozoa. Zeitschrift Für Zellforsch Und Mikroskopische Anat 1961; 55:833–844.
[10] Breucker H, Schäfer E, Holstein AF. Morphogenesis and fate of the residual body in human
spermiogenesis. Cell Tissue Res 1985; 240:303–309.
[11] Sun X, Kovacs T, Hu YJ, Yang WX. The role of actin and myosin during spermatogenesis.
Mol Biol Rep 2011; 38:3993–4001.
[12] Dam AHDM, Feenstra I, Westphal JR, Ramos L, van Golde RJT, Kremer JAM.
Globozoospermia revisited. Hum Reprod Update 2007; 13:63–75.
[13] Chansel-Debordeaux L, Dandieu S, Bechoua S, Jimenez C. Reproductive outcome in
globozoospermic men: Update and prospects. Andrology 2015; 3:1022–1034.
[14] Massart A, Lissens W, Tournaye H, Stouffs K. Genetic causes of spermatogenic failure.
Asian J Androl 2012; 14:40–48.
[15] Thirumavalavan N, Gabrielsen JS, Lamb DJ. Where are we going with gene screening for
male infertility? Fertil Steril 2019; 111:842–850.
[16] Kuentz P, Vanden Meerschaut F, Elinati E, Nasr-Esfahani MH, Gurgan T, Iqbal N,
Carré-Pigeon F, Brugnon F, Gitlin SA, Velez De La Calle J, Kilani Z, De Sutter P, et al.
Assisted oocyte activation overcomes fertilization failure in globozoospermic patients
regardless of the DPY19L2 status. Hum Reprod 2013; 28:1054–1061.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 14 -
[17] Rajkovic A, Yan C, Klysik M, Matzuk M. Discovery of germ cell-specific transcripts by
expressed sequence tag database analysis. Fertil Steril 2001; 76:550–554.
[18] Lin Y, Matzuk MM. High-Throughput Discovery of Germ-Cell- Specific Genes. Semin
Reprod Med 2005; 23(3):201-12.
[19] Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Generation of mutant mice
by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep
2013; 3:1–6.
[20] Noda T, Lu Y, Fujihara Y, Oura S, Koyano T, Kobayashi S, Matzuk MM, Ikawa M. Sperm
proteins SOF1, TMEM95, and SPACA6 are required for sperm-oocyte fusion in mice. Proc
Natl Acad Sci USA, MS# 2019-22650, in press
[21] Sado Y, Inoue S, Tomono Y, Omori H. Lymphocytes from enlarged iliac lymph nodes as
fusion partners for the production of monoclonal antibodies after a single tail base
immunization attempt. Acta Histochem Cytochem 2006; 39:89–94.
[22] Kishiro Y, Kagawa M, Sado Y, Naito I. A Novel Method of Preparing Rat-Monoclonal
Antibody-Producing Hybridomas by Using Rat Medial Iliac Lymph Node Cells. Cell Struct
Funct 1995; 20:151–156.
[23] Toyoda Y, Yokoyama M. The Early History of the TYH Medium for in vitro Fertilization
of Mouse Ova . J Mamm Ova Res 2018; 35:71–71.
[24] Castaneda JM, Hua R, Miyata H, Oji A, Guo Y, Cheng Y, Zhou T, Guo X, Cui Y, Shen B,
Wang Z, Hu Z, et al. TCTE1 is a conserved component of the dynein regulatory complex
and is required for motility and metabolism in mouse spermatozoa. Proc Natl Acad Sci USA
2017; 114:E5370–E5378.
[25] Lin Y-N, Roy A, Yan W, Burns KH, Matzuk MM. Loss of Zona Pellucida Binding Proteins
in the Acrosomal Matrix Disrupts Acrosome Biogenesis and Sperm Morphogenesis. Mol
Cell Biol 2007; 27:6794–6805.
[26] Bellve AR, Cavicchia JC, Millette CF, O’Brien DA, Bhatnagar YM, Dym M. Spermatogenic
cells of the prepuberal mouse. Isolation and morphological characterization. J Cell Biol
1977; 74:68–85.
[27] Fujihara Y, Satouh Y, Inoue N, Isotani A, Ikawa M, Okabe M. SPACA1-deficient male mice
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 15 -
are infertile with abnormally shaped sperm heads reminiscent of globozoospermia. Dev
2012; 139:3583–3589.
[28] Chen J, Gu Y, Zhang Z, Zheng W, Yang L, Huang W, Lin S, Li Y, Guo H, Luo M, Ma Q,
Jiang Z, et al. Deficiency of SPATA46, a Novel Nuclear Membrane Protein, Causes
Subfertility in Male Mice. Biol Reprod 2016; 95:58–58.
[29] Abou-Haila A, Tulsiani DRP. Mammalian sperm acrosome: Formation, contents, and
function. Arch Biochem Biophys 2000; 379:173–182.
[30] De Braekeleer M, Nguyen MH, Morel F, Perrin A. Genetic aspects of monomorphic
teratozoospermia: a review. J Assist Reprod Genet 2015; 32:615–623.
[31] Wei YL, Yang WX. The acroframosome-acroplaxome-manchette axis may function in sperm
head shaping and male fertility. Gene 2018; 660:28–40.
[32] Laiho A, Kotaja N, Gyenesei A, Sironen A. Transcriptome Profiling of the Murine Testis
during the First Wave of Spermatogenesis. PLoS One 2013; 8.
[33] Varkey JP, Muhlrad PJ, Minniti AN, Do B, Ward S. The Caenorhabditis elegans spe-26 gene
is necessary to form spermatids and encodes a protein similar to the actin-associated proteins
kelch and scruin. Genes Dev 1995; 9:1074–1086.
[34] Kelleher JF, Mandell MA, Moulder G, Hill KL, L’Hernault SW, Barstead R, Titus MA.
Myosin VI is required for asymmetric segregation of cellular components during C. elegans
spermatogenesis. Curr Biol 2000; 10:1489–1496.
[35] Shi L, Zhou T, Huang Q, Zhang S, Li W, Zhang L, Hess RA, Pazour GJ, Zhang Z.
Intraflagellar transport protein 74 is essential for spermatogenesis and male fertility in mice†.
Biol Reprod 2019; 101:188–199.
[36] Au CE, Hermo L, Byrne E, Smirle J, Fazel A, Simon PHG, Kearney RE, Cameron PH,
Smith CE, Vali H, Fernandez-Rodriguez J, Ma K, et al. Expression, sorting, and segregation
of Golgi proteins during germ cell differentiation in the testis. Mol Biol Cell 2015; 26:4015–
4032.
[37] Elkis Y, Bel S, Rahimi R, Lerer-Goldstein T, Levin-Zaidman S, Babushkin T, Shpungin S,
Nir U. TMF/ARA160 governs the dynamic spatial orientation of the golgi apparatus during
sperm development. PLoS One 2015; 10:1–22.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 16 -
Fig. 1. Ssmem1 is a conserved testis-specific gene.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 17 -
(A) RT-PCR in multiple tissues confirming the testis-specificity of Ssmem1 in mice (Top panels)
and humans (bottom panels). Hprt and GAPDH were used as controls. He, heart; Li, liver; Sp,
spleen;
Lu, lung; Ki, kidney; Br, brain; St-stomach; In-intestine; Te, testis; Ov, ovary; Ut, Uterus; Ep,
Epididymis; H, head: B, Body; T, Tail. (B) RT-PCR from mouse testes at various postnatal days was
performed. Hprt was used a control. (C) Protein sequence alignment of SSMEM1 from several
mammalian species. Transmembrane region in human protein (asterisk) is well conserved with
other species. Black indicates fully conserved residues. Gray indicates conservation with residues in
human.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 18 -
Fig. 2. Generating Ssmem1 KO mice.
(A) Genomic structure of mouse Ssmem1 and scheme to generate the gene KO mice using the
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 19 -
CRISPR/Cas9 system. Three splice variants of Ssmem1 have been reported. White and black boxes
indicate untranslated and coding regions, respectively. Red arrow and black under bar indicate
gRNA that targets the region. The delivery of CRISPR/Cas9 system into zygotes for mutagenesis
via microinjection resulted in 5 bp (6 bp deletion and 1 bp insertion) frameshift deletion (shown in
red). (B) Genotyping of Ssmem1 alleles. Primers indicated in green color in Fig, 2A amplify specific
amplicon for the WT or KO allele. (C) Mutation in amino acid sequence in KO mouse induced by
-5 frameshift mutation is shown in red color. Asterisk indicates a premature stop codon. The
numbers above sequences are amino acid number for each. (D) Western blot analysis using testis
and sperm. SSMEM1 protein is detected only in WT testis. Equal loading of total protein was
confirmed by CBB staining.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 20 -
Fig. 3. Ssmem1 KO causes male infertility.
(A) Average litter size from natural mating of Ssmem1 HET and KO mice. Litter size was measured
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 21 -
by the number of pups born. Ssmem1 KO males showed complete infertile, P<0.0001. (B)
Quantification of sperm released from the cauda epididymis. There was no significant difference
between HET and KO mice. (C) Images of testes from Ssmem1 HET and KO mice. (D) Average
weight of individual testis. KO males showed a reduction in testis volume, P<0.05. (E)
PAS-Hematoxylin staining of testis and caudal epididymis sections from HET and KO mice.
Occasional KO tubules in testis did not contain germ cells (asterisks). (Scale bar, 100 μm)
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 22 -
Fig. 4. Ssmem1 KO sperm show morphology and motility defects.
(A) SEM images of HET/KO spermatozoa from caudal epididymis. KO sperm exhibited
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 23 -
globozoospermia. (B) Sperm motility at 15 and 90 min after sperm suspension. There was a
reduction in sperm motility in KO. (C) Sperm kinematic parameters measured using the CEROS II
sperm analysis system. Velocities of KO sperm were lower than those of HET. P<0.05 (*), P<0.01
(**), P<0.001 (***).
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 24 -
Fig. 5. Ssmem1 KO caused a delay in organelle transfer.
(A) TEM images of HET/KO spermatozoa in epididymis. Nuclei showed abnormal morphology and
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 25 -
mitochondria are located at the sperm head region, alongside the nuclei (Scale bar, 2.0 μm). (B, C)
TEM images of spermatids at same stages, step 8 (B); step 9 (C) in testis. In Ssmem1 null spermatid,
Golgi body (Red arrows) failed to undergo migration as control spermatid at step 8. In step 9,
elongating spermatids, the Golgi stayed in the caput aspect of the cell and the acrosomal membrane
did not contact the cell surface (Black arrowheads) in Ssmem1 null spermatids (Scale bar, 4.0 μm).
(D) TEM images of sperm at step 11. Golgi and mitochondria were located at caudal region of
sperm in both HET and KO sperm (Scale bar, 2.0 μm). (E) Immunostaining of HET/KO testes. The
Golgi body and acrosome were stained with Golgin 97 (red) and peanut agglutinin (PNA, green),
respectively. Arrows indicate the Golgi retained in acrosome in mutant spermatids. Migration of
Golgi from acrosome side to tail side was delayed in KO spermatids (Scale bar, 10.0 μm).
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 26 -
Fig. 6. Schematic representation of the Ssmem1 deficient spermatogenesis.
The delay in organelle migration from step 8 to step 9 causes progressive changes leading to
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
UNCORRECTED MANUSCRIPT
- 27 -
round-headed sperm in Ssmem1 KO males.
Downloaded from https://academic.oup.com/biolreprod/article-abstract/doi/10.1093/biolre/ioaa040/5818833 by guest on 18 April 2020
