ArticlePDF Available

Anti-Inflammatory and Antioxidant Effects of Anthocyanins of Trifolium pratense (Red Clover) in Lipopolysaccharide-Stimulated RAW-267.4 Macrophages

Authors:

Abstract and Figures

Red clover (Trifolium pratense) possesses various dietary compounds that improve human health. However, the functions of anthocyanins in red clover remain unclear. Here we examined anti-inflammatory and antioxidant effects of red clover extract (RC) and red clover anthocyanins fraction (RCA) using lipopolysaccharide (LPS)-treated RAW 264.7 macrophages and identified dietary compounds. RC and RCA suppressed LPS-induced expression of genes such as tumor necrosis factor (TNF)α, interleukin (IL)1β, inducible nitric oxide synthase (iNOS), monocyte chemoattractant protein (MCP)1, and cyclooxygenase (COX)2. LPS-stimulated intracellular reactive oxygen species (ROS) production also was prevented by both RC and RCA. NADPH oxidase 1 (NOX1) gene and phosphorylation of p47phox of NOX1 that were increased by LPS were inhibited in the cells treated with RCA. LPS-stimulated nuclear factor erythroid 2-related factor 2 (NRF2) gene expression and nuclear translocation of nuclear factor kappa B (NF-kB) subunit p65 were suppressed together with reduced iNOS and COX2 proteins by RCA. Additionally, 27 polyphenols and 7 anthocyanins from RC were identified and quantified. In conclusion, RC, especially RCA, exerted anti-inflammatory and anti-oxidative activities in vitro by regulating NF-κB and NRF2 signaling pathways, suggesting that anthocyanins in red clover are the potential candidates to reduce inflammation and oxidative stress.
Content may be subject to copyright.
nutrients
Article
Anti-Inflammatory and Antioxidant Eects of
Anthocyanins of Trifolium pratense (Red Clover) in
Lipopolysaccharide-Stimulated
RAW-267.4 Macrophages
Sang Gil Lee 1, Cindi R. Brownmiller 2, Sun-Ok Lee 2and Hye Won Kang 3,*
1Department of Food Science and Nutrition, Pukyong National University, Busan 48513, Korea;
Sglee1125@pknu.ac.kr
2Department of Food Science, University of Arkansas, Fayetteville, AR 72704, USA;
cbrownm@uark.edu (C.R.B.); sunok@uark.edu (S.-O.L.)
3
Food and Nutritional Sciences, Department of Family and Consumer Sciences, North Carolina Agricultural
and Technical State University, Greensboro, NC 27411, USA
*Correspondence: hkang@ncat.edu; Tel.: +1-336-285-4858; Fax: +1-336-334-7239
Received: 14 February 2020; Accepted: 10 April 2020; Published: 15 April 2020


Abstract:
Red clover (Trifolium pratense) possesses various dietary compounds that improve human
health. However, the functions of anthocyanins in red clover remain unclear. Here we examined
anti-inflammatory and antioxidant eects of red clover extract (RC) and red clover anthocyanins
fraction (RCA) using lipopolysaccharide (LPS)-treated RAW 264.7 macrophages and identified dietary
compounds. RC and RCA suppressed LPS-induced expression of genes such as tumor necrosis
factor (TNF)α, interleukin (IL)1β, inducible nitric oxide synthase (iNOS), monocyte chemoattractant
protein (MCP)1, and cyclooxygenase (COX)2. LPS-stimulated intracellular reactive oxygen species
(ROS) production also was prevented by both RC and RCA. NADPH oxidase 1 (NOX1) gene and
phosphorylation of p47
phox
of NOX1 that were increased by LPS were inhibited in the cells treated
with RCA. LPS-stimulated nuclear factor erythroid 2-related factor 2 (NRF2) gene expression and
nuclear translocation of nuclear factor kappa B (NF-kB) subunit p65 were suppressed together with
reduced iNOS and COX2 proteins by RCA. Additionally, 27 polyphenols and 7 anthocyanins from
RC were identified and quantified. In conclusion, RC, especially RCA, exerted anti-inflammatory and
anti-oxidative activities
in vitro
by regulating NF-
κ
B and NRF2 signaling pathways, suggesting that
anthocyanins in red clover are the potential candidates to reduce inflammation and oxidative stress.
Keywords: red clover; anthocyanins; anti-inflammation; antioxidation
1. Introduction
Trifolium pratense (red clover), which belongs to the bean family Fabaceae (or Leguminosae),
is a medicinal plant that improves various health conditions such as asthma, whooping cough,
cancer, and gout [
1
]. Phytoestrogenic isoflavones of red clover such as daidzein, genistein, biochain A,
and formononetin improved menopausal symptoms and vaginal cytology on menopausal women [
2
5
].
Although red clover is a rich source of isoflavones, it is expected to have anthocyanins due to its
color. However, anthocyanins of red clover are not identified. Anthocyanins are the plants’ pigments
ranging from orange and red to purple and blue, which is classified as a subgroup of flavonoids
with various health benefits such as antioxidants and anti-inflammation [
6
8
]. Inflammation is a
response against infection, illness, and injury by producing cytokines such as tumor necrosis factor
(TNF)
α
, interleukin (IL)1
β
, and IL6, and further by generating reactive oxygen species (ROS) [
9
].
Nutrients 2020,12, 1089; doi:10.3390/nu12041089 www.mdpi.com/journal/nutrients
Nutrients 2020,12, 1089 2 of 13
Moreover, inflammation and oxidative stress are positively correlated with the development of chronic
diseases such as obesity, diabetes, and cardiovascular disease, which attracts scientists to find new
sources that have anti-inflammatory and antioxidant eects. Of natural sources, anthocyanins have
been suggested as the potential candidate to ameliorate health issues related to inflammation and
oxidative stress [
10
]. Nuclear factor kappa B (NF-
κ
B) is a major regulator for anti-inflammatory and
antioxidant eects of anthocyanins [
11
]. Malvidin-3-glucoside, a major anthocyanin of blueberries
and grapes, suppressed TNF
α
- and IL4-stimulated inflammatory markers in human umbilical vein
endothelial cells and peripheral blood mononuclear cells by inhibiting nuclear translocation of p65 of
NF-κB [12,13]. Cyanidin-3-glucoside reduced production of nitric oxide (NO), prostaglandin E2, and
IL8, as well as the expressions of inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)2
without IkB-
α
degradation and NF-
κ
B activation in cytokine-stimulated human intestinal HT-29
cells [
14
]. Cyanidin-3-O-sophoroside and cyanidin-3-O-sambubioside from black peanut ameliorated
UV-irradiated oxidative injury through the action of the nuclear factor erythroid 2-related factor 2
(NRF2) by interaction with the NF-
κ
B signaling pathway in human keratinocyte cells and mice skin [
15
].
Red clover showed anti-inflammatory eect [
16
,
17
]. Although its isoflavones seem to be responsible
for this eect [
16
,
17
], anthocyanins of red clover may also support this eect. However, the eects of
the anthocyanins of red clover on inflammation are not explored yet. Thus, the purpose of this study
was to examine anti-inflammatory and antioxidant eects of red clover’s anthocyanins and further
identify and quantify anthocyanins and other dietary compounds of red clover.
2. Materials and Methods
2.1. Preparation of Anthocyanin Fractions from Red Clover
Red clover (Trifolium pratense) flowers were purchased from Starwest Botanicals Inc (Sacramento,
CA, USA). Petals of the red clover were cleaned and dried at room temperature. Dried petals (50 g) were
extracted with 1 L of 80% aqueous methanol (v/v) by homogenization and sonication [
18
]. Red clover
extract (RC) yield was 13.2%. To isolate red clover anthocyanins fraction (RCA), RC was loaded into a
C-18 SPE cartridge (Waters, Milford, MA, USA) and 10 mL of 0.01 N HCl was added to remove sugar,
acids, and water-soluble compounds. The cartridge was dried with N
2
gas for 10 min and then washed
with 40 mL of ethyl acetate to remove non-anthocyanin flavonoids. Anthocyanins were eluted with
6 mL of acidic methanol. Solvents of RCA were evaporated using a rotary evaporator (Buchi RE120
Rotovapor, Flawil, Switzerland). RCA yield was 0.36%. RC and RCA were stored at
20
C until use.
2.2. Cell Culture
Mouse monocyte RAW 264.7 cells (ATCC, Manassas, VA, USA) were cultured in RPMI 1640 media
supplemented with 10% fetal bovine serum (FBS) in a humidified culture incubator containing 5% CO
2
at 37
C. Cells were seeded into 12-well plates (Corning Inc., Corning, NY, USA) at a density of
0.5 ×106
and incubated for 24 h. Media was then replaced to serum-free media and cells were treated with RC
or RCA. After incubation for 12 h, cells were stimulated with 1 or 0.5
µ
g/mL lipopolysaccharide (LPS)
(Thermo Fisher Scientific, Waltham, MA, USA) for dierent hours depending on experiments in the
presence and absence of RC or RCA. For the gene expression, cells were treated with 1
µ
g/mL LPS for 3
h. On the completion of the incubation, total RNA and protein were extracted. Cytotoxicity of RC,
RCA, and LPS was determined as previously described [18].
2.3. Measurement of Intracellular ROS
To determine the cellular antioxidant eects of RC and RCA, cellular ROS levels were measured
using a 2’-7’-dichlorofluorescein diacetate (DCFDA), a fluorogenic dye. Cells were seeded in a
black-24-well plate (Corning Inc) at a density of 2.5
×
10
5
cells per well and incubated with serum-free
culture media containing RC or RCA for 12 h. The cells were then stimulated with LPS for 1 h in the
presence and absence of RC or RCA. After cells were washed with 1M HEPES buer (Thermo Fisher
Nutrients 2020,12, 1089 3 of 13
Scientific), they were incubated with phenol red- and serum-free culture media containing 10
µ
M
DCFDA for 1 h at 37
C in the dark. DCF fluorescence was measured at an excitation wavelength of
485 nm and an emission wavelength of 535 nm using a Biotek Synergy H1 microplate reader (Biotek,
Winooski, VT, USA). After the fluorescence was measured, total protein was extracted, and protein
concentrations were used to normalize fluorescent intensity. ROS levels were expressed as an arbitrary
unit of fluorescence intensity/µg total cell protein.
2.4. Quantitative Polymerase Chain Reaction (qPCR) Analysis
Total RNA was extracted using a Trizol and then cDNA was synthesized using XLAScript cDNA
MasterMix (Exella GmbH, Feucht, Germany) according to manufacturers’ instructions. The expression
of genes that are involved in the regulation of inflammation and antioxidant was examined using the
Fast Start Essential DNA Green Light Master kit (Roche, Indianapolis, IN, USA) in a LightCycler 96
(Roche) [
18
]. Primer sequences were designed using Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) and
confirmed using a Primer-Blast (NCBI database). Primer sequences were listed in Table 1. Ribosomal
protein L 32 (RPL32) was used as the housekeeping gene.
Table 1. Primer sequences for qPCR.
Gene Forward Reverse
COX2
GCCTACTACAAGTGTTTCTTTTTGCA
CATTTTGTTTGATTGTTCACACCAT
GAPDH GGTGGTCTCCTCTGACTTCAACA GTTGCTGTAGCCAAATTCGTTGT
IL1βGTCACAAGAAACCATGGCACAT GCCCATCAGAGGCAAGGA
iNOS AATCTTGGAGCGAGTTGTGG CAGGAAGTAGGTGAGGGCTTG
MCP1 CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA
NOX1 TTCACAGTTATTCATATCATTGC AGAGAACAGAAGCGAGAG
NRF2 CTCGCTGGAAAAAGAAGTG CCGTCCAGGAGTTCAGAGG
TNFαGGCTGCCCCGACTACGT
ACTTTCTCCTGGTATGAGATAGCAAAT
2.5. Enzyme-Linked Immunosorbent Assay (ELISA) for TNFα
RAW 264.7 cells were plated into 12-well plates at a density of 0.5
×
10
6
/well and incubated for
24 h. Cells were then treated with 0, 5, 10, and 20
µ
g/mL of RAC for 12 h and then treated with the same
samples and 1
µ
g/mL of LPS for 3 h. TNF
α
concentrations in the culture supernatant were measured
using an ELISA kit (eBioscience, San Diego, CA, USA) following the manufacturer’s instruction.
2.6. Western Blot Analysis
Total protein extraction and a Western blot analysis were performed as previously described [
18
].
To examine the inhibitory eects of RCA on translocation of NF-
κ
B between nuclear and cytoplasm,
cells had the same pretreatments with RCA described above and then were treated with RCA and
0.5
µ
g/mL LPS for 1 h [
19
]. Nuclear and cytoplasmic fractions were obtained using a nuclear extraction
kit (Cayman Chemical, Ann Harbor, MI, USA) according to the manufacturer’s instruction. To find
each incubation time that produces the highest amount of iNOS, COX2, and p47
phox
proteins, cells
were treated with 0.5
µ
g/mL LPS during dierent hours. Based on this result, cells were treated
with RCA and LPS for 12 h and for 3 h for determining eects of RCA on iNOS, COX2, and p47
phox
proteins, respectively after RCA pretreatment. Primary antibodies were used as follows: rabbit
anti-mouse COX2, iNOS, and NADPH oxidase 1 (NOX1 (1:1000, ABclonal, Woburn, MA, USA),
anti-phospho-p47
phox
, anti-p47
phox
, and NF-
κ
B p65 (1:1000, Thermo Fisher Scientific), TATA-binding
protein (1:3000, Thermo Fisher Scientific), and
β
-actin (1:3000, Sigma-Aldrich, St. Louis, MO, USA).
Horseradish-peroxidase-conjugated secondary antibodies (goat anti-rabbit IgG and goat anti-mouse
IgG, 1:5000, Invitrogen, Carlsbad, CA, USA) were used.
Nutrients 2020,12, 1089 4 of 13
2.7. Identification and Quantification of Red Clover Polyphenols Using HPLC/ESI-MS Analysis
Separation, detection, and identification of polyphenols from RC were performed using an
HPLC/ESI-MS (Waters) according to the method of Cho et al. [
20
]. The identified polyphenols were
quantified by an HPLC (Waters) [
20
]. Polyphenols were detected at 330 nm and quantified as daidzein
equivalents. Total polyphenols were calculated as the sum of individual polyphenols. Anthocyanins
were quantified as delphinidin, cyanidin, petunidin, peonidin, and malvidin glucoside equivalents at
510 nm. Total anthocyanins were calculated as the sum of individual anthocyanin monoglucosides.
2.8. Statistical Analysis
Data were analyzed using a one-way analysis of variance with Tukey’s post hoc analysis (Prism
7.0, Graphpad Software Inc., San Diego, CA, USA). Pvalues less than 0.05 were considered significant.
Data were presented as mean ±standard deviation.
3. Results
3.1. RC and RCA Decreased the Expression of Genes Related to Pro-Inflammatory Markers
To examine the anti-inflammatory eects of RC and RCA, the expression of genes that encode
pro-inflammatory markers was measured in LPS-stimulated RAW 264.7 cells with or without treatment
of RC or RCA at 5, 10, or 20
µ
g/mL. LPS increased the expression of TNF
α
,IL1
β
,iNOS, monocyte
chemoattractant protein (MCP)1, and COX2 genes. The LPS-stimulated expressions of TNF
α
,IL1
β
,
and iNOS genes were attenuated by 5 and 10
µ
g/mL RC (Figure 1A–C). No additional reduction was
observed in the cells that were treated with 20
µ
g/mL RC. As shown in Figure 1D and E, LPS-induced
MCP1 and COX2 genes were also downregulated by 5
µ
g/mL RC up to 64.4%
±
1.1% and 39.9%
±
2.6%, without further reduction in higher concentrations of RC. However, RCA did not alleviate the
LPS-induced TNF
α
gene (Figure 1F). Cells treated with 5
µ
g/mL RCA exhibited strong suppression
on LPS-induced IL1
β
,iNOS, and MCP1 genes (Figure 1G–I). COX2 gene expression showed a similar
suppression at 5
µ
g/mL RCA compared to the same concentration of RC (Figure 1J). RCA at 10 or
20
µ
g/mL did not show further inhibitory eect. Although LPS-induced TNF
α
gene expression was
not aected by RCA, the secretion of TNF
α
from macrophage cells into the media was significantly
inhibited by RCA in a dose-dependent manner (Figure 1K). The inhibition of 5, 10, and 20
µ
g/mL RCA
was approximately 10%, 15%, and 25%, respectively.
Nutrients 2020,12, 1089 5 of 13
Nutrients 2019, 11, x FOR PEER REVIEW 5 of 13
Figure 1.
The eect of red clover extract (RC) and red clover anthocyanins fraction (RCA) on gene expression and TNF
α
secretion in LPS-stimulated RAW 264.7
macrophages. Expression of genes related to pro-inflammatory markers was determined in LPS-stimulated RAW 264.7 cells that were treated with or without RC
(AE) or RCA (FJ) at concentrations of 5, 10, or 20 µg/mL. (K) Concentrations of TNFαthat was released in the media were measured. A dierent letter indicates a
statistically significant dierence (P<0.05). +and - indicate the presence and absence of LPS, RC, or RCA, respectively.
Nutrients 2020,12, 1089 6 of 13
3.2. RC and RCA Inhibited LPS-Induced ROS Production
LPS produced a significant amount of cellular ROS in RAW 264.7 cells (Figure 2A). RC or RCA at
5 and 10
µ
g/mL inhibited LPS-induced ROS production to the lower level than that of control cells that
were not stimulated by LPS.
Nutrients 2019, 11, x FOR PEER REVIEW 6 of 13
Figure 1. The effect of red clover extract (RC) and red clover anthocyanins fraction (RCA) on gene
expression and TNFα secretion in LPS-stimulated RAW 264.7 macrophages. Expression of genes
related to pro-inflammatory markers was determined in LPS-stimulated RAW 264.7 cells that were
treated with or without RC (AE) or RCA (FJ) at concentrations of 5, 10, or 20 μg/mL. (K)
Concentrations of TNFα that was released in the media were measured. A different letter indicates a
statistically significant difference (P < 0.05). + and - indicate the presence and absence of LPS, RC, or
RCA, respectively.
3.2. RC and RCA Inhibited LPS-Induced ROS Production
LPS produced a significant amount of cellular ROS in RAW 264.7 cells (Figure 2A). RC or RCA
at 5 and 10 μg/mL inhibited LPS-induced ROS production to the lower level than that of control cells
that were not stimulated by LPS.
Figure 2. The effect of RCA on intracellular ROS production and the expression of gene and proteins
related to oxidative stress. (A) Intracellular ROS levels were determined in LPS-stimulated RAW 264.7
cells that were treated with or without 5 or 10 μg/mL RC or RCA. NOX1 (B) and NRF2 (D) genes were
measured using qPCR. (C) p47phox and its phosphorylation were determined using a Western blot. A
different letter indicates a statistically significant difference (P < 0.05). + and - indicate the presence
and absence of LPS, RC, or RCA, respectively.
To investigate the mechanism by which RCA inhibits LPS-induced ROS production, the
expression of genes and proteins that are involved in the regulation of ROS production were
determined (Figure 2B–D). NOX1 gene encoding a major producer of ROS was significantly
upregulated by LPS, whereas this induction was completely prevented in the cells that were treated
with 5 μg/mL RCA (Figure 2B). When RAW 264.7 cells were incubated with LPS for 3 h, the strongest
Figure 2.
The eect of RCA on intracellular ROS production and the expression of gene and proteins
related to oxidative stress. (
A
) Intracellular ROS levels were determined in LPS-stimulated RAW 264.7
cells that were treated with or without 5 or 10
µ
g/mL RC or RCA. NOX1 (
B
) and NRF2 (
D
) genes were
measured using qPCR. (
C
) p47
phox
and its phosphorylation were determined using a Western blot. A
dierent letter indicates a statistically significant dierence (P<0.05). +and - indicate the presence and
absence of LPS, RC, or RCA, respectively.
To investigate the mechanism by which RCA inhibits LPS-induced ROS production, the expression
of genes and proteins that are involved in the regulation of ROS production were determined
(Figure 2B–D). NOX1 gene encoding a major producer of ROS was significantly upregulated by LPS,
whereas this induction was completely prevented in the cells that were treated with 5
µ
g/mL RCA
(Figure 2B). When RAW 264.7 cells were incubated with LPS for 3 h, the strongest phosphorylation
on p47
phox
, a 47 kDa cytosolic subunit of NOX1 protein was observed, which was reduced by the
treatment of dierent concentrations of RCA (Figure 2C). RCA at 20
µ
g/ml showed the most significant
inhibition. NRF2, a transcriptional factor that regulates response to oxidative stress and inflammation
was also induced by LPS (Figure 2D). RCA at 5
µ
g/mL reversed the expression of LPS-induced NRF2
gene to the same expression level of the cells that were not stimulated by LPS. RAC at 10 and 20
µ
g/mL
Nutrients 2020,12, 1089 7 of 13
suppressed the expression of NRF2 gene to the lower level than that of cells that were not stimulated
by LPS.
3.3. RCA Inhibited the Activation of NF-kB in LPS-Induced RAW 264.7 Cells
To decide LPS-incubation time that produced the highest amount of iNOS and COX2 proteins,
RAW 264.7 cells were incubated with LPS for 30 min, 1, 3, 6, and 12 h and then proteins were examined.
The highest induction of both iNOS and COX2 proteins was observed after a 12 h-LPS-exposure
(Figure 3A). Under this condition, LPS-stimulated iNOS protein was decreased by 5 and 10
µ
g/mL RCA,
but there was no further reduction in cells treated with 20
µ
g/mL RCA (Figure 3B). LPS-stimulated
COX2 protein was almost completely abolished in the cells that were treated with 20
µ
g/mL RCA
(Figure 3C).
To examine whether the RCA inhibited genes and proteins of pro-inflammatory markers by
regulating activation of NF-
κ
B, activation of NF-
κ
B that is indicated by translocation of p65 protein, a
subunit component of NF-kB from the cytosol to nucleus was determined by measuring the relevant
amount of p65 protein in cytosol and nucleus of cells that were treated with or without LPS in the
absence or presence of RCA (Figure 3D). p65 protein was relatively increased in the nuclear when
the cells were stimulated by LPS, compared to that in the cytosol. The increased translocation in the
nuclear was attenuated by RCA.
Nutrients 2020,12, 1089 8 of 13
Nutrients 2019, 11, x FOR PEER REVIEW 8 of 13
Figure 3. The effect of RCA on NF-kB, iNOS, and COX2 proteins. RAW 264.7 cells were pre-incubated with 5, 10, or 20 μg/mL RCA and then stimulated by 0.5 μg/mL LPS
in the presence or absence of RCA. (A) RAW 264.7 cells were stimulated by 0.5 μg/mL LPS for 30 min, 1, 3, 6, and 12 h and then iNOS and COX2 proteins were measured.
(B) iNOS and (C) COX2 proteins were determined in RAW 264.7 cells after 12 h-LPS exposure in the presence or absence of RCA. (D) p65 of NF-κB protein was determined
in nuclear and cytoplasm of RAW 264.7 cells after 1 h-LPS exposure in the presence or absence of RCA. TBP and β-actin proteins were used as housekeeping proteins in
nuclear and cytoplasm, respectively. A different letter indicates a statistically significant difference (p < 0.05).
Figure 3.
The eect of RCA on NF-kB, iNOS, and COX2 proteins. RAW 264.7 cells were pre-incubated with 5, 10, or 20
µ
g/mL RCA and then stimulated by 0.5
µ
g/mL
LPS in the presence or absence of RCA. (
A
) RAW 264.7 cells were stimulated by 0.5
µ
g/mL LPS for 30 min, 1, 3, 6, and 12 h and then iNOS and COX2 proteins were
measured. (
B
) iNOS and (
C
) COX2 proteins were determined in RAW 264.7 cells after 12 h-LPS exposure in the presence or absence of RCA. (
D
) p65 of NF-
κ
B protein
was determined in nuclear and cytoplasm of RAW 264.7 cells after 1 h-LPS exposure in the presence or absence of RCA. TBP and
β
-actin proteins were used as
housekeeping proteins in nuclear and cytoplasm, respectively. A dierent letter indicates a statistically significant dierence (p<0.05).
Nutrients 2020,12, 1089 9 of 13
3.4. Identification and Quantification of Red Clover Polyphenols
As shown in Table 2, 27 peaks were identified from RC at the wavelength of 330 nm. Individual
compounds were reported as
µ
g daidzein equivalents/g of RC. The peak eluting at 37 min which showed
the highest concentration (24560.7
±
60.7
µ
g daidzein equivalents/g of RC, 449,287 m/z) was unknown
tetrahydroxyflavone glucoside, followed by a peak eluding at 38.9 min (17933.8
±
123.6
µ
g daidzein
equivalents/g of RC, 519,271 m/z) which was identified as gemosteom-7-O-
β
-D-glucoside-6”-malonate.
Other abundant polyphenols having concentrations of more than 10,000
µ
g daidzein equivalents/g of
RC were confirmed as genistin (peak 6,12892.3
±
35.6
µ
g daidzein equivalents/g of RC, 433,271,153 m/z)
and kaempferol or luteolin (peak 16 12876 ±16.1 272 m/z)
Table 2. Identification and quantification of isoflavones of red clover.
Number RT (min) Isoflavone Derivatives Amount (µg/g dw) [M-H]-m/z
1 27.1 Luteolin 7-O-β-D-glucoside 368.5 ±14.7 449, 287
2 28.7 unknown tetrahydroxyflavone glucoside 2394.3 ±28.0 449, 287
3 29.2 unknown tetrahydroxyflavone glucoside 1356.2 ±18.0 449, 287
4 31.5 Isoquercitrin-6”-O-malonate 1677.9 ±20.9 551, 303
5 32.3 Pratensein-7-O-β-D-glucoside 682.1 ±6.3 463, 301
6 33.4 Genistin 12892.3 ±35.6 433, 271, 153
7 33.9 Hyperoside 3103.0 ±20.9 465, 303
8 34.3 Isoquercetriin 8940.1 ±16.6 465, 303
9 35.0 Apigenin-7-O-β-D-glucoside 512.1 ±1.7 433, 271
10 36.1 Pseudobaptigenin 5809.6 ±14.0 283
11 37.0 unknown tetrahydroxyflavone glucoside 24560.7 ±60.7 449, 287
12 38.4 Kaempferol or Luteolin 5022.7 ±37.8 287
13 38.9 Gemosteom-7-O-β-D-glucoside-6”-O-malonate 17933.8 ±123.6 519, 271
14 39.3 unknown tetrahydroxyflavone glucoside 2691.2 ±13.6 449, 287
15 40.2 3-methylquercetin-7-O-β-D-glucoside 7838.7 ±7.6 479, 317
16 42.7 Kaempferol or Luteolin 12876.9 ±16.1 287
17 44.3 Pratensein-7-O-β-D-glucoside-6”-malonate 2437.5 ±8.8 549, 317
18 44.9 Pseudobaptigenin-7-O-β-D-glucoside 2280.1 ±8.4 445, 283
19 45.5 Kaempferol or Luteolin 2213.7 ±9.1 287
20 46.7 Glycitein 312.1 ±15.1 285, 167
21 47.5
Pseudobaptigenin-7-O-
β
-D-glucoside-6”-O-malonate
2361.1 ±47.3 445, 283, 137
22 52.2 Formononetin-7-O-β-D-glucoside-6”-O-malonate 2231.1 ±19.0 517, 269
23 53.7 Calysosin-Glucoside-Malonate 213.7 ±15.9 533, 285, 137
24 57.0 Prunetin-40-O-β-D-glucoside-6”-O-malonate 2089.3 ±38.1 533, 285
25 58.7 Formononetin 497.3 ±13.6 269, 137
26 60.2 Biochanin A-7-O-β-D-glucoside-6”-O-malonate 3713.8 ±3.1 533, 285
27 66.8 Biochanin A 1059.8 ±14.8 285
Total 128069.5 ±628.9
Values represent means ±standard deviation, RT: retention time, dw: dried weight.
Anthocyanins were identified at a wavelength of 550 nm (Table 3). Individual compounds were
reported as
µ
g cyanidin-3-glucoside, delphinidin-3-glucoside, petunidin-3-glucoside, peonidin-3-glucoside,
and malvidin-3-glucoside equivalents per g of RC. Based on the quantification of an individual compound,
malvidin-3-O-galactoside was a major anthocyanin of RC, being eluted at 36.3 min (peak 6, 2129.4
±
6.6 malvidin-3-glucoside equivalents/g of RC, 493,331 m/z). As the second abundant molecule of
anthocyanin in RC, peonidin-3-O-monogalactoside was identified in a peak 5 eluting at 34.4 min (633.6
±
5.5
peonidin-3-glucoside equivalents/g of RC, 463,301 m/z).
Nutrients 2020,12, 1089 10 of 13
Table 3. Identification and quantification of anthocyanins of red clover.
Number RT (min) Anthocyanins Amount (µg/g dw) [M-H]-m/z
1 27.5 Delphinidin-3, 5-O-diglucoside 139.0 ±1.1 627, 465, 303
2 29.9 Cyanidin-3-O-galactoside 380.3 ±2.2 449,287
3 31.5 Cyanidin-3-O-glucoside 47.7 ±3.3 449,287
4 33.5 Petunidin-3-O-galactoside 145.5 ±4.4 479,317
5 34.4 Peonidin-3-O-galactoside 633.6 ±5.5 463,301
6 36.3 Malvidin-3-O-galactoside 2129.4 ±6.6 493,331
7 37.3 Petunidin-3-O-rutinoside 123.9 ±7.7 625,479,317
Total 3599.5 ±10.4
Values represent means ±standard deviation, RT: retention time, dw: dried weight.
4. Discussion
This study determined anti-inflammatory and antioxidant eects of anthocyanins of red clover
using LPS-stimulated macrophage cells and identified and quantified anthocyanins and other dietary
compounds of red clover. RC that was extracted using DMSO inhibited the secretion of TNF
α
and
IL6 and suppressed iNOS, COX2, and NF-
κ
B proteins in LPS-stimulated RAW 264.7 cells [
17
]. Muller
et al. showed that isoflavones such as biochanin A, genistein, and daidzein were responsible for the
anti-inflammatory eect of red clover [
17
]. In this study, both RC and RCA suppressed LPS-induced
IL1
β
,iNOS,MCP1, and COX2 genes. This indicates that anthocyanins of red clover may be critical
for the anti-inflammatory eects of red clover. RC reduced LPS-induced TNF
α
gene expression in
this study, but this gene was not changed by RCA. Interestingly, without a change in TNF
α
gene
expression, the secretion of TNF
α
was suppressed by RCA. Chemokines, e.g., TNF
α
are regulated
by post-transcriptional regulation by controlling RNA stability and/or translational regulation [
21
].
Mice deleting TNF AU-rich elements (ARE) in the 3
´
-untranslated region of a transcript encoding
TNF
α
exhibited increased secretion of TNF
α
by decreasing a rate of TNF
α
decay and translational
repression in hemopoietic and stromal cells [
22
]. Therefore, RCA may suppress LPS-induced TNF
α
secretion by controlling translational inhibition without a change in RNA stability. Consistent with
RCA-suppressed genes and proteins related to cytokines and inflammatory enzymes, translocation
of p65 subunit of NF-
κ
B into the nucleus was inhibited by RCA in this study. This indicates that the
anti-inflammatory eects of anthocyanins of red clover may be mediated by regulating the NF-
κ
B
signaling pathway.
In response to LPS-induced cytokines, iNOS and COX2 catalyze the production of NO and
prostaglandin E2, respectively, which are potent pro-inflammatory mediators [
23
]. In this study,
LPS-induced both iNOS and COX2 genes and proteins were suppressed by RCA. The iNOS positively
regulates NOX which produces superoxide by transferring electrons from NADPH to oxygen [
24
,
25
].
Under stimulated conditions, e.g., LPS, NOX enzymes are activated by protein–protein interactions via
its cytosolic subunits (p47
phox
, p67
phox
, and p40
phox
) and membrane subunits (small-G-protein, Rac1,
or Rac 2) and by phosphorylation of p47
phox
[
26
]. Moreover, p47
phox
is a critical organizer to bring
these subunits to complexes by its localization to the membrane and its phosphorylation-induced
conformational changes on the protein [
25
]. In this study, LPS-induced NOX1 gene and phosphorylation
on p47
phox
were completely abolished by RCA treatment at 5 and 20
µ
g/mL, respectively, which
supports reduced intracellular ROS production. Because LPS-induced NOX1 is NF-
κ
B dependent [
27
],
our findings indicate that RCA modulates cellular oxidative stress by suppressing NOX1 through
reduced NF-κB.
When ROS increases in the body, the antioxidant system is promoted to remove free radicals.
NRF2 is a major transcriptional factor to regulate genes and proteins that are involved in the antioxidant
system. LPS-stimulated RAW 264.7 cells that were treated with berry anthocyanins showed a significant
decrease in NRF2 and its downstream genes including catalase and superoxide dismutase [
28
]. Extracts
from red clover showed high antioxidant activities using ABTS radical, DPPH radical, hydrogen
Nutrients 2020,12, 1089 11 of 13
peroxide, and superoxide radical scavenging assays [
29
], which may be eective at cellular levels. In this
study, LPS-induced ROS production led to an increase in NRF2 gene expression, which activates cellular
antioxidant systems to remove ROS. NRF2 gene expression was reduced by RCA, due to possibly either
less ROS production by decreased NOX1 or anthocyanins’ antioxidant activities. Consistent with this,
NOX1 gene and phosphorylation of p47
phox
were reduced to the basal level of cells untreated with LPS
and samples, but LPS-stimulated cells with RC or RCA exhibited lower ROS levels than the basal level,
suggesting that further ROS reduction beyond the NOX1 and its regulation observed in this study
may be caused by the antioxidant activity of red clover, especially its anthocyanins [
29
]. Therefore, its
anthocyanins may save NRF2 activity by directly removing ROS using its strong antioxidant capacity.
Some dietary compounds that are previously found in red clover [
30
], were also identified in
this study, but additional dietary compounds were identified, which may be due to detection at a
dierent wavelength. Cyanidin-3-O-sophoroside and cyanidin-3-O-sambubioside were identified
as major anthocyanins from red clover using thin-layer chromatography [
31
]. However, these
compounds were not identified in this study using LC-MS. This discrepancy results from dierent
methodologies and approaches for extraction and identification. In this study, malvidin-3-O-galactoside
was the most abundant anthocyanin of red clover. Although malvidin-3-glucose had a
higher anti-inflammatory eect than malvidin-3-O-galactoside, malvidin-3-O-galactoside also
suppressed the expression of MCP1, intracellular adhesion molecule-1, and vascular cell adhesion
molecule-1 genes and proteins by inhibiting IkB degradation and translocation of p65 protein
of NF-kB in TNF
α
-stimulated human umbilical vein endothelial cells [
12
]. Other anthocyanins
detected in the red clover including peonidin-3-O-monogalactoside, cyanidin-3-O-monogalactoside,
cyanidin-3-O-monoglucoside, petunidin-3-O-monogalactoside, delphinidin-3,5-O-diglucoside, and
petunidin-3-O-rutinoside are also found in blueberry, concord grape, and myrtle berry, which have
strong antioxidant and anti-inflammatory eects [28,32,33].
5. Conclusions
In summary, anthocyanins of red clover inhibit LPS-induced inflammation and oxidation in
macrophages
in vitro
. This study only tested RC and RCA’s eects on RC and RCA-pretreated
cells, followed by LPS stimulation. Therefore, this indicates RC and RCA’s protective eects on
acute LPS-stimulated inflammation and oxidation. Further studies taking into account pre-existing
inflammation
in vitro
and
in vivo
using animals and humans such as arthritis, Crohn’s disease, are
needed to clarify anti-inflammatory and antioxidant eects of red clover and its anthocyanins.
Author Contributions:
S.G.L. and H.W.K worked on the conceptualization, data curation, and visualization.
S.G.L., H.W.K., C.R.B., and S.-O.L. worked on the methodology and validation. S.G.L., C.R.B., and S.-O.L. worked
on the formal analysis and investigation. S.G.L. worked on writing—original draft preparation. S.G.L., H.W.K.,
and S.-O.L. worked on the writing—review and editing. H.W.K. worked on funding acquisition. All authors have
read and agreed to the published version of the manuscript.
Funding: This work was supported by the United States Department of Agriculture (NC.X-310-5-18-170-1).
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Coates, P.M.; Blackman, M.; Betz, J.; Cragg, G.M.; Levine, M.; Moss, J.; White, J.D. Encyclopedia of Dietary
Supplements; CRC Press: New York, NY, USA, 2010; pp. 665–679.
2.
Booth, N.L.; Piersen, C.E.; Banuvar, S.; Geller, S.E.; Shulman, L.P.; Farnsworth, N.R. Clinical studies of red
clover (Trifolium pratense) dietary supplements in menopause: A literature review. Menopause
2006
,13,
251–264. [CrossRef] [PubMed]
3. Van de Weijer, P.H.; Barentsen, R. Isoflavones from red clover (Promensil) significantly reduce menopausal
hot flush symptoms compared with placebo. Maturitas 2002,42, 187–193. [CrossRef]
Nutrients 2020,12, 1089 12 of 13
4.
Lipovac, M.; Chedraui, P.; Gruenhut, C.; Gocan, A.; Stammler, M.; Imhof, M. Improvement of postmenopausal
depressive and anxiety symptoms after treatment with isoflavones derived from red clover extracts. Maturitas
2010,65, 258–261. [CrossRef] [PubMed]
5.
Hidalgo, L.A.; Chedraui, P.A.; Morocho, N.; Ross, S.; San Miguel, G. The eect of red clover isoflavones on
menopausal symptoms, lipids and vaginal cytology in menopausal women: A randomized, double-blind,
placebo-controlled study. Gynecol. Endocrinol. 2005,21, 257–264. [CrossRef]
6.
Castaneda-Ovando, A.; de Lourdes Pacheco-Hern
Ã
¡ndez, M.; P
Ã
¡ez-Hern
Ã
¡ndez, M.E.; Rodr
Ã
guez, J.A.;
Gal
Ã
¡n-Vidal, C.A. Chemical studies of anthocyanins: A review. Food Chem.
2009
,113, 859–871. [CrossRef]
7.
Yousuf, B.; Gul, K.; Wani, A.A.; Singh, P. Health benefits of anthocyanins and their encapsulation for potential
use in food systems: A review. Crit. Rev. Food Sci. Nutr. 2016,56, 2223–2230. [CrossRef]
8.
Zhu, Y.; Ling, W.; Guo, H.; Song, F.; Ye, Q.; Zou, T.; Li, D.; Zhang, Y.; Li, G.; Xiao, Y.; et al. Anti-inflammatory
eect of purified dietary anthocyanin in adults with hypercholesterolemia: A randomized controlled trial.
Nutr. Metab. Cardiovasc. Dis. 2013,23, 843–849. [CrossRef]
9.
Selvaraju, V.; Ayine, P.; Fadamiro, M.; Babu, J.R.; Brown, M.; Geetha, T. Urinary biomarkers of inflammation
and oxidative stress are elevated in obese children and correlate with a marker of endothelial dysfunction.
Oxid. Med. Cell Longev. 2019,2019, 9604740. [CrossRef]
10. Tsuda, T. Dietary anthocyanin-rich plants: Biochemical basis and recent progress in health benefits studies.
Mol. Nutr. Food Res. 2012,56, 159–170. [CrossRef]
11.
Tak, P.P.; Firestein, G.S. NF-kappaB: A key role in inflammatory diseases. J. Clin. Invest.
2001
,107, 7–11.
[CrossRef]
12.
Huang, W.Y.; Liu, Y.M.; Wang, J.; Wang, X.N.; Li, C.Y. Anti-inflammatory eect of the blueberry anthocyanins
malvidin-3-glucoside and malvidin-3-galactoside in endothelial cells. Molecules
2014
,19, 12827–12841.
[CrossRef]
13.
Decendit, A.; Mamani-Matsuda, M.; Aumont, V.; Wao-Teguo, P.; Moynet, D.; Boniface, K.; Richard, E.;
Krisa, S.; Rambert, J.; Merillon, J.M.; et al. Malvidin-3-O-beta glucoside, major grape anthocyanin, inhibits
human macrophage-derived inflammatory mediators and decreases clinical scores in arthritic rats. Biochem.
Pharmacol. 2013,86, 1461–1467. [CrossRef]
14.
Serra, D.; Paixao, J.; Nunes, C.; Dinis, T.C.; Almeida, L.M. Cyanidin-3-glucoside suppresses cytokine-induced
inflammatory response in human intestinal cells: Comparison with 5-aminosalicylic acid. PLoS ONE
2013
,8,
e73001. [CrossRef]
15.
Li, K.; Zhang, M.; Chen, H.; Peng, J.; Jiang, F.; Shi, X.; Bai, Y.; Jian, M.; Jia, Y. Anthocyanins from black peanut
skin protect against UV-B induced keratinocyte cell and skin oxidative damage through activating Nrf 2
signaling. Food Funct. 2019,10, 6815–6828. [CrossRef]
16.
Krenn, L.; Paper, D.H. Inhibition of angiogenesis and inflammation by an extract of red clover (Trifolium
pratense L.). Phytomedicine Int. J. Phytother. Phytopharm. 2009,16, 1083–1088. [CrossRef]
17.
Mueller, M.; Hobiger, S.; Jungbauer, A. Red clover extract: A source for substances that activate
peroxisome proliferator-activated receptor Î
±
and ameliorate the cytokine secretion profile of
lipopolysaccharide-stimulated macrophages. Menopause 2010,17, 379–387. [CrossRef]
18.
Lee, S.G.; Parks, J.S.; Kang, H.W. Quercetin, a functional compound of onion peel, remodels white adipocytes
to brown-like adipocytes. J. Nutr. Biochem. 2017,42, 62–71. [CrossRef]
19.
Park, Y.K.; Rasmussen, H.E.; Ehlers, S.J.; Blobaum, K.R.; Lu, F.; Schlegal, V.L.; Carr, T.P.; Lee, J.Y. Repression of
proinflammatory gene expression by lipid extract of Nostoc commune var sphaeroides Kutzing, a blue-green
alga, via inhibition of nuclear factor-kappaB in RAW 264.7 macrophages. Nutr. Res. (New York, NY.)
2008
,28,
83–91. [CrossRef]
20.
Cho, M.J.; Howard, L.R.; Prior, R.L.; Clark, J.R. Flavonoid glycosides and antioxidant capacity of various
blackberry, blueberry and red grape genotypes determined by high-performance liquid chromatography/mass
spectrometry. J. Sci. Food Agric. 2004,84, 1771–1782. [CrossRef]
21.
Fan, J.; Heller, N.M.; Gorospe, M.; Atasoy, U.; Stellato, C. The role of post-transcriptional regulation in
chemokine gene expression in inflammation and allergy. Eur. Respir. J. 2005,26, 933–947. [CrossRef]
22.
Kontoyiannis, D.; Pasparakis, M.; Pizarro, T.T.; Cominelli, F.; Kollias, G. Impaired on/oregulation
of TNF biosynthesis in mice lacking TNF AU-rich elements: Implications for joint and gut-associated
immunopathologies. Immunity 1999,10, 387–398. [CrossRef]
Nutrients 2020,12, 1089 13 of 13
23.
Surh, Y.J.; Chun, K.S.; Cha, H.H.; Han, S.S.; Keum, Y.S.; Park, K.K.; Lee, S.S. Molecular mechanisms underlying
chemopreventive activities of anti-inflammatory phytochemicals: Down-regulation of COX-2 and iNOS
through suppression of NF-kappa B activation. Mutat. Res. 2001,480, 243–268. [CrossRef]
24.
Murakami, A.; Ohigashi, H. Targeting NOX, INOS and COX-2 in inflammatory cells: Chemoprevention
using food phytochemicals. Int. J. Cancer 2007,121, 2357–2363. [CrossRef]
25.
Bedard, K.; Krause, K.H. The NOX family of ROS-generating NADPH oxidases: Physiology and
pathophysiology. Physiol. Rev. 2007,87, 245–313. [CrossRef]
26.
El-Benna, J.; Dang, P.M.; Gougerot-Pocidalo, M.A.; Marie, J.C.; Braut-Boucher, F. p47
phox
, the phagocyte
NADPH oxidase/NOX2 organizer: Structure, phosphorylation and implication in diseases. Exp. Mol. Med.
2009,41, 217–225. [CrossRef]
27.
O
0
Leary, D.P.; Bhatt, L.; Woolley, J.F.; Gough, D.R.; Wang, J.H.; Cotter, T.G.; Redmond, H.P. TLR-4 signalling
accelerates colon cancer cell adhesion via NF-kappaB mediated transcriptional up-regulation of Nox-1.
PLoS ONE 2012,7, e44176. [CrossRef]
28.
Lee, S.G.; Kim, B.; Yang, Y.; Pham, T.X.; Park, Y.K.; Manatou, J.; Koo, S.I.; Chun, O.K.; Lee, J.Y. Berry
anthocyanins suppress the expression and secretion of proinflammatory mediators in macrophages by
inhibiting nuclear translocation of NF-kappaB independent of NRF2-mediated mechanism. J. Nutr. Biochem.
2014,25, 404–411. [CrossRef]
29.
Khorasani Esmaeili, A.; Mat Taha, R.; Mohajer, S.; Banisalam, B. Antioxidant activity and total phenolic and
flavonoid content of various solvent extracts from
in vivo
and
in vitro
grown Trifolium pratense L. (Red
Clover). Biomed Res. Int. 2015,2015, 643285. [CrossRef]
30.
Booth, N.L.; Overk, C.R.; Yao, P.; Burdette, J.E.; Nikolic, D.; Chen, S.N.; Bolton, J.L.; Van Breemen, R.B.;
Pauli, G.F.; Farnsworth, N.R. The chemical and biologic profile of a red clover (Trifolium pratense L.) phase
II clinical extract. J. Altern. Complement. Med. 2006,12, 133–139. [CrossRef]
31.
Dedio, W.; Clark, K.W. Influence of cytokinins on isoflavone and anthocyanin synthesis in red clover seedlings.
Pestic. Sci. 1971,2, 65–68. [CrossRef]
32.
Wu, X.; Prior, R.L. Systematic identification and characterization of anthocyanins by HPLC-ESI-MS/MS in
common foods in the United States: Fruits and berries. J. Agric. Food Chem.
2005
,53, 2589–2599. [CrossRef]
33.
Jabri, M.A.; Rtibi, K.; Ben-Said, A.; Aouadhi, C.; Hosni, K.; Sakly, M.; Sebai, H. Antidiarrhoeal, antimicrobial
and antioxidant eects of myrtle berries (Myrtus communis L.) seeds extract. J. Pharm. Pharmacol.
2016
,68,
264–274. [CrossRef]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
... Although the immune response plays an important role in eliminating pathogens, excessive release of inflammatory cytokines causes the destruction of tissue structure [40]. AC showed anti-inflammatory activity in vitro and in vivo, such as reducing the excessive release of pro-inflammatory mediator NO and cytokines (IL-1β, IL-6, IL-8, TNF-α etc.) in RAW 264.7 macrophages, and its intake was a strategy to prevent and inhibit inflammation [41,42]. Also, bilberry extract inhibited intestinal inflammation in mice, reduced intestinal bleeding and improved intestinal histological structure [43]. ...
Article
Full-text available
Anthocyanins (AC) showed positive effects on improving the intestinal health and alleviating intestinal pathogen infections, therefore, an experiment was conducted to explore the protective effects of supplemented AC on Salmonella-infected chickens. A total of 240 hatchling chickens were randomly allocated to 4 treatments, each with 6 replicates. Birds were fed a basal diet supplemented with 0 (CON, and ST), 100 (ACL) and 400 (ACH) mg/kg of AC for d 60, and orally challenged with PBS (CON) or 109 CFU/bird (ST, ACL, ACH) Salmonella Typhimurium at d 14 and 16. (1) Compared with birds in ST, AC supplementation increased the body weight (BW) at d 18 and the average daily gain (ADG) from d 1 to 18 of the Salmonella-infected chickens (P < 0.05); (2) AC decreased the number of Salmonella cells in the liver and spleen, the contents of NO in plasma and inflammatory cytokines in ileal mucosa of Salmonella-infected chickens (P < 0.05); (3) Salmonella infection decreased the ileal villi height, villi height to crypt depth (V/C), and the expression of zonulaoccludins-1 (ZO-1), claudin-1, occludin, and mucin 2 (MUC2) in ileal mucosa. AC supplementation relieved these adverse effects, and decreased ileal crypt depth (P < 0.05); (4) In cecal microbiota of Salmonella-infected chickens, AC increased (P < 0.05) the alpha-diversity (Chao1, Pd, Shannon and Sobs indexes) and the relative abundance of Firmicutes, and decreased (P < 0.05) the relative abundance of Proteobacteria and Bacteroidota and the enrichment of drug antimicrobial resistance, infectious bacterial disease, and immune disease pathways. Dietary AC protected chicken against Salmonella infection via inhibiting the Salmonella colonization in liver and spleen, suppressing secretion of inflammatory cytokines, up-regulating the expression of ileal barrier-related genes, and ameliorating the composition and function of cecal microbes. Under conditions here used, 100 mg/kg bilberry anthocyanin was recommended.
... LPS considered one of the almost important stimuli used to upgrade pro-in ammatory Page 3/18 protein arranging such as inducible nitric oxide synthase (i-NOS) and cyclooxygenase-2 (COX-2) which is in charge of the high standards of prostaglandin spotted in various in ammatory confuses. Furthermore, i-NOS develop huge quantities of NO, which is considered to be important for showing a necessary role in the in ammation [10]. Beside, the highly reactive nitric oxide becomes more sensitive when it is linked with oxygen and thus produces highly reactive compounds which can cause some provisions cellular damage such as; cellular DNA fragmentation and lipid peroxidation [11]. ...
Preprint
Full-text available
The impact of household processes on fenugreek leaves and seeds was analyzed for total phenolic (TP) and total flavonoid content (TF), and in-vitro biological activities such as antioxidant, antimicrobial, and anti-inflammatory properties. Processes included air-drying of leaves and germinating, soaking, and boiling of seeds. Air-dried fenugreek leaves (ADFL) had high TP (15.27 mg GAE/g D.W.) and TF (7.71 mg QE/g D.W.). The TF of unprocessed, germinated, soaked, and boiled seeds had 6.54, 5.60, 4.59, and 3.84 mg GAE/g D.W., respectively. The TF in UFS, GFS, SFS, and BFS were 4.23, 2.11, 2.10, and 2.33 mg QE/g D.W., respectively. Sixteen phenolic and nineteen flavonoid compounds were identified using the HPLC. Antioxidant activity using DPPH • , ABTS +• , and FRAP • assays indicated that ADFL had high activity. Antimicrobial activity was evaluated against each eight pathogenic bacterial and fungal strains. ADFL showed a strong activity with MIC values ranging from 0.03 to 1.06 and 0.04 to 1.18 mg ml − 1 against bacterial and fungal strains, respectively. Anti-inflammatory activity was evaluated in-vitro against RAW 264.7 macrophage cells using of NO assay. Results revealed that ADFL had the highest cytotoxicity and anti-inflammatory activity according to NO assay. Household processes significantly declined the in-vitro biological properties of processed seeds.
... However, the chicory variety that was tested by Migliorini et al. (2019) was a salad type that is suited for human consumption. In contrast, red clover had TAC concentrations of 14, 22 and 24 mg/g in spring, summer and fall, respectively; at least 4-fold more than red clover evaluated by Lee et al. (2020), indicating that a high species and varietal variation exists for plant anthocyanin concentration. ...
Article
Pasture forbs are increasingly being incorporated in pasture systems for their high nutritive value and biologically active secondary compounds as our understanding of their functional roles advances. A 2-year study investigated the effects of varietal differences and companion legume species on forage dry matter (DM) production, nutritive value, and plant secondary composition of two chicory (Cichorium intybus L.) cultivars (Antler and Grasslands Puna) grown in monoculture and in binary mixtures with red clover (Trifolium pratense L.) or birdsfoot trefoil (Lotus corniculatus L.). Antler chicory out-yielded Grasslands Puna chicory in the 2017/2018 growing season but the superiority of Antler was not consistent in 2018/2019. Binary mixtures of chicory and red clover consistently provided greater DM yield and higher nutritive quality forage than chicory monocultures. Intercropping birdsfoot trefoil with chicory cultivar Grasslands Puna yielded more DM in 2018/2019 and had lower NDF content in summer compared to chicory monocultures, but not when intercropped with Antler. Intercropping led to increased condensed tannin (CT) concentrations in forages as compared to monocultures. Antler chicory contained 7.3 times more (CT) compared to Grasslands Puna, but there was no significant difference in their anthocyanin concentrations.
Article
Aging, a natural and inevitable physiological process, is the primary risk factor for all age-related diseases; it severely threatens the health of individuals and places a heavy burden on the public health-care system. Thus, strategies to extend the lifespan and prevent and treat age-related diseases have been gaining increasing scientific interest. Anthocyanins (ACNs) are a subclass of flavonoids widely distributed in fruits and vegetables. Growing evidence suggests that ACNs delay aging and relieve age-related diseases. However, owing to the low bioavailability of ACNs, their gut metabolites have been proposed to play a critical role in mediating health benefits. In this review, we introduce the biological fate of ACNs after consumption and highlight ACNs metabolites (phenolic acids) from intestinal microorganisms. Additionally, ACNs and gut metabolites exhibit outstanding anti-aging ability in Caenorhabditis elegans, Drosophila melanogaster, and mouse models, probably associated with increasing antioxidation, anti-inflammation, protein homeostasis, antiglycation, mitochondrial function, and inhibition of insulin/IGF-1 signaling (IIS). ACNs and gut metabolites have great application prospects as functional foods and drugs to delay aging and manage age-related diseases. Further investigation should focus on the interaction between ACNs and gut microbiota, including clarifying the complex metabolic pathway and maximizing the health effects of ACNs.
Conference Paper
For the prevention of the development of a number of CVDs the systematic use of dietary supplements containing antioxidant substances is promising. Squalene and chlorogenic acid are considered among the candidate substances. The natural sources of which are plants, for squalene is comfrey and for chlorogenic acid is meadow clover. The purpose of this work was to evaluate the presence of antimicrobial and antioxidant properties of squalene and chlorogenic acid obtained from in vitro root culture extracts of the respective plants. The implementation of this goal was carried out on the basis of the Laboratory for Biotesting of Natural Nutraceuticals ( Kemerovo State University, Russia). Conventional assessment methods were used: antimicrobial activity - using the disk diffusion method; antioxidant activity - by trapping ABTS radical cations. As a result, it was found that the BAS solutions under consideration did not show the ability to stimulate the viability of pathogenic, conditionally pathogenic strains. Squalene emulsion (800 –1600 µmol/L) showed high activity against E. coli B-8208. A solution of chlorogenic acid (100–1600 µmol/L) showed moderate activity against St. aureus B-6646, and from 400 to 1600 µmol/l - to P. putida B-1827. The results of the analysis showed that chlorogenic acid showed high antioxidant activity in comparison with ascorbic acid, and the squalene emulsion did not show antioxidant properties, i.e. did not catch ABTS radical cations. Presumably, the antioxidant activity of squalene is not expressed in the capture of free radicals, but in the ability to act on biomolecules that lead to oxidative stress. Chlorogenic acid is a promising antioxidant substance that does not stimulate the development of pathogenic strains, therefore, it is important to use it in the manufacture of prophylactic dietary supplements.
Article
Full-text available
The great importance of diet for health and high life-expectancy is established. The impact of nutrients on immune system is a point of growing research interest. Recent studies have found pro- and anti-inflammatory properties of some diet patterns and nutrients that can be used from the bench to the bedside for chronic low-grade inflammatory status correction. In this regard, the assessment of potential effects of nutrition on macrophage differentiation, proliferation, and functioning in health and disease is highly demanded. In this review, we present current data on the effects of nutrients on the macrophage functioning.
Article
Full-text available
Background: Red clover (Trifolium pratense L.) is a diploid perennial temperate legume with 14 chromosomes (2n = 14) native to Europe and West Asia, with high nutritional and economic value. It is a very important forage grass and is widely grown in marine climates, such as the United States and Sweden. Genetic research and molecular breeding are limited by the lack of high-quality reference genomes. In this study, we used Illumina, PacBio HiFi, and Hi-C to obtain a high-quality chromosome-scale red clover genome and used genome annotation results to analyze evolutionary relationships among related species. Results: The red clover genome obtained by PacBio HiFi assembly sequencing was 423 M. The assembly quality was the highest among legume genome assemblies published to date. The contig N50 was 13 Mb, scaffold N50 was 55 Mb, and BUSCO completeness was 97.9%, accounting for 92.8% of the predicted genome. Genome annotation revealed 44,588 gene models with high confidence and 52.81% repetitive elements in red clover genome. Based on a comparison of genome annotation results, red clover was closely related to Trifolium medium and distantly related to Glycine max, Vigna radiata, Medicago truncatula, and Cicer arietinum among legumes. Analyses of gene family expansions and contractions and forward gene selection revealed gene families and genes related to environmental stress resistance and energy metabolism. Conclusions: We report a high-quality de novo genome assembly for the red clover at the chromosome level, with a substantial improvement in assembly quality over those of previously published red clover genomes. These annotated gene models can provide an important resource for molecular genetic breeding and legume evolution studies. Furthermore, we analyzed the evolutionary relationships among red clover and closely related species, providing a basis for evolutionary studies of clover leaf and legumes, genomics analyses of forage grass, the improvement of agronomic traits.
Article
Full-text available
The study aimed to evaluate the antioxidant potential of sprout and seed extracts from three species of plants, namely Glycine max (GMsp-sprouts, GMsd-seeds), Anethum graveolens (AGsp-sprouts, AGsd-seeds) and Pimpinella anisum (PAsp-sprouts, PAsd-seeds), which are widely accepted by consumers and have various applications in food flavoring, and also in natural medical treatments in the pharmaceutical industries. These plants are rich in valuable compounds that show a remarkable antioxidant power and are associated with many health benefits. Ethanol extracts were obtained by ultrasound-assisted extraction and they were comparatively evaluated for their in vitro antioxidant properties. The extracts were characterized by HPTLC, HPLC-DAD, total phenol content (TPC), total flavonoid content (TFC) analysis and antioxidant activities with different assays, such as total antioxidant capacity (TAC), 2,2′-azino-bis (3- ethylbenzothiazoline-6-sulfonic acid) radical cation decolorization assay (ABTS), 1,1-diphenyl 1-2-picryl-hydrazyl (DPPH) and iron binding ability of chelators. Our results showed that the sprout and seed extracts of the studied plants exhibited a high content of phytochemicals and promising antioxidant properties. The highest polyphenols content was detected for AGsd (53.02 ± 0.57 mg/g DW), PAsd (48.75 ± 0.34 mg/g DW) and the highest flavonoids content for PAsp (26.84 ± 0.57 mg/g DW). Moreover, the presence of valuable compounds was demonstrated by using HPTLC, FT-IR and HPLC-DAD techniques. In order to have a better understanding of the relationship between the biological properties and the electronic structure, a molecular modelling study of genistein was also conducted. Our approach to the comparative assessment of these three plant species was based on a priori knowledge from literature data; however, this study demonstrated that these plant extracts of seeds and also sprouts are excellent sources of natural antioxidants. Significant additional differences that were found in the phytochemical composition could be exploited in future research for pharmaceutical purposes.
Preprint
Full-text available
Background: The study objective was to investigate the protective effects of bilberry anthocyanin (AC) on growth performance, intestinal mucosal barrier and cecal microbes of chickens challenged with Salmonella. Methods: A total of 240 male hatchling chickens were randomly allocated to 4 treatments, each with 6 replicates. Birds were fed a basal diet supplemented with 0 (CON, and ST), 100 (ACL) and 400 (ACH) mg/kg of AC for 60 d, and orally challenged with 10⁹ CFU/bird (ST, ACL, ACH) Salmonella typhimurium at 14 and 16 d, birds in CON were given the same volume of PBS. Results: (1) Dietary supplementation of AC significantly increased d 18 BW, and ADG from d 1 to 18, and significantly decreased the F/G from d 1 to 18, d 1 to 28, d 1 to 60 (P<0.05); (2) At d 18, AC increased (P<0.05) the number of Salmonella in the liver and spleen of chickens; (3) AC decreased (P<0.05) plasma NO and ileal IL-1β, IL-6, IL-8, TNF-α, IFN-β, and IFN-γ; (4) AC also significantly increased ileal villus height (ACL, ACH), the ratio of villus height to crypt depth (ACH) and significantly decreased crypt depth (ACH). AC increased (P<0.05) the expression of Claudin-1 and Muc2 (ACL), ZO-1 and Occludin (ACH) as well; (5) Analysis of cecal microbes indicated that AC had a significant effect on principal co-ordinates and increased the alpha-diversity indexes (Chao, Pd, Shannon and Sobs) (P < 0.05). At the phylum level, the relative abundance of Firmicutes (ACL, ACH) was increased (P<0.05), and the relative abundance of Proteobacteria (ACL, ACH) and Bacteroidota (ACL) was decreased (P<0.05). At the genus level, AC decreased (P<0.05) the relative abundances of Bacteroides and Escherichia-Shigella, and increased (P<0.05) the relative abundances of Lactobacillus, Clostridia_UCG-014, Lachnospiraceae, and Shuttleworthia. Conclusion: Dietary AC prevented Salmonella infection in chicken via inhibiting the Salmonella colonization in liver and spleen, suppressing secretion of inflammatory factors, up-regulating the expression of ileal mucosal tight junction and mucin proteins, and ameliorating the composition of cecal microbes. Under the circumstance of this experiment, 100 mg/kg bilberry anthocyanin was recommended for chickens.
Article
Full-text available
(1) Background: Dyes play an important role in food, medicine, textile, and other industries, which make human life more colorful. With the increasing demand for food safety, the development of natural dyes becomes more and more attractive. (2) Methods: The literature was searched using the electronic databases PubMed, Web of Science, and SciFinder and this scoping review was carried out following Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA). (3) Results: 248 articles were included in this review. This review summarizes the research progress on natural dyes in the last ten years. According to structural features, natural dyes mainly include carotenoids, polyphenols, porphyrins, and alkaloids, and some of the newest dyes are summarized. Some pharmacological activities of carotenoids, anthocyanin, curcumin, and betalains in the last 10 years are summarized, and the biological effects of dyes regarding illumination conditions. The disadvantages of natural dyes, including sources, cost, stability, and poor bioavailability, limit their application. Here, some feasible strategies (potential resources, biotechnology, new extraction and separation strategies, strategies for improving stability) are described, which will contribute to the development and utilization of natural dyes. (4) Conclusion: Natural dyes show health benefits and potential in food additives. However, it is necessary for natural dyes to pass toxicity tests and quality tests and receive many regulatory approvals before their final entry into the market as food colorants or as drugs.
Article
Full-text available
Obesity is a state of chronic low-level inflammation closely associated with oxidative stress. Childhood obesity is associated with endothelial dysfunction, inflammation, and oxidative stress markers individually. This study was aimed at determining the association between the biomarkers of inflammation, oxidative stress, and endothelial dysfunction in urine samples of healthy, overweight, and obese children. Eighty-eight elementary school children aged between 6 and 10 years participated in this study. Anthropometric measurements were measured using WHO recommendations. The biomarkers of low-grade inflammation such as C-reactive protein (CRP), interleukin-6 (IL-6), and α -1-acid glycoprotein (AGP); oxidative stress markers such as 8-isoprostane and 8-hydroxy-2 ′ -deoxyguanosine (8-OHdG); and endothelin-1 (ET-1) were analyzed in urine samples. The area under the curve (AUC) by the receiver operating characteristics (ROC) was analyzed to identify the best urinary biomarker in childhood obesity. Linear regression and Pearson correlation were analyzed to determine the association between the parameters. The obese participants have significantly increased levels of CRP, AGP, IL-6, and 8-isoprostane compared to normal-weight participants. The overweight participants had significantly increased levels of ET-1 and 8-OHdG but not the obese group compared to the NW group. The AUC for urinary CRP (AUC: 0.847, 95% CI: 0.765-0.930; p<0.0001 ) and 8-isoprostane (AUC: 0.857, 95% CI: 0.783-0.932; p<0.0001 ) showed a greater area under ROC curves compared to other inflammatory and oxidative markers. The urinary CRP and 8-isoprostane significantly correlated with the obesity measures (body mass index, waist circumference, and waist-to- height ratio) and ET-1, inflammatory, and oxidative markers. The increased urinary inflammatory markers and 8-isoprostane can serve as a noninvasive benchmark for early detection of the risk of developing cardiovascular disease.
Article
Full-text available
Objectives: The present study was carried out to determine the antidiarrheal effects of myrtle (Myrtus communis L.) berries seeds aqueous extract (MBSAE) from Tunisia as well as the involvement of its antimicrobial and antioxidant properties in such protection. Methods: Adult male wistar rats were used and divided into six groups of ten each: control, Castor oil, Castor oil + Loperamide and Castor oil + various doses of MBSAE. Animals were per orally (p.o.) pre-treated with MBSAE for one hour and intoxicated by castor oil acute oral administration. Key findings: Our results demonstrated that the MBSAE is rich in total and condensed tannins and exhibited a broad spectrum of antibacterial activity. In vivo, we found that MBSAE administration induced a significant dose-dependent protection against diarrhoea and intestinal fluid accumulation. Castor oil-induced intestinal hypersecretion was accompanied by an oxidative stress status in the intestine. More importantly, we showed that acute diarrhoea was accompanied by an increase in intestinal mucosa hydrogen peroxide (H2 O2 ), calcium and free iron levels while MBSAE pre-treatment reversed all castor oil-induced intracellular mediators disturbances. Conclusions: We suggest that MBSAE had a potent protective effects against castor oil-induced acute diarrhoea due in part to its antioxidant and antimicrobial properties.
Book
Full-text available
PRINT/ONLINE PRICING OPTIONS AVAILABLE UPON REQUEST AT [email protected] © 2005 by Marcel Dekker (except as noted on the opening page of each article). All Rights Reserved.
Article
Full-text available
In the present study the extracts of in vivo and in vitro grown plants as well as callus tissue of red clover were tested for their antioxidant activities, using different extraction solvent and different antioxidant assays.The total flavonoid and phenolic contents as well as extraction yield of the extracts were also investigated to determine their correlation with the antioxidant activity of the extracts. Among all the tested extracts the highest amounts of total phenolic and total flavonoids content were found in methanol extract of in vivo grown plants.The antioxidant activity of tested samples followed the order in vivo plant extract > callus extract > in vitro extract. The highest reducing power, 2,2-azino-bis-(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) radical scavenging, and chelating power were found in methanol extracts of in vivo grown red clover, while the chloroform fraction of in vivo grown plants showed the highest 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, superoxide anion radical scavenging and hydrogen peroxide scavenging compared to the other tested extracts. A significant correlation was found between the antioxidant activity of extracts and their total phenolic and total flavonoid content. According to the findings, the extract of in vitro culture of red clover especially the callus tissue possesses a comparable antioxidant activity to the in vivo cultured plants’ extract.
Article
Full-text available
Blueberry fruits have a wide range of health benefits because of their abundant anthocyanins, which are natural antioxidants. The purpose of this study was to investigate the inhibitory effect of blueberry's two main anthocyanins (malvidin-3-glucoside and malvidin-3-galactoside) on inflammatory response in endothelial cells. These two malvidin glycosides could inhibit tumor necrosis factor-alpha (TNF-α) induced increases of monocyte chemotactic protein-1 (MCP-1), intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1) production both in the protein and mRNA levels in a concentration-dependent manner. Mv-3-glc at the concentration of 1 μM could inhibit 35.9% increased MCP-1, 54.4% ICAM-1, and 44.7% VCAM-1 protein in supernatant, as well as 9.88% MCP-1 and 48.6% ICAM-1 mRNA expression (p < 0.05). In addition, they could decrease IκBα degradation (Mv-3-glc, Mv-3-gal, and their mixture at the concentration of 50 μM had the inhibition rate of 84.8%, 75.3%, and 43.2%, respectively, p < 0.01) and block the nuclear translocation of p65, which suggested their anti-inflammation mechanism was mediated by the nuclear factor-kappa B (NF-κB) pathway. In general malvidin-3-glucoside had better anti-inflammatory effect than malvidin-3-galactoside. These results indicated that blueberry is good resource of anti-inflammatory anthocyanins, which can be promising molecules for the development of nutraceuticals to prevent chronic inflammation in many diseases.
Article
Full-text available
The potential use of polyphenols in the prevention and treatment of chronic inflammatory diseases has been extensively investigated although the mechanisms involved in cellular signaling need to be further elucidated. Cyanidin-3-glucoside is a typical anthocyanin of many pigmented fruits and vegetables widespread in the human diet. In the present study, the protection afforded by cyanidin-3-glucoside against cytokine-triggered inflammatory response was evaluated in the human intestinal HT-29 cell line, in comparison with 5-aminosalicylic acid, a well-established anti-inflammatory drug, used in inflammatory bowel disease. For this purpose, some key inflammatory mediators and inflammatory enzymes were examined. Our data showed that cyanidin-3-glucoside reduced cytokine-induced inflammation in intestinal cells, in terms of NO, PGE2 and IL-8 production and of iNOS and COX-2 expressions, at a much lower concentration than 5-aminosalicylic acid, suggesting a higher anti-inflammatory efficiency. Interestingly, cyanidin-3-glucoside and 5-aminosalicylic acid neither prevented IkB-α degradation nor the activation of NF-kB, but significantly reduced cytokine-induced levels of activated STAT1 accumulated in the cell nucleus. In addition, we established that phosphorylated p38 MAPK was not involved in the protective effect of cyanidin-3-glucoside or 5-aminosalicylic acid. Taking into account the high concentrations of dietary anthocyanins potentially reached in the gastrointestinal tract, cyanidin-3-glucoside may be envisaged as a promising nutraceutical giving complementary benefits in the context of inflammatory bowel disease.
Article
Excessive Ultraviolet (UV) irradiation induces skin damages. In the present study, the potential protective activity of anthocyanins (cyanidin-3-O-sophoroside and cyanidin-3-O-sambubioside) from black peanut against skin damage induced by UV-B was evaluated in vitro and in vivo. Treatment with anthocyanins significantly reversed UV-B induced oxidative damage and following apoptotic death in human HaCaT cells. Nuclear-factor-E2-related factor 2 (Nrf 2) was activated by anthocyanins through Nrf 2 protein stabilization and nuclear translocation, along with the expressions of antioxidant responsive element (ARE)- related genes (HO1, GCLC and NOQ1). Nrf 2 knockdown in HaCaT cells by targeted-shRNA plasmid markly abolished the protective activity of anthocyanins against UV-B irradiation. Additionally, topical application of anthocyanins (5 mg/cm2) inhibited UV-B induced oxidative stress and cell apoptosis in BALB/c mouse skin tissues. The protective effect of anthocyanins can be explained by the regulation of oxidative-stress and the suppression of cell apoptosis through the activation of Nrf-2 by interaction with the MAPK and NF-κB signaling pathways. Our results suggested that anthocyanins from black peanut skin might be used as a potential photochemo-protective agent against UV-B induced skin damage.
Article
Adipocyte browning is a promising strategy for obesity prevention. Using onion peel-derived extracts and their bioactive compounds, we demonstrate that the onion peel, a by-product of the onion, can change the characteristics of white adipocytes to those of brown-like adipocytes in the white adipose tissue of mice and in 3 T3-L1 cells. The expression of the following brown adipose tissue-specific genes was increased in the retroperitoneal and subcutaneous adipose tissues of 0.5% onion peel extract-fed mice: PR domain-containing 16, peroxisome proliferator-activated receptor gamma coactivator 1α, uncoupling protein 1, fibroblast growth factor 21, and cell death-inducing DFFA-like effector. In 3 T3-L1 adipocytes, onion peel extract induced the expression of brown adipose tissue-specific genes and increased the expression of carnitine palmitoyltransferase 1α. This effect was supported by decreased lipid levels and multiple small-sized lipid droplets. The ethyl acetate fraction of the onion peel extract that contained the highest proportion of hydrophobic molecules showed the same browning effect in 3 T3-L1 adipocytes. A high-performance liquid chromatography analysis further identified quercetin as a functional compound in the browning effect of onion peel. The quercetin-associated browning effect was mediated in part by the activation of AMP-activated protein kinase. In summary, our study provides the first demonstration of the browning effects of onion peel and quercetin using both animal and cell models. This result indicates that onion peel has the potential to remodel the characteristics of white adipocytes to those of brown-like adipocytes.
Article
Anthocyanins are one of the six subgroups of large and widespread group of plant constituents known as flavonoids. They are responsible for the bright attractive orange, red, purple, and blue colors of most fruits, vegetables, flowers and some cereal grains. More than 300 structurally distinct anthocyanins have been identified in nature. Earlier, anthocyanins were only known for their coloring properties but now interest in anthocyanin pigments has intensified because of their possible health benefits as dietary antioxidants, which help to prevent neuronal diseases, cardiovascular illnesses, cancer, diabetes, inflammation and many such others diseases. Ability of anthocyanins to counter oxidants makes them atherosclerosis fighters. Therefore, anthocyanin rich foods may help boost overall health by offering an array of nutrients. However, the incorporation of anthocyanins into food and medical products is challenging task due to their low stability towards environmental conditions during processing and storage. Encapsulation seems to be an efficient way to introduce such compounds into these products. Encapsulating agents act as a protector coat against ambient adverse conditions such as light, humidity and oxygen. Encapsulated bioactive compounds are easier to handle and offer improved stability. The main objective of this review is to explore health benefits of anthocyanins and their extraction, characterization, encapsulation and delivery.
Article
The objectives of this study were to compare the anti-inflammatory effects of anthocyanins from blueberry (BBA), blackberry (BKA), and blackcurrant (BCA) and to determine the relationship between their antioxidant capacity and anti-inflammatory effect in macrophages. Major anthocyanins in BBA, BKA and BCA were malvidin-3-glucoside (16%), cyanidin-3-glucoside (98%) and delphinidin-3-rutinoside (44%), respectively. BKA showed higher total antioxidant capacity than BBA and BCA. RAW 264.7 macrophages were incubated with 0-20 μg/ml of BBA, BKA and BCA, and subsequently activated by lipopolysaccharide (LPS) to measure proinflammatory cytokine production. Interleukin 1β (IL-1β) messenger RNA (mRNA) levels were significantly decreased by all berry anthocyanins at 10 μg/ml or higher. Tumor necrosis factor α (TNFα) mRNA levels and secretion were also significantly decreased in LPS-treated macrophages. The levels of the repression were comparable for all berry anthocyanins. LPS-induced nuclear factor κB (NF-κB) p65 translocation to the nucleus was markedly attenuated by all of the berry anthocyanins. In bone marrow-derived macrophages (BMMs) from nuclear factor E2-related factor 2 wild-type (Nrf2(+/+)) mice, BBA, BKA and BCA significantly decreased cellular reactive oxygen species (ROS) levels with a concomitant decrease in IL-1β mRNA levels upon LPS stimulation. However, in the BMM from Nrf2(-/-) mice, the anthocyanin fractions were able to significantly decrease IL-1β mRNA despite the fact that ROS levels were not significantly affected. In conclusion, BBA, BKA and BCA exert their anti-inflammatory effects in macrophages, at least in part, by inhibiting nuclear translocation of NF-κB independent of the NRF2-mediated pathways.