Available via license: CC BY
Content may be subject to copyright.
nutrients
Article
Diminished Vitamin D Receptor Protein Levels in
Crohn’s Disease Fibroblasts: Effects of Vitamin D
Laura Gisbert-Ferrándiz 1, †, Jesús Cosín-Roger 2, †, Carlos Hernández 2,
Dulce C. Macias-Ceja 2, Dolores Ortiz-Masiá3, Pedro Salvador 1, Juan V. Esplugues 1,2 ,
Joaquín Hinojosa 4, Francisco Navarro 4, Sara Calatayud 1and María D. Barrachina 1, *
1
Departamento de Farmacolog
í
a and CIBER, Facultad de Medicina, Universidad de Valencia, 46010 Valencia,
Spain; laura.gisbert@uv.es (L.G.-F.); pedro.salvador@uv.es (P.S.); juan.v.esplugues@uv.es (J.V.E.);
sara.calatayud@uv.es (S.C.)
2
Fundaci
ó
n para la Investigaci
ó
n Sanitaria y Biom
é
dica de la Comunitat Valenciana, FISABIO, 46015 Valencia,
Spain; jesus.cosin@uv.es (J.C.-R.); carlos.hernandez-saez@uv.es (C.H.);
yuche_dulce@hotmail.com (D.C.M.-C.)
3Departamento de Medicina, Facultad de Medicina, Universidad de Valencia, 46010 Valencia, Spain;
m.dolores.ortiz@uv.es
4Hospital de Manises, 46940 Valencia, Spain; jhinojosad@gmail.com (J.H.);
fran.navarro.vicente@gmail.com (F.N.)
*Correspondence: dolores.barrachina@uv.es; Tel.: +34-96-398-3834
†Both authors contribute equally to this work.
Received: 24 February 2020; Accepted: 28 March 2020; Published: 1 April 2020
Abstract:
Vitamin D (VD) deficiency has been associated to Crohn’s disease (CD) pathogenesis, and
the exogenous administration of VD improves the course of the disease, but the mechanistic basis of
these observations remains unknown. Vitamin D receptor (VDR) mediates most of the biological
functions of this hormone, and we aim to analyze here the expression of VDR in intestinal tissue,
epithelial cells, and fibroblasts from CD patients. The effects of VD on a fibroblast wound healing
assay and murine intestinal fibrosis are also analyzed. Our data show diminished VDR protein levels
in surgical resections and epithelial cells from CD patients. In intestinal fibroblasts isolated from
damaged tissue of CD patients, we detected enhanced migration and decreased VDR expression
compared with both fibroblasts from non-damaged tissue of the same CD patient or control fibroblasts.
Treatment with VD increased VDR protein levels, avoided the accelerated migration in CD fibroblasts,
and prevented murine intestinal fibrosis induced by the heterotopic transplant model. In conclusion,
our study demonstrates diminished VDR protein levels associated with enhanced migration in
intestinal fibroblasts from damaged tissue of CD patients. In these cells, VD accumulates VDR and
normalizes migration, which supports that CD patients would benefit from the VD anti-fibrotic
therapeutic value that we demonstrate in a murine experimental model.
Keywords: Crohn’s disease; vitamin D; vitamin D receptor (VDR); fibroblasts; fibrosis
1. Introduction
Crohn’s disease (CD) is a chronic inflammatory disorder of the gastrointestinal tract characterized
by transmural inflammation, which often leads to intestinal fibrosis and the formation of strictures.
Current pharmacological anti-inflammatory treatment does not prevent fibrosis in susceptible patients,
and surgery is required in a high percentage of patients which, however, does not rule out recurrence [
1
,
2
].
In recent years, a better knowledge of the fibrotic pathways has emerged from other organs [
3
,
4
], and
the assessment of some anti-fibrotic therapies has been proposed for CD patients [
5
,
6
]. However, the
lack of current clinical trials forces us to better understand the etiopathogenesis of intestinal fibrosis
Nutrients 2020,12, 973; doi:10.3390/nu12040973 www.mdpi.com/journal/nutrients
Nutrients 2020,12, 973 2 of 13
which is finally mediated by the activation/dysregulation of subepithelial myofibroblasts that triggers
excessive extracellular matrix (ECM) and collagen deposition [7,8].
Clinical studies report serum Vitamin D (VD) levels lower than 20 ng/mL or 50 nmol/L in CD
patients, a situation that has been qualified as VD deficiency and explained by the reduced food
intake or malnutrition characteristic of these patients [
9
–
11
]. VD plays an immunomodulatory role
in the gut [
11
], and the exogenous administration of VD to CD patients prolongs periods of clinical
remission and decreases the risk of surgery or hospitalization [
12
,
13
]. In addition, several studies
report that VD improves symptom-based activity scores [
14
] and the therapeutic response to specific
immunosuppressive therapy [
15
–
17
]. However, little is known about the mechanistic basis that
explicates both how VD deficiency contributes to the pathogenesis of CD and the beneficial effects of
VD in these patients.
Vitamin D receptor (VDR) is a nuclear transcription factor that mediates most of the biological
functions induced by VD [
18
]. In cultured cells, VD inhibits the ubiquitin-proteasome degradation and
increases VDR protein levels [
19
] which mediates the effects of VD in the gut. We aim to analyze here
the basal and VD-stimulated expression of VDR in intestinal fibroblasts isolated from CD patients and
the effects of VD in fibroblasts migration and murine intestinal fibrosis.
2. Materials and Methods
2.1. Patients
Control and CD patients were recruited from the Surgical Service of the Hospital of Manises
(Valencia, Spain), following the Helsinki declaration recommendations. The study was approved by
the Institutional Review Board of the hospital (2018/00438/PI). Written informed consent was obtained
from all patients. All patients included in the study are Caucasian, and we collected demographic and
clinical data from them, including age, sex, and disease behavior (Table 1).
Table 1. Patients characteristics.
Control CD
Number of patients 10 12
Age
17–40 years 3 5
>40 years 7 7
Sex
Female 4 7
Male 6 5
Behavior
B2 6
B3 6
Intestinal resections from control patients, from the stricture in CD patients presenting a stenotic
behavior (B2), or from the damaged area of CD patients with a penetrating behavior (B3), were obtained
after surgery. In general, in CD patients, the last pharmacological treatment dose was administered
at least 3 weeks before surgery. As control samples, we used the non-damaged tissue obtained from
patients undergoing surgery due to a colorectal carcinoma.
2.2. Primary Fibroblasts and Epithelial Cells Isolation
Primary fibroblasts and epithelial cells were isolated from human intestinal resections of control
and CD patients, as previously reported [
20
,
21
]. The tissue was cut in small pieces and incubated
in agitation with HBSS-EDTA 30 min at 37
◦
C. After this step, the supernatant was collected and
centrifuged to obtain the epithelial cells. Then a digestion of the pieces with collagenase I (1 mg/mL),
hyaluronidase (2 mg/mL), and DNAse (1
µ
L/mL) in PBS was performed during 30 min at 37
◦
C. Finally,
Nutrients 2020,12, 973 3 of 13
the explants were seeded in a Petri dish with the culture medium. The medium (DMEM high glucose,
Sigma-Aldrich) was supplemented with FCS 20%, Penicilin/Streptomicin (100
µ
g/mL), Gentamycin
(100
µ
g/mL), Amphotericin B (2
µ
g/mL), and Ciprofloxacin (16
µ
g/mL). Intestinal fibroblasts from
passages 6 to 8 were used in all experiments, and they were treated with 1
α
,25-Dihydroxyvitamin D
3
(VD) (D1530; Sigma-Aldrich, Madrid, Spain) 10 nM or 100 nM dissolved in ethanol or vehicle for 24 h.
2.3. Fibroblasts Wound Healing Assay
Standardized wounds in the fibroblast monolayer were made by a single scraping with a disposable
pipette tip, as previously reported [
22
], and medium with or without inactivated fetal bovine serum
(iFBS) containing calcitriol 100 nM (D1530, Sigma) or vehicle was added. Then fibroblast photos
were taken at different time points. In all cases, the wounded area was determined (ImageJ; National
Institutes of Health, Bethesda, MD, USA) from 3 representative photographs taken of each well at
0, 24, and 48 h. Results were expressed as the percentage of the wound at each time point for the
maximal wounded area (time 0, 100%). These experiments were performed using an Olympus IX81
(Hamburg, Germany) fluorescence inverted microscope, and the CellˆR software v.2.8 was employed
to take images manually.
2.4. Immunohistochemical Studies
Immunohistochemistry for VDR was performed in fixed and paraffin-embedded sections (5
µ
M)
of intestinal resections from damaged mucosa of CD patients or healthy mucosa from colorectal cancer
patients [23].
The heat-mediated antigen retrieval was performed with 10 mM of sodium citrate buffer at pH
6.0 (Dako Target Retrieval Solution) during 20 min at 98
◦
C. After the inactivation of endogenous
peroxidase and blocking the slides during 1 h at room temperature, intestinal tissues were incubated
with the primary antibody Anti-VDR antibody (1:200; 12550, Cell Signaling, Danvers, MA, USA)
overnight at 4 ◦C. The samples were incubated for 30 min at room temperature with the Biotinylated
Universal Antibody (1:100; BA-1400, Vector, Peterborough, UK) as a secondary antibody. A negative
control without the primary antibody incubation was also performed. Afterwards, in order to get a
stronger signal, a 30 min room temperature incubation with Vectastain
®
Universal Elite ABC Kit (Vector)
was performed. A signal was developed after 2 min with DAB enhanced substrate (Sigma-Aldrich,
Madrid, Spain). All samples were counterstained with hematoxylin, and pictures were obtained with a
microscope (Leica DMI 3000).
2.5. Mice
Female C57BL/6 mice were used in all experiments (10–12 weeks old, 20–25 g weight). Animals
were housed in stainless steel cages in a room kept at 22
±
1
◦
C with a 12 h light/12 h dark cycle and
had free access to food and water. Care conditions were adapted to facilitate access of the animals to
food and water ad libitum during the experiments. All experiments were performed in compliance
with the European Animal Research Law, and the protocols were approved by the institutional animal
care and use committees of the University of Valencia (2019/VSC/PEA/0290).
2.6. Induction of Intestinal Fibrosis by Heterotopic Transplant of Colonic Tissue and Vitamin D Treatment
The
in vivo
model of intestinal fibrosis was induced in C57BL/6 mice using a heterotopic intestinal
transplant as previously described [
21
,
24
]. In this protocol, small pieces of colon were subcutaneously
transplanted into the dorsal neck region of recipient mice. After 7 days, recipient mice were sacrificed
by neck dislocation, and intestinal grafts were obtained. An adjacent segment of the colon from each
donor was kept to be used as an autologous control tissue (named as day 0).
Recipient mice received intraperitoneally a daily dose of VD or its vehicle until sacrifice. VD
(D1530; Sigma-Aldrich) dissolved in ethanol was administered at the dose of 2
µ
g/kg in a 0.9%
NaCl solution.
Nutrients 2020,12, 973 4 of 13
2.7. Sirius Red Staining
Sirius Red staining was performed in intestinal grafts in order to determine the collagen layer
in paraffin-embedded tissues (5
µ
m) as previously described [
21
] and the staining was examined
under transmission light. The collagen layer thickness was quantified in intestinal grafts by using the
software Image J.
2.8. RNA Extraction and Real-Time Quantitative PCR (RT-qPCR)
Total RNA from fibroblasts and epithelial cells was isolated with Illustra RNAspin Mini RNA
isolation Kit (GE Healthcare Life Science), and total RNA from the colonic tissue was obtained using
Tripure Isolation reagent (Roche Diagnostics). In both cases, 1
µ
g was used to obtain cDNA with the
PrimeScript RT reagent Kit (Takara Bio Inc.). Real-time PCR was performed with the SYBR
®
Premix Ex
Taq (Takara Bio Inc.) in a LightCycler thermocycler (Roche Diagnostics). Specific oligonucleotides were
designed according to the reported sequences and are shown in Tables 2and 3. The
∆∆
C
T
method was
used to calculate the fold induction of studied genes. β-actin was used as a housekeeping gene.
Table 2. Sequences of human primers used in real-time PCR.
Gene Sense (50-30) Antisense (50-30)
VDR TGGAGACTTTGACCGGAACG AAGGGGCAGGTGAATAGTGC
CYP24A1 ACCAGGGGAAGTGATGAAGC TCATCCTCCCAAACGTGCTC
COL1A1 GGAGCAGACGGGAGTTTCTC CCGTTCTGTACGCAGGTGAT
ACTA2 (α-SMA) GACCTTTGGCTTGGCTTGTC AGCTGCTTCACAGGATTCCC
MMP2 CATTCCCTGCAAAGAACACA GTATTTGATGGCATCGCTCA
ACTB (β-actin) GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG
Table 3. Sequences of mouse primers used in real-time PCR.
Gene Sense (50-30) Antisense (50-30)
Vdr
ACAAGACCTACGACCCCACCT
AGCCGATGACCTTTTGGATGCT
E-cadherin ACCCAAGCACGTATCAGGG ACTGCTGGTCAGGATCGTTG
Col1a1 CAGGCTGGTGTGATGGGATT AAACCTCTCTCGCCTCTTGC
Adgre1 (F4/80)
CTTCCCAGAATCCAGTCTTTCC
TGACTCACCTTGTGGTCCTAA
Tgfb
GCGGACTACTATGCTAAAGAGG
TCAAAAGACAGCCACTCAGG
Il-6
GAGTCCTTCAGAGAGATACAGAAAC
TGGTCTTGGTCCTTAGCCAC
Cd86 GCACGGACTTGAACAACCAG CCTTTGTAAATGGGCACGGC
Actb (β-actin)
GCCAACCGTGAAAAGATGACC
GAGGCATACAGGGACAGCAC
2.9. Protein Extraction and Western Blot Analysis
Homogenization with lysis buffer for cells (50 mM TrisHCl pH 7.8, 137 mM NaCl, 1 mM EDTA, 10
mM NaF, 10 mM
β
-glycerophosphate, 1 mM Na
3
VO
4
, 1% Triton X-100, 0.2% N-Lauroylsarcosine, and
10% Glycerol) and for colonic tissue (10 mM HEPES pH 7.5, 2 mM MgCl
2
, 1 mM EDTA, 1 mM EGTA,
10 mM NaCl, 10 mM NaF, 0.1 mM Na
3
VO
4
, 1 mM DTT, 10% NP-40, 1 mM PMSF) containing both
proteases inhibitors (Complete Mini tablets, Roche Diagnostics) was used to obtain protein lysates.
Equal amounts of protein were loaded onto SDS-PAGE gels and analyzed by Western blot, by using
specific primary antibodies shown in Table 4. Protein bands were detected with SuperSignal
™
West
Femto Substrate (ThermoFisher) in a LAS-3000 (Fujifilm). The Image Gauge version 4.0 software
(Fujifilm) was used to quantify the protein expression by means of densitometry. Total protein data
were normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
Nutrients 2020,12, 973 5 of 13
Table 4. Specific antibodies used for Western blot analysis.
Antibody Supplier Dilution
VDR 12550, Cell Signaling 1:1000
COL1A1 84336S, Cell Signaling 1:1000
STAT3 ab68153, Abcam 1:1000
Phospho STAT3 ab76315, Abcam 1:1000
Alpha SMA PA5-16697, ThermoFisher 1:1000
Vimentin ab92547, Abcam 1:1000
CD86 ab53004, Abcam 1:1000
GAPDH G9545, Sigma-Aldrich 1:10000
2.10. Statistical Analysis
Data were expressed as mean
±
s.e.m. and compared by a t-test for comparisons between two
groups, and by one-way analysis of variance (ANOVA) with Newman–Keuls post hoc correction
for multiple comparisons. A pvalue <0.05 was considered to be statistically significant. The
correlation between different data obtained in human samples was analyzed using Spearman’s
correlation coefficient.
3. Results
3.1. VDR Expression Is Diminished in Intestinal Resections of CD Patients
In intestinal tissue from CD patients, we detected a diminution of VDR mRNA expression
(70.4
±
32.8%) and VDR protein levels (81.3
±
32.8%) compared with control tissue (Figure 1a,b). An
increase in COL1A1 mRNA expression (139.8
±
63.26%) was also observed in CD intestine compared
with control tissue (Figure 1b). In epithelial crypts isolated from intestinal resections from CD patients,
we also found a diminution in protein levels of VDR (51.5
±
29.2%) compared with those obtain from
control tissue (Figure 1c).
Immunohistochemical analysis in control tissue show cytosolic and nuclear VDR staining in
epithelial cells as well as in cells of the lamina propria. In intestinal tissue from CD patients, cytosolic
VDR staining was lost, and a slight nuclear VDR staining was detected mainly in epithelial cells
(Figure 1d). These changes were detected in samples from CD patients with both a B2 phenotype and
a B3 phenotype. VDR protein levels were analyzed by Western blot, and the quantitative analysis
reveals non-significant differences among CD behaviors (Figure 1e).
3.2. Reduced VDR Protein Levels Are Associated with Increased Migration in Fibroblasts from CD Patients
Fibroblasts were obtained from intestinal resections of control patients and from damaged and
non-damaged intestinal tissue of CD patients. Those obtained from CD-affected mucosa presented
significantly lower levels of VDR protein (0.5
±
0.03) than fibroblasts from both the non-damaged
tissue of the same CD patient (0.8
±
0.1) and control fibroblasts (1
±
0.1) (Figure 2a). A significant
reduction was also detected in the mRNA expression of a VDR target gene, CYP24A1, in CD fibroblasts
from damaged tissue (0.03
±
0.013) compared with those from non-damaged tissue (0.18
±
0.08) and
from controls (1.1
±
0.3) (Figure 2a). Levels of CYP24A1 were also significantly lower in fibroblast
from non-damaged tissue of CD patients than in those from control tissue. Fibroblasts obtained from
damaged tissue of CD patients exhibited, 48h after wounding, a lower percentage of wound area
(51
±
5.8) than those obtained from both control (76.8
±
2.6) or non-damaged tissue of CD patients
(87.3 ±2.88) (Figure 2b).
Nutrients 2020,12, 973 6 of 13
Nutrients 2020, 12, x FOR PEER REVIEW 6 of 14
significant correlation was detected between VDR and MMP2 mRNA expression, while a negative
correlation was detected between α-SMA mRNA and VDR mRNA levels (Figure 3d).
Figure 1. Diminished vitamin D receptor (VDR) expression in damaged intestinal resections from
Crohn’s disease (CD) patients. (a) A representative Western blot image of VDR protein in lysates of
total mucosa from control (n = 8) and from CD patients (n = 10). The graph shows VDR protein
expression vs. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) represented as fold induction
vs. control mucosa. (b) mRNA expression (expressed as fold induction vs. control) of different genes
vs. β-actin in total mucosa from control (n = 5) and CD patients (n = 10). In (a) and (b), bars in graph
represent mean ± s.e.m. and significant differences vs. the control group are shown by *p < 0.05. (c)
Representative Western blot from lysates of epithelial cells isolated from intestinal tissue of controls
(n = 4) and CD patients (n = 4). Graph shows protein expression vs. GAPDH represented as fold
induction vs. control. (d) Representative images showing VDR immunostaining in the mucosa of
control and CD patients. (e) A representative Western blot image of VDR protein in lysates of total
mucosa from CD patients with a stenotic (B2, n = 2) or penetrating (B3, n = 3) behavior. The graph
shows VDR protein expression vs. GAPDH represented as fold induction vs. B2-CD.
Figure 1.
Diminished vitamin D receptor (VDR) expression in damaged intestinal resections from
Crohn’s disease (CD) patients. (
a
) A representative Western blot image of VDR protein in lysates
of total mucosa from control (n=8) and from CD patients (n=10). The graph shows VDR protein
expression vs. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) represented as fold induction
vs. control mucosa. (
b
) mRNA expression (expressed as fold induction vs. control) of different genes
vs.
β
-actin in total mucosa from control (n=5) and CD patients (n=10). In (
a
) and (
b
), bars in graph
represent mean
±
s.e.m. and significant differences vs. the control group are shown by * p<0.05.
(
c
) Representative Western blot from lysates of epithelial cells isolated from intestinal tissue of controls
(n=4) and CD patients (n=4). Graph shows protein expression vs. GAPDH represented as fold
induction vs. control. (
d
) Representative images showing VDR immunostaining in the mucosa of
control and CD patients. (
e
) A representative Western blot image of VDR protein in lysates of total
mucosa from CD patients with a stenotic (B2, n=2) or penetrating (B3, n=3) behavior. The graph
shows VDR protein expression vs. GAPDH represented as fold induction vs. B2-CD.
Nutrients 2020,12, 973 7 of 13
Nutrients 2020, 12, x FOR PEER REVIEW 7 of 14
Figure 2. Reduced VDR expression and a higher migration rate in intestinal fibroblasts of CD patients.
(a) A Western blot showing protein levels in fibroblasts isolated from non-damaged tissue of control
patients (n = 3) and non-damaged and damaged tissue of CD patients (n = 3). Graphs show protein
expression vs. GAPDH or the relative mRNA expression of CYP24A1 gene vs.
β
-actin in control (n =
4) and CD (n = 7) fibroblasts. In all cases, data are represented as fold induction vs. control fibroblasts.
(b) The graph represents percentage of the wounding area (time 0, 100%) at 48 h in fibroblasts from
control, CD non-damaged and CD-damaged tissue treated with medium iFBS-free. In all cases, bars
in graphs represent mean ± s.e.m., and significant differences vs. the control group or vs. the non-
damaged CD (connecting lines) are shown by *p < 0.05 or ***p < 0.001.
VDR
GAPDH
Control CD non-damaged CD damaged
(a)
(b)
Figure 2.
Reduced VDR expression and a higher migration rate in intestinal fibroblasts of CD patients.
(
a
) A Western blot showing protein levels in fibroblasts isolated from non-damaged tissue of control
patients (n=3) and non-damaged and damaged tissue of CD patients (n=3). Graphs show protein
expression vs. GAPDH or the relative mRNA expression of CYP24A1 gene vs.
β
-actin in control (n=4)
and CD (n=7) fibroblasts. In all cases, data are represented as fold induction vs. control fibroblasts. (
b
)
The graph represents percentage of the wounding area (time 0, 100%) at 48 h in fibroblasts from control,
CD non-damaged and CD-damaged tissue treated with medium iFBS-free. In all cases, bars in graphs
represent mean
±
s.e.m., and significant differences vs. the control group or vs. the non-damaged CD
(connecting lines) are shown by * p<0.05 or *** p<0.001.
3.3. VD Increased VDR Protein Levels and Prevented the Accelerated Migration in Fibroblasts from CD
Patients
VD, compared with vehicle, induced a significant increase in VDR protein levels in control
fibroblasts (87
±
29.2%), in fibroblasts from non-damaged tissue of CD patients (48
±
25.6%) and in
those from damaged intestine (87
±
31.6%) (Figure 3a). In fibroblasts from damaged tissue of CD
patients, VD significantly increased, 48 h after wounding, the percentage of wound (66.75
±
5.94%)
compared to that detected in vehicle-treated cells (51.9 ±5.4%) (Figure 3b).
The basal mRNA expression of VDR, and
α
-smooth muscle actin (
α
-SMA) was similar between
control fibroblasts (1.1
±
0.2 and 2.6
±
1.3, respectively), CD fibroblasts from non-damaged tissue
(1.9
±
0.2 and 0.5
±
0.2, respectively), and CD fibroblasts from damaged tissue (1.8
±
0.4 and 1.3
±
0.4,
respectively). Basal metalloproteinase 2 (MMP2) mRNA levels were significantly higher in fibroblasts
from non-damaged tissue of CD patients (3.5
±
0.4) than in control cells (1.3
±
0.5) (Figure 3c).
Treatment with VD significantly increase VDR mRNA levels, compared with vehicle, in fibroblasts
from non-damaged tissue of CD patients (36.2
±
3.6%) (Figure 3c), while it failed to significantly modify
the mRNA expression of
α
-SMA or MMP2 in any cell analyzed. However, a positive and significant
correlation was detected between VDR and MMP2 mRNA expression, while a negative correlation
was detected between α-SMA mRNA and VDR mRNA levels (Figure 3d).
3.4. Reduced VDR Expression in Murine Intestinal Fibrosis
We next analyzed the protein expression of VDR in the heterotopic transplant mouse model of
intestinal fibrosis. As shown in Figure 4a, our results show an important decrease in VDR protein levels
(81.6
±
27.6%) in intestinal grafts obtained 7 days after transplantation in parallel with an increased
protein expression of COL1A1 (267.9
±
51.9%) and the ratio pSTAT3/STAT3 (49
±
10.1%), compared
with colon at day 0.
Nutrients 2020,12, 973 8 of 13
Nutrients 2020, 12, x FOR PEER REVIEW 8 of 14
Figure 3. Vitamin D (VD) increased VDR protein levels and prevented enhanced migration in
fibroblasts from CD patients. Fibroblasts were treated for 24 h with VD (10 nM or 100 nM) or vehicle.
(a) A Western blot showing protein levels in fibroblasts isolated from control mucosa (n = 4) or the
non-damaged and damaged tissue of CD patients (n = 4) treated with vehicle or VD (100 nM). Graphs
show VDR protein expression vs. GAPDH represented as fold induction vs. vehicle in control cells
and vs. non-damaged vehicle in CD cells. Bars represent mean ± s.e.m., and significant differences vs.
the respective vehicle group are shown by *p < 0.05. (b) The graph represents a time course of the
percentage of the wounding area (time 0, 100%) in fibroblasts from CD-damaged tissue cultured with
VD
VDR
GAPDH
- + - +
Control
VDR
GAPDH
Non-damaged Damaged Non-damaged Damaged
- + - + - + - +
VD
Crohn’s Disease
(a)
(b)
(c)
(d)
Figure 3.
Vitamin D (VD) increased VDR protein levels and prevented enhanced migration in fibroblasts
from CD patients. Fibroblasts were treated for 24 h with VD (10 nM or 100 nM) or vehicle. (
a
) A Western
blot showing protein levels in fibroblasts isolated from control mucosa (n=4) or the non-damaged and
damaged tissue of CD patients (n=4) treated with vehicle or VD (100 nM). Graphs show VDR protein
expression vs. GAPDH represented as fold induction vs. vehicle in control cells and vs. non-damaged
vehicle in CD cells. Bars represent mean
±
s.e.m., and significant differences vs. the respective vehicle
group are shown by * p<0.05. (
b
) The graph represents a time course of the percentage of the wounding
area (time 0, 100%) in fibroblasts from CD-damaged tissue cultured with medium iFBS-free treated
with vehicle (n=4) or VD (100 nM) (n=4). Symbols represent mean
±
s.e.m., and significant difference
vs. the vehicle group is shown by ** p<0.01. Representative images showing the wound healing
assay. (
c
) Graphs show the relative mRNA expression (expressed as fold induction vs. vehicle control
group) of different genes vs.
β
-actin in fibroblasts from control mucosa (n=4), CD-non-damaged (n=
6), and CD-damaged (n=7) tissue. Bars in graph represent mean
±
s.e.m, and significant differences
from vehicle-treated control group (connecting lines) are shown by * p<0.05 or from the respective
vehicle-treated group by *** p<0.001. (
d
) Significant correlations (showed by Ct gene-Ct
β
-actin)
detected between VDR and markers of fibrosis in intestinal fibroblasts treated with vehicle (n=17) or
with vitamin D 10 nM and 100 nM (n=34).
Nutrients 2020,12, 973 9 of 13
1
Figure 4.
VD reduces murine intestinal fibrosis. (
a
) Western blots of protein levels in total lysates
from intestinal grafts at day 0 (control) (n=3) or seven days after transplantation (n=3). Graphs
show protein expression vs. GAPDH represented as fold induction vs. day 0. Bars in graph represent
mean
±
s.e.m., and significant differences vs. day 0 are shown by * p<0.05 or ** p<0.01 (
b
) Sirius
Red staining was performed in paraffin-embedded intestinal tissue at day 0 and in intestinal explants.
Representative pictures taken under transmission light. (
c
) Graph shows the collagen layer thickness
quantified in intestine and grafts by Image J. Significant differences vs. day 0 or vs. 7 days-vehicle
(connecting lines) are shown by *** p<0.001. (
d
) Graphs show the relative mRNA expression (expressed
as fold induction vs. vehicle-treated group) of different genes vs.
β
-actin in intestinal explants from
mice treated for 7 days with VD 2
µ
g/kg (n=6) or vehicle (n=6). (
e
) Western blot images of protein
expression from 7 day grafts from mice treated with VD (n=3) or vehicle (n=2). Graphs represent
protein expression vs. GAPDH quantification expressed as fold induction vs. vehicle-treated group. In
(
d
) and (
e
)
,
bars in graph represent mean
±
s.e.m. and significant differences vs. the vehicle group are
shown by * p<0.05. (f) Graphs show the mRNA expression of different genes vs. β-Actin (expressed
as fold induction vs. vehicle) in 7 day grafts from mice treated with VD (n=6) or vehicle (n=6). Bars
in graph represent mean ±s.e.m., and significant differences vs. the vehicle group are shown by * p<
0.05 or ** p<0.01. (
g
) A Western blot showing CD86 protein levels in grafts from vh- or VD-treated
mice. The graph represents protein expression vs. GAPDH quantification expressed as fold induction
vs. vehicle-treated group.
Nutrients 2020,12, 973 10 of 13
3.5. VD Reduces Murine Intestinal Fibrosis
Next, we proceeded to administer VD (2
µ
g/kg, i.p.) or its vehicle daily to receptor mice, and
grafts were obtained 7 days after transplantation. The histological analysis of the colon shows a
decrease in collagen deposition and a preserved histological architecture in colon grafts obtained
from VD-treated mice compared with vehicle-treated mice (Figure 4b). A quantitative analysis of
the collagen layer thickness reveals higher levels in grafts from vehicle-treated mice (80.8
±
5.9
µ
m)
compared with both control intestines at day 0 (16.8
±
3.2
µ
m) and grafts from VD-treated mice
(49
±
3.4
µ
m) (Figure 4c). Treatment with VD, compared with vehicle significantly reduced the mRNA
expression of Col1a1 (93.6
±
38.6%), while it failed to significantly modify the mRNA expression of
E-cadherin or Vdr at the time point analyzed (Figure 4d). No significant changes were detected in
protein expression of VDR in intestinal grafts from VD-treated mice, while a significant reduction in
protein levels of COL1A1 (83.2
±
19.5%) was observed, compared with levels detected in grafts from
vehicle-treated mice (Figure 4e). These grafts also exhibited a significant reduction in vimentin protein
levels (41.8
±
35.2%) compared with grafts from vehicle-treated mice, while protein levels of
α
-SMA
were not significantly different (Figure 4e).
In intestinal grafts from VD-treated mice, the mRNA expression of F4/80 (1.1
±
0.1) was not different
to that detected in vehicle-treated mice (1.01
±
0.07) (Figure 4f). However, VD induced a significant
decrease (36.4
±
8.3%) in the mRNA expression of the macrophage marker, cluster of differentiation
86 (Cd86) in parallel with a significant diminution in the mRNA expression of interleukin-6 (Il-6)
(67.1
±
28.6%) while non-significant differences in Tgf-
β
mRNA expression were observed (Figure 4f). A
Western blot analysis reveals a non-significant decrease in CD86 protein levels in grafts from VD-treated
mice compared with grafts from vehicle-treated mice (Figure 4g).
4. Discussion
VD is at present widely used for the treatment of CD patients because its immunomodulatory
effects in the gut, but little is known about its role in intestinal fibrosis, a main feature of CD
complications. Our study demonstrates diminished VDR expression in intestinal fibroblasts from CD
patients; treatment with VD increases VDR protein levels and prevents the enhanced migration of
these cells. In a murine model, the systemic administration of VD reduced intestinal fibrosis.
The present study shows a significant reduction in VDR protein expression in intestinal resections
from CD patients with regard to control tissue, and no differences in VDR expression were observed
between the stenotic or penetrating behavior. Immunohistochemical analysis reveals a diminished
VDR in both epithelial cells and cells in the lamina propria, and the study performed in isolated crypts
reinforces this observation. Previous studies reported diminished VDR levels in intestinal biopsies
from patients with inflammatory bowel disease [
25
], and our results extend these observations by
showing for the first time that fibroblasts obtained from the damaged intestine of CD patients present
lower VDR protein levels than those obtained from the non-damaged tissue of the same patient. Serum
VD levels were correlated with colonic VDR expression in normal mucosa [
26
], and these levels seem
to be dependent on several factors, such as body mass index [
27
] or sun exposure [
28
]. However, the
difference in VDR protein levels detected in the present study between samples of the same patient,
excludes genetics or changes in serum VD levels as responsible for the VDR down-regulation observed
in cells coming from damaged tissues. Of interest, this reduced VDR protein expression parallels with
no changes in VDR mRNA expression at the same time point and remains stable over several passages,
which strongly suggests the epigenetic regulation of VDR by local inflammation or damage associated
to CD [
29
]. In this line, the overexpression of both miR-125b [
30
] and miR27b [
31
], which were shown
to be differentially regulated by CD [32], were associated with reduced VDR protein levels.
Treatment of intestinal fibroblasts with VD induced a significant VDR accumulation in all cells
analyzed, although final protein levels were lower in cells obtained from the affected mucosa of CD
patients than in cells from non-affected tissue. Of interest, VD failed to significantly modify VDR
mRNA expression, which reinforces that VD inhibits the proteasomal degradation of VDR [
19
], a
Nutrients 2020,12, 973 11 of 13
process that may be overactive in fibroblasts from the CD-damaged tissue. However, the possibility
that VD down-regulates the expression of miRNAs involved in VDR reduction, as recently reported in
lung fibroblasts and cardiac fibrosis [
33
,
34
], cannot be ruled out. Of interest, the reduced VDR levels
detected in fibroblasts from damaged tissue of CD patients paralleled with an enhanced migration of
these cells, and VD significantly prevented the enhanced migration. These observations, together with
the significant correlations detected between the mRNA expression of VDR and MMP2 (positive) and
α
-SMA (negative), strongly support an anti-fibrotic effect of VD in intestinal tissue, previously reported
in several other organs [35–37], and suggest a direct effect of this hormone on intestinal fibroblasts.
Finally, we analyzed the relevance of this signaling pathway in intestinal fibrosis development
by testing the effects of VD in a murine model. The heterotopic transplant of colonic tissue provokes
submucosal and subserosal fibrosis, significant ECM deposition, and important cellular infiltration
and thus resembles some of the CD characteristics [
21
]. In line with the results obtained in human
intestinal samples from CD patients, we found reduced VDR expression in murine fibrotic tissue which
was not associated with significant differences in cellular composition. Treatment of mice with daily
doses of VD preserved the histological architecture of the colon, reduced collagen deposition, and
prevented intestinal fibrosis, which reinforces a previous study in a different experimental model [
35
].
The modulation of the immune response by VD may be involved in its protective effects since intestinal
grafts from VD-treated mice showed an altered pattern of macrophage expression characterized by a
reduced mRNA expression of the M1 macrophage marker, Cd86, in parallel with a diminished mRNA
expression of Il-6, a known pro-fibrotic cytokine [
38
]. However, the fact that no significant differences
in CD86 protein levels were detected among treatments, together with the direct effects of VD on
intestinal fibroblasts shown in the present study, strongly suggests a role of VD acting on fibroblasts in
its anti-fibrotic effects.
5. Conclusions
In conclusion, our study demonstrates that VDR is diminished in fibroblasts isolated from damaged
tissue of CD patients, and treatment with VD increased VDR levels and prevented the enhanced
migration detected in these cells. These results strongly support that CD patients would benefit from
the VD anti-fibrotic therapeutic value clearly demonstrated in a murine experimental model.
Author Contributions:
Conceptualization, M.D.B., L.G.-F., S.C. and C.H.; methodology, L.G.-F., J.C.-R., D.C.M.-C.
and P.S.; validation, J.V.E., J.H., and F.N.; formal analysis, L.G.-F., J.C.-R., D.O.-M., S.C. and M.D.B.; data curation,
L.G.-F. and D.C.M.-C.; writing—original draft preparation, L.G.-F., S.C.; writing—review and editing, M.D.B.;
funding acquisition, M.D.B. and S.C. All authors have read and agreed to the published version of the manuscript.
Funding:
This work was supported by the Ministerio de Economia, Industria y Competitividad and the European
Regional Development fund of the European Union (ERDF) (SAF2016-80072P), CIBERehd (CB06/04/0071), and
Generalitat Valenciana [PROMETEOIII/2018/141]. Laura Gisbert Ferr
á
ndiz is supported by FPU fellowships from
Ministerio de Educación, Cultura y Deporte.
Acknowledgments: We thank Brian Normanly for his English language editing.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Ramos, G.P.; Papadakis, K.A. Mechanisms of Disease: Inflammatory Bowel Diseases. Mayo Clin. Proc.
2019
,
94, 155–165. [CrossRef] [PubMed]
2.
Danese, S.; Bonovas, S.; Lopez, A.; Fiorino, G.; Sandborn, W.J.; Rubin, D.T.; Kamm, M.A.; Colombel, J.F.;
Sands, B.E.; Vermeire, S.; et al. Identification of Endpoints for Development of Antifibrosis Drugs for
Treatment of Crohn’s Disease. Gastroenterology 2018,155, 76–87. [CrossRef] [PubMed]
3.
Cannito, S.; Novo, E.; Parola, M. Therapeutic pro-fibrogenic signaling pathways in fibroblasts. Adv. Drug
Deliv. Rev. 2017,121, 57–84. [CrossRef] [PubMed]
4.
Herrera, J.; Henke, C.A.; Bitterman, P.B. Extracellular matrix as a driver of progressive fibrosis. J. Clin.
Investig. 2018,128, 45–53. [CrossRef]
Nutrients 2020,12, 973 12 of 13
5.
Szab
ò
, H.; Fiorino, G.; Spinelli, A.; Rovida, S.; Repici, A.; Malesci, A.C.; Danese, S. Review Article:
Anti-Fibrotic Agents for the Treatment of Crohn’s Disease—Lessons Learnt from Other Diseases. Aliment.
Pharmacol. Ther. 2010,31, 189–201. [CrossRef]
6.
D’Haens, G.; Rieder, F.; Feagan, B.G.; Higgins, P.D.R.; Panes, J.; Maaser, C.; Rogler, G.; Löwenberg, M.; van
der Voort, R.; Pinzani, M.; et al. Challenges in the Pathophysiology, Diagnosis and Management of Intestinal
Fibrosis in Inflammatory Bowel Disease. Gastroenterology 2019. [CrossRef]
7.
Powell, D.W.; Mifflin, R.C.; Valentich, J.D.; Crowe, S.E.; Saada, J.I.; West, A.B. Myofibroblasts. II. Intestinal
Subepithelial Myofibroblasts. Am. J. Physiol. 1999,277, C183–C201. [CrossRef]
8.
Bettenworth, D.; Rieder, F. Pathogenesis of Intestinal Fibrosis in Inflammatory Bowel Disease and Perspectives
for Therapeutic Implication. Dig. Dis. 2017,35, 25–31. [CrossRef]
9.
Harries, A.D.; Brown, R.; Heatley, R.V.; Williams, L.A.; Woodhead, S.; Rhodes, J. Vitamin D Status in Crohn’s
Disease: Association with Nutrition and Disease Activity. Gut 1985,26, 1197–1203. [CrossRef]
10.
White, J.H. Vitamin D Deficiency and the Pathogenesis of Crohn’s Disease. J. Steroid Biochem. Mol. Biol.
2018
,
175, 23–28. [CrossRef]
11.
Li, X.X.; Liu, Y.; Luo, J.; Huang, Z.D.; Zhang, C.; Fu, Y. Vitamin D Deficiency Associated with Crohn’s Disease
and Ulcerative Colitis: A Meta-Analysis of 55 Observational Studies. J. Transl. Med.
2019
,17, 323. [CrossRef]
12.
Ananthakrishnan, A.N.; Cagan, A.; Gainer, V.S.; Cai, T.; Cheng, S.C.; Savova, G.; Chen, P.; Szolovits, P.; Xia, Z.;
De Jager, P.L.; et al. Normalization of Plasma 25-Hydroxy Vitamin D is Associated with Reduced Risk of
Surgery in Crohn’s Disease. Inflamm. Bowel Dis. 2013,19, 1921–1927. [CrossRef]
13.
Hawthorne, A.B. Editorial: Clinical Benefits of Vitamin D Therapy in Inflammatory Bowel Disease. Aliment.
Pharmacol. Ther. 2017,45, 1365–1366. [CrossRef]
14.
Garg, M.; Rosella, O.; Rosella, G.; Wu, Y.; Lubel, J.S.; Gibson, P.R. Evaluation of a 12-Week Targeted Vitamin
D Supplementation Regimen in Patients with Active Inflammatory Bowel Disease. Clin. Nutr.
2018
,37,
1375–1382. [CrossRef]
15.
Murdaca, G.; Tonacci, A.; Negrini, S.; Greco, M.; Borro, M.; Puppo, F.; Gangemi, S. Emerging Role of Vitamin
D in Autoimmune Diseases: An Update on Evidence and Therapeutic Implications. Autoimmun. Rev.
2019
,
18, 102350. [CrossRef]
16.
Pludowski, P.; Holick, M.F.; Grant, W.B.; Konstantynowicz, J.; Mascarenhas, M.R.; Haq, A.; Povoroznyuk, V.;
Balatska, N.; Barbosa, A.P.; Karonova, T.; et al. Vitamin D supplementation guidelines. J. Steroid Biochem.
Mol. Biol. 2018,175, 125–135. [CrossRef]
17.
Nielsen, O.H.; Irgens Hansen, T.; Gubatan, J.M.; Jensen, K.B.; Rejnmark, L. Managing vitamin D deficiency in
inflammatory bowel disease. Frontline Gastroenterol. 2019,10, 394–400. [CrossRef]
18.
Pike, J.W.; Meyer, M.B.; Lee, S.M.; Onal, M.; Benkusky, N.A. The Vitamin D Receptor: Contemporary
Genomic Approaches Reveal New Basic and Translational Insights. J. Clin. Investig.
2017
,127, 1146–1154.
[CrossRef]
19.
Li, X.Y.; Boudjelal, M.; Xiao, J.H.; Peng, Z.H.; Asuru, A.; Kang, S.; Fisher, G.J.;
Voorhees, J.J. 1,25-Dihydroxyvitamin D3 Increases Nuclear Vitamin D3 Receptors by Blocking
Ubiquitin/Proteasome-Mediated Degradation in Human Skin. Mol. Endocrinol.
1999
,13, 1686–1694.
[CrossRef]
20.
Ortiz-Masia, D.; Cosin-Roger, J.; Calatayud, S.; Hernandez, C.; Alos, R.; Hinojosa, J.; Apostolova, N.;
Alvarez, A.; Barrachina, M.D. Hypoxic Macrophages Impair Autophagy in Epithelial Cells through Wnt1:
Relevance in IBD. Mucosal Immunol. 2014,7, 929–938. [CrossRef]
21.
Macias-Ceja, D.C.; Ortiz-Masia, D.; Salvador, P.; Gisbert-Ferrandiz, L.; Hernandez, C.; Hausmann, M.;
Rogler, G.; Esplugues, J.V.; Hinojosa, J.; Alos, R.; et al. Succinate Receptor Mediates Intestinal Inflammation
and Fibrosis. Mucosal Immunol. 2019,12, 178–187. [CrossRef]
22.
Ortiz-Masia, D.; Hernandez, C.; Quintana, E.; Velazquez, M.; Cebrian, S.; Riano, A.; Calatayud, S.;
Esplugues, J.V.; Barrachina, M.D. iNOS-Derived Nitric Oxide Mediates the Increase in TFF2 Expression
Associated with Gastric Damage: Role of HIF-1. FASEB J. 2010,24, 136–145. [CrossRef]
23.
Cosin-Roger, J.; Ortiz-Masia, D.; Calatayud, S.; Hernandez, C.; Alvarez, A.; Hinojosa, J.; Esplugues, J.V.;
Barrachina, M.D. M2 Macrophages Activate WNT Signaling Pathway in Epithelial Cells: Relevance in
Ulcerative Colitis. PLoS ONE 2013,8, e78128. [CrossRef]
Nutrients 2020,12, 973 13 of 13
24.
Meier, R.; Lutz, C.; Cosin-Roger, J.; Fagagnini, S.; Bollmann, G.; Hunerwadel, A.; Mamie, C.; Lang, S.;
Tchouboukov, A.; Weber, F.E.; et al. Decreased Fibrogenesis After Treatment with Pirfenidone in a Newly
Developed Mouse Model of Intestinal Fibrosis. Inflamm. Bowel Dis. 2016,22, 569–582. [CrossRef]
25.
Liu, W.; Chen, Y.; Golan, M.A.; Annunziata, M.L.; Du, J.; Dougherty, U.; Kong, J.; Musch, M.; Huang, Y.;
Pekow, J.; et al. Intestinal Epithelial Vitamin D Receptor Signaling Inhibits Experimental Colitis. J. Clin.
Investig. 2013,123, 3983–3996. [CrossRef]
26.
Abreu-Delgado, Y.; Isidro, R.A.; Torres, E.A.; Gonzalez, A.; Cruz, M.L.; Isidro, A.A.; Gonzalez-Keelan, C.I.;
Medero, P.; Appleyard, C.B. Serum Vitamin D and Colonic Vitamin D Receptor in Inflammatory Bowel
Disease. World J. Gastroenterol. 2016,22, 3581–3591. [CrossRef]
27.
Rafiq, S.; Ieppesen, P.B. Body Mass Index, Vitamin D, and Type 2 Diabetes: A Systematic Review and
Meta-Analysis. Nutrients 2018,10, 1182. [CrossRef]
28.
Holmes, E.A.; Rodney Harri, R.M.; Lucas, R.M. Low Sun Exposure and Vitamin D Deficiency as Risk Factors
for Inflammatory Bowel Disease, With a Focus on Childhood Onset. Photochem. Photobiol.
2019
,95, 105–118.
[CrossRef]
29.
Zenata, O.; Vrzal, R. Fine Tuning of Vitamin D Receptor (VDR) Activity by Post-Transcriptional and
Post-Translational Modifications. Oncotarget 2017,8, 35390–35402. [CrossRef]
30.
Mohri, T.; Nakajima, M.; Takagi, S.; Komagata, S.; Yokoi, T. MicroRNA Regulates Human Vitamin D Receptor.
Int. J. Cancer 2009,125, 1328–1333. [CrossRef]
31.
Li, F.; Zhang, A.; Shi, Y.; Ma, Y.; Du, Y. 1alpha,25-Dihydroxyvitamin D3 Prevents the Differentiation of
Human Lung Fibroblasts Via microRNA-27b Targeting the Vitamin D Receptor. Int. J. Mol. Med.
2015
,36,
967–974. [CrossRef] [PubMed]
32.
Bai, J.; Li, Y.; Shao, T.; Zhao, Z.; Wang, Y.; Wu, A.; Chen, H.; Li, S.; Jiang, C.; Xu, J.; et al. Integrating Analysis
Reveals microRNA-Mediated Pathway Crosstalk among Crohn’s Disease, Ulcerative Colitis and Colorectal
Cancer. Mol. Biosyst. 2014,10, 2317–2328. [CrossRef] [PubMed]
33.
Xu, Y.; Qian, J.; Yu, Z. Budesonide Up-Regulates Vitamin D Receptor Expression in Human Bronchial
Fibroblasts and Enhances the Inhibitory Effect of Calcitriol on Airway Remodeling. Allergol. Immunopathol.
(Madr) 2019,47, 585–590. [CrossRef] [PubMed]
34.
Panizo, S.; Carrillo-Lopez, N.; Naves-Diaz, M.; Solache-Berrocal, G.; Martinez-Arias, L.; Rodrigues-Diez, R.R.;
Fernandez-Vazquez, A.; Martinez-Salgado, C.; Ruiz-Ortega, M.; Dusso, A.; et al. Regulation of miR-29b and
miR-30c by Vitamin D Receptor Activators Contributes to Attenuate Uraemia-Induced Cardiac Fibrosis.
Nephrol. Dial. Transplant. 2017,32, 1831–1840. [CrossRef]
35.
Tao, Q.; Wang, B.; Zheng, Y.; Jiang, X.; Pan, Z.; Ren, J. Vitamin D Prevents the Intestinal Fibrosis Via Induction
of Vitamin D Receptor and Inhibition of Transforming Growth Factor-Beta1/Smad3 Pathway. Dig. Dis. Sci.
2015,60, 868–875. [CrossRef]
36. Tian, Y.; Lv, G.; Yang, Y.; Zhang, Y.; Yu, R.; Zhu, J.; Xiao, L.; Zhu, J. Effects of Vitamin D on Renal Fibrosis in
Diabetic Nephropathy Model Rats. Int. J. Clin. Exp. Pathol. 2014,7, 3028–3037.
37.
Tzilas, V.; Bouros, E.; Barbayianni, I.; Karampitsakos, T.; Kourtidou, S.; Ntassiou, M.; Ninou, I.; Aidinis, V.;
Bouros, D.; Tzouvelekis, A. Vitamin D Prevents Experimental Lung Fibrosis and Predicts Survival in Patients
with Idiopathic Pulmonary Fibrosis. Pulm. Pharmacol. Ther. 2019,55, 17–24. [CrossRef]
38.
Holvoet, T.; Devriese, S.; Castermans, K.; Boland, S.; Leysen, D.; Vandewynckel, Y.P.; Devisscher, L.; Van
den Bossche, L.; Van Welden, S.; Dullaers, M.; et al. Treatment of Intestinal Fibrosis in Experimental
Inflammatory Bowel Disease by the Pleiotropic Actions of a Local Rho Kinase Inhibitor. Gastroenterology
2017,153, 1054–1067. [CrossRef]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
