Content uploaded by Oyediran Akinrinade
Author content
All content in this area was uploaded by Oyediran Akinrinade on Apr 28, 2020
Content may be subject to copyright.
Available via license: CC BY-NC-ND 4.0
Content may be subject to copyright.
Arteriosclerosis, Thrombosis, and Vascular Biology
Arterioscler Thromb Vasc Biol is available at www.ahajournals.org/journal/atvb
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1325
Correspondence to: Seema Mital, MD, Hospital for Sick Children, 555 University Ave, Toronto, Ontario M5G 1X8, Canada, Email seema.mital@sickkids.ca; or James
Ellis, PhD, Hospital for Sick Children, 16-9705 PGCRL, 686 Bay St, Toronto, Ontario M5G 0A4, Canada, Email jellis@sickkids.ca
The Data Supplement is available with this article at https://www.ahajournals.org/doi/suppl/10.1161/ATVBAHA.119.313936.
For Sources of Funding and Disclosures, see page 1338.
© 2020 The Authors. Arteriosclerosis, Thrombosis, and Vascular Biology is published on behalf of the American Heart Association, Inc., by Wolters Kluwer Health,
Inc. This is an open access article under the terms of the Creative Commons Attribution Non-Commercial-NoDerivs License, which permits use, distribution, and
reproduction in any medium, provided that the original work is properly cited, the use is noncommercial, and no modifications or adaptations are made.
TRANSLATIONAL SCIENCES
Everolimus Rescues the Phenotype of Elastin
Insufficiency in Patient Induced Pluripotent Stem
Cell–Derived Vascular Smooth Muscle Cells
Caroline Kinnear, Rahul Agrawal, Caitlin Loo, Aric Pahnke, Deivid Carvalho Rodrigues, Tadeo Thompson,
Oyediran Akinrinade, Samad Ahadian, Fred Keeley, Milica Radisic, Seema Mital, James Ellis
OBJECTIVE: Elastin gene deletion or mutation leads to arterial stenoses due to vascular smooth muscle cell (SMC) proliferation.
Human induced pluripotent stem cells–derived SMCs can model the elastin insufficiency phenotype in vitro but show only
partial rescue with rapamycin. Our objective was to identify drug candidates with superior efficacy in rescuing the SMC
phenotype in elastin insufficiency patients.
APPROACH AND RESULTS: SMCs generated from induced pluripotent stem cells from 5 elastin insufficiency patients with severe
recurrent vascular stenoses (3 Williams syndrome and 2 elastin mutations) were phenotypically immature, hyperproliferative,
poorly responsive to endothelin, and exerted reduced tension in 3-dimensional smooth muscle biowires. Elastin mRNA and
protein were reduced in SMCs from patients compared to healthy control SMCs. Fourteen drug candidates were tested
on patient SMCs. Of the mammalian target of rapamycin inhibitors studied, everolimus restored differentiation, rescued
proliferation, and improved endothelin-induced calcium flux in all patient SMCs except one Williams syndrome. Of the calcium
channel blockers, verapamil increased SMC differentiation and reduced proliferation in Williams syndrome patient cells but
not in elastin mutation patients and had no effect on endothelin response. Combination treatment with everolimus and
verapamil was not superior to everolimus alone. Other drug candidates had limited efficacy.
CONCLUSIONS: Everolimus caused the most consistent improvement in SMC differentiation, proliferation and in SMC function
in patients with both syndromic and nonsyndromic elastin insufficiency, and offers the best candidate for drug repurposing
for treatment of elastin insufficiency associated vasculopathy.
VISUAL OVERVIEW: An online visual overview is available for this article.
Key Words: elastin ◼ genes ◼ mutation ◼ stem cells ◼ vascular diseases
Elastin is the dominant extracellular matrix protein in
the arterial wall, allowing vascular elasticity, and facil-
itating the recoil essential to blood vessel physiology.
It is mainly produced by smooth muscle cells (SMCs)
during late fetal and early postnatal life, with minimal
generation of elastin throughout adulthood.1 Chromo-
somal deletion of 7q11.23 that includes deletion of the
elastin (ELN) gene causes Williams syndrome (WS) with
supravalvar aortic stenosis (SVAS) and other large artery
stenosis or generalized arteriopathy. This is related to
increased proliferation of SMCs2 that are functionally
immature. Heterozygous mutations of the ELN gene
cause nonsyndromic SVAS, that is, SVAS without other
systemic manifestations. The arterial narrowing often
recurs despite surgery,3,4 and there are no drugs clini-
cally approved to treat this condition. Novel therapies are
being tested in animal models and human cells as was
recently reviewed.5 A recent small clinical trial evaluating
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1326 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
minoxidil treatment on patients with WS reported no pos-
itive improvement in vascular phenotype.6 Our goal was
to find targeted therapies that can rescue the abnormal
vascular phenotype in patients with elastin insufficiency
(EI) using drugs approved by the Food and Drug Admin-
istration for other indications as a potential drug repur-
posing strategy.
Although mouse models of EI have greatly improved
our overall understanding of elastin signaling, there are
limitations in their use in drug screens. Eln−/− mice die
shortly after birth due to severe aortic obstruction,7 and
heterozygous mice are viable but do not exhibit SVAS.8
Interestingly, a transgenic mouse carrying a human
version of ELN on a bacterial artificial chromosome
recapitulates aortic thickening with heterozygosity sug-
gesting that the human and mouse elastin gene, and
elastin synthesis, are not regulated equivalently in the
developing aorta, and highlights the need for human-
relevant models.9–11 Patient induced pluripotent stem
cells (iPSCs) provide human-relevant models while
retaining the genetic background of the patient and
provide a noninvasive and renewable cell source for
study of phenotype and drug responses. Importantly,
for the study of EI, the use of patient cells that still
carry a functioning copy of the ELN gene facilitates
the testing of drugs that promote elastin transcrip-
tion. Human iPSCs have been widely used to study
the function of susceptible genes in a variety of dis-
eases, including cardiovascular diseases.12–15 The use
of iPSCs also offers a highly useful platform for drug
screening because of their potential for replicating in
vivo drug safety and efficacy.16–19
Human iPSCs can successfully be differentiated into
vascular SMCs with efficiencies exceeding 80%,20 and
their functional properties can be studied as they respond
to vasoactive agonists.21 SMCs derived from patient
iPSCs have been used to model vascular disease, such
as WS, SVAS, hypertension, Marfan and Hutchinson-Gil-
ford Progeria syndromes.22–26 These iPSC-SMCs reca-
pitulated the pathological phenotype of each disease and
identified novel targets for treatment.22,23,25 In our previ-
ous report, we recapitulated the disease phenotype of EI
using patient iPSC-derived SMCs from a single patient
with WS. The SMCs were hyperproliferative, poorly dif-
ferentiated, and poorly contractile compared with healthy
control cells. The antiproliferative mTOR (mammalian
target of rapamycin) inhibitor rapamycin rescued the dif-
ferentiation and proliferation defects but did not improve
contractile properties.22
The goal of the current study was to identify one or
more drug classes that would rescue not just the phe-
notypic abnormalities but also functional abnormalities
in the SMCs of patients with WS as well as those with
ELN mutations. We generated iPSCs from 2 additional
patients with WS and 2 patients with heterozygous ELN
mutations, all of whom had infantile-onset severe dis-
ease. We studied the effect of 14 candidate drugs on
SMC differentiation, proliferation, and calcium flux. Our
results showed that drugs belonging to the class of
mTOR inhibitors showed the greatest efficacy in rescu-
ing not just phenotypic but also contractile abnormalities
in EI patient SMCs.
MATERIALS AND METHODS
The data that support the findings of this study are available
from the corresponding author on reasonable request.
Nonstandard Abbreviations and Acronyms
CCB calcium channel blocker
DMSO dimethyl sulfoxide
EI elastin insufficiency
ELN elastin
iPSC induced pluripotent stem cell
mTOR mammalian target of rapamycin
mTORC mTOR complex
Oct octamer-binding transcription factor
RT-qPCR reverse transcription-quantitative poly-
merase chain reaction
SM22α smooth muscle 22 α
SMC smooth muscle cell
SVAS supravalvar aortic stenosis
WS Williams syndrome
Highlights
• Elastin insufficiency caused by smooth muscle cell
proliferation is a vascular disorder with no approved
therapies. Elastin insufficiency caused by 7q11.23
deletion or by point mutations in the elastin gene
can be modeled in the dish using patient induced
pluripotent stem cell-derived smooth muscle cells.
• Compared with healthy cells, cells from 5 patients
with elastin insufficiency were immature, hyper-
proliferative, did not respond to endothelin and
3-dimensional biowires generated from patient
smooth muscle cells failed to compact.
• Candidate drugs tested on induced pluripotent
stem cell-derived smooth muscle cells showed that
mTOR (mammalian target of rapamycin) inhibitor,
everolimus, was the best at rescuing the abnormal
phenotype by enhancing smooth muscle cell differ-
entiation and functional maturation.
• As a drug with a known safety profile, these find-
ings provide supporting evidence for consideration
of everolimus for treatment of elastin insufficiency
syndromes, and ultimately, may also benefit patients
with acquired vascular disorders.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1327
Cell Source
De-identified patient with WS (WS2, WS3) and elastin muta-
tion patient (ELN1, ELN2) skin fibroblasts were obtained from
patients recruited through the SickKids Heart Centre Biobank
Registry (Toronto, ON, Canada). WS1-iPSC line C and wild-
type control 1 BJ iPSC were previously reported by us22; con-
trol 2 21P and control 3 19-2 iPSCs were previously reported
as controls in autism studies.27,28 H9 human embryonic stem
cells were obtained from the National Stem Cell Bank (WiCell
Research Institute, Madison, WI). All investigations were con-
ducted according to the Declaration of Helsinki principles,
studies were approved by the Hospital for Sick Children
institutional review board, and written informed consent was
obtained from the patient/parent/legal guardians. Human
embryonic stem cell and iPSC studies were approved by the
Canadian Institute for Health Research Stem Cell Oversight
Committee of Canada.
Generation of iPSCs and Pluripotency
Characterization
All EI patient skin fibroblasts were reprogrammed with the
OCT4, SOX2, KLF4, and C-MYC retrovirus vectors using the
Early Transposon promoter and Oct (octamer-binding transcrip-
tion factor)-4 and Sox2 enhancers (EOS) lentivirus protocol as
previously published.29 In brief, the EOS system allows expres-
sion of reporter genes in pluripotent stem cells but not in pri-
mary fibroblasts, which aids isolation of reprogrammed iPSC
lines. Emerging human iPSC colonies marked with EGFP and
puromycin-resistance were isolated, expanded, and character-
ized. Controls 1 and 3 iPSCs were also reprogrammed with
retrovirus and the EOS lentivirus. Control 2 was reprogrammed
using a nonintegrative Sendai virus approach.27 In vitro differ-
entiation into embryoid bodies was performed and analyzed for
pluripotency as described.30
Deletion Confirmation Using Multiplex Ligation
Probe Amplification and DNA Fluorescence In
Situ Hybridization
We confirmed the genetic diagnosis of 7q11.23 deletion in
DNA from WS patients using the SALSA multiplex ligation
probe amplification Kit P029-A1 which contains 32 multiplex
ligation probe amplification probes for 8 genes located in the
WS critical region (MRC Holland), and the ELN gene muta-
tion in nonsyndromic SVAS patients using Sanger sequencing.
To verify the deletion of chromosome region 7q11.23 in the
iPSCs, we performed karyotyping by G banding chromosome
analysis with a 400 to 500 band resolution through The Centre
For Applied Genomics, Hospital for Sick Children, Toronto, and
fluorescence in situ hybridization. A deletion at chromosome
7q11.23 involving 50 oligonucleotide probes from position
72 404 049 to 73 771 409 bp, including ELN, was identified
using the oligonucleotide-based array Comparative Genomic
Hybridization (Molecular Cytogenetics Laboratory, Hospital for
Sick Children, Toronto, Canada).
Variant Confirmation Using Sanger Sequencing
To confirm ELN mutation in iPSCs, polymerase chain reac-
tion (PCR) products from patient and control iPSCs were
sent to The Centre For Applied Genomics for Sanger
sequencing. Primers for ELN variants were designed using
National Center for Biotechnology Information. ELN1:
5′–GGGAAGGAGCAGGTAGATCAG–3′ and 5′–TCTATTGTGA
CCACCCCAGTC–3′; ELN2: 5′–ACAAGTCCCTTAATGAGTG
TGTTG–3′ and 5′–GGAACAAAGGCCAAGTCCATC–3′. Primer-
BLAST and primer specificity were confirmed using the
Ensembl Project BLAST/BLAT. Chromatographs were ana-
lyzed using FinchTV.
Differentiation of iPSCs Into SMCs
Control and patient iPSCs were differentiated into SMCs
using previously published protocols.22,31 iPSC colonies were
digested using 1 mg/mL collagenase type IV and transferred
to an ultralow attachment 6-well plate (Corning Incorp, Corning,
NY) to generate embryoid bodies. Knockout DMEM was used
for 2 days and replaced by DMEM/F12 supplemented with
10% fetal bovine serum and 1% glutamax. Six-day-old embry-
oid bodies were transferred to 6-well plates coated with 0.1%
gelatin for an additional 6 days in DMEM +10% fetal bovine
serum. The embryoid bodies were dissociated with 0.05% tryp-
sin and cultured on Matrigel-coated 6-well plates in smooth
muscle growth medium (medium 231 + smooth muscle growth
supplement; Life Technologies, Carlsbad, CA). Cells were pas-
saged when they reached 80% to 90% confluence. To induce
differentiation to SMCs, cells were re-plated in smooth muscle
differentiation medium (medium 231 + smooth muscle dif-
ferentiation supplement; Life Technologies) on gelatin-coated
plates for 6 days.
Immunocytochemistry and High Content
Imaging Assays
Five thousand cells were plated per well in 96 well plates,
and after differentiation was treated with dimethyl sulfox-
ide (DMSO) or candidate drugs (dissolved in DMSO) for 6
days and stained using high content cell imaging (Cellomics
ArrayScan VTI, ThermoFisher Scientific, Ottawa, ON, Canada).
Three independent experiments were performed using 3 tech-
nical replicates for each experiment. Cells were fixed with
4% paraformaldehyde, permeabilized, blocked, and incubated
overnight with primary antibody, rabbit anti-smooth muscle 22
alpha (SM22α; Abcam, Cambridge, MA). Secondary goat- anti-
rabbit IgG antibody conjugated with fluorescein isothiocyanate
(Sigma-Aldrich, St Louis, MO) was added to the samples and
incubated for an hour. Cell nuclei were stained with 4′,6-diamid-
ino-2-phenylindole (Life Technologies). Fluorescence was
analyzed using an ArrayScan VTI HCS Reader (ThermoFisher
Scientific). Images were captured using the Volocity or the
vHCS View Software.
xCELLigence Real-Time Cell Monitoring
The xCELLigence system (Roche/ACEA Biosciences, San
Diego, CA) was used to continuously monitor cell proliferation.
Cells were cultivated in culture plates equipped with micro-
electrodes, which allow the computer to measure mechanical
impedance.32 The xCELLigence software (version 1.2.1.1.002)
converts collected data to a cell index, as a measure of cell
proliferation. Five thousand cells were seeded per well of
xCELLigence E-96 plates in growth medium in 3 independent
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1328 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
experiments conducted on 3 different days (and with 3 tech-
nical replicates per experiment). Plates were placed in the
system, incubated at 37°C under 5% CO2 and monitored at
15-minute time intervals. After 24 hours, medium was changed
to differentiation medium, which was replaced after 2 days. Cell
impedance was recorded at 15-minute intervals for up to 145
hours. Candidate drugs were added after 24 hours in differen-
tiation conditions and change in cell index as an indicator of
cell number was compared between cases and control iPSC-
SMCs and between treated and untreated SMCs.
Calcium Measurement
SMCs were loaded with 1 µmol/ L fluo5F AM (Life Technologies)
at 37°C for 30 minutes, then washed with Hank’s Balanced
Salt Solution. Fluorescence was visualized using a Nikon
TE-2000 epifluorescence microscope (Nikon Corporation,
Tokyo, Japan). Images were collected and analyzed using
Volocity image acquisition and analysis software (PerkinElmer
Inc, Waltham, MA). Fluorescence intensity was measured after
subtracting nonspecific fluorescence background in 50 indi-
vidual cells per well in 3 wells. The experiments were repeated
3 times. Values were plotted against time using graphing soft-
ware (Excel, Microsoft, Redmond, WA). After 10 seconds base-
line, cells were exposed to 100 nmol/L of the calcium agonist,
endothelin-1 (Sigma-Aldrich) to stimulate calcium influx which
was continuously monitored for 3 minutes. The change in fluo-
rescence intensity (ie, F–F0) was used to estimate intracellular
calcium flux in response to endothelin in control and patient
iPSC-SMCs and in DMSO versus drug-treated SMCs.
Smooth Muscle Biowire Assay
To generate 3-dimensional-bioengineered tissues from SMCs,
that is, biowires, polydimethylsiloxane posts were made using
the Sylgard 184 Elastomer Kit by Dow Corning Corporation.
Forty-five grams of elastomer base was mixed with 3 g of
curing agent to make the posts. This mixture was added on
a metal template (Department of Mechanical and Industrial
Engineering, University of Toronto), which was placed in a
vacuum machine at −760 mm Hg for 1 hour and then heated
at 80°C for another 1 hour. A collagen gel was prepared with
2.2 g/L sodium bicarbonate, 1 mol/L sodium hydroxide, 3 mg/
mL collagen (Corning), and Matrigel (Corning). The collagen
gel was added to a suspension of 500 000 SMCs. This mixture
was added to a well containing the polydimethylsiloxane posts
and maintained in the incubator. After 24 hours, differentiation
medium was added into the well with 0.01% DMSO or 100
nmol/L rapamycin. Tissue remodeling resulting from tractional
forces during gel compaction was assessed by measuring tis-
sue width every day for 7 days. Both passive and active tension
were assessed by measuring the silicone post displacement
from the microscopically acquired video images over multiple
time points. Multiple measurements were averaged to arrive
at an average post displacement for each condition. Elastic
modulus and post dimensions were described in the previous
work.33 The post displacement was related to the bending force
exerted by the tissue on the post using cantilever beam-partial
uniform load equation as previously described. For accurate
application of beam bending equations, the vertical position of
the tissue on the post was determined by cutting through the
tissue microwell and imaging at the end of the experiment. To
determine tension, the force per width of the tissue that results
from beam bending equations was converted into a point load
and divided by the cross-sectional area of the tissue calculated
from the experimentally measured average tissue diameter.
Passive tension, that is, the tension exerted by tissues on the
posts in a resting state, was calculated from the post displace-
ment for resting tissues at day 7, whereas active tension was
assessed from the maximum post displacement after endo-
thelin stimulation (n=3 biological replicates for DMSO and
rapamycin-treated control 1, WBS2, and ELN1).
Reverse Transcription-Quantitative PCR for ELN
Total RNA was extracted from control and patient cul-
tured SMCs using the RNeasy Mini kit (QIAGEN, Toronto,
Canada) from 3 independent experiments (and 3 techni-
cal replicates per experiment). cDNA was synthesized from
1 µg RNA with Superscript III first-strand synthesis (Life
Technologies) in a 20-µL reaction volume. Primer sequences
for ELN were 5′-CAAGGCTGCCAAGTACGG-3′ and 5′-CCA
GGAACTAACCCAAACTGG-3′ for elastin; and 5′-GCTGAGA
ACGGGAAGCTTGT-3′ and 5′-TCTCCATGGTGGTGAAGACG-3′
for GAPDH. Real-time PCR was performed on a StepOnePlus
Real-Time System (Life Technologies) using SYBR GreenER
qPCR SuperMix (Life Technologies). Quantification of gene
expression was assessed with the comparative cycle threshold
(ΔΔCT) method. mRNA expression was compared between
control and patient SMCs. Reverse transcription-quantitative
polymerase chain reaction (RT-qPCR) for pluripotency genes
was performed as described.30
Mass Spectrometry for ELN
Mass spectrometry on protein lysates from control and patient
SMCs was performed in the SickKids Proteomics, Analytics
Robotics & Chemical Biology Centre. Parallel reaction moni-
toring analysis was performed on a Q-Exactive HF-X hybrid
Quadrupole-Orbitrap mass spectrometer (ThermoFisher
Scientific) outfitted with a nanospray source and EASY-nLC
split-free nano-LC system (ThermoFisher Scientific). Lyophilized
peptide mixtures were dissolved in 0.1% formic acid and loaded
onto a 75 µm × 50 cm PepMax RSLC EASY-Spray column filled
with 2 µm C18 beads (ThermoFisher Scientific) at a pressure
of 900 bars. Peptides were eluted over 60 minutes at a rate of
250 nL/min using a 0% to 35% acetonitrile gradient in 0.1%
formic acid. Peptides were introduced by nanoelectrospray
into the spectrometer. The instrument consisted of a tandem
mass spectrometry scan detecting precursor ions. Automatic
gain control targets were 1×105 with a maximum ion injection
time of 50 ms. The quadrupole isolation window was set to 0.5
m/z, and the normalized collision energy was set at 30. Heavy
synthetic elastin peptides were spiked-in to ensure the right
light elastin peptides were monitored and precisely quantified
in the cell samples. Amounts were normalized to endogenous
tubulin beta chain 5 and myosin heavy chain 9. The follow-
ing elastin peptide sequences were measured and relative
amounts were compared between control and patient SMCs—
LPGGYGLPYTTGK [212, 224]; LPYGYGPGGVAGAAGK
[225, 240]; AGYPTGTGVGPQAAAAAAAK [241, 260]; and
VPGALAAAK [644, 652]. Mass spectrometry was repeated
3 times in all controls and patient iPSC-SMCs as well as in
DMSO and rapamycin-treated patient cells.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1329
RNA Sequencing
RNA was extracted from DMSO-treated and rapamycin-treated
iPSC-SMCs, and sequenced using the Illumina HiSeq 2500
platform through The Centre For Applied Genomics. Read
data that passed quality control checks were aligned to the
human genome browser, UCSC hg19, using Tophat v. 2.0.11.
Alignments were processed to extract raw read counts for genes
using htseq-count v.0.6.1p2. Differential expression analysis was
performed between DMSO and rapamycin-treated cells using
EdgeR. Reads per kilobase of transcript per million generated
were normalized for the size of each library and normalized
for the length of the transcripts. Using supervised hierarchi-
cal clustering, raw fold difference between DMSO-treated and
rapamycin-treated SMCs was calculated for the following SMC
associated gene sets using gene ontology terms for differentia-
tion (GO:0051145, GO:0051152); proliferation (GO:0048661,
GO:1904707); and contraction (GO:0006940, GO:0006939).
Statistical Analysis
Statistical analyses were performed using the Student t test
on data from 3 independent experiments (n=3) with the mean
of each independent experiment derived from 3 technical rep-
licates where appropriate. Analyses were done to measure dif-
ferences in the phenotype between (1) 5 cases and 3 control
iPSC-SMCs and (2) candidate drug and DMSO-treated SMCs
for the following variables: protein expression, mRNA expres-
sion by RT-qPCR, cell proliferation, and calcium flux. Three
dimensional smooth muscle biowire assays were analyzed
using cells derived from 2 cases and 1 control. The normality
and variance were not tested to determine whether the applied
parametric tests were appropriate. Two-way ANOVA with
Bonferroni post hoc test was used for smooth muscle biowire
compaction analyses. Differences were considered statistically
significant at P<0.05.
RESULTS
Reprogramming of Patient iPSCs
In addition to our previously reported WS (WS1) line,22
we reprogrammed skin fibroblasts from 4 patients with
SVAS recruited through our Heart Centre Biobank. Two
(WS2 and WS3) had 7q11.23 deletion confirmed by
multiplex ligation probe amplification,22 while 2 had non-
syndromic SVAS due to heterozygous ELN mutations—
one with a variant (substitution) in exon 27 (ELN1) and
another with a frameshift variant (insertion) in exon
16 (ELN2), both predicted to induce a premature stop
codon. Patient information, cardiac diagnoses, surgical
history, and genetic test results are shown in the Table.
In addition to the healthy BJ control line previously used
by us (control 1),22 we also used lines from 2 additional
unaffected individuals as controls—21P (control 2)27 and
19-2 (control 3).28 Fibroblasts do not express pluripo-
tency genes,12–14,17–19 which we previously confirmed in
WS1 lines.22 After reprogramming using the 4-factor ret-
rovirus approach34 (Methods for details), all iPSC lines
showed the hallmarks of pluripotent phenotype (Fig-
ure 1; Figure I in the Data Supplement). They expressed
human pluripotency markers NANOG (homeobox pro-
tein NANOG), OCT-4, TRA-1-60 (T-cell receptor alpha
locus), and SSEA-4 (stage specific embryo antigen 4)
as shown by immunofluorescence and OCT4, NANOG,
REX1 (reduced expression gene 1), and DNMT3B (DNA
methyltransferase 3 beta) by RT-qPCR (Figure 1A and
1B; Figure IA and ID in the Data Supplement). The iPSCs
gave rise to cells from all 3 germ layers upon in vitro dif-
ferentiation into embryoid bodies and they all exhibited a
Table. Patient Clinical and Genetic Data
Patient ID
Age at
Enrollment
(Months) Sex Cardiac Diagnoses
Surgical/Intervention
History
Age at First Surgery/
Intervention (Months)
MLPA for
7q11.23
Deletion
Elastin Gene
Sequencing
Williams-Beuren syndrome: 7q11.23 deletion
WS1 9 M PS 1 surgery 10.5 1.6Mb deletion
FZD9-CYLN2
heterozygous
WS2 3 M SVAS, SVPS, bilateral
branch PA hypoplasia,
coarctation of the aorta
3 surgeries 2 catheter
interventions in 3 y
3.7 1.6Mb deletion
FZD9-CYLN2
heterozygous
WS3 11 F SVAS, branch PA
hypoplasia
1 surgery 2 catheter
interventions in 4 y
11 1.6Mb deletion
FZD9-CYLN2
heterozygous
Nonsyndromic cases: elastin mutation
ELN1 1 M SVAS; valvar and SVPS;
peripheral PS; aortic arch
hypoplasia; coronary artery
ostial stenosis
3 surgeries 3 catheter
interventions in 3 y
1.7 Heterozygous substitution
c.1785T>A (p.Tyr595X),
exon 27 pathogenic,
rs727503033
ELN2 7 F SVAS, peripheral PS 6 catheter
interventions in 5 y
11 Heterozygous
frameshift c.862_863insG
(p.Ala288fs), exon 16
pathogenic rs727503028
ELN indicates elastin; Ins, insertion; MLPA, multiplex ligation-dependent probe amplification; PA, pulmonary artery; PS, pulmonary stenosis; SVAS, supravalvar aortic
stenosis; SVPS, supravalvar pulmonary stenosis; and WS, Williams-Beuren syndrome.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1330 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
normal karyotype (Figure 1C and 1D; Figure IB and IC
in the Data Supplement). Short tandem repeat analyses
were used to confirm that the iPSCs were from the cor-
rect patients (Table I in the Data Supplement). Assays
were performed using one reprogrammed cell line
derived from each of the 5 patients in accordance with
Germain and Testa’s guidelines for optimal interpretation
of iPSC-based studies.35
Phenotype of iPSC-Derived SMCs
iPSCs were differentiated into SMCs using an estab-
lished protocol.31 The morphological and functional phe-
notype were compared between patient iPSC-derived
SMCs and healthy control iPSC-derived SMCs. Support-
ing data are provided in Table IIIA in the Data Supplement.
SMC Differentiation
We previously reported that control iPSC-SMCs showed
downregulation of SM progenitor markers (CD34,
Flk1 [fetal liver kinase 1], and Tie2 [tyrosine-protein
kinase receptor]) and upregulation of SM differentia-
tion markers (calponin, SM22a, smoothelin, myokardin,
and telokin).22 We, therefore, selected SM22α staining
to assess SMC differentiation using high content imag-
ing. Control iPSCs generated 80% to 90% SM22α posi-
tive cells compared with patient iPSCs, which generated
45% to 68% SM22α-positive cells suggesting impaired
differentiation in EI patients with the most severe differ-
entiation abnormality seen in WS3 (Figure 2A and 2B).
SMC Proliferation
We used the xCELLigence system for real-time moni-
toring of cell proliferation. The system uses specially
designed microtiter plates containing microelectrodes to
noninvasively monitor dynamic changes in cell index of
cultured cells that reflects changes in cell size and num-
ber. Cell index was higher suggesting higher proliferation
in all patient SMCs except for ELN2-SMCs, which did
not demonstrate hyperproliferation. WS3 was the most
proliferative compared to controls (Figure 2C and 2D).
Endothelin-Induced Calcium Flux
SMC active function was evaluated by the ability of SMCs
to increase calcium flux in response to a vasoactive ago-
nist, endothelin. Cells on day 6 of differentiation were
loaded with the Fluo5F calcium dye, and calcium tran-
sients were measured by the intensity of fluorescence
before and after treatment with endothelin. All 3 controls
responded to endothelin as seen by the rise in calcium
flux within 30 seconds of treatment. While ELN1-SMCs
showed a small increase in calcium flux following treat-
ment, WS1 and WS2-SMCs indicated a smaller and
delayed response. WS3 and ELN2-SMCs showed the
lowest response to endothelin (Figure 2E and 2F).
Smooth Muscle Biowire Maturation and Contractility
Contractile response and SMC maturation were further
assessed by generating 3-dimensional smooth muscle
biowires from one control (control 1), one WS (WS2), and
one ELN mutation (ELN1) patient SMCs. A mixture of
SMC suspension and a collagen gel was added into a
Figure 1. Pluripotency characterization of induced pluripotent stem cells (iPSCs) from the patient with an ELN variant (ELN1).
A, iPSCs stained positive for pluripotency markers OCT (octamer-binding transcription factor)-4, NANOG, and TRA-1-60. Nuclei were stained
with 4′,6-diamidino-2-phenylindole (DAPI). B, Endogenous pluripotency genes were upregulated following successful reprogramming of ELN
(elastin)-1 iPSCs as detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and comparable to pluripotency gene
expression in human embryonic stem cells, H9. C, ELN1 iPSCs differentiated in vitro into all 3 germ layers. Immunocytochemistry showed
nestin expression as an example of neuronal ectoderm, SMA (smooth muscle actin) expression for mesoderm, and AFP (α-fetoprotein)
expression for endoderm. D, Normal G banding karyotype of ELN1 iPSCs. Results are shown as means and standard deviations from 3
independent replicates for each gene.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1331
Figure 2. Abnormal smooth muscle cell (SMC) differentiation, proliferation and function in elastin insufficiency (EI) induced
pluripotent stem cells (iPSC)-SMCs.
A, SM22α (smooth muscle 22α) staining (representative images) and (B) quantification by high content imaging revealed the percentage of
SM22α positive cells was lower in all patient with Williams syndrome (WS) and in ELN (elastin) patient SMCs compared with control SMCs.
C, SMC proliferation measured by cell impedance (representative graph of cell index), and (D) quantification revealed increased proliferation in
all 3 WS SMCs and in ELN1 patient SMCs compared to control SMCs. ELN2 patient SMC proliferation was not different from control SMCs.
E, Calcium flux in response to endothelin (representative graph from 50 cells from an individual well) and (F) quantification from all replicates of
maximum peak of mean fluorescence intensity after background correction (F–F0) showed lower calcium flux in response to endothelin in all patient
SMCs compared with control SMCs (n=3 independent biological replicates and 3 technical replicates each for differentiation, proliferation, and
calcium assays). G, Biowires generated from iPSC-SMCs from one control (CT1), one WS (WS2), and one ELN mutant patient (ELN1) showed
failure of compaction of patient SMCs compared to control SMCs on day 6. H, Graph shows the change in the diameter of SMC-seeded biowires
from day 1 to 6. All biowires showed some compaction by day 6, and the biowire diameter on day 6 remained significantly larger in WS2 and
ELN1 patients compared to CT1 control. I, Passive tension at baseline was lower in patient SMC biowires compared with control. J, Active tension
following treatment with endothelin was lower in patient SMC biowires compared to control (n=3 independent experiments). A–J, Supporting data
are included in Table IIIA in the Data Supplement. *P<0.05, patient vs control, łP<0.05, day 6 vs 1.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1332 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
well containing a pair of polydimethylsiloxane posts to
serve as fixation points and for measurements of con-
traction force. While control cells compacted after 6 days,
both WS2 and ELN1 patient SMCs did not fully compact
(Figure 2G and 2H). Passive tension was reduced in
patient SMCs compared to control cells (Figure 2I). Bio-
wires were then treated with endothelin and the change
in active tension, that is, force was measured. Compared
with control SMCs, tension generation in response to
endothelin was lower in both patient SMCs (Figure 2J).
Elastin Gene and Protein Expression
ELN variants were confirmed in the differentiated iPSC-
SMCs using Sanger sequencing (Figure II in the Data
Supplement). We measured ELN mRNA expression in
all iPSC-SMCs using RT-qPCR. Compared with control
SMCs, elastin mRNA levels were significantly lower in
all patient SMCs (Figure 3A). Elastin protein expression
was then quantified by parallel reaction monitoring mass
spectrometry using the sum of 4 different peptides. Elas-
tin was significantly lower in all EI patient SMCs com-
pared to controls except for ELN2-SMCs which showed
a nonsignificantly lower ELN expression. WS3 had the
lowest levels compared to controls (Figure 3B). To deter-
mine if the difference in ELN mRNA expression between
ELN1 and ELN2-SMCs could be related to failure of
nonsense-mediated decay of truncated elastin in ELN2,
we quantified the amount of elastin peptides separately.
Three peptides upstream of ELN1 (p.Tyr595X) and ELN2
(p.Ala288fs) variants and one peptide downstream of
the variants, that is, VPGALAAAK (644, 652) were quan-
tified. Because the downstream peptide was present in
both ELN mutation patients, it indicates that mutated
mRNA was being eliminated and that the baseline phe-
notype was likely not related to translation of structurally
abnormal protein in ELN mutant SMCs (Figure 3C).
In summary, we successfully differentiated patient
iPSCs into SMCs and recapitulated the abnormal EI
phenotype. The iPSC-SMCs from the ELN2 patient with
the frameshift variant had higher elastin levels than other
patients and showed only mild abnormalities in differenti-
ation and proliferation compared with other patients. The
SMCs from the WS3 patient had lower elastin levels than
other patients and showed the most severe abnormali-
ties in SMC differentiation, proliferation, and calcium flux.
Response of Patient iPSC-SMCs to Rapamycin
We previously reported the ability of the mTOR inhibi-
tor rapamycin to rescue abnormal SMC differentiation
and hyperproliferation.22 To confirm that the SMCs being
studied were functionally active and drug responsive, we
performed a pilot experiment. We studied the effect of
rapamycin on gene expression by RNAseq of rapamycin-
treated and DMSO-treated SMCs from all patients and
compared gene sets that were differentially expressed
using gene ontology (P<0.05). Figure 4A shows the
fold-change in gene expression between rapamycin and
DMSO-treated SMCs. Compared with DMSO-treated
SMCs, rapamycin-treated SMCs showed reduced
expression of SMC proliferation genes and a variable
increase in expression of SMC differentiation and con-
traction genes. Rapamycin also increased elastin protein
levels as seen by mass spectrometry likely reflecting
improved SMC maturation (Figure 4B). Transmission
electron microscopy performed on WS2 and ELN1
smooth muscle biowires showed that rapamycin induced
SMC elongation and the formation of myofilaments, the
main feature of a differentiated SMC (Figure 4C and
4D) compared with DMSO-treated biowires. Although
antibody staining was not performed, the presence of
myofilaments was confirmed by an independent pathol-
ogy service at our institution. Rapamycin also induced
structural maturation in the form of biowire compac-
tion in both WS2 and ELN1 patient biowires (Figure 4E
and 4F). These findings confirmed that SMCs from EI
patients were functionally active and drug responsive.
Response of Patient iPSC-SMCs in Candidate
Drug Screens
We explored additional drugs in the class of mTOR inhibitors
as well as drugs from other classes that have the poten-
tial to target SMC differentiation, proliferation, and function
and elastin synthesis, including calcium channel blockers
(CCBs), other antiproliferative drugs, and proelastogenic
drugs. Cells were treated with drug for 6 days throughout
the differentiation process. Dose selection (Table II in the
Data Supplement) was based on the dose that induced the
optimum response without toxicity, as shown in Figure III in
the Data Supplement. Significance tests were performed
in comparison to DMSO-treated cells, which were not dif-
ferent from untreated cells (Table IIIB through IIID in the
Data Supplement), and control cell lines were included to
compare with the phenotype of healthy cells.
mTOR Inhibitors
Similar to rapamycin, the mTORC1 (mTOR complex 1)
inhibitors, everolimus and temsirolimus, increased differ-
entiation of all patient SMCs as depicted by significantly
higher percentage of SM22α positive cells compared to
DMSO-treated cells and to levels equivalent to the healthy
control lines (Figure 5A). AZD0857, a dual inhibitor of
mTORC1 and mTORC2, increased SM22α percentage in
all WS patient cells but not in the ELN mutant patient cells.
All mTOR inhibitors decreased cell impedance, a measure
of SMC proliferation, in all WS and ELN1 cells but did
not have an effect on ELN2 cells that were not hyper-
proliferative (Figure 5B). Compared with DMSO-treated
cells, most of the mTOR inhibitors increased endothelin-
induced calcium flux in one or more patient SMCs except
WS3, which had lowest elastin levels and the most severe
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1333
Figure 3. ELN expression was decreased in elastin insufficiency (EI) induced pluripotent stem cells (iPSC)-smooth muscle cells (SMCs).
A, ELN mRNA expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was 20%–46% lower in patient iPSC-
SMCs compared with all control SMCs. B, Parallel reaction monitoring mass spectrometry of the sum of peak area of 4 normalized elastin
peptides showed lower elastin formation in all patient iPS-SMCs compared to controls (not statistically significant for ELN2). C, Quantification
of 3 elastin peptides upstream of the elastin variants and one elastin peptide downstream of the elastin variants showed lower abundance
of both upstream and downstream peptides in all patient cells (n=3 independent experiments). *P<0.05, patient vs control SMCs; †P<0.05,
patient vs control SMCs for fourth peptide only. WS indicates Williams syndrome.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1334 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
Figure 4. Phenotypic rescue by rapamycin.
A, Heat map of RNA sequencing data from 5 patient induced pluripotent stem cells (iPSC)-smooth muscle cells (SMCs). Supervised
hierarchical clustering showing raw fold difference in gene expression between dimethyl sulfoxide (DMSO) and corresponding rapamycin-
treated SMCs for genes associated with SMC differentiation, SMC proliferation, and SMC contraction (P<0.05 between rapamycin vs
DMSO-treated SMCs). Positive values indicate upregulation and negative values indicate downregulation compared to untreated SMCs. B,
Elastin expression measured by mass spectrometry in 3 independent experiments increased in all patient SMCs after treatment with rapamycin.
C, Transmission electron microscopy of patient smooth muscle biowires treated with DMSO or rapamycin. SMC maturation was observed
after rapamycin treatment with the appearance of myofilaments (arrows and insets) and an elongated cell shape. D, The length to width ratio
of the SMCs was higher in rapamycin compared to DMSO-treated biowires. E, Biowires treated with rapamycin showed greater compaction
compared to DMSO-treated biowires by day 6. F, Comparison of tissue width from day 1 to 6 showed that both patient biowires showed
compaction by day 6, but the compaction was greater in the rapamycin-treated compared to DMSO-treated biowires (*P<0.05, DMSO vs
rapamycin-treated biowires, łP<0.05, day 6 vs 1; (n=3 independent experiments). WS indicates Williams syndrome.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1335
phenotype and did not respond to any mTOR inhibitor.
Also, similar to our previous results, rapamycin did not
improve calcium flux in WS1. Everolimus rescued cal-
cium flux but not to control levels in a higher proportion
of patient SMCs (4 of 5) but WS3 was a nonresponder
(Figure 5C). Overall, mTOR inhibitors restored differen-
tiation in EI iPSC-SMCs, rescued SMC proliferation and
rescued contractile abnormalities but not to control levels,
with everolimus showing the most consistent effects.
Calcium Channel Blocker
We then investigated the effect of CCBs that are often
used to treat hypertension in EI patients36,37 and have
also been reported to reduce vascular SMC prolifera-
tion in a calcium channel-independent manner.38 Diltia-
zem and verapamil improved SMC differentiation and
decreased cell proliferation in WS2 and WS3 patients,
respectively, but not in ELN mutants. They improved
endothelin response only in ELN2 cells (Figure 5D
through 5F). Amlodipine induced cytotoxicity, that
is, cell death in all patient SMCs even at low doses
(Figure 5E).
Other Antiproliferative Drugs
We screened other antiproliferative drugs, including
paclitaxel, fluvastatin, apocynin, and losartan. Although all
4 antiproliferative drugs decreased cell proliferation in all
WS and in ELN1 SMCs, the effect on SMC differentiation
was not significant for all drugs and all patients (except
for the effect of paclitaxel on WS2 cells; Figure IVA and
IVB in the Data Supplement). Fluvastatin induced cell
toxicity at 3 different doses. These drugs were, therefore,
not studied further for effect on endothelin response.
Figure 5. Effect of candidate drugs on smooth muscle cell (SMC) differentiation, proliferation, and calcium flux.
A–C, mTOR (mammalian target of rapamycin) inhibitors. A, The percentage of SM22α (smooth muscle 22α) positive cells measured by high
content imaging showed that dimethyl sulfoxide (DMSO)-treated elastin insufficiency (EI) patient SMCs express 50%–70% SM22α (black
dots) similar to untreated patient cells (blue) in contrast to 80%–90% expressed in control SMCs (gray). Rapamycin (dark red), everolimus
(orange), and temsirolimus (yellow) increased % of SM22α positive cells in all patients when compared to DMSO treatment (black). AZD0857
(brown) only increased SMC differentiation in Williams syndrome (WS) patient SMCs. B, All 4 mTOR inhibitors decreased SMC proliferation
in all WS and in ELN (elastin)-1 cells. ELN2 cells were not hyperproliferative and did not show any further change in proliferation with mTOR
inhibitors. C, Endothelin-induced calcium flux was increased by everolimus in WS1, WS2, ELN1, and ELN2-SMCs compared with DMSO-
treated cells. Rapamycin only improved calcium flux in two patients (WS2, ELN2), temsirolimus in 3 patients (WS1, ELN1, ELN2), and
AZD0857 in 1 patient (WS2). WS3 did not respond to any mTOR inhibitor. D–F, Calcium channel blockers. D, Verapamil (dark green) and
diltiazem (bright green) increased % of SM22α positive cells only in 3 and 2 WS patients, respectively, but not in elastin mutation patients. E,
Verapamil and diltiazem decreased SMC proliferation only in 3 and 2 WS patients, respectively, not in elastin mutation patients. Amlodipine
(military green) treatment was associated with cell death (data not shown). F, Verapamil and diltiazem improved endothelin-induced calcium flux
only in ELN2 patient SMCs (n=3 independent experiments, using 3 technical replicates for each experiment). A–F, Supporting data are shown
in Table IIIB in the Data Supplement. *P<0.05, drug treatment vs DMSO.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1336 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
Proelastogenic Drugs
Dexamethasone, aldosterone, and retinyl acetate have
previously been shown to increase elastin production39–41
but have not been tested in conditions of primary EI.
The effect of these drugs on SMC proliferation differed.
Aldosterone significantly decreased proliferation in all
patients with WS; retinyl acetate was only effective on
ELN1 and dexamethasone had no effect. The drugs did
not improve SMC differentiation and were therefore not
studied further for effect on endothelin response (Figure
IVC and IVD and Table IIID in the Data Supplement).
Combination Therapy
As shown in Figure 5, everolimus restored SMC dif-
ferentiation and rescued cell proliferation and calcium
flux but not to the level of controls. To determine if the
effects of everolimus could be further improved, we
tested the effect of combining everolimus with a drug
from a different class. Verapamil was selected as best
in class agent based on its observed SMC responses.
Combined treatment with the two drugs was not sig-
nificantly better (Table IIIC in the Data Supplement)
than everolimus alone in restoring SMC differentiation
(Figure 6A), in rescuing proliferation (Figure 6B), and in
improving calcium flux (Figure 6C). Moreover, combined
treatment did not rescue endothelin-induced calcium
flux in WS3, which had the most severe and unrespon-
sive phenotype (Figure 6C).
In summary, mTOR inhibitors were the most effec-
tive drug class in rescuing the abnormal EI phenotype in
patient SMCs with everolimus treatment associated with
the highest and most consistent response rate across
patient SMCs compared with any other drug.
DISCUSSION
We generated iPSCs from a group of patients with EI, all
of whom had a severe phenotype requiring multiple sur-
gical and catheter re-interventions for progressive and
recurrent vascular stenoses starting in infancy. iPSCs
from the patients recapitulated the disease phenotype in
vitro as demonstrated by abnormal SMC differentiation,
increased proliferation, reduced compaction on 3-dimen-
sional smooth muscle biowires, and reduced contractile
response to endothelin. Candidate drug screens identi-
fied that mTOR inhibitors were the most effective drug
class in patients with WS as well as ELN mutations, with
everolimus showing the most favorable response. The
severity of the SMC phenotype and the interindividual
variability in drug response was associated with variable
elastin levels between patients. This is the first system-
atic evaluation of clinically available drugs in correcting
vascular SMC abnormalities in multiple patients with syn-
dromic and nonsyndromic EI. Overall, our study showed
how drug testing of SMCs derived from patient iPSCs
can identify a potentially efficacious drug for use in these
patients. The availability of effective drug therapy has the
potential to reduce vascular stenosis or restenosis and
reduce the need for invasive re-interventions and mortal-
ity in this severe disease.
Elastin Protein Levels and SMC Phenotype
As expected for haploinsufficient WS cells and for ELN
nonsense/frameshift mutations that are subject to non-
sense-mediated decay,3 ELN mRNA was significantly
reduced in SMCs from all 5 patients. Elastin protein was
Figure 6. Combination treatment with a mTOR (mammalian target of rapamycin) inhibitor and a calcium channel blocker.
A, Everolimus restored differentiation of SM22α (smooth muscle 22α) positive cells to the control cell level. Combination treatment with
everolimus and verapamil (purple) was not superior to treatment with everolimus alone (orange) in any patient. Although there is a strong
trend towards significance, we note that verapamil treatment (green) was less effective on Williams syndrome (WS)2 (P=0.068) and
WS3 (P=0.059) than in Figure 5D. Verapamil was also more effective on ELN (elastin)-1 (P=0.037). This has no effect on the conclusion
that everolimus alone rescued all patients. B, Everolimus rescued proliferation in all 4 patients exhibiting the hyperproliferation phenotype.
Combination treatment was not significantly different to treatment with everolimus. C, Everolimus rescued endothelin-induced calcium flux in 4
patients but not to control levels, and WS3 did not respond. Combination treatment was not significantly different to treatment with everolimus.
n=3 independent experiments, using 3 technical replicates for each experiment. A–C, Supporting data are provided in Table IIIC in the Data
Supplement. *P<0.05, drug treatment vs DMSO.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1337
also significantly reduced in these samples with lowest
levels seen in WS3 SMCs and higher levels in ELN2-
SMCs, which showed only a nonsignificant reduction in
elastin. The lower amounts of elastin in WS3 may account
for the more severe phenotype as well as the failure of
both classes of drugs to rescue the response to endo-
thelin. ELN2-SMCs were not hyperproliferative suggest-
ing that their elastin levels were likely already sufficient
to prevent a proliferative phenotype. We measured ELN
peptides upstream and downstream of the variant but
did not find evidence of incomplete nonsense-mediated
decay. This suggests that the baseline phenotype was
likely related to EI in all patients rather than to translation
of structurally abnormal protein in ELN mutant SMCs.
Although the presence of some compensatory transla-
tion pathway in ELN2 cannot be ruled out, detailed eval-
uation of post-transcriptional regulation of elastin was
beyond the scope of this study.42,43
Everolimus Emerges as Best of Class mTOR
Inhibitor for Rescue of SMC Differentiation,
Proliferation, and Contractility in EI Patient
SMCs
mTOR is a serine/threonine-protein kinase that forms
2 distinct complexes—mTORC1 that stimulates protein
synthesis and cell cycle progression, while mTORC2
regulates the cytoskeleton and cell survival. Our findings
that mTORC1 inhibitors, everolimus and temsirolimus,
were more effective than a dual inhibitor of mTORC1
and mTORC2, AZD0857, supports a stronger role for
pathways involved in cell proliferation as opposed to
cell survival in mediating the EI phenotype. This is con-
sistent with previous findings in a mouse model of EI
where mTORC1 inhibition decreased SMC prolifera-
tion more effectively than mTORC2 inhibition.44 How-
ever, unlike the mouse study, our study also evaluated
the effect of these analogs on SMC function through
assessment of calcium flux in response to endothelin.
The mechanism is hypothesized to be an insulin recep-
tor substrate-1 feedback signal linked to mTOR inhibition
that activates the AKT pathway and promotes contrac-
tile protein expression and inhibits SMC proliferation.45,46
Also, mTOR inhibition displaces FK506-binding protein
12 from ryanodine receptor 2 calcium release channel
which can result in increased intracellular release of free
calcium from the endoplasmic reticulum and may explain
the increased endothelin-induced calcium flux in patient
SMCs treated with mTOR inhibitors.47 Comparison of
drug responses revealed that everolimus was the most
effective of all analogs in improving SMC contractility in
response to endothelin.
Other Drug Classes Are Less Effective Than
mTOR Inhibitors in EI SMCs
CCBs are widely used to treat hypertension in patients
with EI but their effect on SMC phenotype and function
has not been systematically evaluated in patients with
EI. Of the CCBs tested, verapamil and diltiazem rescued
the differentiation and proliferation defects but only in
patients with WS, not in elastin mutation patients. Also,
CCBs did not rescue the poor response to endothelin.
Additionally, amlodipine was associated with increased
cell death. Although the mechanism of cell toxicity
requires further study, this finding raises concerns about
the appropriateness of clinical use of amlodipine as an
antihypertensive agent in patients with EI. All the other
drug classes tested only had antiproliferative effects and
did not improve SMC differentiation and were, therefore,
not considered candidates for further study. In addition,
combination treatment with everolimus and verapamil
was not superior than treatment with everolimus alone
even in the everolimus-unresponsive WS3 cells suggest-
ing an absence of synergy between these 2 drug classes.
Although treatment with everolimus significantly res-
cued the in vitro SMC phenotypes, evidence for efficacy
will require a clinical trial in patients with EI with vascular
stenoses, administered systemically or as drug-eluting
stents in areas of discrete stenoses. Everolimus has a
well-established safety profile with therapeutic blood
levels maintained using therapeutic drug monitoring.48
Side-effects can be further minimized with targeted
delivery using drug-eluting stents. As other novel treat-
ment options emerge,5 their ability to rescue SMC phe-
notypes can be evaluated in our iPSC-derived patient
SMCs, especially for efficacy in patient SMCs that fail to
respond to everolimus.
Overall, these data confirm the effectiveness of mTOR
inhibitors in general, and of everolimus in particular,
as a best in class drug with potential for rescuing the
vascular SMC phenotype in patients with EI. Although
mTOR inhibitors are used clinically in drug-eluting stents
to prevent and treat restenosis in adult coronary artery
disease and systemically in children and adults to treat
transplant coronary artery disease,49–51 our findings sug-
gest that vascular stenoses caused by EI may respond
better to everolimus. Since elastin variants may influence
the vascular phenotype in patients with acquired vascular
disorders, our study highlights the importance of assess-
ing the underlying molecular basis of vascular disease to
select the most effective mTOR inhibitor and identifies
everolimus as an attractive candidate for repurposing to
treat vascular stenosis in EI.
ARTICLE INFORMATION
Received October 17, 2019; accepted February 28, 2020.
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
1338 May 2020 Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936
Affiliations
From the Program in Genetics and Genome Biology, The Hospital for Sick Chil-
dren, Toronto, Ontario, Canada (C.K., R.A., O.A., S.M.); Program in Developmental
and Stem Cell Biology, The Hospital for Sick Children, Toronto, Ontario, Canada
(C.L., D.C.R., T.T., J.E.); Department of Molecular Genetics (C.L., J.E.), Institute of
Biomaterials and Biomedical Engineering (A.P., S.A., M.R.), Department of Chemi-
cal Engineering and Applied Chemistry (A.P., S.A., M.R.), Department of Biochem-
istry (F.K.), and Department of Pediatrics, The Hospital for Sick Children (S.M.),
University of Toronto, Ontario, Canada; and Program in Molecular Medicine, The
Hospital for Sick Children, Toronto, Ontario, Canada (F.K.).
Acknowledgments
We acknowledge the Labatt Family Heart Centre Biobank for access to patient
DNA and cells for this study, and The Centre for Applied Genomics, the Sick-
Kids imaging facility, and SickKids Proteomics, the Analytics Robotics & Chemical
Biology Centre at the Hospital for Sick Children for their assistance with experi-
mental assays. Yew Heng from the Division of Pathology, Department of Pediat-
ric Laboratory Medicine, the Hospital for Sick Children acquired and interpreted
electron microscopy images.
Sources of Funding
This work was supported by funding from the Canadian Institutes of Health Re-
search (grant no. 126146 to Drs Mital and Ellis), SickKids Foundation Stem Cell
Innovation Grant (to Drs Mital and Ellis), Ted Rogers Centre for Heart Research
(to Dr Mital), and the Heart and Stroke Foundation of Ontario Chair (to Dr Mital).
Disclosures
M. Radisic is co-founder of TARA Biosystems Inc and holds equity in this com-
pany. The other authors report no conflicts.
REFERENCES
1. Akhtar K, Broekelmann TJ, Miao M, Keeley FW, Starcher BC, Pierce RA,
Mecham RP, Adair-Kirk TL. Oxidative and nitrosative modifications of tropo-
elastin prevent elastic fiber assembly in vitro. J Biol Chem. 2010;285:37396–
37404. doi: 10.1074/jbc.M110.126789
2. Urbán Z, Riazi S, Seidl TL, Katahira J, Smoot LB, Chitayat D, Boyd CD,
Hinek A. Connection between elastin haploinsufficiency and increased
cell proliferation in patients with supravalvular aortic stenosis and
Williams-Beuren syndrome. Am J Hum Genet. 2002;71:30–44. doi:
10.1086/341035
3. Urbán Z, Michels VV, Thibodeau SN, Davis EC, Bonnefont JP, Munnich A,
Eyskens B, Gewillig M, Devriendt K, Boyd CD. Isolated supravalvular aor-
tic stenosis: functional haploinsufficiency of the elastin gene as a result
of nonsense-mediated decay. Hum Genet. 2000;106:577–588. doi:
10.1007/s004390000285
4. Kececioglu D, Kotthoff S, Vogt J. Williams-Beuren syndrome: a 30-year
follow-up of natural and postoperative course. Eur Heart J. 1993;14:1458–
1464. doi: 10.1093/eurheartj/14.11.1458
5. Fhayli W, Boëté Q, Harki O, Briançon-Marjollet A, Jacob MP, Faury G.
Rise and fall of elastic fibers from development to aging. Consequences
on arterial structure-function and therapeutical perspectives. Matrix Biol.
2019;84:41–56. doi: 10.1016/j.matbio.2019.08.005
6. Kassai B, Bouyé P, Gilbert-Dussardier B, Godart F, Thambo JB, Rossi M,
Cochat P, Chirossel P, Luong S, Serusclat A, et al. Minoxidil versus placebo
in the treatment of arterial wall hypertrophy in children with Williams Beuren
Syndrome: a randomized controlled trial. BMC Pediatr. 2019;19:170. doi:
10.1186/s12887-019-1544-1
7. Li DY, Brooke B, Davis EC, Mecham RP, Sorensen LK, Boak BB, Eichwald E,
Keating MT. Elastin is an essential determinant of arterial morphogenesis.
Nature. 1998;393:276–280. doi: 10.1038/30522
8. Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P,
Boak B, Keating MT. Novel arterial pathology in mice and humans hemizy-
gous for elastin. J Clin Invest. 1998;102:1783–1787. doi: 10.1172/JCI4487
9. Hirano E, Knutsen RH, Sugitani H, Ciliberto CH, Mecham RP. Functional
rescue of elastin insufficiency in mice by the human elastin gene: implica-
tions for mouse models of human disease. Circ Res. 2007;101:523–531.
doi: 10.1161/CIRCR ESAHA.107.153510
10. Li HH, Roy M, Kuscuoglu U, Spencer CM, Halm B, Harrison KC, Bayle JH,
Splendore A, Ding F, Meltzer LA, et al. Induced chromosome deletions cause
hypersociability and other features of Williams-Beuren syndrome in mice.
EMBO Mol Med. 2009;1:50–65. doi: 10.1002/emmm.200900003
11. Osborne LR. Animal models of Williams syndrome. Am J Med Genet C
Semin Med Genet. 2010;154C:209–219. doi: 10.1002/ajmg.c.30257
12. Yazawa M, Hsueh B, Jia X, Pasca AM, Bernstein JA, Hallmayer J,
Dolmetsch RE. Using induced pluripotent stem cells to investigate car-
diac phenotypes in Timothy syndrome. Nature. 2011;471:230–234. doi:
10.1038/nature09855
13. Moretti A, Bellin M, Welling A, Jung CB, Lam JT, Bott-Flügel L, Dorn T,
Goedel A, Höhnke C, Hofmann F, et al. Patient-specific induced pluripotent
stem-cell models for long-QT syndrome. N Engl J Med. 2010;363:1397–
1409. doi: 10.1056/NEJMoa0908679
14. Carvajal-Vergara X, Sevilla A, D’Souza SL, Ang YS, Schaniel C, Lee DF,
Yang L, Kaplan AD, Adler ED, Rozov R, et al. Patient-specific induced
pluripotent stem-cell-derived models of LEOPARD syndrome. Nature.
2010;465:808–812. doi: 10.1038/nature09005
15. Birket MJ, Ribeiro MC, Kosmidis G, Ward D, Leitoguinho AR, van de Pol V,
Dambrot C, Devalla HD, Davis RP, Mastroberardino PG, et al. Contractile
defect caused by mutation in MYBPC3 revealed under conditions optimized
for human PSC-cardiomyocyte function. Cell Rep. 2015;13:733–745. doi:
10.1016/j.celrep.2015.09.025
16. Heilker R, Traub S, Reinhardt P, Schöler HR, Sterneckert J. iPS cell derived
neuronal cells for drug discovery. Trends Pharmacol Sci. 2014;35:510–519.
doi: 10.1016/j.tips.2014.07.003
17. Lan F, Lee AS, Liang P, Sanchez-Freire V, Nguyen PK, Wang L, Han L,
Yen M, Wang Y, Sun N, et al. Abnormal calcium handling properties under-
lie familial hypertrophic cardiomyopathy pathology in patient-specific
induced pluripotent stem cells. Cell Stem Cell. 2013;12:101–113. doi:
10.1016/j.stem.2012.10.010
18. Sakai T, Naito AT, Kuramoto Y, Ito M, Okada K, Higo T, Nakagawa A,
Shibamoto M, Yamaguchi T, Sumida T, et al. Phenotypic screening using
patient-derived induced pluripotent stem cells identified Pyr3 as a candidate
compound for the treatment of infantile hypertrophic cardiomyopathy. Int
Heart J. 2018;59:1096–1105. doi: 10.1536/ihj.17-730
19. Jung CB, Moretti A, Mederos y Schnitzler M, Iop L, Storch U, Bellin M, Dorn T,
Ruppenthal S, Pfeiffer S, Goedel A, et al. Dantrolene rescues arrhythmo-
genic RYR2 defect in a patient-specific stem cell model of catecholaminer-
gic polymorphic ventricular tachycardia. EMBO Mol Med. 2012;4:180–191.
doi: 10.1002/emmm.201100194
20. Patsch C, Challet-Meylan L, Thoma EC, Urich E, Heckel T, O’Sullivan JF,
Grainger SJ, Kapp FG, Sun L, Christensen K, et al. Generation of vascular
endothelial and smooth muscle cells from human pluripotent stem cells. Nat
Cell Biol. 2015;17:994–1003. doi: 10.1038/ncb3205
21. Halaidych OV, Cochrane A, van den Hil FE, Mummery CL, Orlova VV. Quanti-
tative analysis of intracellular Ca2+ release and contraction in hipsc-derived
vascular smooth muscle cells. Stem Cell Reports. 2019;12:647–656. doi:
10.1016/j.stemcr.2019.02.003
22. Kinnear C, Chang WY, Khattak S, Hinek A, Thompson T, de Carvalho
Rodrigues D, Kennedy K, Mahmut N, Pasceri P, Stanford WL, et al. Model-
ing and rescue of the vascular phenotype of Williams-Beuren syndrome in
patient induced pluripotent stem cells. Stem Cells Transl Med. 2013;2:2–15.
doi: 10.5966/sctm.2012-0054
23. Ge X, Ren Y, Bartulos O, Lee MY, Yue Z, Kim KY, Li W, Amos PJ, Bozkulak EC,
Iyer A, et al. Modeling supravalvular aortic stenosis syndrome with human
induced pluripotent stem cells. Circulation. 2012;126:1695–1704. doi:
10.1161/CIRCU LATIONAHA.112.116996
24. Biel NM, Santostefano KE, DiVita BB, El Rouby N, Carrasquilla SD,
Simmons C, Nakanishi M, Cooper-DeHoff RM, Johnson JA, Terada N. Vas-
cular smooth muscle cells from hypertensive patient-derived induced plu-
ripotent stem cells to advance hypertension pharmacogenomics. Stem Cells
Transl Med. 2015;4:1380–1390. doi: 10.5966/sctm.2015-0126
25. Granata A, Serrano F, Bernard WG, McNamara M, Low L, Sastry P, Sinha S.
An iPSC-derived vascular model of Marfan syndrome identifies key media-
tors of smooth muscle cell death. Nat Genet. 2017;49:97–109. doi:
10.1038/ng.3723
26. Liu GH, Barkho B Z, Ruiz S, Diep D, Qu J, Yang SL, Panopoulos AD, Suzuki K,
Kurian L, Walsh C, et al. Recapitulation of premature ageing with iPSCs
from Hutchinson-Gilford progeria syndrome. Nature. 2011;472:221–225.
doi: 10.1038/nature09879
27. Deneault E, Faheem M, White SH, Rodrigues DC, Sun S, Wei W, Piekna A,
Thompson T, Howe JL, Chalil L, et al. Cntn5(-)(/+)or ehmt2(-)(/+)human
ipsc-derived neurons from individuals with autism develop hyperactive neu-
ronal networks. Elife. 2019;8:e40092.
28. Deneault E, White SH, Rodrigues DC, Ross PJ, Faheem M, Zaslavsky K,
Wang Z, Alexandrova R, Pellecchia G, Wei W, et al. Complete disruption
of autism-susceptibility genes by gene editing predominantly reduces
Downloaded from http://ahajournals.org by on April 28, 2020
TRANSLATIONAL SCIENCES - VB
Kinnear et al Drug Screening in Elastin-Deficient Patient iPSCs
Arterioscler Thromb Vasc Biol. 2020;40:1325–1339. DOI: 10.1161/ATVBAHA.119.313936 May 2020 1339
functional connectivity of isogenic human neurons. Stem Cell Reports.
2018;11:1211–1225. doi: 10.1016/j.stemcr.2018.10.003
29. Hotta A, Cheung AY, Farra N, Garcha K, Chang WY, Pasceri P,
Stanford WL, Ellis J. EOS lentiviral vector selection system for human
induced pluripotent stem cells. Nat Protoc. 2009;4:1828–1844. doi:
10.1038/nprot.2009.201
30. Cheung AY, Horvath LM, Grafodatskaya D, Pasceri P, Weksberg R, Hotta A,
Carrel L, Ellis J. Isolation of MECP2-null Rett Syndrome patient hiPS cells
and isogenic controls through X-chromosome inactivation. Hum Mol Genet.
2011;20:2103–2115. doi: 10.1093/hmg/ddr093
31. Xie CQ, Zhang J, Villacorta L, Cui T, Huang H, Chen YE. A highly effi-
cient method to differentiate smooth muscle cells from human embry-
onic stem cells. Arterioscler Thromb Vasc Biol. 2007;27:e311–e312. doi:
10.1161/ATVBAHA.107.154260
32. Ke N, Wang X, Xu X, Abassi YA. The xCELLigence system for real-time and
label-free monitoring of cell viability. Methods Mol Biol. 2011;740:33–43.
doi: 10.1007/978-1-61779-108-6_6
33. Miklas JW, Nunes SS, Sofla A, Reis LA, Pahnke A, Xiao Y, Laschinger C,
Radisic M. Bioreactor for modulation of cardiac microtissue phenotype
by combined static stretch and electrical stimulation. Biofabrication.
2014;6:024113. doi: 10.1088/1758-5082/6/2/024113
34. Hotta A, Cheung AY, Farra N, Vijayaragavan K, Séguin CA, Draper JS,
Pasceri P, Maksakova IA, Mager DL, Rossant J, et al. Isolation of human iPS
cells using EOS lentiviral vectors to select for pluripotency. Nat Methods.
2009;6:370–376. doi: 10.1038/nmeth.1325
35. Germain PL, Testa G. Taming human genetic variability: transcriptomic
meta-analysis guides the experimental design and interpretation of ipsc-
based disease modeling. Stem Cell Reports. 2017;8:1784–1796. doi:
10.1016/j.stemcr.2017.05.012
36. Rodríguez Padial L, Barón-Esquivias G, Hernández Madrid A, Marzal Martín D,
Pallarés-Carratalá V, de la Sierra A. Clinical experience with diltiazem in
the treatment of cardiovascular diseases. Cardiol Ther. 2016;5:75–82. doi:
10.1007/s40119-016-0059-1
37. Black HR. Calcium channel blockers in the treatment of hypertension and
prevention of cardiovascular disease: results from major clinical trials. Clin
Cornerstone. 2004;6:53–66. doi: 10.1016/s1098-3597(04)80078-4
38. Salabei J K, Balakumaran A, Frey JC, Boor PJ, Treinen-Moslen M, Conklin DJ.
Verapamil stereoisomers induce antiproliferative effects in vascular smooth
muscle cells via autophagy. Toxicol Appl Pharmacol. 2012;262:265–272.
doi: 10.1016/j.taap.2012.04.036
39. Barnett CP, Chitayat D, Bradley TJ, Wang Y, Hinek A. Dexamethasone
normalizes aberrant elastic fiber production and collagen 1 secretion by
Loeys-Dietz syndrome fibroblasts: a possible treatment? Eur J Hum Genet.
2011;19:624–633. doi: 10.1038/ejhg.2010.259
40. Bunda S, Liu P, Wang Y, Liu K, Hinek A. Aldosterone induces elastin produc-
tion in cardiac fibroblasts through activation of insulin-like growth factor-I
receptors in a mineralocorticoid receptor-independent manner. Am J Pathol.
2007;171:809–819. doi: 10.2353/ajpath.2007.070101
41. Chailley-Heu B, Boucherat O, Barlier-Mur AM, Bourbon JR. FGF-18 is
upregulated in the postnatal rat lung and enhances elastogenesis in myo-
fibroblasts. Am J Physiol Lung Cell Mol Physiol. 2005;288:L43–L51. doi:
10.1152/ajplung.00096.2004
42. Qi YF, Shu C, Xiao ZX, Luo MY, Fang K, Guo YY, Zhang WB, Yue J.
Post-Transcriptional control of tropoelastin in aortic smooth muscle cells
affects aortic dissection onset. Mol Cells. 2018;41:198–206. doi:
10.14348/molcells.2018.2193
43. Ott CE, Grünhagen J, Jäger M, Horbelt D, Schwill S, Kallenbach K, Guo G,
Manke T, Knaus P, Mundlos S, et al. MicroRNAs differentially expressed in
postnatal aortic development downregulate elastin via 3’ UTR and coding-
sequence binding sites. PLoS One. 2011;6:e16250. doi: 10.1371/journal.
pone.0016250
44. Jiao Y, Li G, Li Q, Ali R, Qin L, Li W, Qyang Y, Greif DM, Geirsson A,
Humphrey JD, et al. mTOR (Mechanistic Target of Rapamycin) inhibition
decreases mechanosignaling, collagen accumulation, and stiffening of
the thoracic aorta in elastin-deficient mice. Arterioscler Thromb Vasc Biol.
2017;37:1657–1666. doi: 10.1161/ATVBAHA.117.309653
45. Martin KA, Merenick BL, Ding M, Fetalvero KM, Rzucidlo EM, Kozul CD,
Brown DJ, Chiu HY, Shyu M, Drapeau BL, et al. Rapamycin promotes vascu-
lar smooth muscle cell differentiation through insulin receptor substrate-1/
phosphatidylinositol 3-kinase/Akt2 feedback signaling. J Biol Chem.
2007;282:36112–36120. doi: 10.1074/jbc.M703914200
46. Jin Y, Xie Y, Ostriker AC, Zhang X, Liu R, Lee MY, Leslie KL, Tang W, Du J,
Lee SH, et al. Opposing Actions of AKT (Protein Kinase B) isoforms in vas-
cular smooth muscle injury and therapeutic response. Arterioscler Thromb
Vasc Biol. 2017;37:2311–2321. doi: 10.1161/ATVBAHA.117.310053
47. Habib A, Karmali V, Polavarapu R, Akahori H, Cheng Q, Pachura K,
Kolodgie FD, Finn AV. Sirolimus-FKBP12.6 impairs endothelial barrier func-
tion through protein kinase C-α activation and disruption of the p120-vas-
cular endothelial cadherin interaction. Arterioscler Thromb Vasc Biol.
2013;33:2425–2431. doi: 10.1161/ATVBAHA.113.301659
48. Arena C, Troiano G, Zhurakivska K, Nocini R, Lo Muzio L. Stomatitis and
everolimus: a review of current literature on 8,201 patients. Onco Targets
Ther. 2019;12:9669–9683. doi: 10.2147/OTT.S195121
49. Windecker S, Remondino A, Eberli FR, Jüni P, Räber L, Wenaweser P,
Togni M, Billinger M, Tüller D, Seiler C, et al. Sirolimus-eluting and paclitaxel-
eluting stents for coronary revascularization. N Engl J Med. 2005;353:653–
662. doi: 10.1056/NEJ Moa051175
50. Poon M, Badimon JJ, Fuster V. Overcoming restenosis with sirolimus:
from alphabet soup to clinical reality. Lancet. 2002;359:619–622. doi:
10.1016/s0140-6736(02)07751-6
51. Suzuki T, Kopia G, Hayashi S, Bailey LR, Llanos G, Wilensky R, Klugherz BD,
Papandreou G, Narayan P, Leon MB, et al. Stent-based delivery of siroli-
mus reduces neointimal formation in a porcine coronary model. Circulation.
2001;104:1188–1193. doi: 10.1161/hc3601.093987
Downloaded from http://ahajournals.org by on April 28, 2020
