Content uploaded by Lynn Carta
Author content
All content in this area was uploaded by Lynn Carta on Feb 17, 2022
Content may be subject to copyright.
Content uploaded by Mihail Kantor
Author content
All content in this area was uploaded by Mihail Kantor on Mar 06, 2020
Content may be subject to copyright.
Forest Pathology. 2020;00:e12580. wileyonlinelibrary.com/journal/efp
|
1 of 15
https://doi.org/10.1111/efp.12580
© 2020 Blackwell Verlag GmbH
Received:30July2019
|
Revised:24Ja nuary2020
|
Accepted:27Januar y2020
DOI : 10.1111/efp .12580
ORIGINAL ARTICLE
Beech leaf disease symptoms caused by newly recognized
nematode subspecies Litylenchus crenatae mccannii (Anguinata)
described from Fagus grandifolia in North America
Lynn Kay Carta1 | Zafar A. Handoo1 | Shiguang Li1 | Mihail Kantor1 |
Gary Bauchan2 | David McCann3 | Colette K. Gabriel3 | Qing Yu4 | Sharon Reed5 |
Jennifer Koch6 | Danielle Martin7 | David J. Burke8
1Mycology & Nematology Genetic Diversity
&Biolog yLaborator y,USDA-ARS,Belts ville,
MD,USA
2Soybea n Genom ics & Imp rovement
Laboratory, Electron Microscopy and
ConfocalMicroscopyUnit,USDA-ARS,
Beltsville,MD,USA
3OhioDepartmentofAgriculture,
Reynoldsburg,OH,USA
4Agriculture&A grifoodCanada,Ottawa
Research and Deve lopme nt Centre, Ott awa,
ON, Canada
5Ontario Forest Resear ch Institute, Ministr y
of Natura l Resources and Forestr y, Sault Ste.
Marie, ON, Canada
6USDA-FS,Delaware,OH,USA
7USDA-FS,Morgantown,WV,USA
8HoldenA rboretum,Kirtland,OH,USA
Correspondence
LynnK.Carta,Mycolog y&Nematology
Genetic Diversity & Biology Laboratory,
USDA-ARS,Belts ville,MD20705-2350,
USA.
Email: lynn.carta@usda.gov
Editor:StephenWoodward
Abstract
Symptoms of beech leaf disease (BLD), first reported in Ohio in 2012, include in-
terveinal greening, thickening and often chlorosis in leaves, canopy thinning and mor-
tality.NematodesfromdiseasedleavesofAmericanbeech(Fagus grandifolia) sent by
the OhioDepartment ofAgriculture tothe USDA, Beltsville, MD inautumn 2017
wereidentifiedasthefirstrecordedNorthAmericanpopulationofLitylenchus crena-
tae (Nematology, 21, 2019, 5), originally described from Japan. This and other popu-
lations from Ohio, Pennsylvania and the neighbouring province of Ontario, Canada
showed some differences in morphometric averages among females compared to
theJapanesepopulation.RibosomalDNAmarkersequenceswerenearlyidenticalto
thepopulationfromJapan. A sequenceforthe COI markerwasalsogenerated,al-
though it was not available from the Japanese population. The nematode was not en-
countered in Fagus crenata(itshostinJapan)livingamongnematode-infestedFagus
grandifoliaintheHoldenArboretum,norhasL. crenataebeenreportedinAmerican
beech inJapan. The morphological and host range differences in North American
populations are nomenclaturally distinguished as L. crenatae mccannii ssp. n. from the
populationinJapan.Low-temperaturescanningelectronmicroscopy(LT-SEM)dem-
onstrated five lip annules and a highly flexible cuticle. Females, juveniles and eggs
wereimagedwithinbudswithaHiroxDigitalmicroscopeandanLT-SEM.Nematodes
swarmed to the tips of freshly cut beech buds, but explants could not be maintained.
Inoculation of fresh nematodes from infested leaves or buds to buds or leaves of
F. grandifolia seedlings resulted in BLD leaf symptoms. Injuring dormant buds prior
to nematode application, in fall or spring, promoted the most reliable symptom ex-
pression. The biogeography and physiology of anguinid nematode leaf galling, and
potentialco-factorsandtransmissionarediscussed.
KEYWORDS
Anguinidae,digitalandscanningelectronmicroscopy,foliarnematode,hostrange,molecular
identification, morphometrics, new continent detection, new subspecies, symptom
transmission, taxonomy
2 of 15
|
CARTA eT Al.
1 | INTRODUCTION
Symptoms of beach leaf disease (BLD) were first detected in north-
ern Ohio, USA in 2012 and have since been found in northern
Pennsylvania, New York, Ontario, Canada (Ewing, Hausman, Pogacnik,
Slot,&Bonello,2018)and Connecticut.SomeAmericanbeechtrees,
Fagus grandifolia Ehrh. and European beech trees, Fagus sylvatica L.
fromPerry,Ohioshowedsymptomsofdiseaseinthesummerof2017.
Specimens were sent to the Nematology Department at Ohio State
University, and the Ohio Departmentof Agriculture, Reynoldsburg,
Ohio. The beech leaf disease symptoms included interveinal darken-
ing, some puckering, crinkling and irregularly thickened leaves (Figure
1). Mature forest trees exhibited thinned crowns and branch dieback.
The interveinal darkening was similar to eriophyid mite damage, but
those bud mites were not noticed in association with infested leaves.
Nearlyangularleafspots,uponcloseinspectionwithastereo-micro-
scope, showed very small angular lesions within the darkened areas.
The appearance was similar to foliar nematode damage that appears
as larger angular lesions. BLD is associated with tree mortality within
7yearsofdetection.
Morphologically, these nematodess had a relatively large,
slender body length, short stylet length, more posterior vulva
and higher c′ value (tail length/anal body width) than most
Aphelenchoides (Shahina, 1996) and Bursaphelenchus taphrorychi
(Tomalak, Ma lewski, Gu, & Qian g, 2017) from European b eech.
Unlike Aphelenchoides or Bursaphelenchus, females also had a
small, narrow, weak median bulb and 6 lateral incisures. Upon fur-
ther inspection, it was determined to be the first population of
Litylenchus crenataeKanzakietal.(2019)fromthewesternhemi-
sphere, herein designated a new subspecies. Other populations
from Ohio, Pennsylvania and Ontario, Canada were also charac-
terizedwith molecular markers andmicroscopicanalysisof their
morphology. Nematodes stages within buds and leaves were ex-
aminedandimaged.InordertofulfilKoch'spostulates,L. crenatae
mccanniissp.n.wasusedtoinoculateotherwisehe althyAm erican
beec hs eedling si nO hio,USAandOnt ario,Ca nadagre enhouse st o
test whether BLD symptoms would result.
2 | MATERIALS AND METHODS
2.1 | Plant materials
InfestedleaveswerecollectedinSeptember,2017fromPerry,Ohio(Lake
County),USAbyan Ohio DepartmentofAgriculturenurseryinspector
fromailingAmericanbeech trees Fagus grandifolia Ehrh. and European
beech trees, Fagus sylvatica L. Other leaf specimens in 2018 were
sent from Kirtland, Ohio (Lake County), Potter County, Pennsylvania,
USA,CrawfordCounty,Pennsylvania,andElginandNorfolkCounties,
Ontario, Canada for morphological and molecular confirmation using
28Sand ITS 1,2 rDNAmarkers. Somespecimenswere dissectedfrom
leaves in water, measured and imaged using a microscope. Some leaves
weredissectedandstainedwithacidfuchsin(Byrd,Kirkpatrick,&Barker,
1983) for 5–10 days at room temperature to reveal nematodes in leaves.
2.2 | Microscopy
Nematodes from leaves were imaged on an Olympus BX51 microscope
equipped with polarization optics and with a DP73 camera (Olympus
AmericaInc.). Measurements in micrometresweretakenwith the cali-
brated measuring tool in the imaging program cellSens ver 1.6 (Olympus
America Inc.). Fixed specimens were processed for permanent slides
withthe formalin-glycerine method (Golden, 1990) andimagedwith a
Q-ImagingRetigaEXiColorDigitalCamera(Q-Imaging)attachedtoaLeica
WildMPS48LeitzDMRB compound microscope (LeicaMicrosystems).
Measurements and morphometrics were calculated on an Excel spread-
sheet.TheLT-SEMprotocolofCarta, Bauchan, Hsu,andYuceer(2010)
wasusedemployingaHitachiS-4700 fieldemissionSEM (HitachiHigh
TechnologiesAmerica,Inc.)withaQuorum CryoPrepPP2000 (Quorum
Technologies Ltd.) cryotransfer system to observe nematodes isolated
fromleavesandwithinbuds.AHiroxMXB-504RZdigitalmicroscopewas
alsousedtoobservenematodesinbuds(HiroxUSA,Inc.).
2.3 | DNA Isolation, amplification,
sequencing, alignment
2.3.1 | DNA extraction
DNAextractionwasperformedbyfreeze-thawlysiswithasinglelive
nematode in a 0.2 ml PCR tube containing 25 μl of extraction buffer
(10mMTrispH8.2,2.5mMMgCl2,50mMKCl,0.45%TWEEN20
and0.05%gelatin)(Carta&Li,2019).
FifteenspecimensfromBLDleavescollectedNovember,2017
inPerry,OhiowereprocessedforindividualDNAextraction,and
10 of them, prior to being transferred to each PCR tube, were im-
aged as vouchers for morphological and morphometrical analysis.
PCR amplification and DNA Sequencing: The 3.5 kb ribosomal
DNA(rDNA), ranging from near-full length 18S,internal transcribed
spacer(ITS),to28S(D1-D3)wasamplifiedandsequencedfromeach
of the imaged specimens using recently modified procedures of Carta
and Li (2019). Cytochrome c oxidase I (COI) was amplified by PCR with
theprimersets,COI-F1andCOI-R2(Kanzaki&Futai,2002).Allprim-
ersused for amplificationandsequencingarelistedin Table1.Each
25 µl PCR reaction was prepared with 2 µl of the extract and 23 µl of
thePCRmastermixcontaining0.625 U DreamTaq™Hot Start DNA
Polymerase(ThermoFisherScientific)perthemanufacturer'sprotocol.
ThePCRconditionsfortheCOIwere94°Cfor1min,5cyclesof94°C
for40s,45°C45s,72°C1min,35cyclesof94°Cfor40s,51°C45s,
72°C1minandfinalextensionat72°Cfor5min.PCRproductswere
visualizedwiththeLonzaFlashGel™DNAsystem(VWRInternational)
andthentreated with ExoSAP-ITreagent(Affymetrix,Inc) according
tothe manufacturer'sprotocol.DirectDNA sequencing forthe COI
|
3 of 15
CARTA eT Al .
was performed bidirectionally with anABI BigDye Terminator v3.1
kitand in an ABI3730xlDNAAnalyzer(AppliedBiosystems) owned
bytheUSDASystematicEntomologyLab.Themarkersequencesde-
rived from Litylenchussp.specimens, 104H78and104H82werede-
positedtoGenBankwithaccessionnumbers forrDNA(MK292137,
MK292138)andCOI(MN524968,andMN524969).
SequenceswerecomparedwithClustalWinGenius(ver11.1.5)
with thos e from the type p opulation from Mo rioka, Iwate Pref., Japa n
forGenBankaccession numbers LC383723forSSU,LC383724for
D2-D3LSUandLC383725forITSrDNA.
2.4 | Nematode plant inoculations
2.4.1 | Nematode collection and quantification
Nematodes were isolated from leaves collected with severe BLD
symptoms, and a modification of the “water soaking” isolation method
(Zhen,Agudelo,&Gerard,2012)wasemployed.Inshort,5leaveswith
symptomsofBLDwerecut into 1-cm2 pieces and placed in a petri
dish containing 4% potato dextrose agar. Leaveswere than soaked
overnightinsterilewaterat22°C.Aftersoaking,theliquidcontaining
FIGURE 1 Leafsymptomsincludedarkenedgreenbands,chlorosisandnecrosis,Perry,OHFall2017(a)AmericanbeechFagus
grandifolia; (b) European beech, Fagus sylvatica images of David McCann
(a)
(b)
TABLE 1 PrimersusedforPCRandsequencing
Primers Direction Sequence (5′–3′) Loci PCR Sequence Reference
18 S - C L- F3 FCT TGTCTCA AAGATTAAGCCATGCAT 18S √ √ Cart aandWick(2018)
18S-530R RGCGGCTGCTGGCACCACACTT 18S √T homas (20 11)
18S-530F FAAGTCTGGTGCCAGCAGCCGC 18S √Tho mas (2011)
18 S - C L- F2 FCTGTGATGCCCTTAGATGTCC 18S √ CartaandWick(2018)
18 S - C L- R7 RACCTTGTTACGACTTTTGCCCGGTTCA 18S √This study
IT S - C L- F 2 FATTACGTCCCTGCCCT TTGTA 18S √ CartaandWick(2018)
rDNA1.58S RACGAGCCGAGTGATCCACCG 5.8S √ Cherry,Szalanski,ToddandPowers(1997)
AB28 RATATGCTTAAGTTCAGCGGGT 28S √ Vrain,Wakarchuk,LevesqueandHamilton(1992)
28 S - C L- F 3 FAAGAGAGAGTTAAAGAGGACGTGAA 28S √This study
28 S - C L- R 1 RACTCC TTGGTCCGTGTTTCAAG 28S √This study
28 S - C L- F 2 FCGACCCGTCTTGA AACAC 28S √This study
28 S - C L- R RCAGCTACTAGATGGTTCGATTAGTC 28S √ √ This stud y
COI-R2 RGTAGCAGCAGTAAAATAAGC ACG COI √ √ KanzakiandFutai(2002)
COI-F1 FCCTACTATGATTGGTGGTT TTGGTAATTG COI √ √ KanzakiandFutai(2002)
4 of 15
|
CARTA eT Al.
nematodes was carefully collected with a pipettor and then centri-
fugedat1 252 gfor2 mintoconcentratethenematodes.Waterwas
then removed through pipetting and nematodes resuspended into
1-mltotalvolumeofsterilewater.Approximately,200-µlofthenema-
todesuspensionwasremovedand200-µlof100%ethanolwasadded
tofixthenematodespriortoquantification.Nematodeswerecounted
using a Sedgewick rafter at a magnification of4X, on an Olympus
BH-2 dissecting microscope. Quantification wasmade to standard-
izethe numberofnematodes usedforleaf andbudinoculation.The
nematodes remaining in the sterile water were used for leaf and bud
inoculation as described below. Some nematodes treated with ethanol
werealsoretainedformorphologicalidentificationandDNAsequenc-
ing. Nematodes used for autumn tree inoculation were collected on
3 October 2018, and those used for spring bud inoculation were col-
lectedon22April2019.
2.4.2 | Tree leaf and bud inoculation
Three dif ferent types of plant inoculations were conducted; (a) new
leaf inoculation, (b) dormant bud inoculation prior to winter dormancy
and (c) dormant bud inoculation just prior to leaf out in spring. For
new leaf inoculation, mature, 1-m tall American beech trees (Fagus
grandifolia) that had been kept dormant in cold storage were placed
inawarmgreenhouse7September2018.Treesbrokedormancyand
began to grow after 2 weeks and newly emerged, fully expanded
leaves were available for inoculation in early October 2018. Four
treatments were conducted on each of four trees: uninjured leaf,
injured leaf, injured leaf that was inoculated with 100 µl of a water
suspensioncontaining400nematodes(4,000/ml),andaninjuredleaf
that was inoculated with 100 µl of a water suspension containing 80 0
nematodes (8,000/ml). Leaves were injured using a sterile dissecting
needle by making small holes in the leaf tissue and by scraping the
needle across the underside and upper side of each leaf. Leaves were
injured as this was found to produce the highest level of nematode
leafcolonizati oninprevi ouswork(Zhenetal.,2012).Afterleafi njur y,
thel eafwa sw rap ped ina11×21cmKi mwipe (Ki mbe rly-C lar k)w hich
was lightly moistened with sterile water to make it adhere to the leaf
surface. Leaves that received no nematodes had 100 µl of sterile
water added to the sur face of the leaf underneath the surrounding
Kimwipe.Theleafwasthanenclosed in asterile,plastic samplebag
to maintain moisture close to the surface of the leaf. Leaves receiving
nematodeshad 100µlofsterilewatercontainingeither400or 800
nematodesaddedtot hele afsurfacea sdes cr ibedabove.Af te rnem a-
todeap pl icati on,th el eafa ndKimwi pewereenc lo sedinaste rilesam-
ple bag to maintain leaf moisture. This was essential since nematodes
requireawaterfilmformovementtoallowtissuecolonization.Trees
were then placed in a warm greenhouse with supplemental lighting.
Bags were kept on the tre ated leaves for 3 days to allow for nematod e
colonizationandthenremoved.Treesweremaintainedinthegreen-
house with atemperature between 12–25°Cwith a12-hrday-night
cycle. Trees were monitored for 5 months until leaf senescence and
fall associated with the onset of plant dormancy.
BudinoculationsoccurredinOctober2018using4treeswith
well-developedbuds.Oneachtree,therewere4budtreatments:
uninjured bud, injured bud, uninjured bud that received a water
suspension containing 170 nematodes and 80 eggs (Table 2),
and an injured bud that received a water suspension containing
170nematodesand80eggs.Buds werewrappedwithapieceof
Kimwipe asdescribed above and wettedwithsterilewaterto in-
sure adherence to the bud surface. Then, 100 µl of sterile water
wasadded undertheKimwipe tothebud surface. The budsthat
did not receive nematodes received a sterile water control treat-
ment, but for buds receiving nematodes the sterile water suspen-
sioncontainedthenematodesasdescribedabove.Afternematode
or sterile water application, buds were carefully wrapped with
parafilm to retain moisture against the bud surface (Figure 7).
Buds were injured with a sterile dissecting needle such that 6 small
holes were poked into each injured bud to facilitate nematode
entry. Trees were then placed in a cold greenhouse where they
underwentwinterdormancy.Treeswerekeptundercold(4–10°C
withambientdaylight),dormantconditionsfor4 monthsprior to
moving plants intoaheatedgreenhouse (12–25°C)to break bud
dormancy and stimulate leaf emergence and grow th. Leaves were
then monitored for BLD as they developed.
Addit io na lbudinoculationswerealsoma deinApril2019using
two trees that had been dormant through winter. Due to low re-
covery of nematodes fromdormant budsinApril 2019,onlyone
bud on each tree could be inoculated with nematodes. Therefore
four total buds, two per tree, were treated as a part of this exper-
iment. On each tree, one bud was injured with a dissecting needle
as described above and then treated with sterile water as a no
nematode control, and a second was injured but treated with a
water suspension containing approximately 110 nematodes (see
Table 2). Buds were cover ed with a Kimwipe an d parafilm as a
part of the inoculation as described above. The trees were placed
inaheated greenhouse(12–25°C)tobreak bud dormancyunder
ambient light. Parafilm and Kimwipe were removed after3days,
and buds broke dormancy and leaves emerged 2 weeks after bud
inoculat ion. We monitore d leaves for sym ptoms of BLD as they
developed.
2.5 | DNA extraction and nematode detection post-
inoculation
DNAwasextractedfromsymptomaticleaftissuecollectedfromeach
tree and branch type. Leaftissuewascollected usinga1-cmsterile
cork corer, and 1 leaf punch of BLD symptomatic tissue was extracted
per tree.DNA wasextracted usinga bead-beatingapproach where
tissue was t ransferre d into a 1.5-ml bea d beating tube w hich con-
tained 300mgof400 µM sterileglass beads(VWR)and 200 mg of
1 mm steril e glass beads (C hemglass). Ab out 750-µl of 2% cet yltri-
methyl-am monium bromid e (CTAB) was added to ea ch tube as the
extraction buffer, and samples were bead beaten using a Precellys
homogenizer(Bertin Technologies)for 80 s to lyse cells andrelease
|
5 of 15
CARTA eT Al .
DNA.DNAwaspurifiedfromtheextractmatrixusingphenol-chloro-
formextraction(Burke, Smemo,López-Gutiérrez,&DeForest,2012)
followed by precipitation in 20% polyethylene glycol 8,000 with
2. 5M NaC l.Pre cipit ate dDNAw assub sequentl ydrie dan ds usp end ed
in50µlTE(TrisEDTA)bufferandstoredina1.5-mllowretentionmi-
crocentrifugetube(FisherScientific)at−20°Cuntilanalysis.Weused
nematode specific ITS primers to detect nematodes within leaf and
budsamples.Forwardprimer TW81 (GT TTCCGTAGGTGAACCTGC)
andreverseprimer5.8MS(GGCGCAATGTGCATTCGA)(TanhaMaafi,
Subbotin, & Moens, 2003; Vovlas, Subbotin, Troccoli, Liebanas, &
Castillo,2008) wereusedfornematodeamplification. Amplification
reactionswereperformedinanMJResearchPTC-200thermalcycler
(Bio-RadLaboratories,Inc.).Aninitialdenaturationfor2minat94°C
wasfollowedby35cyclesofdenaturationfor30sat94°C,annealing
for45sat55°Candextensionfor3minat72°C,withafinalexten-
sionof10 min at72°C (Esmaeili, Heydari,&Ye,2017).PCR product
was visually checked using 1%agaros egels and ethidium bromide
staining. PCR product positive to nematodes was purified using a
WizardSVGelandPCRCleanUpSystem(Promega)andpurifiedPCR
usedfordirectsequencingofthenematodeITSregionusingBigDye
Terminatorchemistryanda3730DNAAnalyzer(AppliedBiosystems
Inc.). Sequences were generated through the Life Sciences Core
Laboratories Center (Cornell University). Sequences were identi-
fied with the EMBL/GenBank /DDBJ database entries and the NCBI
Blast tool through GenBank (https ://blast.ncbi.nlm.nih.gov/Blast.
cgi?PAGE_TYPE=BlastSearch).
Morphological identification of nematodes: Leaves showing BLD
symptoms and nearby bud tissue were also collected and sent to
USDA-ARSBeltsvilleformicroscopicexaminationandidentification.
Nematodes were dissected from plant tissue and stained with acid
fuchsin (Byrd et al., 1983).
3 | RESULTS
Litylenchus crenataeKanzakietal.(2019)mccanniissp.n.(Tables3‒5
andFigures2‒4).
3.1 | Description
Females have a nearly continuous,slightlyoffsetlip(Figures2a‒d,
3a,band4a,b)regionwith5annules(Figure4a,b),longandslender
body shape (Figures 2, 3a,b and 6c),the st ylet infemalesis5%of
thepharynxlengthand7%–10%ofthepharynxlengthinmales,and
there is a small, narrow, weak median bulb without an obvious valve.
Thevulval regioniskinked and irregular (Figure4c,d). Theanterior
gonadisrelativelylong[254±79(166–365)µmwheren=5],nearly
fivetimesthelengthofthepost-uterinesac.Thepost-uterinesacis
aboutthreetimesthevulvalbodywidthandonequarterofthevul-
valanaldistance( VAD).TheVADis2.8±0.3(2.3–3.3)timesthetail
length.Therectumisapproximately one quarter of thetaillength,
theanuspore-likeandobscureinmostspecimens.Thereisagradu-
ally tapering, slender, conical tail with an asymmetrically pointed,
often mucronate extension. The dist al tail in immature (Figures 2i
and4g,h)andmaturefemales(Figure4i,j)varyinshape.
3.1.1 | Localities and hosts
Perry,OhioonleavesofAmericanbeechtreesFagus grandifolia Ehrh.
and European beech trees, Fagus sylvatica L. specimens collected
inSeptember 2017 and received between 9/12/17,and 05/18/18;
Fagus grandifoliaspecimensfromHoldenArboretum,Kirtland, OH
TABLE 2 Litylenchus crenatae mccannii ssp. n. Leaf and bud inoculation results based on results obtained through 6 May 2019
Sample ID Date Treat Control Injury + Control
Injury + 400
Nematodes Injury + 800 Nematodes Notes
Leaf Tree 1 10- 3 -18 Negative Negative Negative Negative See below
Leaf Tree 2 10- 3 -18 Negative Negative Negative Negative
Leaf Tree 3 10- 3 -18 Negative Negative Negative Negative
LeafTree4 10 - 3 -18 Negative Negative Negative Negative
Sample ID Date Treat Control Injur y + Control
170 Nematodes + 80
eggs
Injury + 170
Nematodes + 80 eggs
Bud Tree 1 10 - 3-18 Negative Negative Negative Not open (dead?)
Bud Tree 2 10 - 3-18 Negative Negative Negative Positive BLD
Bud Tree 3 10 - 3-18 Negative Negative Positive BLD Positive (slight)
BudTree4 10 - 3 -18 Negative Negative Negative Positive (slight)
Bud Tree 5 4-23 -19 NA Negative NA Positive BLD May 6 open
Bud Tree 6 4-23 -19 NA Negative NA Positive BLD May 6 open
Note: ForBudtreeinoculation1–4,redandyellowlabelreceivedabout140juvenilenematodes,30adultnematodesand80eggsperbudif
inoculated.
Forbudtrees5–6theyreceived110nematodesand40eggsonaverage.Duetolownematodeyield,weinoculatedonlyinjuredbuds.
NAequalsnotapplicable;treatmentwasnotincluded.
6 of 15
|
CARTA eT Al.
TABLE 3 Morphometrics of live adult female Litylenchus crenatae mccannii ssp. n
Character
L. c. mccannii
Perry OH
9-20 17
L. c. mccannii
Kirtland, OH
10-2018
L. c. mccannii
Crawford, PA
9-20 18
L. c. mccannii
Potter, PA
10-2018
L. c. mccannii
Ontario, Canada
11-2018
n27 12 11 14 13
Body L µm 889±119(625–1084) 907.6±28.6(853.1–952.7) 739.8±178.9(562.0–1015.0) 788.8±95.2(564.4–891.2) 836±115(789–1109)
BodyWµm 14.2±1.0(12.1–16.1) 13.2±0.6(12.1–14.0) 16.2±2.4(15.0–22.0) 12.8±2.9(10.6–22.2) 14.8±2.2(13.6–15.9)
Stylet µm 9.2±0.5(8.4–10.3) 9.5±0.7(8.8–11.4) 9.3±1.2(7.5–11.0) 9.6±0.8(8.8–11.5) 9.5±0.7(8.210.4)
Phary nx L µm 193.5±35.7(126.3–244.2) 209.8±6.4(200.1–221.0) 141.7±36.7(100–195) 193.7±26.9(126.0–224.1) 176.6±12.7(151.2–198.9)
PUS µm 34.3±6.1(22.7–45.0) 22.9±5.8(13.7–33.7) —27.9±11.7(17.7–64.0) 36.9±9.4(29.7–54.1)
Tail L µm 54.3±6.1(39.8–64.4) 55.6±3.1(51.6–61.9) 43.7±11.3(33.0–62.0) 50.6±6.5(31.5–57.0) 50.6±5.5(42.3–56.6)
a63.0±10.0(43.8–76.8) 68.8±4.0(64.3–78.8) 46.3±13.6(31.2–67.7) 63.5±11.8(28.6–74.7) 61.4±9.8(40.9–73.4)
b4.7±0.7(3.8–6.6) 4.3±0.2(4.1–4.6) 5.4±0.6(4.8–6.8) 4.1±0.5(3.5–5.0) 4.8±0.3(4.0–5.3)
c16.4±1.5(13.3–20.1) 16.3±0.7(15.0–17.6) 16.8±1.4(15.0–18.8) 15.7±1.7(13.4–20.2) 16.6±1.7(12.6–19.6)
c′ 5.7±0.8(4.3–7.9) 6.0±0.5(5.5–7.2) —5.3±1.2(2.2–6.8) 5.9±0.9(4.5–6.5)
V% 76.6±1.4(73–79) 77.1±0.7(76–78) 77.7±0.07(76.5–78.4) 76.6±1.0(75.3–78.3) 80.2±6.6(75.2–86.9)
PUS/VA D% 27±8(22–50) 15 —20.9 25.5±3.4(20.4–30.6)
PUS/BW 2.8±0.5(1.9–3.8) 1.8±0.5(1.1–2.7) —2.3±0.7(1.6–3.9) 2.5±0.5(1.8–2.9)
|
7 of 15
CARTA eT Al .
TABLE 4 Morphometrics of fixed and live, adult female Litylenchus crenatae mccannii ssp. n
Character
L. c. mccannii
Perry, OH,
Live, young
L. c. mccannii
Perry OH
Fixed, young
L. crenatae
Japan
Fixed, young
L. c. mccannii
N. America
Live, mature
L. crenatae
Japan,
Fixed, mature
n27 10 10 50 10
Body L µm 889±119(625–1084) 823±61(750–947) 863±33(837–915) 740–908(625–1109) 816±32(758–870)
BodyWµm 14.2±1.0(12.1–16.1) 11.4±1.1(9.9–13.5) 12.3±0.9(11.0–13.5) 12 .8 –16. 2 (1 0 .6–16 .1) 22.9±2.6(18.4–27.7)
Stylet µm 9.2±0.5(8.4–10.3) 9.7±0.9(8.5–11.2) 8±0.4(7.4–8.5) 9.3–9.6(7.5–11.4) 10.6±0.5(9.9–11.3)
Styl conus µm 4.6±0.4(3.6–5.2) —3.1±0.2(2.8–3.5) —3.3±0.2(3.9–4.6)
Phary nx L µm 193.5±35.7(126.3–244.2) 152.6±16.2(133–186) 203±5.9(192–213) 142–210 (10 0–24 4) 123±6.7(110–131)
PUS µm 34.3±6.1(22.7–45.0) —32±3.4(29–39) 23–37(14–64) 68±7.4(57–81)
Tail L µm 54.3±6.1(39.8–64.4) 48.3±6.2(34.5–56.4) 55±3.8(50–63) 44–56(31.5–64.4) 33±2.3(30–36)
a63.0±10.0(43.8–76.8) 72.9±9.3(61–86) 67.5±5.8(60.7–74.4) 46–69(31–79) 35.9±3.4(30.2–41.1)
b4.7±0.7(3.8–6.6) 5.4±0.7(4.5–6.6) 5.3±0.6(4.5–6.3) 4.1–5.4(3.3–6.8) 6.6±0.4(6.1–7.6)
c16.4±1.5(13.3–20.1) 17.4±3.3(13–25) 15.7±0.7(14.4–16.7) 15.7–16.8(12.6–20.2) 24.5±1.9(18.5–25.1)
c′ 5.7±0.8(4.3–7.9) 6.0±1.0(4.3–7.9) 6.3±0.5(5.5–7.4) 5.3–6.0(2.2–7.9) 2.9±0.3(2.5–3.3)
V% 76.6±1.4(73–79) 76.9±1.2(75–79) 77.4±0.5(76.6–78.3) 77–80(73–87) 81.5±1.0(79.4–83.2)
PUS/VA D% 27±8(22–50) 22.9±2.1(20.2–25.9) 15–25 (20–50) 57.9±7(47–73)
PUS/BW 2.8±0.5(1.9–3.8) 2.6±0.4(2.2–3.5) 1.8–2. 8 (1.1–3.9) 3.5±0.4(2.8–4)
8 of 15
|
CARTA eT Al.
8/27/18; (41°62′52.2x″N, 77°93′19.5x″W) Susquehannock State
Forest,PotterCounty,PA9/6/18;(41°64′41.95″N,80°48′96.67″W)
Pymatuning Reservoir,Jamestown, Crawford County, PA 9/21/18;
ElginCounty(42°39′52.49″N,81°10′12.48″W)andNorfolkCounty,
Ontario Canada 11/2018).
3.1.2 | Specimen designation and deposition
Thirty-seven slides (T709t (holotype), T6960- 6973p (paratypes),
7108-7110p, 7113-7126p, 7182-7186p) with 260 females and 10
males and 89 juveniles from Perry, OH were deposited in the United
States DepartmentofAgricultureNematodeCollection (USDANC)
alongwith5vials(T-576-T-580p).Inaddition,5femalesand5males
fromOntario,CanadaweredepositedintheUSDANC,and20slides
(T567a-t)oftheOntariopopulationweredepositedintheCanadian
National Collection of Nematodes Ottawa.
3.2 | Diagnosis
The Litylenchus crenatae mccannii ssp. n. young female population
fixedandmountedinearlyautumnfromNor thAmericahadalonger
stylet[9.7±0.9µmn= 10(8.6–11.2)vs.8.0±0.4 (7.4–8.5)n= 10,
p< .001]µm andstyletconus[4.6(3.6–5.2) vs. 3.1 ±0.2 (2.8–3.5)
p<.001]µmthanthetypepopulationfromJapan.Thephar ynxwas
alsosignificantlyshorter(152.6±16.2vs.203±5.9µm,p < .001) in
immature females, although the “b” ratio was not dif ferent. However,
the phar ynx was longer in mature females of 3 populations (p < .001)
but not for t hose in Crawfo rd County (142 ± 36.7 vs. 123 ± 6.7)
Thepost-uterinesac in maturefemaleswas shorter (36.9 ± 9.4vs.
68±7.4,p < .001) than the Japanese population. The tail was shorter
in the fixed immature female populations (48.3 ± 6.2 vs. 55 ± 3.8
p<.01)butitwaslongerinthematurepopulations(43.7±11.3vs.
33±2.3 p < .01, and p < .001 for 3 other populations) which was
alsoreflectedindifferent c(16.8±1.4vs.24.5±1.9,p < .001) and
c′(5.3±1.2 vs.2.9±0.3,p < .001) ratios. The body width was nar-
rowerinallpopulationsofmaturefemales(16.2±2.4vs.22.9±2.6,
p < .001). The male population from Perry, Ohio also had a longer
styl et [11.2 (10.6–12) vs. 10.2 (9.9–11)] µm and st ylet conus [4.8
(4.4–5.3)vs.3.6(3.5–4.3)]µm,anda widerbody[16.7(13.5–20.3)]
µm than the fixed type population from Japan.
3.3 | Remarks
The morp hological a nd host range di fferences in N orth Ame rican
populations are nomenclaturally distinguished as L. crenatae mccan-
nii ssp. n., after the plant pathologist who first observed the nema-
todes in BLD affected leaves. Live, mature males and females (Tables
1‒3)hadagreatdeal ofvariationwithoverlappingranges,butcer-
tain differences were noted when population averages were com-
pared. The degree of dimorphism between immature and mature
TABLE 5 Morphometrics of adult male Litylenchus crenatae mccannii ssp. n
Character
L. c. mccannii
Kirtland, OH
Live 2-2018
L. c. mccannii
Crawford, PA
Live 9-2018
L. c. mccannii
Ontario, Canada
Live 5-2018
L. c. mccannii
Perry, OH
Fixed 11-2017
L. crenatae
Japan
Fixed 6-2017
n8 3 5 48
Body L µm 657±64(554–772) 586.3±73.3(502–635) 611.8±109.1(511.8–778.2) 548.0±16.7(534.5–566.7) 707±41(642–773)
BodyWµm 16.7±2.3(13.5–20.3) 15±0(15) 15.4±1.5(13.1–17.6) 15.1±2.5(12.1–16.7) 12.4±0.8(11.3–13.5)
Stylet µm 11.2±0.4(10.6–12.0) 10±0(10) 9.8±0.3(9.6–10.1) 11.1±0.5(10.5–11.4) 10.2±0.4(9.9–11.0)
Styl conus µm 4.8±0.3(4.4–5.3) 3.4±0.1(3.4–3.6) 3.6±0.3(3.5–4.3)
Phary nx L µm 143.2±11.8(124.9–159.7) 121.2±13.4(117.8–134.9) 113.9±5.0(108.5–118.1) 135±14(116–157)
Tail L µm 34.9±3.3(30.1–41.5) 33.3±3.9(29.0–36.7) 35.3±1.6(33.7–37.9) 34±2.6(30–38)
a40.0±7.8(31.1–57.3) 41.9±0.6(41.5–42.3) 45.6±2.6(41.1–47.8) 36.1±5.4(33.3–44.1) 57.2±4.7(48.9–61.9)
b4.6±0.4(4.1–5.3) 4.5±4.1(3.9–5.0) 4.8±0.2(4.6–4.9) 4.3±0.3(3.9–4.8)
c18.9±2.0(16.2–22.7) 19.1±1.9(17.0–22.7) 15.5±0. 2(15.3–15.9) 21.1±2.0(18.5–25.1)
c′ 3.2±0.2(2.9–3.5) 3.4±0.3(2.8–3.9) 3.6±0.4(3.0–4.1)
Spicule L µm 17.1±2.4(13.7–19.7) 15±0(15) 16.5±2.1(14.3–17.6) 16.3±1.4(14.9–17.6) 15.6±1.2(14.2–17.7)
Gubernaculm L µm 6.9±0.7(6.4–8.0) 6±1(5–7) 5.9±0.2(5.7–6.0) 5.3±0.8(4.3–6.1) 6.5±0.4(6.0–7.1)
|
9 of 15
CARTA eT Al .
females seen in the population from Japan was less than that seen in
themultiple NorthAmericanpopulations,primarilyreflectedinthe
narrower body of mature females.
The young overwintering adults were primarily found in October
- November, and reproductive, mature females predominated in
spring through early autumn. Multiple nematode life stages, but not
males, were found within buds, and males were found within leaves
from spring through autumn. In Ontario, the young overwintering
adults were only found in leaves on the ground in the wintering
months, while mature adults could still be found in buds.
FIGURE 2 Light microscopy (LM) of Litylenchus crenatae mccanniissp.n.fixedfemalespecimens.(a–k),live,polarizedlightmicroscopy
(PLM)females(l–n);(a-b)immatureanteriorpharynx;(c,d)matureanteriorpharynx,(e)immaturemid-bodywithvulva;(f)pharyngealgland;
(g)maturevulva,post-uterinesac;(h)immaturetail.(i)maturevulva,tail;( j,k)maletailswithspicules;(l)slenderfemaletailwithmucro,
Perry,Ohio,USA;(m)obesefemaletailwithasymmetrictip,KirtlandOhio,USA;(n)maturefemalebody,egg,PotterCounty,Pennsylvania,
USA
FIGURE 3 Polarizedlightmicroscopy
(PLM) of live Litylenchus crenatae mccannii
ssp. n. (a) female; (b) male; (c) eggs; (d)
juvenile
(a) (b)
(c) (d)
10 of 15
|
CARTA eT Al.
Nematodes did not sur vive on potato dex trose agar plates
with Rhizoctonia solani.Rinsed,surface-sterilizedleavesembed-
ded in either water agar or potato dextrose agar did not provide
any better yield of nematodes than strips of leaves in sterile water
from which thousands of nematodes per infested leaf could be
harvested over a few weeks. Twigs below infested buds were
cut and placed in Baermann funnels or dishes but no nematodes
emerged.
3.4 | Bud associated nematodes
Litylenchus crenatae mccannii ssp. n. adults were inoculated to freshly
dissected beech bud tips embedded in moist water agar plates that
resulted in adult females swarming onto the bud tip (Figure 6a).
Dissection demonstrated that nematodes entered the excised bud
but did not develop.
Neither bud nor leaf explant s could be maintained on water
agar. Nematode females and eggs were exposed from within buds in
March 2019 and imaged with a Hirox (Figure 5b–d) microscope and
anLT-SEM(Figure6a–c).
3.5 | Tree leaf and bud inoculation
Wefound that beechleaf inoculations failed to initiate anysymp-
tomsofBLDintrees after5months of growth(Table4).Although
some leaves developed browning or leaf margins over the course of
5 months, none developed interveinal darkening that is characteris-
ticofBLD. Wealsoobservednoleafmortality duringthe5-month
incubation until trees began to senesce and enter dormanc y. Bud
inoculation however was successful in initiating symptoms of BLD
inbuds wherenematodeswereapplied(Table4andFigure8). For
budsinoculatedinautumnpriortodormancy,atotalof3of4buds
which were injured prior to nematode inoculation showed evidence
of BLD, while the fourth bud failed to open and died. Control buds
which were injured or uninjured and which did not receive nema-
tode inoculation all opened without signs of BLD. However, injured
FIGURE 4 Low-temperaturescanningelectronmicroscopyoffemalemorphology(a)facewithstyletopening(verticalarrow),amphid
opening(lateralarrow),obliqueview;(b)lipregionofhead,lateralview;(c)vulva(toparrow)andlateralfield(lowarrow);(d)ventralviewof
vulvawithpuckeredlipsandlateralbodydepressioninlinewithvulvalopening(arrow);(e)nematodelipspressedonmid-bodyofasecond
nematode;(f)mid-bodycuticlewithsix-sectoredlipindentationsfromanothernematodeface,lateralview;conicaltailtipvariations.(g,h)
young females; (i, j) mature females
(a) (b) (c)
(d)
(e)
(f)
(g)
(h) (i) (j)
|
11 of 15
CARTA eT Al .
FIGURE 5 Litylenchus crenatae
mccannii ssp. n. on and in buds. (a) LM
image of adult females swarming on bud
tip;(b–d)Hiroxmicroscopyofnematode-
infested beech bud from the Holden
Arboretum,Kirtland,Ohio,USA
(a) (b)
(c) (d)
FIGURE 6 Low-temperaturescanning
electron microscopy images of Litylenchus
crenatae mccannii ssp. n. on leaf sheath
at bud base. (a) females, juveniles, eggs
on bud sheath; (b) adult females on bud
sheath; (c) adult female on bud sheath
near leaf mesophyll
(a) (b)
(c)
12 of 15
|
CARTA eT Al.
buds, even those without nematode inoculation, tended to open
more slowl y than uninjur ed leaves. Of th e 4 buds which rece ived
nematodes but were not injured, only 1 developed symptoms of BLD
while the other 3 buds opened normally and leaves appeared unaf-
fected. For spring inoculated buds, both buds which were injured
and received nematodes developed BLD symptoms even after only
2 weeks of incubation. Both buds which did not receive nematodes
opened normally and were free of BLD symptoms.
3.6 | Nematode identification and sequence identity
Leaf tissue symptomatic for BLD was extracted from trees that underwent
budinoculation.DirectsequencingofPCR productandBlastmatching
returned matches to Litylenchus crenatae with 99% identity confirm-
ing the presence of the nematode in leaves developed from inoculated
buds.GenBanksequenceaccessionnumbers:MN625146–MN625161.
LeavesfromTree4thatwerebudinoculatedwithnematodesplusnee-
dleinjurywereharvested4-22-19,afterwhichsymptomaticleaveswere
dissected and stained with acid fuchsin (Byrd et al., 1983) and stained
nematodesrecoveredafter21days(Figure9a-c).
4 | DISCUSSION
Multiplesymptomaticleavesreceivedby the USDA-ARSMNGDBL
and Agriculture Canada national nematology laboratories yielded
many nematodes of one species only. In heavily infested areas where
nematode counts were highest in symptomatic leaves, a very small
number of nematodes were occasionally found on asymptomatic
leaves, but across all samples nematodes were not found in the vast
majority of asymptomatic leaves (S. Reed unpublished data).
FIGURE 7 Inoculation of Fagus
grandifolia seedlings with nematodes.
Bud inoculation for nematodes involved
wrappingthebudwithawetKimwipe
and adding nematode suspension under
Kimwipeatbudsurface.Thebudwas
loosely wrapped in parafilm to retain
moisture and permit nematodes to
colonizeit.Photographsshowinoculation
inApril2019ofdormantbudswith
nematodes collected from field grown
trees. The “I” indicates the bud was
injured prior to inoculation
(a) (b)
FIGURE 8 Symptoms from inoculated
seedlings. (a) Bud tree two, injured with
nematodeadded.22April2019.(b)Bud
tree three, no injury with nematode
added. 29 May 2019
(a) (b)
|
13 of 15
CARTA eT Al .
Litylenchus nematodes with slender and obese morphs exhibit
phenotypic plasticity as they develop, as with other nematodes in
the family Anguinidae. Sclerotized, cuticular landmark structures
like anal and vulval openings were much more difficult to identify in
youngadultsandjuveniles.However,thestronglysclerotizedfeed-
ing stylet was always distinct, and consistently larger in mature than
immature specimens.
AswithL. crenataeinJapan(Kanzakietal.,2019)andL. coprosma
in NZ (Zhao, Davies, Alexander,& Riley,2011),slender and obese
morphs coexisted during much of the year, but obese morphs pre-
dominate d in the late spring th rough autumn. A s in Japan, males
were found in leaves in late spring through autumn, but males
were not foun d within buds in No rth Americ a during Septem ber,
November, March, or June. Eggs were found in buds rather than
leaves during autumn months despite careful dissection and staining
of leaves. However, it was possible to find eggs in leaves during late
spring which hatched within leaves to produce many nematodes by
late summer.
The fine resolution COI marker generated for this population
employed the same primers designed for another phylogenetically
distantfoliarnematode(Kanzaki&Futai,2002)associatedwiththe
laboratory of the author of the description of L. crenatae, but slightly
different conditions. These included an especially thermostable
polymeraseenzymeandhigherannealingtemperatureafterthefifth
PCRcycle.Thisdifferentprotocolmayaccountforthesequencere-
ported here that was not reported for the population from Japan.
Simple leaf inoculations with nematodes from leaves failed
to produce symptoms in Ohio greenhouse tests reported here.
However, a different experiment in Sault Ste. Marie, Ontario, Canada
with two leaves per sapling injured with a needle, treated with a
largervolumenematodeinoculumbutwithasimilar540totalnem-
atodes as in Ohio, was saturated to runoff in two 2 ml doses over a
72-hrperiod. Inthis September 2018inoculationexperiment,four
out of the five surviving treated seedlings had BLD leaf symptoms at
the beginning of June 2019, while all control seedlings were free of
symptoms. Half of the initially treated seedlings were weakened by
mites in the growth chamber and succumbed to freezing tempera-
tures in a poly house. Leaves and buds of the surviving plant s may
havebeeninjuredby freezingtemperature andmites.Itispossible
that the nematodes could have entered buds in the larger inoculum
volume runoff during these ostensible leaf inoculations to produce
symptoms. Entry into buds was the most reliable route for successful
inoculation of nematodes, whether this occurred in the fall or the
spring. Nematodes could enter buds on their own, but symptoms
appeared more routinely with injur y. In nature this might be facili-
tated by some type of vectororfreezingandthawing.However,it
appearsthatfreezingduringwinterisnotnecessarytoallowsymp-
toms to develop since an early spring inoculation in the greenhouse
produced symptoms.
While foliar nematodes are fairly common, nematodes that
exist high in the tree canopy are not well-known, though endo-
phytic Aphelenchoides were recently discovered in poplar leaves
(Populus sp.) (Carta, Li, Skantar, & Newcombe, 2016). Nematodes
like Litylenchus crenatae mccannii ssp. n. within the nematode family
Anguini dae that are asso ciated with har dwood leaves havi ng sim-
ilar swollen, chlorotic-becoming-necrotic mesophyll tissue include
Litylenchus coprosma(N ew Zealand, Zha o et al., 2011), L. crenatae
(Japan,Kanzaki et al.,2019),Ditylenchus leptosoma(Korea,Geraert
& Choi, 1990) and Subanguina chilensis (Chile, Vovlas, Troccoli, &
Moreno, 20 00). Except for leaf symptoms in L. coprosma, the others
were described as galls, though they are not discrete like the seed
galls of Anguina or eriophyid mite galls. These other anguinid nem-
atode leaf gallers were implicitly assumed to be the cause of their
symptoms. Those plants were not very economically import ant nor
did those symptoms accompany serious mortality, so there was no
indication for the need to follow up with proof of nematode patho-
genicity. None of these nematodes associated with galls have been
reported to have a fundamental association with another pathogen
sincetheirdescription(Xu,Li,Ho,Alexander,&Zhao,2017;citation
updates of all species).
The sponginess of galled por tions of the BLD leaves may result
from pectinases, similar to host leaves of the related anguinid nema-
tode Ditylenchus dipsaci (Myers, 1965). Physiological investigation of
superficially similar leaf galls of the related Ditylenchus gallaeformans
(Anguinidae)andleaf-gallingmites(Eryiophidae)bothdemonstrated
increased phenolics and carotenoids that counteract oxidative and
light damage. However, the Ditylenchus nematode gall originated in
the primordium, had a vascular connection, exhibited hypertrophied
and hyperplastic mesophyll and promoted indeterminate growth.
In contrast the simpler mite gall exhibited determinate grow th in
the epidermis (Ferreira et al., 2018). Therefore, the nematode gall
affected the host plant more profoundly and systemic ally than the
gall mite. Because there is likely to be a similar vascular connec-
tion for this related anguinid leaf galler, a Litylenchus metabolite or
even an endophytic microorganism could have a profound effect
on the plant. The nematode itself might be discovered to produce
a toxin like that recently discovered in entomoparasitic nematode
Steinernema carpocapsae(Luetal.,2017).
FIGURE 9 Acidfuchsinstains(a)
female and male nematodes from peeled
beech leaf mesophyll; (b) male nematodes
stained from leaf of experimentally
inoculated seedling, May 2019. (c) female
nematode from inoculated seedling bud
May 2019
(a) (b) (c)
14 of 15
|
CARTA eT Al.
Nematodes within the Anguinidae related to Litylenchus may
harbour toxic Rathayibacter spp. bacteria specific to their plant
hosts ( Anguina agrostis, A. funesta, A. tritici on monocots: Dorofeeva
et al., 2018 and Mesoanguina picridis on a dicot: Starodumova et al.,
2017),but this appears to bea population-specificevent among a
fewknown species (Murray et al.,2017). In any event, preliminary
evidence from subtractive leaf biome profiling by one of the authors
found no suggestion of any Rathayibacter associated with the dis-
ease. However, work is underway to better understand the nem-
atode and beech microbiomes. The microbiomes of the pinewood
nematode, and beetle vectors are expected to illuminate the patho-
genicityofpinewooddisease(Alvesetal.,2018).
Lack of symptomatic, naturally infested Fagus crenata leaves
near infested Fagus grandifolia in Nort h America sug gests F. c re n-
atamayberesistanttothepopulationfromNorth Americabutnot
fromJapan.Asaresultofthediversityofanguinidswithsimilarleaf
symptoms from the Pacific rim, that is a likely region of endemic-
ity.TheinitialNorthAmericanlocalitiesinOhio,Pennsylvania, and
NewYork,USA,andOntario,Canadaneighbour LakeErie,atrade
hub from wh ich invasive spe cies such as em erald ash bor er (EAB)
originate d (Muirhead et al., 2 006). Like EAB, h uman transpor t of
wood may have distributed this probably invasive nematode. The
nematode may have arrived on this continent through an inverte-
brate vector, as is also suspected for Bursaphelenchus antoniae that
recentlydetectedintheU.S.(Carta&Wick,2018).
Transmission.Anguinidnematodesrequirewaterfilmstomove.
Certainly, windborne rain is a likely local means of disease transmis-
sion. Inver tebrates are as well. For instance, a predatory mite was
found entangled with nematodes, and we have collec ted various
mites and insects from leaf surfaces. Spider mites were numerous
in the summer in Ohio beech stands, and they can be windborne
for many miles. There are many potential invasive beetle vectors as-
sociated w ith beech (Mor rison, Sweeney, Hugh es, & Johns, 2017;
Rabagli a, Vandenberg, & A ccivatti, 20 09) (that may be present i n
the geographic regions where BLD occurs. Finding enough of any of
these invertebrates with nematodes takes time and directed effort
howeve r.
Birds are another possible vector, as with transport of Lyme
disease through ticks (Loss, Noden, Hamer, & Hamer, 2016).
Beech nuts are a critical component of the food chain for birds in
NortheasternandAppalachian forests. Theyarehighinthe can-
opy and difficult to harvest before the birds consume them. Since
these nematodes inhabit leaf buds they may also inhabit flower
buds. If so, birds might ingest nematodes and distribute them di-
rectly. They might carry mites, ticks or insects that carry nema-
todes as well.
Whetherthenematodeitselfisthesolecauseofthedisease,ora
vector of an elusive, hidden pathogen, it has had a consistent natural
and experimental association with disease symptoms to date.
ACKNOWLEDGEMENTS
Wethank DavidChitwood, retired MNGDBL Research Leader, for
early guidance and Joseph Mowery, ECMU, USDA-ARS, Beltsville,
MDforgraphicsofscanningelectronmicrographimages.Wethank
Adam Hoke for a ssistance w ith labora tory work an d tree inocul a-
tions. Wethank Tracey OlsonandThomas Hall,PADepartmentof
Agriculture, Harrisburg, PAand Sarah Johnson, Wellsborough, PA
for samples. Mention of trade names or commercial products in this
publication is solely for the purpose of providing specific informa-
tion and does not imply recommendation or endorsement by the
U.S.DepartmentofAgriculture.USDAisanequalopportunitypro-
vider and employer.MihailKantor was supported in partbyanap-
pointment to the Research Par ticipation Program at the Mycology
andNematology Genetic Diversity and Biology LaboratoryUSDA,
ARS,Nor theastArea,Beltsville,MD,administeredbytheOakRidge
Institute for Science and Educ ation through an interagency agree-
mentbetweentheU.S.DepartmentofEnergyandUSDA-ARS.
ORCID
Lynn Kay Carta https://orcid.org/0000-0001-7793-3990
Zafar A. Handoo https://orcid.org/0000-0001-5714-5663
Mihail Kantor https://orcid.org/0000-0001-7609-104X
Colette K. Gabriel https://orcid.org/0000-0001-9089-0155
Sharon Reed https://orcid.org/0000-0002-7724-333X
David J. Burke https://orcid.org/0000-0003-1774-1617
REFERENCES
Alves, M ., Pereira, A ., Vicente , C., Matos, P., Henri ques, J., Lop es, H.,
… Henriq ues, I. (2018). The r ole of bacteria i n Pine Wilt Dise ase:
Insights from microbiome analysis. FEMS Microbiology Ecology, 94,
fiy077.https://doi.org/10.1093/femsec/fiy077
Burke, D. J., Smemo, K . A., López-Gutiérrez, J. C., & D eForest, J. L.
(2012). Soil fungi influence the distribution of microbial func tional
groups that mediate forest greenhouse gas emissions. Soil Biology
and Biochemistry, 53, 112–119. https ://doi.org/10.1016/j.soilb
io.2012.05.008
Byrd,D.W.,Jr.,Kirkpatrick,T.,&Barker,K.R.(1983).Animprovedtech-
nique for clearing and staining plant tissue for detection of nema-
todes. Journal of Nematology, 14,142–143.
Cart a,L.K.,Bauchan,G.R.,Hsu,C.-Y.,&Yuceer,C.Y.(2010).Description
of Parasitorhabditis mississippii, n.sp. (Nemata: Rhabditida) from
Dendroctonus frontalisZimmermann(Coleoptera:Scolytidae).Journal
of Nematology, 42,46–54.
Cart a, L. K., & Li, S. (2019). PCR amplification of a long rDNA seg-
ment with one primer pair in agriculturally impor tant nematodes.
Journal of Nematology, 51 , e2019–e2026. https://doi.org/10.21307/
jofnem-2019-026
Cart a,L.K.,Li,S.,Skantar,A.M.,&Newcombe,G.(2016).Morphological
and Mole cular charac terization of t wo Aphelenchoides endophytic
in poplar leaves. Journal of Nematology, 48, 28–33. https ://doi.
org /10. 213 07/jofn em-2017-0 06
Cart a,L.K.,&Wick,R.L.(2018).FirstreportofBursaphelenchus antoniae
from Pinus strobus in the U.S. Journal of Nematology, 50, 473–478.
https://doi.org/10.21307/jofnem-2018-052
Cherry,T.,Szalanski,A.L.,Todd,T.C.,&Powers,T.O.(1997).Theinternal
transcribed spacer region of Belonolaimus (Nemata: Belonolaimidae).
Journal of Nematology, 29, 23–29.
Dorofee va, L. V., Starodum ova, I. P., Krauzova, V. I., Pri syazhnaya, N.
V.,Vinokurova,N. G.,Lysanskaya,V.Y.,…Evtushenko, L. I.(2018).
Rathayibacter oskolensis sp. nov., a novel actinobacterium from
Androsace Koso-poljanskii Ovcz. (Primulaceae) endemic to the
Central Russian Upland. International Journal of Systematic and
Evolutionary Microbiology, 68,1442–1447.
|
15 of 15
CARTA eT Al .
Esmaeili,M.,Heydari,R.,&Ye,W.(2017).Descriptionofanewanguinid
nematode, Nothotylenchus phoenixaen. sp. (Nematoda:Anguinidae)
associated with palm date trees and it s phylogenetic relations within
thefamily Anguinidae. Journal of Nematology, 49,268–275.https://
doi.org/10.21307/jofnem-2017-072
Ewing, C. J., Hausman, C. E., Pogacnik, J., Slot, J., & Bonello, P. (2018).
Beech leaf disease: Anemerging forest epidemic.Forest Pathology,
49(2),e12488.https://doi.org/10.1111/efp.12488
Ferreira, B. G.,Oliveira, D. C.,Moreira, A. S.F.P.,Faria, A.P.,Guedes,
L. M., Fr anca, M. G . C., … Isaias , R. M. S. (2018). A ntioxidant m e-
tabolism in galls due to the extended phenotypes of the associated
organisms. PLoS ONE, 13,e0205364.https://doi.org/10.1371/journ
al.pone.0205364
Geraert, E., & Choi, Y. E. (1990). Ditylenchus leptosoma sp. n. (Nematoda:
Tylenchida), a parasite of Carpinus leaves in Korea. Nematologia
Mediterranea, 18,27–31.
Golden,A. M. (1990). Preparation and mounting nematodesfor micro-
scopicobservation.InB.M. Zuckerman,W.F.Mai,&L.R.Krusberg
(Eds.), Plant nematology laboratory manual ( pp. 197–205). Amh erst,
MA:UniversityofMassachusettsAgriculturalExperimentStation.
Kanzaki,N., & Futai,K. A.(2002). PCRprimersetfor determinationof
phylogenetic relationships of Bursaphelenchus species within the xy-
lophilus group. Nematology, 4,35–41.
Kanzaki, N., Ichihara, Y., Aikawa, T., Ekino, T., & Masuya, H. (2019).
Litylenchus crenataen. sp.(Tylenchomorpha:Anguinidae) a leafgall
nematodeparasitizingFagus crenata Blume. Nematology, 21, 5–22.
Loss, S.R., Noden,B.H.,Hamer,G.L.,& Hamer,S.A. (2016).A quanti-
tative synthesisof theroleofbirds in carryingticks and tick-borne
pathogensin North America. Oecologia, 182, 947–959. https://doi.
org/10.1007/s00442-016-3731-1
Lu,D.,Macchietto,M.,Chang,D.,Barros,M.M.,Baldwin,J.,Mortazavi,
A., &Dillman,A. R. (2017).Activatedentomopathogenicnematode
infective juveniles release lethal venom proteins. PLoS Path, 13,
e1006302.https://doi.org/10.1371/journal.ppat.1006302
Morrison,A., Sweeney,J., Hughes,C., &Johns,R.C.(2017).Hitching a
ride: Fi rewood as a potenti al pathway for ran ge expansion of an ex otic
beechleaf-miningweevil,Orchestes fagi (Coleoptera: Curculionidae).
Canadian Entomologist, 149,129–137.
Muirhead, J. R.,Leung,B., Van Overdijk, C., Kelly, D. W., Nandakumar,
K., Mar chant, K. R ., & MacIsaa c, H. J. (200 6). Modelling l ocal and
long-distance dispersal of invasive emerald ash borer Agrilus pla-
nipennis (Coleopt era) in Nort h America . Diversity and Distributions,
12,71–79.https://doi.org/10.1111/j.1366-9516.2006.00218.x
Murray,T.D.,Schroeder,B.K.,Schneider,W.L.,Luster,D.G.,Sechler,
A., Roge rs, E. E., & S ubbotin, S . A. (2017). Rathayibacter toxicus,
other Rathayibacter species inducing bacterial head blight of
grasses, and the potential for livestock poisoning s. Phytopatholog y,
107,804–815.
Myers, R . F. (1965). Amylase, cellulase, invertase and pectinase in
several free-living, mycophagus, and plant-parasitic nematodes.
Nematologica, 11,441–448.
Rabaglia,R.J.,Vandenberg,N.J.,&Accivatti,R.E.(2009).Firstrecordsof
Anisandrus maiche Stark (Coleoptera: Curculionidae: Scolytinae) from
North America. Zootaxa, 2137, 23–28. https://doi.org/10.11646/
zootaxa.2137.1.2
Shahina,F.(1996).AdiagnosticcompendiumofthegenusAphelenchoides
Fischer,1894(Nematoda:Aphelenchida) withsomenewrecords of
the group from Pakistan. Pakistan Journal of Nematology, 14, 1–3 2 .
Starodumova,I.P.,Tarlachkov,S.V.,Prisyazhnaya,N.V.,Dorofeeva,L.V.,
Ariskina,E.V.,Chizhov,V.N.,…Vasilenko,O.V.(2017).Draftgenome
sequenceofRathayibactersp.str ainVKMAc-2630isolatedfromleaf
gall induced by the knapweed nematode Mesoanguina picridis on
Acroptilon repens. Genome Announcements, 5,e00650-17.
TanhaMaafi, Z., Subbotin, S.A., &Moens, M.(2003). Molecular iden-
tification ofcyst-formingnematodes(Heteroderidae)fromIran and
aphylogenybased onITS-rDNAsequences.Nematology, 5, 99–111.
h t t p s : / / d o i . o r g / 1 0 . 1 1 6 3 / 1 5 6 8 5 4 1 0 2 7 6 5 2 1 6 7 3 1
Thomas , W. K. (2011). Mole cular techniqu es. In Internatio nal Seabed
Authority (Ed.), Marine benthic nematode molecular protocol hand-
book (Nematode barcoding). Technical Study: No. 7, ISA Technical
Study Se ries (pp. 22–37). Kings ton, Jamaica: I nternational S eabed
Authorit y.
Tomalak,M.,Malewski,T.,Gu,J.F.,&Qiang,Z.F.(2017).Descriptionof
Bursaphelenchus taphrorychi sp. n. (Nematoda: Parasitaphelenchidae),
the second Bursaphelenchus species from lar val gallerie s of the
beech bark beetle, Taphrorychus bicolor (Herbst.) (Coleoptera:
Curculionidae: Scolytinae), in European beech, Fagus sylvatica L.
Nematology, 19,1217–1235.
Vovlas, N., Subbotin, S. A., Troccoli, A., Liebanas, G., & Castillo, P.
(2008). Molecular phylogeny of the genus Rotylenchus (Nematoda,
Tylenchida) and description of a new species. Zoologica Scripta, 37,
52 1–5 3 7.
Vovlas, N., Troccoli, A., & Moreno, I . (2000). Subanguina chilensis sp.
n. (Nematoda: Anguinidae), a new leaf-gall nematode parasitizing
Nothophagus obliqua, in Chile. International Journal of Nematology, 10,
1–8 .
Vrain,T.C.,Wakarchuk,D.A.,Levesque, A. C., &Hamilton,R. I.(1992).
IntraspecificrDNArestrictionfragmentlengthpolymorphismsinthe
Xiphinema americanum group. Fundamental and applied Nematology,
15,563–573.
Xu,Y.M.,Li,D.,Ho,W.,Alexander,B.J.R.,&Zhao,Z.Q.(2017).Firstre-
port of Litylenchus coprosma on Coprosma robusta. Australasian Plant
Disease Notes, 12(1),17.https://doi .org/10.10 07/s13314-017- 0242-9
Zhao,Z.Q., Davies,K .A .,Alexander,B.,&Riley,I.T.(2011).Litylenchus
coprosmagen.n.,sp.n.(Anguinata),fromleavesonCoprosma repens
(Rubiaceae)inNewZealand.Nematology, 13,29–44.
Zhen,F.,Agudelo,P.,&Gerard,P.(2012).Aprotocolforassessingresis-
tance to Aphelenchoides fragariae in Hosta cultivars. Plant Disease, 96,
1438–144 4.
How to cite this article:CartaLK,HandooZ A,LiS,etal.
Beechleafdiseasesymptomscausedbynewlyrecognized
nematode subspecies Litylenchus crenatae mccannii
(Anguinata)describedfromFagus grandifoliainNorthAmerica.
For Path. 2020;00:e12580. htt ps ://doi .org/10.1111 /efp.12 58 0
