Mosquito-Independent Transmission of West Nile virus in Farmed Saltwater Crocodiles (Crocodylus porosus)

Abstract

West Nile virus, Kunjin strain (WNVKUN) is endemic in Northern Australia, but rarely causes clinical disease in humans and horses. Recently, WNVKUN genomic material was detected in cutaneous lesions of farmed saltwater crocodiles (Crocodylus porosus), but live virus could not be isolated, begging the question of the pathogenesis of these lesions. Crocodile hatchlings were experimentally infected with either 105 (n = 10) or 104 (n = 11) TCID50-doses of WNVKUN and each group co-housed with six uninfected hatchlings in a mosquito-free facility. Seven hatchlings were mock-infected and housed separately. Each crocodile was rotationally examined and blood-sampled every third day over a 3-week period. Eleven animals, including three crocodiles developing typical skin lesions, were culled and sampled 21 days post-infection (dpi). The remaining hatchlings were blood-sampled fortnightly until experimental endpoint 87 dpi. All hatchlings remained free of overt clinical disease, apart from skin lesions, throughout the experiment. Viremia was detected by qRT-PCR in infected animals during 2–17 dpi and in-contact animals 11–21 dpi, indicating horizontal mosquito-independent transmission. Detection of viral genome in tank-water as well as oral and cloacal swabs, collected on multiple days, suggests that shedding into pen-water and subsequent mucosal infection is the most likely route. All inoculated animals and some in-contact animals developed virus-neutralizing antibodies detectable from 17 dpi. Virus-neutralizing antibody titers continued to increase in exposed animals until the experimental endpoint, suggestive of persisting viral antigen. However, no viral antigen was detected by immunohistochemistry in any tissue sample, including from skin and intestine. While this study confirmed that infection of saltwater crocodiles with WNVKUN was associated with the formation of skin lesions, we were unable to elucidate the pathogenesis of these lesions or the nidus of viral persistence. Our results nevertheless suggest that prevention of WNVKUN infection and induction of skin lesions in farmed crocodiles may require management of both mosquito-borne and water-borne viral transmission in addition to vaccination strategies.

Full text

viruses
Article
Mosquito-Independent Transmission of West Nile
virus in Farmed Saltwater Crocodiles
(Crocodylus porosus)
Gervais Habarugira 1, †, Jasmin Moran 2, †, Agathe M.G. Colmant 3, 4, †, Steven S. Davis 5,
Caitlin A. O’Brien 3,4, Sonja Hall-Mendelin 6, Jamie McMahon 6, Glen Hewitson 6,
Neelima Nair 6, Jean Barcelon 6, Willy W. Suen 3,‡, Lorna Melville 5, Jody Hobson-Peters 3,4,
Roy A. Hall 3, 4, *, Sally R. Isberg 2, * and Helle Bielefeldt-Ohmann 1,3,4,*
1
School of Veterinary Science, University of Queensland, Gatton, Qld 4343, Australia; g.habarugira@uq.net.au
2Centre for Crocodile Research, Noonamah, NT 0837, Australia; research@crocresearch.com.au
3School of Chemistry and Molecular Biosciences, University of Queensland, St Lucia, Qld 4072, Australia;
a.colmant@uq.edu.au (A.M.G.C.); caitlin.obrien@uqconnect.edu.au (C.A.O.); willy.suen@csiro.au (W.W.S.);
j.peters2@uq.edu.au (J.H.-P.)
4Australian Infectious Diseases Centre, University of Queensland, St Lucia, Qld 4072, Australia
5Berrimah Veterinary Laboratories, NT 0828, Australia; steven.davis@menzies.edu.au (S.S.D.);
Lorna.Melville@nt.gov.au (L.M.)
6Queensland Health, Forensic and Scientific Services, Public Health Virology,
Coopers Plains, Qld 4108, Australia; Sonja.Hall-Mendelin@health.qld.gov.au (S.H.-M.);
Jamie.McMahon@health.qld.gov.au (J.M.); Glen.Hewitson@health.qld.gov.au (G.H.);
Neelima.Nair@health.qld.gov.au (N.N.); Jean.Barcelon@health.qld.gov.au (J.B.)
*Correspondence: roy.hall@uq.edu.au (R.A.H.); sally@crocresearch.com.au (S.R.I.);
h.bielefeldtohmann1@uq.edu.au (H.B.-O.)
†These authors contributed equally to this work.
‡Present address: Australian Animal Health Laboratories (CSIRO), Geelong, VIC, Australia.
Received: 27 December 2019; Accepted: 10 February 2020; Published: 11 February 2020


Abstract:
West Nile virus, Kunjin strain (WNV
KUN
) is endemic in Northern Australia, but rarely
causes clinical disease in humans and horses. Recently, WNV
KUN
genomic material was detected
in cutaneous lesions of farmed saltwater crocodiles (Crocodylus porosus), but live virus could not
be isolated, begging the question of the pathogenesis of these lesions. Crocodile hatchlings were
experimentally infected with either 10
5
(n=10) or 10
4
(n=11) TCID
50
-doses of WNV
KUN
and each
group co-housed with six uninfected hatchlings in a mosquito-free facility. Seven hatchlings were
mock-infected and housed separately. Each crocodile was rotationally examined and blood-sampled
every third day over a 3-week period. Eleven animals, including three crocodiles developing typical
skin lesions, were culled and sampled 21 days post-infection (dpi). The remaining hatchlings were
blood-sampled fortnightly until experimental endpoint 87 dpi. All hatchlings remained free of
overt clinical disease, apart from skin lesions, throughout the experiment. Viremia was detected by
qRT-PCR in infected animals during 2–17 dpi and in-contact animals 11–21 dpi, indicating horizontal
mosquito-independent transmission. Detection of viral genome in tank-water as well as oral and
cloacal swabs, collected on multiple days, suggests that shedding into pen-water and subsequent
mucosal infection is the most likely route. All inoculated animals and some in-contact animals
developed virus-neutralizing antibodies detectable from 17 dpi. Virus-neutralizing antibody titers
continued to increase in exposed animals until the experimental endpoint, suggestive of persisting
viral antigen. However, no viral antigen was detected by immunohistochemistry in any tissue
sample, including from skin and intestine. While this study confirmed that infection of saltwater
crocodiles with WNV
KUN
was associated with the formation of skin lesions, we were unable to
elucidate the pathogenesis of these lesions or the nidus of viral persistence. Our results nevertheless
suggest that prevention of WNV
KUN
infection and induction of skin lesions in farmed crocodiles
Viruses 2020,12, 198; doi:10.3390/v12020198 www.mdpi.com/journal/viruses

Viruses 2020,12, 198 2 of 21
may require management of both mosquito-borne and water-borne viral transmission in addition to
vaccination strategies.
Keywords: West Nile virus; saltwater crocodile; water-borne transmission
1. Introduction
West Nile virus (WNV) is a mosquito-transmitted flavivirus that produces a potentially fatal
disease in humans, horses, birds and alligators and has been associated with outbreaks of viral
encephalitis in Africa, Europe, and the Americas [
1
]. Although the Kunjin strain of WNV was initially
considered a separate species in the flavivirus genus, subsequent studies revealed that it shared a high
degree of antigenic and genetic homology to other WNV strains [
2
–
4
], prompting the International
Committee for Taxonomy on Viruses (ICTV) to classify Kunjin virus as a subtype of WNV. Until 2011,
the relatively benign WNV
KUN
had only been associated with a few cases of non-fatal encephalitis
in humans and a handful of equine cases, since it was first isolated in 1960 [
5
]. However, in 2011 an
emerging strain of WNV
KUN
(referred to as NSW2011) caused a major outbreak of equine encephalitis
in SE Australia [4,6].
When WNV first entered the Americas in 1999 (the WNV
NY99
strain), much effort went into
identifying hosts and reservoirs for the virus, and reptiles became a focus of attention. Serological
surveys detected antibodies to WNV in farmed Nile crocodiles (Crocodylus niloticus) in Israel, wild
and farmed Morelet’s crocodiles (C. moreletii) in Mexico as well as wild and captive American
alligators (Alligator mississippiensis) in Florida and free-ranging alligators in Louisiana (reviewed
in [
7
,
8
]). WNV
NY99
was found to be associated with neurological and gastrointestinal disease and
high mortality in farmed alligators in Georgia, Louisiana and Florida. Alligators with clinical signs
exhibited very high WNV loads in liver, spleen, intestine and brain—the same tissues displayed severe
pathological changes [
9
,
10
]. Skin lesions were also noted in animals surviving the acute infection,
generally appearing 4–5 weeks after the acute disease, but it was not until later that a direct association
between the skin lesions, known as “pix” or “Lymphohistiocytic proliferative cutaneous lesions”
(LPCL), and WNV-infection was made [10,11].
In late 2016, similar skin lesions (pix) were discovered in farmed saltwater crocodiles (Crocodylus
porosus) in the Northern Territory of Australia, and WNV
KUN
viral RNA was detected by qRT-PCR [
12
].
These lesions severely diminish the value of the skin, with some farms in the Northern Territory
observing lesions in almost half the crocodiles harvested. Farming saltwater crocodiles in Northern
Australia is an emerging primary industry, currently worth more than AU$100 million per year with
quality crocodile skins highly sought by the international fashion industry. However, lost production
due to WNV
KUN
infection is estimated to cost the industry more than AU$10 million/year. Of note
is that the appearance of the lesions was not preceded by any other apparent clinical signs in the
animals, suggesting that the virus–host relationship between WNV
KUN
and C. porosus is different to
that observed between WNV
NY99
and alligators. This prompted us to further characterize the virus
strain detected in the lesions and the infection in hatchling saltwater crocodiles.
The mode of transmission of WNV
KUN
to crocodiles is likely to be via the bite of infected mosquitoes.
This is consistent with preliminary vector prevalence studies conducted on or near crocodile farms in
Northern Australia, that showed high numbers of Culex annulirostris, the major mosquito vector of
WNV
KUN
in Australia [
13
]. Another incriminated WNV
KUN
vector, Culex quinquefasciatus [
14
], was also
found breeding in some of the crocodile rearing ponds (unpublished findings of the Northern Territory
Medical Entomology unit). Herons and egrets (Ardeidae)—present in large numbers on crocodile farms
scavenging for crocodile food waste—are the main recognized vertebrate hosts of WNV
KUN
[
5
] and
are likely to be involved in the initiation and maintenance of the transmission cycle on crocodile farms.
In addition, some crocodile farms contain breeding pens to produce a constant supply of eggs and

Viruses 2020,12, 198 3 of 21
hatchlings. These swamp-like environments provide ideal conditions for mosquito breeding and
attract large populations of these water birds [
15
]—the perfect scenario for WNV
KUN
transmission.
However, an additional role for infected crocodiles in transmitting the virus to mosquitoes, i.e., as
amplifying hosts, has not been investigated. Another potential transmission route is via water fecally
contaminated with WNV
KUN
, particularly in pens containing a high density of animals. Indeed, this
has been shown to occur for WNV on alligator farms in the USA [
10
]. However, while alligators
experience a necrotizing enteritis with WNV-shedding in the fecal material during acute infections [
10
],
there has been no evidence that saltwater crocodiles are similarly clinically affected. In this report, we
describe the full genome sequence of the crocodile-derived virus and its genetic relationship to other
WNV
KUN
strains as well as the outcome of both direct experimental infection and indirect (contact)
virus transmission in juvenile (hatchling) saltwater crocodiles. Our results suggest that despite absence
of clinical signs or pathological lesions in the gastrointestinal tract, WNV
KUN
is indeed shed into
the water and can be transmitted directly to other animals in close contact. The implications are
that in order to protect farmed crocodiles from developing WNV
KUN
-induced skin lesions, causing
financial costs to a locally important industry, a two-pronged approach must be taken: control of the
mosquito-bird-crocodile transmission cycle, and the crocodile-to-crocodile transmission, the latter
probably best aided by vaccination.
2. Materials and Methods
2.1. Cell Culture and Virus
African green monkey (Vero) and Aedes albopictus larvae (C6/36) cells were cultured as previously
described [
16
]. The isolation, propagation and characterization of the equine pathogenic WNV
KUN
outbreak strain (NSW2011 - isolate E667) has previously been described in detail [
4
,
6
]. An additional
two passages in BSR (derivative of BHK-1 hamster kidney cells) and C6/36 cells, respectively, were
performed at Berrimah Veterinary Laboratories (BVL) prior to use for inoculation.
To assess replication of the NSW2011 strain of WNV
KUN
in C. porosus derived cell lines, 3-CPK and
1-LV cells [
17
] were infected at a multiplicity of infection (MOI) of 0.1, alongside C6/36 and Vero cells.
The crocodile derived cells were maintained in Medium 199 with 10–15% fetal bovine serum (FBS),
50 U
·
mL
−1
penicillin, 50
µ
g
·
mL
−1
streptomycin, and 2 mM l-glutamine. All inoculated cells were
incubated for five days and the culture supernatants harvested and titrated on C6/36 mosquito cells.
The viral titers (TCID
50
infectious units/mL) were determined by fixed-cell ELISA and calculated as per
Reed and Muench [
18
]. The prototype strain of WNV
KUN
(MRM61C, passage unknown, C6/36-derived
stock) was used for comparison in these experiments.
Assessment of WNV
KUN
growth kinetics in 1-LV and a chicken fibroblast cell line (DF-1) was
performed in 24-well plates (Costar, Corning). The wells were coated with poly-d-Lysine (PDL),
1 mg/mL (Sigma-Aldrich Pty. Ltd., North Ryde, NSW, Australia), by incubation at 37
◦
C for 1 h
followed by aspiration of the PDL-solution and two rounds of washing with sterile cell culture grade
water. The plates were air-dried for 1 hour and subsequently seeded with 10
5
1-LV or DF-1 cells per
well. Following overnight incubation at 34
◦
C, the cells were infected with WNV
KUN
at a MOI of 1.
Following virus-adsorption for 2 h at room temperature with rocking, the supernatant was discarded
and the cell monolayers washed three times with sterile PBS, after which each well received 1 mL
of M199 medium supplemented with 5% FBS, PSG and 2.5 mM HEPES. The cells were incubated at
34
◦
C. For each time point, the supernatant from three infected wells and one mock-infected well were
collected and stored at −80 ◦C until virus titration by TCID50-assay as described in Section 2.6.
2.2. Sequencing and Phylogenetic Analysis
RNA was extracted from crocodile lesions and screened for the presence of flaviviruses using the
pan-flavivirus generic primers FU2/cFD3 binding to the conserved NS5 region [
19
]. One positive sample
(D66) was sent for next generation Illumina sequencing on a HiSeq platform (Australian Genome

Viruses 2020,12, 198 4 of 21
Research Facility, Melbourne, Victoria) after initial identification of WNV by Sanger sequencing of the
pan-flavivirus primers-derived amplicon.
The reads obtained were mapped to the published genomes of WNV
KUN
and 222 reads corresponded
to the crocodile-derived WNV. Selected regions of the viral genome remained unsequenced, so primers
were designed (Table S1) to produce large amplicons from viral RNA template extracted by high-fidelity
RT-PCR (SuperScript
™
III One-Step RT-PCR System with Platinum
™
Taq High Fidelity DNA Polymerase
(Thermo Fisher Scientific Australia Pty Ltd, Scoresby, VIC, Australia)). These amplicons were sequenced
by Sanger sequencing (Australian Genome Research Facility, Brisbane, Queensland). The whole genome
of the crocodile-derived WNV was obtained following this method and was included in a nucleotide
alignment with various WNV sequences, using MAFFT in Geneious v8.1.9. The alignment was then used
to generate a maximum likelihood phylogenetic tree, using MrBayes 3.2.6 in Geneious v8.1.9 [
20
] with a
Generalized Time Reversible substitution model, a rate variation with invariable proportion remaining
gamma, 5 gamma categories and the sequence of Murray Valley Encephalitis virus (NC_000943) as an
outgroup. The Markov Chain Monte Carlo settings were 1,100,00 chain length, 4 heated chains, 0.2
heated chain temp, 200 subsampling frequency, 100,000 burn in length and a random seed.
2.3. Experimental Animals and Housing
All protocols were approved by the Charles Darwin University Animal Ethics Committee (Permit
# A18004; 31 January, 2018 to 31 January, 2019). Thirty-nine hatchlings were obtained from four wild
clutches incubated under standard conditions (32
±
0.5
◦
C; 95%–100% humidity) at Darwin Crocodile
Farm, Noonamah, Northern Territory, Australia [
21
–
23
]. On the day of hatch, each animal was scute
cut for individual identification [
15
] and randomized between three pens. Each pen was 200 cm wide
and 202 cm in length including a feed deck 30 cm wide tapering to a maximum water depth of 19.5 cm.
These pens were housed in an enclosed building at BVL, to prevent natural infection by mosquitoes,
and temperature controlled using thermostatically controlled air (32
◦
C
±
2
◦
C) and water (32
◦
C
±
1
◦
C) heaters (Hobo
™
data Loggers Onset Computer Corporation, MA). The rear two-thirds of
each pen was covered with black shade cloth to provide security and heat retention and a smaller
hide-board was also provided for additional security. Crocodiles were fed to excess five times weekly
with meat mince enhanced with 2% vitamin/mineral premix (Monsoon Crocodile Premix, Brisbane,
Australia) and 1.5% calcium carbonate. Residual food was removed the following morning and pens
were cleaned thoroughly with a chlorine-based detergent. Monthly water samples were taken to
ensure no environmental WNVKUN prior to infection.
2.4. Experimental Infection
Prior to infection, crocodiles were measured (head and total length [
24
]), blood sampled from the
occipital sinus using a 23-gauge needle, and belly skins were photographed at one, two, three and four
months post-hatching. At four months, the crocodiles were randomized into three treatment groups:
10
4
infectious units (IU) (n=11; infection controls =6), 10
5
IU (n=10; infection controls =6) and
control (n=7) as shown in Table 1. At that stage, with the exception of one animal in the control group,
all crocodiles were seronegative for passively acquired (maternal) WNVKUN specific antibodies.
Table 1.
West Nile Virus, Kunjin strain (WNV
KUN
) experimental infection trial groups description
and size.
Group Control
(No Injection)
1×105IU 1WNVKUN
Challenge
In-Contact Controls
for 105IU Injected
1×104IU WNVKUN
Challenge
In-Contact Controls
for 104IU Injected
N 7 10 6 11 6
1IU =infectious units.

Viruses 2020,12, 198 5 of 21
Crocodiles were infected with the different doses of WNV
KUN
in a volume of 0.1 mL given by a
29-gauge insulin needle as a subcutaneous injection behind the hind leg. Post infection (p.i.) blood
sampling (up to 200
µ
L; EDTA tubes), cloacal and oral swabs, and skin inspection were done daily,
but on a rotating basis so that any one animal was only bled every three days for the first 21 days p.i.
Subsequently, all animals were bled at scheduled termination (day 21 p.i.) and/or every two weeks
until termination of the experiment. Whole blood and plasma samples collected were aliquoted in
triplicate and immediately frozen at
−
80
◦
C for virus isolation and serology, including blocking ELISA
and VNTs (see later).
The animals were clinically assessed on a daily basis, with special attention to activity, growth
rate, and neurological signs. At day 21 p.i., 11 animals were terminated (three from the control group;
four from the 10
5
IU-group, three from the 10
4
IU-group and one from the 10
4
IU-in-contact group)
and subjected to necropsy and tissue sampling (see below). The remaining 29 animals were terminated
at three months p.i. (seven months of age) and also subjected to necropsy and tissue sampling.
2.5. RT-PCR, qRT-PCR and Sequencing
2.5.1. Water
Monthly water samples were collected from each treatment pen prior to infection and daily
post-infection. Water was collected in 60 mL syringes and pushed through a 0.45
µ
M nitrate cellulose
paper using a Swinnex
™
Filter Holder (Millipore, Merck, Bayswater, VIC, Australia). Viral RNA was
extracted from the filters by the RNeasy PowerWater Kit following the manufacturer’s instruction
(QIAGEN Pty Ltd, Chadstone Centre, VIC, Australia).
2.5.2. Cloacal and Oral Swabs
The throat and cloaca were swab sampled each time the animal was bled during the infection period.
The cotton tips were stored in 350
µ
L phosphate buffered gelatin saline (PBGS). For the extraction, the
cotton tip was lifted out of the PBGS and placed in a clean microcentrifuge tube. The extraction was
conducted using the RNeasy Plus Mini Kit (QIAGEN) following the manufacturer’s instruction for
tissue samples.
All extractions were qRT-PCR processed using a previously described WNV
KUN
detection
protocol [
19
], using the forward primer AACCCCAGTGGAGAAGTGGA, reverse primer TCAGGCT
GCCACACCAAA and probe 6FAM-CGATGTTCCATACTCTGG-MGB NFQ [25]. Using the Applied
Biosystems’ MicroAmp Fast 96-Well Reaction Plate and 7500 Fasr Real-Time PCR system, water extracts
were run against a WNVKUN standard (Table S2), while swabs were assessed for presence/absence of
viral RNA (cut-offat Ct ≥40 [19]).
2.5.3. Skin Samples
Skin sections, 4 mm
×
4 mm (or smaller) with suspect lesions, sampled at necropsy, were stored
in sterile vials at
−
80
◦
C until processing. The samples were then placed into a beater tube (cryovial
containing 0.3 g of 0.5 mm diameter Zirconia/silicon beads) with 900
µ
L of PBGS, beaten for 1 min
30 s on a Qiagen Tissue Lyser and centrifuged at 8000 rpm for 1 min. Using the manufacturer’s
instructions for the MagMAX-96 Viral RNA Isolation Kit (Applied Biosystems, Thermo Fisher Scientific
Australia Pty Ltd, Scoresby, VIC, Australia), 50
µ
L of the homogenized sample was processed for RNA
purification. The isolated RNA was subsequently stored at
−
80
◦
C until subjected to the qRT-PCR as
described above.
2.5.4. Plasma Samples
Crocodile plasma was diluted in AVE (molecular grade water with preservative from QIAGEN)
1:4 and viral RNA was extracted on EZ1 Advanced XL instrument (Qiagen, Hilden, Germany)
using the EZ1 Virus Mini Kit V 2.0 (Qiagen, Clifton Hill, Australia) according to the manufacturer’s

Viruses 2020,12, 198 6 of 21
instructions. For WNV
KUN
RNA detection, Superscript III Platinum one-step quantitative qRT-PCR
system (Invitrogen, Carlsbad, CA, USA) was used as per the manufacturer’s instructions and based on
the methods described by Pyke et al. [
19
] with minor modifications (primer and probe concentrations).
Primer and probe sequences were as described in the section on swab samples. Primers were used at a
final concentration of 900 nM, probe at 150 nM. Detection of WNV
KUN
specific RNA was performed in
20
µ
L reactions in a Rotor-Gene 600 real-time PCR cycler (Qiagen, Chadstone, VIC, Australia) with the
following cycling conditions: one cycle at 50
◦
C for 5 min, one cycle at 95
◦
C for 2 min, and 50 cycles at
95
◦
C for 3 s and 60
◦
C for 30 s. Separate synthetic controls for WNV
KUN
primers and probe and no
template controls were included in each Rotor-Gene run as per [
19
]. A standard curve was generated to
determine WNV
KUN
IU equivalents from plasma qRT-PCR CT scores. Ten-fold dilutions of WNV
KUN
(10
−1
to 10
−7
) were simultaneously assessed for infectious titre by TCID
50
assay (see Section 2.6) and
levels of viral RNA by Taqman qRT-PCR. An exponential trend line was generated from the derived Ct
scores and calculated IU of the standard dilution series using the Excel Growth Function. Infectious
unit equivalents were then predicted for each plasma sample from their derived Ct scores (Figure S1).
2.6. Virus Isolation and Titration
Infectious virus titers in blood were determined by the TCID
50
method as previously described [
16
].
Briefly, C6/36 cells were seeded in maintenance RPMI culture media supplemented with 5% FBS, 50
U
·
mL
−1
penicillin, 50
µ
g
·
mL
−1
streptomycin, and 2 mM l-glutamine into each well of a 96-well tissue
culture plate (Costar, Corning) and incubated overnight at 28
◦
C, at which stage the cell monolayers
were at 80% confluency. Plasma or whole blood samples were diluted in 10-fold serial dilutions in
RPMI with 2% FBS, 50 U mL
−1
penicillin, 50
µ
g
·
mL
−1
streptomycin, and 2 mM l-glutamine. Fifty
µ
L of the diluted samples were transferred in triplicate onto the subconfluent C6/36 cell monolayer
and the plates were incubated at 28
◦
C. After five days, the cultures were terminated by discarding
the supernatant or transferring it into a new 96-well plate and storing at 4
◦
C pending the fixed cell
ELISA results. The cells were fixed overnight with 20% acetone supplemented with 0.02% bovine
serum albumen (BSA) at 4
◦
C. The fixative was then discarded, and plates dried overnight at room
temperature before fixed cell ELISA was performed using monoclonal antibody (mAb) 4G2 (specific
for the flavivirus E protein) and or 4G4 (specific for epitope on the viral NS1 protein) as previously
described [16].
2.7. Histopathology and Immunohistochemistry (IHC)
Samples were harvested immediately after euthanasia from all major organs and tissues, including
brain, eyes, lungs, heart, liver, kidneys, spleen, gastrointestinal tract (multiple segments), tongue,
skeletal muscle and skin, and fixed in 10% neutral buffered formalin solution for 48 hours before being
transferred into 70% ethanol for storage until trimming and routine processing for paraffin embedding.
Bone-containing specimens were decalcified by incubation in 8% formic acid for five days prior to
trimming and paraffin embedding. Four micrometer thick sections were stained with hematoxylin and
eosin and examined on a Nikon Eclipse 51 E microscope. Digital microphotographs were taken using
a Nikon DS-Fi1 camera with a DS-U2 unit and NIS elements F 4.60 software. Images are reproduced
without manipulations other than cropping and adjustment of light intensity.
Serial sections (4
µ
m) were cut from formaldehyde-fixed, paraffin-embedded samples and subjected
to IHC-labeling as previously described in detail [
26
]. Briefly, following deparaffinization, antigen
retrieval (EDTA, pH 9) and several blocking steps, the sections were incubated with the flavivirus
NS1-specific mouse mAb 4G4 or a mixture of 4G4 and the E-protein specific mAb 4G2 as primary
antibody followed by visualization of the binding using the DAKO Envision kit, specific for mouse
immunoglobulin (Agilent Technologies). A positive control (brain sections from mice experimentally
infected with WNV
NSW2011
[
16
]) was included in every IHC-batch performed. The sections were
counterstained with Meyer’s hematoxylin and examined on a Nikon Eclipse 51 E microscope. Digital
micrographs were generated as described above.

Viruses 2020,12, 198 7 of 21
2.8. Serology
Quantification of anti-WNV specific antibodies was performed by two methods: blocking-ELISA [
26
]
and microneutralization assay [
16
,
27
]. The blocking-ELISA protocol has been described extensively in
previous publications [
16
,
26
,
27
]. The current assay used lysate from C6/36 cells infected with WNV
KUN
strain MRM61C as the coating antigen. Monoclonal antibodies used for these competitive assays were
either an anti-flavivirus envelope monoclonal antibody, 6B6C-1, or an anti-WNV NS1 specific monoclonal
antibody, 3.1112G [
27
,
28
]. A cut-off of 30% inhibition was used to determine positive samples [
27
]. Western
blot for detection of serum antibody specificities for WNV proteins was performed as described [
16
], but
using goat anti-alligator immunoglobulin (Novus Biologicals, Centennial, Colorado) and fluorophore
680-conjugated rabbit anti-goat-immunoglobulin.
3. Results
3.1. Isolation of WNVKUN from Skin Lesions and Plasma
Multiple attempts at isolating WNV from skin lesions and plasma of naturally infected crocodiles and
from mosquitoes caught at affected crocodile farms were made, but all were negative. Similarly, attempts
at detecting viral antigen (E protein or NS1) in skin lesions of naturally infected saltwater crocodiles
have so far been unsuccessful despite the proven sensitivity of this approach [
16
,
26
,
29
]. Nevertheless, by
RNA-extraction and RT-PCR, WNV genomic material was detected in several skin lesions from naturally
infected crocodiles [
12
]. Animals with skin lesions also had WNV-specific antibodies that reacted strongly
to WNV-antigens in Western blot (Figure 1A) and in ELISA or VNT (Figure 1B).
Viruses 2020, 12, 198 7 of 22
2.8. Serology
Quantification of anti-WNV specific antibodies was performed by two methods: blocking-ELISA
[26] and microneutralization assay [16,27]. The blocking-ELISA protocol has been described
extensively in previous publications [16,26,27]. The current assay used lysate from C6/36 cells
infected with WNVKUN strain MRM61C as the coating antigen. Monoclonal antibodies used for these
competitive assays were either an anti-flavivirus envelope monoclonal antibody, 6B6C-1, or an anti-
WNV NS1 specific monoclonal antibody, 3.1112G [27,28]. A cut-off of 30% inhibition was used to
determine positive samples [27]. Western blot for detection of serum antibody specificities for WNV
proteins was performed as described [16], but using goat anti-alligator immunoglobulin (Novus
Biologicals, Centennial, Colorado) and fluorophore 680-conjugated rabbit anti-goat-
immunoglobulin.
3. Results
3.1. Isolation of WNVKUN from Skin Lesions and Plasma
Multiple attempts at isolating WNV from skin lesions and plasma of naturally infected
crocodiles and from mosquitoes caught at affected crocodile farms were made, but all were negative.
Similarly, attempts at detecting viral antigen (E protein or NS1) in skin lesions of naturally infected
saltwater crocodiles have so far been unsuccessful despite the proven sensitivity of this approach
[16,26,29]. Nevertheless, by RNA-extraction and RT-PCR, WNV genomic material was detected in
several skin lesions from naturally infected crocodiles [12]. Animals with skin lesions also had WNV-
specific antibodies that reacted strongly to WNV-antigens in Western blot (Figure 1a) and in ELISA
or VNT (Figure 1b).
Figure 1. Antibody responses in farmed saltwater crocodiles with (184818, 184821) and without “pix”
skin lesions. (A) Western blot using serum samples from crocodiles presenting with skin lesions and
lesion-free animals from the same farm were used to probe WNVKUN (strain MRM61C) cell lysate (+)
or mock-infected cell lysate (−). Signal for envelope (E) and pre-membrane (prM) proteins are
observed at approximate molecular weights of 50 and 20 kDa, respectively. WNVKUN-reactive horse
serum was used as positive control. (B) Reactivity of the same serum samples in virus neutralisation
test (VNT) and blocking ELISA. POS—positive, NEG—negative.
Figure 1. Antibody responses in farmed saltwater crocodiles with (184818, 184821) and without “pix”
skin lesions. (
A
) Western blot using serum samples from crocodiles presenting with skin lesions and
lesion-free animals from the same farm were used to probe WNV
KUN
(strain MRM61C) cell lysate (+)
or mock-infected cell lysate (
−
). Signal for envelope (E) and pre-membrane (prM) proteins are observed
at approximate molecular weights of 50 and 20 kDa, respectively. WNV
KUN
-reactive horse serum was
used as positive control. (
B
) Reactivity of the same serum samples in virus neutralisation test (VNT)
and blocking ELISA. POS—positive, NEG—negative.

Viruses 2020,12, 198 8 of 21
3.2. Sequence Analysis of Virus RNA from Skin Lesions
The RNA from one of the skin lesions positive for WNV
KUN
by RT-PCR was analysed by next-
generation sequencing. From the data produced, only 222 reads corresponded to WNV, and did not
cover the whole genome. We therefore designed primers to amplify large fragments from additional
samples (D17, D63, D68, D117) by high-fidelity one-step RT-PCR, and Sanger-sequenced the missing
sections. This allowed us to obtain a composite consensus sequence that covered the whole genome,
despite some sequence variation between samples (Genbank accession number pending). The translated
sequence obtained was included in a complete ORF comparison with the prototype WNV
KUN
strain
(MRM61C), the NSW2011 strain of WNV
KUN
and WNV
NY99
. WNV
NSW2011
(JN887352) was the most
closely related strain to the crocodile-derived composite sequence, with a maximum 13 amino acid
changes over the ORF (Table 2and Figure 2). The amino acids for multiple WNV strains at these
13 positions are listed in Table 2and cross-referenced with previously published data on virulence
determinants for WNVNY99 [6,30].
Table 2.
Comparison of amino acid sequences between the crocodile-derived WNV RNA and three
previously described WNV strains over the 13 amino acid positions that differed between WNV
KUN
(strain NSW2011) and the crocodile-derived WNV sequence.
Position in
Polyprotein 1Protein Position
in Protein WNVny99 WNVkun
(mrm61c)
WNVkun
(nsw2011)
Crocodile-Derived
WNV
nt Position in
Assembly
20 C 20 G G G E104
108 prM 3 K K R K 404
166 prM 61 Y H Y H 578
207 prM 102 T T T A701
837 NS1 46 I I V I 2591
1026 NS1 235 G G G E3158
1192 NS2A 49 I I I V 3656
1355 NS2A 212 L F F L4145
1719 NS3 214 N N N S 5237
2210 NS4A 86 V V V I 6710
2683 NS5 155 E E E Q 8129
2797 NS5 269 K K K R 8471
2978 NS5 450 H H H Y 9014
1
Amino acid position numbers highlighted in red-brown are differences from WNV
NSW2011
which are predicted to
have an influence on protein structure or function.
3.3. WNVKUN Replication in C. porosus Derived Cell Lines
Since we were unsuccessful in obtaining a field isolate of the WNV circulating amongst crocodiles,
an infectious clone was generated based on the crocodile-derived viral amino acid sequence described
above. However, it was subsequently found that this infectious clone grew poorly or not at all in
crocodile-derived cells. Furthermore, given the minor sequence differences present in the viral genomes
obtained from different crocodile skin lesions compared to the NSW2011 strain of WNV
KUN
, it was
decided to use this virus for all subsequent
in vitro
and
in vivo
studies, as it is a well-characterized,
recent and low-passage isolate [4,6].

Viruses 2020,12, 198 9 of 21
Viruses 2020, 12, 198 9 of 22
Figure 2. Phylogeny of the C. porosus-derived WNV strain (Genbank accession number: MN954648).
This maximum likelihood phylogeny was built from a nucleotide alignement of the whole genome of
67 WNV sequences and one Murray Valley Encephalitis virus (NC_000943) sequence used as an
outgroup, using MrBayes 3.2.6 in Geneious 8.1.9. The branch labels represent the posterior probability
and the scale bar represents the substitutions per site.
3.3. WNVKUN Replication in C. porosus Derived Cell Lines
Since we were unsuccessful in obtaining a field isolate of the WNV circulating amongst
crocodiles, an infectious clone was generated based on the crocodile-derived viral amino acid
sequence described above. However, it was subsequently found that this infectious clone grew poorly
or not at all in crocodile-derived cells. Furthermore, given the minor sequence differences present in
the viral genomes obtained from different crocodile skin lesions compared to the NSW2011 strain of
WNVKUN, it was decided to use this virus for all subsequent in vitro and in vivo studies, as it is a well-
characterized, recent and low-passage isolate [4,6].
To assess replication of WNVKUN in crocodile cells we infected liver- (LV-1) and kidney- (3CPK)
derived cell lines with WNVKUN (NSW2011) and the prototype WNVKUN strain (MRM61C) at a MOI
of 0.1. For comparison, we also infected mosquito cells (C6/36) and mammalian cells (Vero) with these
viruses and assessed titres at 120 hours post infection (hpi). While virus yield was lower in the
crocodile cell lines compared to mosquito and mammalian cell culture (Figure 3), it should be noted
that the crocodile cells replicate extremely slowly [17], indicating a potentially lower metabolic rate
(G.H., W.W.S and H.B.O., unpublished data). When compared to avian cells (DF-1), the NSW2011
WNVKUN strain replicated to a slightly lower titre in 1-LV cells, but due to the lesser cytopathic effect
in the LV-1 cells, replication was still detectable at 14 dpi. (Figure 4). In contrast, the DF-1 cells
displayed marked cytopathic effect and viral titers dropped precipitously from a peak at 4 dpi, likely
Figure 2.
Phylogeny of the C. porosus-derived WNV strain (Genbank accession number: MN954648).
This maximum likelihood phylogeny was built from a nucleotide alignement of the whole genome
of 67 WNV sequences and one Murray Valley Encephalitis virus (NC_000943) sequence used as an
outgroup, using MrBayes 3.2.6 in Geneious 8.1.9. The branch labels represent the posterior probability
and the scale bar represents the substitutions per site.
To assess replication of WNV
KUN
in crocodile cells we infected liver- (LV-1) and kidney- (3CPK)
derived cell lines with WNV
KUN
(NSW2011) and the prototype WNV
KUN
strain (MRM61C) at a MOI
of 0.1. For comparison, we also infected mosquito cells (C6/36) and mammalian cells (Vero) with
these viruses and assessed titres at 120 hours post infection (hpi). While virus yield was lower in the
crocodile cell lines compared to mosquito and mammalian cell culture (Figure 3), it should be noted
that the crocodile cells replicate extremely slowly [
17
], indicating a potentially lower metabolic rate
(G.H., W.W.S and H.B.O., unpublished data). When compared to avian cells (DF-1), the NSW2011
WNV
KUN
strain replicated to a slightly lower titre in 1-LV cells, but due to the lesser cytopathic effect in
the LV-1 cells, replication was still detectable at 14 dpi. (Figure 4). In contrast, the DF-1 cells displayed
marked cytopathic effect and viral titers dropped precipitously from a peak at 4 dpi, likely due to a
combination of decreasing number of viable cells and thermal inactivation of the virus (Figure 4).

Viruses 2020,12, 198 10 of 21
Viruses 2020, 12, 198 10 of 22
due to a combination of decreasing number of viable cells and thermal inactivation of the virus
(Figure 4).
Figure 3. Comparison of virus replication in mosquito (C6/36), mammalian (Vero) and crocodile (1-
LV, 3-CPK) cell lines.
Figure 4. Comparison of WNV
KUN
replication in crocodile cells (1-LV) versus avian cells (DF-1) during
a two-week period. Cells were infected at a MOI = 1 and triplicate wells were terminated at the
indicated time points and tested individually for viable virus by TCID
50
-assay in C6/36 mosquito cells.
Stippled line indicates limit of detection.
3.4. Experimental WNV-Infection in Hatchling C. porosus
3.4.1. Clinical Observations
No adverse effects of the virus inoculation or blood samplings were observed in any of the
hatchlings, and the animals appeared to grow at the expected rate. At no stage during the observation
period were overt clinical signs, such as neurological disease, observed. Seven animals in the virus-
infected groups developed small, WNV-like skin lesions (“pix"; Figure 5a). These were sampled at
necropsy and subjected to either microscopic examination or RT-PCR for viral RNA.
3.4.2. Gross and Histopathology
Histologically, the skin lesions appeared as noted for natural WNV-infections (Figure 5b) [12].
No frank gross lesions, apart from the skin-lesions, were observed at necropsy. Histologically, the
only changes seen were development of lymphofollicular aggregates in various tissues (summarized
in Table S3), notably in the subepithelial layers of the tongue and conjunctiva and in the submucosa
of the gastrointestinal tract, more rarely in the kidneys and liver. In the tongue, the lymphoid
Figure 3.
Comparison of virus replication in mosquito (C6/36), mammalian (Vero) and crocodile (1-LV,
3-CPK) cell lines.
Viruses 2020, 12, 198 10 of 22
due to a combination of decreasing number of viable cells and thermal inactivation of the virus
(Figure 4).
Figure 3. Comparison of virus replication in mosquito (C6/36), mammalian (Vero) and crocodile (1-
LV, 3-CPK) cell lines.
Figure 4. Comparison of WNV
KUN
replication in crocodile cells (1-LV) versus avian cells (DF-1) during
a two-week period. Cells were infected at a MOI = 1 and triplicate wells were terminated at the
indicated time points and tested individually for viable virus by TCID
50
-assay in C6/36 mosquito cells.
Stippled line indicates limit of detection.
3.4. Experimental WNV-Infection in Hatchling C. porosus
3.4.1. Clinical Observations
No adverse effects of the virus inoculation or blood samplings were observed in any of the
hatchlings, and the animals appeared to grow at the expected rate. At no stage during the observation
period were overt clinical signs, such as neurological disease, observed. Seven animals in the virus-
infected groups developed small, WNV-like skin lesions (“pix"; Figure 5a). These were sampled at
necropsy and subjected to either microscopic examination or RT-PCR for viral RNA.
3.4.2. Gross and Histopathology
Histologically, the skin lesions appeared as noted for natural WNV-infections (Figure 5b) [12].
No frank gross lesions, apart from the skin-lesions, were observed at necropsy. Histologically, the
only changes seen were development of lymphofollicular aggregates in various tissues (summarized
in Table S3), notably in the subepithelial layers of the tongue and conjunctiva and in the submucosa
of the gastrointestinal tract, more rarely in the kidneys and liver. In the tongue, the lymphoid
Figure 4.
Comparison of WNV
KUN
replication in crocodile cells (1-LV) versus avian cells (DF-1) during
a two-week period. Cells were infected at a MOI =1 and triplicate wells were terminated at the
indicated time points and tested individually for viable virus by TCID
50
-assay in C6/36 mosquito cells.
Stippled line indicates limit of detection.
3.4. Experimental WNV-Infection in Hatchling C. porosus
3.4.1. Clinical Observations
No adverse effects of the virus inoculation or blood samplings were observed in any of the hatchlings,
and the animals appeared to grow at the expected rate. At no stage during the observation period
were overt clinical signs, such as neurological disease, observed. Seven animals in the virus-infected
groups developed small, WNV-like skin lesions (“pix”; Figure 5a). These were sampled at necropsy and
subjected to either microscopic examination or RT-PCR for viral RNA.
3.4.2. Gross and Histopathology
Histologically, the skin lesions appeared as noted for natural WNV-infections (Figure 5b) [
12
]. No
frank gross lesions, apart from the skin-lesions, were observed at necropsy. Histologically, the only
changes seen were development of lymphofollicular aggregates in various tissues (summarized in
Table S3), notably in the subepithelial layers of the tongue and conjunctiva and in the submucosa of
the gastrointestinal tract, more rarely in the kidneys and liver. In the tongue, the lymphoid aggregates

Viruses 2020,12, 198 11 of 21
were mostly surrounding small nerve bundles associated with sensory organs (taste/touch sensors), as
was also the case in the skin lesions (Figure 5b,c).
Viruses 2020, 12, 198 11 of 22
Figure 5. Representative gross and histopathological changes in experimentally WNV-infected C.
porosus hatchlings. (a) Typical WNV-induced skin lesion (“pix”; enlarged in insert); (b) Microscopic
appearance of a typical “pix” lesion; (c) Lymphofollicular aggregate in subepithelial layers of the oral
cavity; (d) Lymphofollicular aggregate in the adrenal gland.
3.4.3. Virus Detection by qRT-PCR, Isolation and Immunohistochemistry
By inoculation of plasma samples on C6/36 mosquito cells, viremia was detected on days 2–5 in
WNV-challenged animals but not in-contact animals (Table 3). For a small subset of animals, virus
isolation and titrations were performed on both whole blood and on plasma, with the former possibly
being slightly more sensitive as also seen for other flaviviruses [31]. However, all samples displayed
some level of cytotoxicity at the lowest dilutions tested and therefore the limit of detection was
relatively high (2–3 log10 TCID50/mL; Figure 6). It is thus possible that there are false negative samples
in the set and, that the actual period of viremia was longer as suggested by the qRT-PCR results which
showed intermittent plasma viremia in the virus challenged animals out to 17 dpi (Figures 7, S2 and
Table S4).
Low levels of WNVKUN RNA were detected by qRT-PCR in three “pix” lesions tested by this
approach. The Ct-scores ranged from 26.16 to 31.35, equivalent to approaximately 102 TCID50/sample
(refer to Table S2 for conversion).
Figure 5.
Representative gross and histopathological changes in experimentally WNV-infected C. porosus
hatchlings. (
a
) Typical WNV-induced skin lesion (“pix”; enlarged in insert); (
b
) Microscopic appearance
of a typical “pix” lesion; (
c
) Lymphofollicular aggregate in subepithelial layers of the oral cavity;
(d) Lymphofollicular aggregate in the adrenal gland.
3.4.3. Virus Detection by qRT-PCR, Isolation and Immunohistochemistry
By inoculation of plasma samples on C6/36 mosquito cells, viremia was detected on days 2–5 in
WNV-challenged animals but not in-contact animals (Table 3). For a small subset of animals, virus
isolation and titrations were performed on both whole blood and on plasma, with the former possibly
being slightly more sensitive as also seen for other flaviviruses [
31
]. However, all samples displayed
some level of cytotoxicity at the lowest dilutions tested and therefore the limit of detection was relatively
high (2–3 log
10
TCID
50
/mL; Figure 6). It is thus possible that there are false negative samples in the set
and, that the actual period of viremia was longer as suggested by the qRT-PCR results which showed
intermittent plasma viremia in the virus challenged animals out to 17 dpi (Figure 7, Figure S2 and
Table S4).
Low levels of WNV
KUN
RNA were detected by qRT-PCR in three “pix” lesions tested by this
approach. The Ct-scores ranged from 26.16 to 31.35, equivalent to approaximately 10
2
TCID
50
/sample
(refer to Table S2 for conversion).

Viruses 2020,12, 198 12 of 21
Table 3.
Detection of viremia in WNV-challenged and in-contact hatchling crocodiles by inoculation of
C6/36 cells with plasma (positive/tested).
Group Day p.i.
0 1 2 3 4 5 6 7 8 9
105IU 0/10 0/3 1/4 1/3 1/3 2/4 0/3 0/3 0/2 0/3
105IU in-contact 0/6 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2 0/2
104IU 0/11 0/3 0/4 0/4 0/3 3/4 0/4 0/3 0/2 0/4
104IU in-contact 0/6 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2
Control 0/7 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2
Viruses 2020, 12, 198 12 of 22
Table 3. Detection of viremia in WNV-challenged and in-contact hatchling crocodiles by inoculation
of C6/36 cells with plasma (positive/tested).
Group Day p.i.
0 1 2 3 4 5 6 7 8 9
10
5
IU 0/10 0/3 1/4 1/3 1/3 2/4 0/3 0/3 0/2 0/3
10
5
IU in-contact 0/6 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2 0/2
10
4
IU 0/11 0/3 0/4 0/4 0/3 3/4 0/4 0/3 0/2 0/4
10
4
IU in-contact 0/6 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2
Figure 6. Viral titres in plasma from hatchling saltwater crocodiles following experimental WNV
KUN
challenge. Stippled line indicates limit of detection.
Figure 7. Quantification of WNV
KUN
RNA in plasma from hatchling saltwater crocodiles following
experimental WNV
KUN
challenge or in-pen contact animals determined by qRT-PCR (limit of
detection 10 TCID
50
/mL at Ct = 39; see Figure S1 and Table S4).
Figure 6. Viral titres in plasma from hatchling saltwater crocodiles following experimental WNVKUN
challenge. Stippled line indicates limit of detection.
Viruses 2020, 12, 198 12 of 22
Table 3. Detection of viremia in WNV-challenged and in-contact hatchling crocodiles by inoculation
of C6/36 cells with plasma (positive/tested).
Group Day p.i.
0 1 2 3 4 5 6 7 8 9
10
5
IU 0/10 0/3 1/4 1/3 1/3 2/4 0/3 0/3 0/2 0/3
10
5
IU in-contact 0/6 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2 0/2
10
4
IU 0/11 0/3 0/4 0/4 0/3 3/4 0/4 0/3 0/2 0/4
10
4
IU in-contact 0/6 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2
Control 0/7 0/2 0/2 0/2 0/2 0/2 0/2 0/2 0/1 0/2
Figure 6. Viral titres in plasma from hatchling saltwater crocodiles following experimental WNV
KUN
challenge. Stippled line indicates limit of detection.
Figure 7. Quantification of WNV
KUN
RNA in plasma from hatchling saltwater crocodiles following
experimental WNV
KUN
challenge or in-pen contact animals determined by qRT-PCR (limit of
detection 10 TCID
50
/mL at Ct = 39; see Figure S1 and Table S4).
Figure 7.
Quantification of WNV
KUN
RNA in plasma from hatchling saltwater crocodiles following
experimental WNV
KUN
challenge or in-pen contact animals determined by qRT-PCR (limit of detection
10 TCID50/mL at Ct =39; see Figure S1 and Table S4).

Viruses 2020,12, 198 13 of 21
Water samples were collected from the pens prior to cleaning, once per month before the
experimental period and daily during the experimental period, and tested by RT-PCR. Notably,
WNV
KUN
genomic material was detected in the water from the pens holding the virus-challenged
hatchlings on multiple sampling days, but not in the pen holding the control hatchlings (Figure 8).
Viruses 2020, 12, 198 13 of 22
Water samples were collected from the pens prior to cleaning, once per month before the
experimental period and daily during the experimental period, and tested by RT-PCR. Notably,
WNV
KUN
genomic material was detected in the water from the pens holding the virus-challenged
hatchlings on multiple sampling days, but not in the pen holding the control hatchlings (Figure 8).
Figure 8. WNV
KUN
RNA detection in pen water by qRT-PCR. Data are shown as TCID
50
-equivalents.
Pen water was collected daily just prior to cleaning of the pen and RNA isolated from filters following
filtration of 60 mL of water.
Swabs from the oral cavity and cloaca were taken prior to infection and at each blood sampling
thereafter, i.e., eight samplings per hatchling. WNV was first detected in both the oral and cloacal
swabs on day 3 p.i. in the 10
5
IU challenged crocodiles. Similarly, WNV
KUN
was detected in the oral
swabs of 10
4
IU challenged hatchlings at 3 dpi, but was not recovered from the cloacal swabs until 5
dpi. Oral swabs of in-contact crocodiles were first WNV
KUN
-positive on days 7 and 11 p.i. for the 10
4
IU and 10
5
IU challenged groups, respectively, and days 5 and 10 p.i. for cloacal swabs (Figures 9,
10), although at the later time points, i.e., past day 15 p.i., the levels were low as judged by the Ct
scores and no longer detectable in the pen water (Figure 8). In the 10
5
IU group, all hatchlings had
WNV-RNA-positive oral swabs on 2–6 of the eight samplings, while cloacal swabs were positive on
1–5 samplings per animal, with one animal being consistently negative. All six in-contact animals in
the 10
5
IU-pen had RNA-positive swabs on 1–3 samplings, while only four had positive cloacal swabs.
In the 10
4
IU challenged group, 10 of the animals had 1–5 virus RNA-positive oral swabs and all had
RNA-positive cloacal swabs on 1–5 samplings. All in-pen contact animals in this cohort had 1–3
positive oral swabs and five had 1–4 RNA-positive cloacal swabs. Notably, positive oral and cloacal
swabs were detected in both the 10
5
and 10
4
IU pens up to six days after the last positive tank-water-
positive sample on day 15 of the experiment (Figure 8), suggesting that the viral RNA detected in the
swabs was not just contamination from the pen water.
Figure 8.
WNV
KUN
RNA detection in pen water by qRT-PCR. Data are shown as TCID
50
-equivalents.
Pen water was collected daily just prior to cleaning of the pen and RNA isolated from filters following
filtration of 60 mL of water.
Swabs from the oral cavity and cloaca were taken prior to infection and at each blood sampling
thereafter, i.e., eight samplings per hatchling. WNV was first detected in both the oral and cloacal
swabs on day 3 p.i. in the 10
5
IU challenged crocodiles. Similarly, WNV
KUN
was detected in the oral
swabs of 10
4
IU challenged hatchlings at 3 dpi, but was not recovered from the cloacal swabs until 5
dpi. Oral swabs of in-contact crocodiles were first WNV
KUN
-positive on days 7 and 11 p.i. for the
10
4
IU and 10
5
IU challenged groups, respectively, and days 5 and 10 p.i. for cloacal swabs (Figures 9
and 10), although at the later time points, i.e., past day 15 p.i., the levels were low as judged by the Ct
scores and no longer detectable in the pen water (Figure 8). In the 10
5
IU group, all hatchlings had
WNV-RNA-positive oral swabs on 2–6 of the eight samplings, while cloacal swabs were positive on
1–5 samplings per animal, with one animal being consistently negative. All six in-contact animals
in the 10
5
IU-pen had RNA-positive swabs on 1–3 samplings, while only four had positive cloacal
swabs. In the 10
4
IU challenged group, 10 of the animals had 1–5 virus RNA-positive oral swabs
and all had RNA-positive cloacal swabs on 1–5 samplings. All in-pen contact animals in this cohort
had 1–3 positive oral swabs and five had 1–4 RNA-positive cloacal swabs. Notably, positive oral and
cloacal swabs were detected in both the 10
5
and 10
4
IU pens up to six days after the last positive
tank-water-positive sample on day 15 of the experiment (Figure 8), suggesting that the viral RNA
detected in the swabs was not just contamination from the pen water.

Viruses 2020,12, 198 14 of 21
Viruses 2020, 12, 198 14 of 22
Figure 9. Proportion (%) of oral swabs positive for WNV RNA as determined by qRT-PCR with a cut-
off of Ct ≥ 40 [19]. Two in-contact hatchlings and three or four inoculated animals were sampled and
tested each day.
Figure 9.
Proportion (%) of oral swabs positive for WNV RNA as determined by qRT-PCR with a
cut-offof Ct
≥
40 [
19
]. Two in-contact hatchlings and three or four inoculated animals were sampled
and tested each day.
The WNV-like skin lesions (pix) that developed in three of the virus-challenged crocodiles
(Figure 5) were confirmed to be WNV
KUN
-positive by RT-PCR, but no viral antigen was detected in
those lesions subjected to IHC. A large number of the tissue samples with lymphoid aggregates (see
Figure 5b,c,d) were also subjected to IHC for detection of WNV
KUN
NS1, a highly sensitive assay for
virus replication [
16
,
26
,
29
]. While the positive controls (brains from mice experimentally infected with
the NSW2011 isolate of WNV
KUN
had NS1 signal in neurons (red cells in Figure 11a), all samples from
the crocodiles terminated at day 21 p.i. and at the end of the study were negative for viral protein
(example in Figure 11b).

Viruses 2020,12, 198 15 of 21
Viruses 2020, 12, 198 15 of 22
Figure 10. Proportion (%) of cloacal swabs positive for WNV RNA as determinaed by qRT-PCR with
a cut-off of CT ≥ 40 [19]. Two in-contact hatchlings and three or four inoculated animals were sampled
and tested each day.
The WNV-like skin lesions (pix) that developed in three of the virus-challenged crocodiles
(Figure 5) were confirmed to be WNV
KUN
-positive by RT-PCR, but no viral antigen was detected in
those lesions subjected to IHC. A large number of the tissue samples with lymphoid aggregates (see
Figure 5b,c,d) were also subjected to IHC for detection of WNV
KUN
NS1, a highly sensitive assay for
virus replication [16,26,29]. While the positive controls (brains from mice experimentally infected
with the NSW2011 isolate of WNV
KUN
had NS1 signal in neurons (red cells in Figure 11a), all samples
from the crocodiles terminated at day 21 p.i. and at the end of the study were negative for viral protein
(example in Figure 11b).
Figure 10.
Proportion (%) of cloacal swabs positive for WNV RNA as determinaed by qRT-PCR with a
cut-offof CT
≥
40 [
19
]. Two in-contact hatchlings and three or four inoculated animals were sampled
and tested each day.
Viruses 2020, 12, 198 16 of 22
(a) (b)
Figure 11. Immunohistochemical detection of WNVKUN NS1, using mAb 4G4, in tissues from
experimentally infected animals. (a) Brain from mouse experimentally challenged with the NSW2011
isolate of WNVKUN [16] showing virus protein-positive neurons throughout the cerebrum (red cells).
(b) Lymphoid aggregate in the tongue of a hatchling crocodile 21 dpi with WNVKUN. No virus antigen-
positive cells are apparent in either the lymphoid aggregate, sublingual glands, endothelial cells or
the interstitial tissue fibrocytes.
3.4.4. Detection of WNVKUN-Specific Antibodies Pre- and Post-Infection
Pre-screening of the hatchlings for maternal antibodies (egg yolk-transmitted) specific for
WNVKUN was conducted by virus-neutralization test (VNT) at BVL, and only animals negative in the
VNT at 2–3 months of age were used for virus challenge. Two crocodiles with very low or query
WNVKUN antibody titers were assigned to the non-infected control group. These crocodiles showed
persistent low WNVKUN antibody titers for the entire 27 weeks of observation and were from the same
clutch of eggs.
Post-challenge antibody levels were assessed by a WNVKUN-specific and flavivirus group
reactive monoclonal blocking-ELISA (data not shown) and by VNT. All animals in the 104 IU group
developed WNVKUN-neutralizing antibodies (Figure 12), with most having detectable levels by 21 dpi.
Similarly, all but one animal in the 105 IU group developed neutralizing antibodies, albeit for most
delayed relative to the 104 IU group (Figure 12). In both groups, the titers continued to rise beyond
the time of detectable viremia and cloacal virus shedding, suggestive of a persistent source of viral
antigen. Notably, three in-contact animals (one in the 104 IU and two in the 105 IU group, respectively)
seroconverted—first detectable eight weeks after the experimental infections but then with
continuing rising titers throughout the remainder of the experimental period (Figure 12).
Figure 11.
Immunohistochemical detection of WNV
KUN
NS1, using mAb 4G4, in tissues from experimentally
infected animals. (
a
) Brain from mouse experimentally challenged with the NSW2011 isolate of WNV
KUN
[
16
]
showing virus protein-positive neurons throughout the cerebrum (red cells). (
b
) Lymphoid aggregate in
the tongue of a hatchling crocodile 21 dpi with WNV
KUN
. No virus antigen-positive cells are apparent
in either the lymphoid aggregate, sublingual glands, endothelial cells or the interstitial tissue fibrocytes.

Viruses 2020,12, 198 16 of 21
3.4.4. Detection of WNVKUN-Specific Antibodies Pre- and Post-Infection
Pre-screening of the hatchlings for maternal antibodies (egg yolk-transmitted) specific for WNV
KUN
was conducted by virus-neutralization test (VNT) at BVL, and only animals negative in the VNT at
2–3 months of age were used for virus challenge. Two crocodiles with very low or query WNV
KUN
antibody titers were assigned to the non-infected control group. These crocodiles showed persistent
low WNV
KUN
antibody titers for the entire 27 weeks of observation and were from the same clutch
of eggs.
Post-challenge antibody levels were assessed by a WNV
KUN
-specific and flavivirus group reactive
monoclonal blocking-ELISA (data not shown) and by VNT. All animals in the 10
4
IU group developed
WNV
KUN
-neutralizing antibodies (Figure 12), with most having detectable levels by 21 dpi. Similarly,
all but one animal in the 10
5
IU group developed neutralizing antibodies, albeit for most delayed
relative to the 10
4
IU group (Figure 12). In both groups, the titers continued to rise beyond the
time of detectable viremia and cloacal virus shedding, suggestive of a persistent source of viral
antigen. Notably, three in-contact animals (one in the 10
4
IU and two in the 10
5
IU group, respectively)
seroconverted—first detectable eight weeks after the experimental infections but then with continuing
rising titers throughout the remainder of the experimental period (Figure 12).
Viruses 2020, 12, 198 17 of 22
Figure 12. WNVKUN-neutralizing antibody responses in experimentally infected hatchling saltwater
crocodiles and in the in-pen contact animals. For the first 21 dpi, each animal was bled every third
day. At the later time points (after 40 dpi), all remaining animals were bled on each occasion.
4. Discussion
We have presented data that confirm that WNV does indeed cause characteristic skin lesions,
so-called “pix”, in a subset of infected saltwater crocodiles within a few weeks of infection and that
at least some of the infected animals sustain a viremia at a level sufficient for transmission to biting
mosquitoes [32]. Moreover, we have demonstrated that the virus is shed into the water, likely via
fecal material, where it can spread to in-contact animals, presumably via mucosal infection—either
fecal-oral or via other exposed mucosal surfaces such as conjunctiva or the nasal cavity. Regardless
of viral challenge dose, WNV-neutralizing antibodies appeared in the directly challenged animals
around 21 dpi, at which time viremia had ceased as determined by qRT-PCR, but cloacal shedding
may still have taken place (Figure S2). The in-pen controls, that became infected, developed WNV-
neutralizing antibodies detectable around six weeks into the experiment. Viremia was detected in the
in-contact animals by RT-PCR on plasma samples between day 11 and 21, suggesting that these
animals received a much lower infection dose (via the mucosal route) than that of the inocula
resulting in a different transmission-clearance dynamic and possibly different or additional antiviral
mechanisms involved [33–35]. The time of viremia in the in-contact animals does appear to correlate
with detection of virus genomic material in oral and cloacal swabs of the virus-challenged hatchlings
as well as in the pen-water (Figures 9,10,S2), but since tank-water was changed daily, there was no
actual build-up of infectious material. The in-contact animals would nevertheless have been
repeatedly exposed during that period and potentially re-infected until activated innate responses
[36] or virus-specific antibodies [35] interfered with this transmission route. The noted discrepancy
between viremia, as detected by virus isolation versus qRT-PCR (Table 3, Figures 6,7), suggests that
past 5 dpi virus in the plasma may have been in antibody–virus complexes [37] or toxicity of the
crocodile plasma may have resulted in false negative isolation results. This issue will be addressed in
future studies.
While WNV has been associated with severe disease outbreaks in both wild and farmed
American alligators in several USA states (reviewed in [8,10]), there are no reports of similar disease
outbreaks amongst crocodilians in other parts of the world, including Northern Australia and South-
East Asia, where C. porosus also occur. American alligators display clinical neurological signs and
suffer severe gastrointestinal lesions, including stomatitis and necrohemorrhagic enteritis following
infection with WNVNY99 [10]. High viral titers were detected in the liver of the alligators [32],
0 102030405060708090
16
32
64
128
256
512
1024
2048
4096
Days post infection
105 IU WNVNSW2011
challenge
in contact 105 IU
WNVNSW2011 challenge
104IU WNVNSW2011
challenge
in contact 104IU
WNVNSW2011 challenge
Uninfected control
Figure 12.
WNV
KUN
-neutralizing antibody responses in experimentally infected hatchling saltwater
crocodiles and in the in-pen contact animals. For the first 21 dpi, each animal was bled every third day.
At the later time points (after 40 dpi), all remaining animals were bled on each occasion.
4. Discussion
We have presented data that confirm that WNV does indeed cause characteristic skin lesions,
so-called “pix”, in a subset of infected saltwater crocodiles within a few weeks of infection and that
at least some of the infected animals sustain a viremia at a level sufficient for transmission to biting
mosquitoes [
32
]. Moreover, we have demonstrated that the virus is shed into the water, likely via
fecal material, where it can spread to in-contact animals, presumably via mucosal infection—either
fecal-oral or via other exposed mucosal surfaces such as conjunctiva or the nasal cavity. Regardless of
viral challenge dose, WNV-neutralizing antibodies appeared in the directly challenged animals around
21 dpi, at which time viremia had ceased as determined by qRT-PCR, but cloacal shedding may still
have taken place (Figure S2). The in-pen controls, that became infected, developed WNV-neutralizing
antibodies detectable around six weeks into the experiment. Viremia was detected in the in-contact

Viruses 2020,12, 198 17 of 21
animals by RT-PCR on plasma samples between day 11 and 21, suggesting that these animals
received a much lower infection dose (via the mucosal route) than that of the inocula resulting in a
different transmission-clearance dynamic and possibly different or additional antiviral mechanisms
involved [
33
–
35
]. The time of viremia in the in-contact animals does appear to correlate with detection
of virus genomic material in oral and cloacal swabs of the virus-challenged hatchlings as well as in
the pen-water (Figure 9, Figure 10 and Figure S2), but since tank-water was changed daily, there
was no actual build-up of infectious material. The in-contact animals would nevertheless have been
repeatedly exposed during that period and potentially re-infected until activated innate responses [
36
]
or virus-specific antibodies [
35
] interfered with this transmission route. The noted discrepancy between
viremia, as detected by virus isolation versus qRT-PCR (Table 3, Figures 6and 7), suggests that past 5 dpi
virus in the plasma may have been in antibody–virus complexes [
37
] or toxicity of the crocodile plasma
may have resulted in false negative isolation results. This issue will be addressed in future studies.
While WNV has been associated with severe disease outbreaks in both wild and farmed American
alligators in several USA states (reviewed in [
8
,
10
]), there are no reports of similar disease outbreaks
amongst crocodilians in other parts of the world, including Northern Australia and South-East Asia,
where C. porosus also occur. American alligators display clinical neurological signs and suffer severe
gastrointestinal lesions, including stomatitis and necrohemorrhagic enteritis following infection with
WNV
NY99
[
10
]. High viral titers were detected in the liver of the alligators [
32
], suggesting that some of
the virus detected in the cloacal swabs and water from this study might have originated from this organ
via bile secreted into the gastrointestinal tract. While we observed development of lymphofollicular
proliferations in various mucosal tissues as well as liver and kidney of the WNV
KUN
infected saltwater
crocodiles and virus RNA was detected in cloacal swabs and tank-water, no frank pathology was
observed in any of the tissues and organs examined. Furthermore, no viral antigen was detected in
association with these lymphoid aggregates using IHC. Thus, whether the presence of these lymphoid
proliferations reflects prior replication of virus in the sites or simply is a reflection of a stimulated
immune system in the infected animals cannot be established based on the present study. Future
studies should include daily tissue sampling of virus-challenged animals during at least the first 15
dpi, i.e., a kinetic study, and employ additional methodologies such as in situ hybridization, RT-PCR
and virus isolation from tissues.
The one commonality between WNV
NY99
infection in American alligators and WNV
KUN
infection
of saltwater crocodiles, is the development of typical skin lesions, “pix”, consisting of lymphohistiocytic
proliferations in the superficial dermis, with attenuation of the overlaying epidermal layers and
degeneration of the dermal collagen (Figure 5) [
10
–
12
]. Previous studies in alligators have failed to
detect virus in skin lesions, and while we have previously successfully detected WNV
KUN
viral RNA
in “pix” lesions from naturally infected saltwater crocodiles [
12
] and did so from a few lesions in the
experimental animals in this study, our attempts at isolating replication competent virus in cell culture
has so far been fruitless. Nor have we been able to detect viral nonstructural (NS1) or envelope (E)
protein expression by IHC in either these skin lesions or other tissues. However, the presence of viral
RNA in some of these lesions suggests that either the virus does indeed replicate in the site, albeit likely
only very early in the infection, or inactivated viral particles in dermal dendritic cells and macrophages
stimulate an in situ immune reaction, which persists long enough to cause permanent damage to the
dermis and resulting in grossly apparent “pix” lesions. Again, a kinetic study of the virus infection
with extensive sampling of animals may allow elucidation of this aspect.
Knowledge about the antiviral immune defenses in reptilians in general and crocodilians in
particular is still relatively limited [
36
], and the role of co-infections has so far not been systematically
explored. While the hatchlings used in this experiment were kept under strict quarantine conditions,
crocodiles in the wild and on farms are exposed to a plethora of other infectious agents, including
viral, fungal, bacterial and parasitic (reviewed in [
7
,
8
,
38
,
39
]), some of which, notably herpes-, rana-
and retroviruses, are known to affect the immune system profoundly [
40
–
42
]. While WNV
KUN
is less
virulent than WNV
NY99
, at least in horses, mice and birds [
6
,
16
,
26
], it may not be the only explanation

Viruses 2020,12, 198 18 of 21
for the dramatic difference in clinical outcomes of WNV infection in alligators and saltwater crocodiles,
respectively. The Kunjin strains of WNV have presumably circulated in Australia for a very long
time [
4
], and Australasia is host to an abundance of related flaviviruses, such as Murray Valley
encephalitis virus and Alfuy virus, that may confer some degree of cross-protection [
5
,
43
,
44
]. Hence,
C. porosus may have evolved innate immune defenses to this group of viruses, which ensures relatively
fast elimination of the virus without a severe inflammatory response. In contrast, WNV
NY99
is a
relatively newly introduced infectious agent in the Americas and native crocodilians may not have
been through a similar evolutionary pathway for this group of viruses. Notably, antibodies to St.
Louis encephalitis virus, a flavivirus circulating in southern USA and South America, have never
been detected in crocodilians [
7
,
8
,
45
]. Future studies of the host-virus interaction in WNV-infection
of crocodilians should therefore also focus on innate and adaptive antiviral defenses as well as the
potential role of co-infections and the gut microbiota [
8
,
46
,
47
]. In this study, we detected maternal
antibodies to WNV in a number of the clutches used, i.e., passive immunity acquired through the egg
yolk, which persisted beyond 4 months in a few animals. Other seeming clutch-effects noted related to
the kinetics of the infection-elicited antibody response and the development of “pix” lesions; however,
a study with larger group sizes will be required to determine whether a true immunogenetic influence
also play a role in the pathogenesis of the lesions.
5. Conclusions
While WNV
KUN
infection in saltwater crocodiles appears to be a relatively innocuous event, it
does have serious economic ramifications for tropical regions of Australia and South-East Asia, where
farming of C. porosus for the production of hides is an important and growing industry, benefitting
local communities and, interestingly enough, encouraging conservation efforts for this iconic apex
predator. It is therefore imperative that ways are found to prevent WNV-infection, at least in the
farm setting. While mosquito and bird management measures, notably the latter, may go some way
to address this, the fact that the virus is easily and efficiently transmitted horizontally between pen
mates via the water, suggests that vaccination is necessary to truly prevent transmission, whether by
mosquitoes or via water contact. In addition, if genetics indeed plays a role, then methodologies to
assess overall vulnerability of ranched stock to WNV “pix” lesions should be pursued.
Supplementary Materials:
The following are available online at http://www.mdpi.com/1999-4915/12/2/198/s1,
Table S1: Primers used for the “fill in” to attain the full-length genome sequence of the C. porosus derived
WNV strain. Table S2. Standard for estimation of TCID
50
-equivalents of WNV
KUN
in pen-water as determined
by qRT-PCR. Table S3: Summary of histopathological changes in tissues and organs from experimentally
WNV-infected hatchling saltwater crocodiles. Table S4. Plasma viremia as detected by qRT-PCR and converted to
TCID
50
equivalents. Figure S1. Standard curve to determine WNV
KUN
infectious unit equivalents from plasma
qRT-PCR CT scores. Figure S2. Relationship between virus detection and antibody development.
Author Contributions:
Conceptualization, H.B.-O., R.A.H., and S.R.I.; methodology, S.H.-M., J.M., G.H., N.N.,
J.B.; validation, G.H., J.M., A.M.G.C., S.S.D., S.H.-M., J.M., G.H., N.N., and J.B; formal analysis, G.H., J.M.,
A.M.G.C., S.D., S.H.-M., J.H.-P., R.A.H., S.R.I., and H.B.-O.; investigation, G.H., J.M., A.M.G.C., S.S.D, S.H.-M.,
C.A.O., W.W.S., and H.B.-O.; resources, S.R.I., L.M., J.H.-P., R.A.H and H.B.-O.; data curation, H.B.O. and S.R.I.;
writing—original draft preparation, H.B.-O.; writing—review and editing, all authors.; visualization, G.H, J.M.,
A.M.G.C., H.B.-O.; supervision, J.H.-P., W.W.S., S.H.-M., R.A.H., S.R.I., and H.B.-O.; project administration, S.R.I.
and L.M.; funding acquisition, S.R.I., R.A.H., S.H.-M., J.H.-P., L.M., G.H. and H.B.-O. All authors have read and
agreed to the published version of the manuscript.
Funding:
This research was funded by the Cooperative Research Centre for Developing Northern Australia
(CRC-DNA, 2018-20; S.R.I., L.M., J.H.P., S.H.-M., R.A.H., and H.B.O.) and the SVS 2019-20 Bequest Fund (H.B.-O.,
G.H.). G.H. is a recipient of an Australian Postgraduate Scholarship Award (2018-22).
Acknowledgments:
We are indebted to the Darwin Crocodile Farm management and stafffor providing access to
crocodile hatchlings and feed. We thank Cathy Shilton, Bridgette Primmer, Cameron Hokanson, Ayril Foster,
Neville Hunt, Rachel deAraujo and Nikki Elliott for technical input and advice.
Conflicts of Interest:
The authors declare no conflict of interest. The funders had no role in the design of the
study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to
publish the results.

Viruses 2020,12, 198 19 of 21
References
1.
Murgue, B.; Zeller, H.; Deubel, V. The ecology and epidemiology of West Nile virus in Africa, Europe and
Asia. Curr. Top. Microbiol. Immunol. 2002,267, 195–221.
2.
Hall, R.A. The emergence of West Nile virus: The Australian connection. Viral Immunol.
2000
,13, 447–461.
[CrossRef] [PubMed]
3.
Scherret, J.H.; Poidinger, M.; Mackenzie, J.S.; Broom, A.K.; Deubel, V.; Lipkin, W.I.; Gould, E.A.; Hall, R.A.
The relationships between West Nile and Kunjin viruses. Emerg. Infect. Dis.
2001
,7, 697–705. [CrossRef]
[PubMed]
4.
Prow, N.A.; Edmonds, J.H.; Williams, D.T.; Setoh, Y.X.; Bielefeldt-Ohmann, H.; Suen, W.W.; Hobson-Peters, J.;
van den Hurk, A.F.; Pyke, A.T.; Hall-Mendelin, S.; et al. Virulence and evolution of West Nile Virus, Australia,
1960–2012. Emerg. Infect. Dis. 2016,22, 1353–1362. [CrossRef] [PubMed]
5.
Hall, R.A.; Broom, A.K.; Smith, D.W.; Mackenzie, J.S. The ecology and epidemiology of Kunjin virus. Curr.
Top. Microbiol. Immunol. 2002,267, 253–269. [PubMed]
6.
Frost, M.J.; Zhang, J.; Edmonds, J.H.; Prow, N.A.; Gu, X.; Davis, R.; Hornitzky, C.; Arzey, K.E.; Finlaison, D.;
Hick, P.; et al. Characterization of virulent West Nile virus Kunjin strain, Australia. Emerg. Infect. Dis.
2012
,
18, 792–800. [CrossRef] [PubMed]
7. Ariel, E. Viruses in reptiles. Vet. Res. 2011,42, 100. [CrossRef] [PubMed]
8. Marschang, R.E. Viruses infecting reptiles. Viruses 2011,3, 2087–2126. [CrossRef]
9.
Jacobson, E.R.; Ginn, P.E.; Troutman, J.M.; Farina, L.; Stark, L.; KLenk, K.; Burkhalter, K.L.; Komar, N. West
Nile virus infection in farmed American alligators (Alligator mississippiensis) in Florida. J. Wildl. Dis.
2005
,41,
96–106. [CrossRef]
10.
Newarez, J.G. Lymphohistiocytic Proliferative Syndrome of Alligators (Alligator Mississipiensis): A Cutaneous
Manifestation of West Nile Virus. Ph.D. Thesis, Louisiana State University, Baton Rouge, LA, USA, 2007.
11.
Newarez, J.G.; Mitchell, M.A.; Morgan, T.; Roy, A.; Johson, A. Association of West Nile virus with
lymphohistiocytic proliferative cutaneous lesions in American alligators (Alligator mississippiensis) detected
by RT-PCR. J. Zoo Wildl. Med. 2008,39, 562–566. [CrossRef]
12.
Isberg, S.R.; Moran, J.L.; De Araujo, R.; Elliott, N.; Melville, L. First evidence of Kunjin strain of West Nile
virus associated with saltwater crocodile (Crocodylus porosus) skin lesions. Aust. Vet. J.
2019
,97, 390–393.
[CrossRef] [PubMed]
13.
Jansen, C.C.; Webb, C.E.; Northill, J.A.; Ritchie, S.A.; Russell, R.C.; van den Hurk, A.F. Vector competence of
Australian mosquito species from a Northern American strain of West Nile virus. Vector Borne Zoonotic Dis.
2008,8, 805–811. [CrossRef]
14.
Kay, B.H.; Fanning, I.D.; Carley, J.G. Vector competence of Culex pipiens quinquefasciatus for Murray Valley
encephalitis, Kunjin, and Ross River viruses from Australia. Am. J. Trop. Med. Hyg.
1982
,31, 844–848.
[CrossRef] [PubMed]
15.
Isberg, S.R.; Chen, Y.; Barker, S.G.; Moran, C. Analysis of microsatellites and parentage testing in saltwater
crocodiles. J. Hered. 2004,122, 361–369. [CrossRef] [PubMed]
16.
Prow, N.A.; Setoh, Y.X.; Biron, R.M.; Sester,D.P.; Kim, K.S.; Hobson-Peters, J.; Hall,R.A.; Bielefeldt-Ohmann, H.
The West Nile virus-like flavivirus Koutango is highly virulent in mice due to delayed viral clearance and
the induction of a poor neutralizing antibody response. J. Virol. 2014,88, 9947–9962. [CrossRef] [PubMed]
17.
Melville, L.; Davis, S.; Shilton, C.; Isberg, S.; Chong, A.; Gongora, J. Hunting Viruses in Crocodiles. Viral
and Endogenous Retroviral Detection and Characterization in Farmed Crocodiles; Australian Government Rural
Industries Research and Development Corporation, RIRDC Publication: Melbourne, Australia, 2012.
18.
Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol.
1938
,27,
493–497. [CrossRef]
19.
Pyke, A.T.; Smith, I.L.; van den Hurk, A.F.; Northill, J.A.; Chuan, T.F.; Westacott, A.J.; Smith, G.A. Detection
of Australasian Flavivirus encephalitic viruses using rapid fluorogenic TaqMan RT-PCR assays. J. Virol.
Methods 2004,117, 161–167. [CrossRef]
20.
Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics
2001
,17,
754–755. [CrossRef]

Viruses 2020,12, 198 20 of 21
21.
Isberg, S.R.; Thomson, P.C.; Nicholas, F.W.; Barker, S.G.; Moran, C. Quantitative analysis of production traits
in saltwater crocodiles (Crocodylus porosus): I. reproductive traits. J. Anim. Breed. Genet.
2005
,122, 361–369.
[CrossRef]
22.
Miles, L.G.; Isberg, S.R.; Thomson, P.C.; Glenn, T.C.; Lance, S.L.; Dalzell, P.; Moran, C. QTL mapping for
two commercial traits in farmed saltwater crocodiles (Crocodylus porosus). Anim. Genet.
2010
,41, 142–149.
[CrossRef]
23.
Finger, J.W.J.; Thomson, P.C.; Adams, A.L.; Benedict, S.; Moran, C.; Isberg, S.R. Reference levels for
corticosterone and immune function in farmed saltwater crocodiles (Crocodylus porosus) hatchlings using
current Code of Practice guidelines. Gen. Comp. Endocrinol. 2015,212, 63–72. [CrossRef] [PubMed]
24.
Isberg, S.R.; Thomson, P.C.; Nicholas, F.W.; Barker, S.G.; Moran, C. Quantitative analysis of production traits
in saltwater crocodiles (Crocodylus porosus): II. age at slaughter. J. Anim. Breed. Genet.
2005
,122, 370–377.
[CrossRef] [PubMed]
25.
Van den Hurk, A.F.; Hall-Mendelin, S.; Townsend, M.; Kurucz, N.; Edwards, J.; Ehlers, G.; Rodwell, C.;
Moore, F.A.; McMahon, J.L.; Northill, J.A.; et al. Applications of a sugar-based surveillance system to track
arboviruses in wild mosquito populations. Vector Borne Zoonotic Dis.
2014
,14, 66–73. [CrossRef] [PubMed]
26.
Bielefeldt-Ohmann, H.; Bosco-Lauth, A.; Hartwig, A.E.; Uddin, M.J.; Barcelon, J.; Suen, W.W.; Wang, W.;
Hall, R.A.; Bowen, R.A. Characterization of non-lethal West Nile Virus (WNV) infection in horses: Subclinical
pathology and innate immune response. Microb. Pathog. 2017,103, 71–79. [CrossRef] [PubMed]
27.
Hall, R.A.; Broom, A.K.; Hartnett, A.C.; Howard, M.J.; Mackenzie, J.S. Immunodominant epitopes on the NS1
protein of MVE and KUN viruses serve as targets for a blocking ELISA to detect virus-specific antibodies in
sentinel animal serum. J. Virol. Methods. 1995,51, 201–210. [CrossRef]
28.
Prow, N.A.; Tan, C.S.; Wang, W.; Hobson-Peters, J.; Kidd, L.; Barton, A.; Wright, J.; Hall, R.A.;
Bielefeldt-Ohmann, H. Natural exposure of horses to mosquito-borne flaviviruses in south-east Queensland,
Australia. Int. J. Environ. Res. Public Health 2013,10, 4432. [CrossRef]
29.
Suen, W.W.; Imoda, M.; Thomas, A.W.; Nasir, N.N.B.M.; Tearnsing, N.; Wang, W.; Bielefeldt-Ohmann, H. An
acute stress model in New Zealand white rabbits exhibits altered immune response to infection with West
Nile Virus. Pathogens 2019,8, 195. [CrossRef]
30.
Setoh, Y.X.; Prow, N.A.; Rawle, D.J.; Tan, C.S.; Edmonds, J.H.; Hall, R.A.; Khromykh, A.A. Systematic analysis
of viral genes responsible for differential virulence between American and Australian West Nile virus strains.
J. Gen. Virol. 2015,96, 1297–1308. [CrossRef]
31.
Voermans, J.J.C.; Pas, S.D.; van der Linden, A.; Geurts van Kessel, C.; Koopmans, M.; van der Eijk, A.;
Reusken, C.B.E.M. Whole-blood testing for diagnosis of acute Zika virus infections in routine diagnostic
setting. Emerg. Infect. Dis. 2019,25, 1394–1396. [CrossRef]
32.
Klenk, K.; Snow, J.; Morgan, K.; Bowen, R.; Stephens, M.; Foster, F.; Gordy, P.; Beckett, S.; Koman, N.;
Gubler, D.; et al. Alligators as West Nile virus amplifiers. Emerg. Infect. Dis.
2004
,10, 2150–2155. [CrossRef]
33.
Althouse, B.M.; Hanley, K.A. The tortoise or the hare? Impacts of within-host dynamics on transmission
success of arthropod-borne viruses. Philos Trans. R. Soc. Lond. B Biol. Sci.
2015
,370, 20140299. [CrossRef]
[PubMed]
34.
Hanley, K.A.; Azar, S.R.; Campos, R.K.; Vasilakis, N.; Rossi, S.L. Support for the transmission-clearance
trade-offhypothesis from a study of Zika virus delivered by mosquito bite to mice. Viruses
2019
,11, 1072.
[CrossRef] [PubMed]
35.
Laoprasopwattana, K.; Libraty, D.H.; Endy, T.P.; Nisalak, A.; Chunsuttiwat, S.; Ennis, F.A.; Rothman, A.L.;
Green, S. Antibody-dependent cellular cytotoxicity mediated by plasma obtained before secondary dengue
virus infections: Potential involvement in early control of viral replication. J. Infect. Dis.
2007
,195, 1108–1116.
[CrossRef] [PubMed]
36.
Sarker, S.; Wang, Y.; Warren-Smith, B.; Helbig, K.J. Dynamic changes in host gene expression following
in vitro viral mimic stimulation in crocodile cells. Front. Immunol. 2017,8, 1634. [CrossRef]
37.
Ohmann, H.B.; McDougall, L.; Potter, A. Secondary
in vitro
B lymphocyte (antibody) response to microbial
antigens: Use in appraisal of vaccine immunogenicity and cytokine immunoregulation. Vaccine
1991
,9,
170–176.
38.
Conley, K.J.; Shilton, C.M.C. Pathology of Wildlife and Zoo Animals, 1st ed.; Terio, K.A., McAloose, D., St.
Leger, J., Eds.; Academic Press: Cambridge, MA, USA, 2018.
39. Jacobson, E.R. Infectious Diseases and Pathology of Reptiles, 1st ed.; CRC Press: Boca Raton, FL, USA, 2007.

Viruses 2020,12, 198 21 of 21
40.
Grayfer, L.; De Jes
ú
s Andino, F.; Chen, G.; Chinchar, G.V.; Robert, J. Immune evasion strategies of ranaviruses
and innate immune responses to these emerging pathogens. Viruses 2012,4, 1075–1092. [CrossRef]
41.
Sharma, S.; Thomas, P.G. The two faces of heterologous immunity: Protection or immunopathology. J. Leuk.
Biol. 2014,95, 405–416. [CrossRef]
42.
Kaye, S.; Wang, W.; Miller, C.; McLuckie, A.; Beatty, J.A.; Grant, C.K.; VandeWoude, S.; Bielefeldt-Ohmann, H.
Role of feline immunodeficiency virus in lymphomagenesis–going alone or colluding? ILAR J.
2016
,57,
24–33. [CrossRef]
43.
Hall, R.A.; Bielefeldt-Ohmann, H.; McLean, B.J.; O’Brien, C.A.; Colmant, A.M.; Piyasena, T.B.; Harrison, J.J.;
Newton, N.D.; Barnard, R.T.; Prow, N.A.; et al. Commensal viruses of mosquitoes: Host restriction,
transmission, and interaction with arboviral pathogens. Evol. Bioinform. Online 2017,12, 35–44. [CrossRef]
44.
Colmant, A.M.; Bielefeldt-Ohmann, H.; Hobson-Peters, J.; Suen, W.W.; O’Brien, C.A.; van den Hurk, A.F.;
Hall, R.A. A newly discovered flavivirus in the yellow fever virus group displays restricted replication in
vertebrates. J. Gen. Virol. 2016,97, 1087–1093. [CrossRef]
45.
Pauvolid-Corr
ê
a, A.; Campos, Z.; Juliano, R.; Velez, J.; Nogueira, R.M.; Komar, N. Serological evidence of
widespread circulation of West Nile virus and other flaviviruses in equines of the Pantanal, Brazil. PLoS
Negl. Trop. Dis. 2014,8, e2706. [CrossRef] [PubMed]
46.
Stromsland, K.; Zimmerman, L.M. Relationships between parasitic infection and natural antibodies, age,
and sex in a long-lived vertebrate. J. Exp. Zool 2017,327, 407–412. [CrossRef] [PubMed]
47.
Keenan, S.W.; Summers Engel, A.; Elsey, R.M. The alligator gut microbiome and implications for archosaur
symbioses. Sci. Rep. 2013,3, 2877. [CrossRef] [PubMed]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).