Modular and Integrative Vectors for Synthetic Biology Applications in Streptomyces spp

Abstract

One of the strategies employed today to obtain new bioactive molecules with potential applications for human health (for example, antimicrobial or anticancer agents) is synthetic biology. Synthetic biology is used to biosynthesize new unnatural specialized metabolites or to force the expression of otherwise silent natural biosynthetic gene clusters. To assist the development of synthetic biology in the field of specialized metabolism, we constructed and are offering to the community a set of vectors that were intended to facilitate DNA assembly and integration in actinobacterial chromosomes. These vectors are compatible with various DNA cloning and assembling methods. They are standardized and modular, allowing the easy exchange of a module by another one of the same nature. Although designed for the assembly or the refactoring of specialized metabolite gene clusters, they have a broader potential utility, for example, for protein production or genetic complementation.

Full text

Modular and Integrative Vectors for Synthetic Biology
Applications in Streptomyces spp.
Céline Aubry,
a
Jean-Luc Pernodet,
a
Sylvie Lautru
a
a
Institute for Integrative Biology of the Cell (I2BC), CEA, CNRS, Université Paris-Sud, Université Paris-Saclay, Gif-sur-Yvette Cedex, France
ABSTRACT With the development of synthetic biology in the field of (actinobacte-
rial) specialized metabolism, new tools are needed for the design or refactoring of
biosynthetic gene clusters. If libraries of synthetic parts (such as promoters or ribo-
some binding sites) and DNA cloning methods have been developed, to our knowl-
edge, not many vectors designed for the flexible cloning of biosynthetic gene
clusters have been constructed. We report here the construction of a set of 12 stan-
dardized and modular vectors designed to afford the construction or the refactoring
of biosynthetic gene clusters in Streptomyces species, using a large panel of cloning
methods. Three different resistance cassettes and four orthogonal integration sys-
tems are proposed. In addition, FLP recombination target sites were incorporated to
allow the recycling of antibiotic markers and to limit the risks of unwanted homolo-
gous recombination in Streptomyces strains when several vectors are used. The func-
tionality and proper integration of the vectors in three commonly used Streptomyces
strains, as well as the functionality of the Flp-catalyzed excision, were all confirmed.
To illustrate some possible uses of our vectors, we refactored the albonoursin gene
cluster from Streptomyces noursei using the BioBrick assembly method. We also used
the seamless ligase chain reaction cloning method to assemble a transcription unit
in one of the vectors and genetically complement a mutant strain.
IMPORTANCE One of the strategies employed today to obtain new bioactive mole-
cules with potential applications for human health (for example, antimicrobial or an-
ticancer agents) is synthetic biology. Synthetic biology is used to biosynthesize new
unnatural specialized metabolites or to force the expression of otherwise silent natu-
ral biosynthetic gene clusters. To assist the development of synthetic biology in the
field of specialized metabolism, we constructed and are offering to the community a
set of vectors that were intended to facilitate DNA assembly and integration in acti-
nobacterial chromosomes. These vectors are compatible with various DNA cloning
and assembling methods. They are standardized and modular, allowing the easy ex-
change of a module by another one of the same nature. Although designed for the
assembly or the refactoring of specialized metabolite gene clusters, they have a
broader potential utility, for example, for protein production or genetic complemen-
tation.
KEYWORDS Streptomyces, synthetic biology
Synthetic biology is a domain of biotechnology that emerged at the beginning of the
21st century. It aims, for one part, at the rational engineering of biological systems
to confer on them new functions. In the field of specialized metabolism, synthetic
biology aims first at cloning and refactoring of silent (cryptic) biosynthetic gene clusters
to afford the expression of genes and the production of metabolites that otherwise
cannot be isolated and purified (1–3). Second, it is usually the method of choice for the
synthesis of “unnatural natural products.” In this case, it consists either in the design
and assembly of new biosynthetic gene clusters (4) or in the engineering of biosyn-
Citation Aubry C, Pernodet J-L, Lautru S. 2019.
Modular and integrative vectors for synthetic
biology applications in Streptomyces spp. Appl
Environ Microbiol 85:e00485-19. https://doi
.org/10.1128/AEM.00485-19.
Editor Haruyuki Atomi, Kyoto University
Copyright © 2019 American Society for
Microbiology. All Rights Reserved.
Address correspondence to Sylvie Lautru,
sylvie.lautru@i2bc.paris-saclay.fr.
Received 12 March 2019
Accepted 22 May 2019
Accepted manuscript posted online 7 June
2019
Published
BIOTECHNOLOGY
crossm
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 1Applied and Environmental Microbiology
1 August 2019

thetic enzymes such as the modular nonribosomal peptide synthetases (NRPS) (5–7)
and polyketide synthases (PKS) (8, 9). Such approaches are often referred to as
combinatorial biosynthesis.
The development of synthetic biology in the field of specialized metabolism requires
the development of dedicated tools and methods. In particular, it requires hosts
(chassis) optimized for the production of specialized metabolites, libraries of synthetic
DNA parts, such as promoters, ribosome binding sites (RBSs), or terminators, and
vectors and DNA assembly methods for de novo assembly of gene clusters. Several
Streptomyces strains, such as Streptomyces coelicolor (10), Streptomyces avermitilis (11),
and Streptomyces albus (12, 13), have been optimized as chassis for the heterologous
production of specialized metabolites. High-producing industrial strains have also been
reported for the successful heterologous production of specialized metabolites (14). In
parallel, efforts have been made to construct libraries of synthetic promoters (15–18)
and of RBSs (15).
Many DNA assembly methods have been proposed and used so far for the assembly
of DNA fragments, more specifically for the assembly of specialized metabolite biosyn-
thetic gene clusters. These methods are mainly based on the existence of homology
regions at the extremities of the fragments to be assembled, on the use of restriction
enzymes, or on the use of site-specific recombinases. Examples of homology-based
methods include the one-pot isothermal assembly (19), the ligase cycling reaction (LCR)
(20), and direct pathway cloning (DiPaC) (3) for in vitro assembly and DNA assembler
(21) based on transformation-associated recombination (TAR) in yeast or the linear plus
circular homologous recombination (LCHR) method (used in the AGOS system [22]) for
in vivo assembly. The first restriction enzyme-based DNA assembly method was the
BioBrick assembly, based on the utilization of four restriction enzymes, two of which
generate compatible cohesive ends (23). Other similar cloning methods based on the
assembly of basic parts (promoter, coding sequence, terminator, etc.) into transcrip-
tional units that can then be assembled together have since been developed (Golden
Gate [24]; modular cloning, or MoClo [25]; and GoldenBraid 2.0 [26]). Finally, Olorunniji
and colleagues recently established a DNA assembly method based on the use of
site-specific integrases and orthogonal pairs of att sites (27).
While many DNA assembly methods have been developed, none is universal and
adapted to all experimental situations. Indeed, some methods are more suitable to the
assembly of (large) transcriptional units together (restriction enzyme-based methods,
leaving a scar sequence but not requiring challenging PCRs of large and/or GC-rich
fragments). Others are better suited to the assembly of the various elements of a
transcriptional unit (homology-based methods allowing the precise positioning of the
different elements without scar sequences). The size (from a few kilobases to more than
100 kb), the GC content, and the presence and number of regions presenting relatively
high degrees of sequence similarities (in NRPS or PKS genes, for example) can vary a lot
depending on the specialized metabolite gene cluster of interest. Thus, different
experimental settings are likely to require different cloning approaches or even a
combination of approaches. Therefore, the vectors used for cloning need to be flexible
and adapted or easily adaptable to various assembly methods. It has been proposed
that vectors built for synthetic biology should follow a standard and modular format
(SEVA plasmids [28]), allowing a rapid and easy exchange of a module for another one.
However, in the field of specialized metabolite synthetic biology, not many such vectors
have been constructed. To our knowledge, one of the rare attempts was carried out by
Phelan and colleagues (29) for the expression of genes in Streptomyces species. In their
study, they describe the construction of 45 vectors based on three site-specific inte-
gration systems (
␸
BT1,
␸
C31, and VWB), four antibiotic resistance genes (apramycin,
spectinomycin, and thiostrepton/ampicillin), and 14 promoters. These vectors were
mainly designed for monocistronic gene expression, although the presence of several
restriction sites could allow the assembly of a few gene cassettes.
In this study, we describe the construction of a set of 12 standardized and modular
vectors designed to allow the assembly of biosynthetic gene clusters using various
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 2

cloning methods in Streptomyces species, prolific producers of specialized metabolites.
These vectors were designed on the model of the SEVA plasmids, although the exact
architecture of these plasmids could not be used for our application. The 12 vectors
were proven to be functional by the verified integration in the chromosome of three
commonly used Streptomyces species. We also illustrate two possible uses of our
vectors. We first refactored the albonoursin gene cluster using BioBrick assembly.
Second, we genetically complemented our cgc22 mutant strain, CGCL030 (cgc22 is
involved in congocidine biosynthesis [30]), by constructing a gene cassette constituted
of a promoter, an RBS, cgc22, and a terminator using ligase chain reaction assembly.
RESULTS AND DISCUSSION
Design of the vectors. The vectors were designed to meet the following specifi-
cations. It should be possible to use several vectors in the same strain (orthogonality),
so different antibiotic resistance cassettes and different systems of integration at
specific sites in the chromosome of Streptomyces should be used for the construction
of the vectors. The vectors should be E. coli/Streptomyces shuttle vectors so that genetic
constructions can be prepared in E. coli before being introduced into Streptomyces
strains; thus, an E. coli origin of replication has to be included. It should be possible to
introduce the vectors into Streptomyces strains by E. coli/Streptomyces intergeneric
conjugation, so the presence of an origin of transfer is necessary. The vectors should be
compatible with several cloning methods, including homology and restriction enzyme-
based assembly methods. Finally, the vectors should be modular and flexible, so that
each module can be easily replaced by an equivalent one if needed.
Each vector is made of five modules (Fig. 1). The first module is constituted of the
E. coli origin of replication and of an Flp recombination target (FRT) recognition site for
the Flp recombinase. We chose the p15A E. coli origin of replication to limit the number
of plasmid copies in the cell and, thus, the metabolic burden induced by the vector,
FIG 1 Schematic representation of the set of modular and integrative vectors pOSV801 to pOSV812. The
various antibiotic resistance cassettes and integration systems used are indicated. Each restriction
enzyme site indicated is unique, except NotI (two cutting sites). E. coli ori corresponds to the E. coli p15A
origin of replication. oriT is the origin of transfer. amilCP is the gene coding for an Acropora millepora
chromoprotein, a protein which exhibits blue color. FRT corresponds to the sites recognized by the Flp
recombinase. The promoter of module 5 is only functional in E. coli.attP sites are used by integrases to
integrate the plasmid in the Streptomyces genome at a specific site.
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 3

which could be important with large inserts. The second module consists of the
antibiotic resistance marker. Three different resistance genes were chosen: acc(3)IV
(conferring apramycin resistance), aph(7==) (conferring hygromycin resistance), and aph
(conferring kanamycin resistance). The expression of the resistance genes is under the
control of a promoter that is functional in both E. coli and Streptomyces. The third
module is constituted by the RP4 origin of transfer, oriT, and a second FRT site. The two
FRT sites have been positioned so that the E. coli origin of replication, the antibiotic
resistance cassette, and the origin of transfer can be excised once the vector is
integrated in the chromosome of Streptomyces, allowing the recycling of the resistance
marker and limiting the possibility of homologous recombination between two differ-
ent vectors. The fourth module is the integration system cassette (integrases and their
corresponding attP site) that allows site-specific integration into Streptomyces chromo-
somes after conjugation. Four different integration cassettes are used, derived from the
integration systems of the actinophages
␸
BT1,
␸
C31, and VWB or of the integrative
conjugative element pSAM2. Chromosomal integration sites for these systems are
found in the genomes of Streptomyces species commonly used for heterologous
expression (Streptomyces coelicolor,Streptomyces lividans, or Streptomyces albus J1074,
for example). The construction of plasmids with four different integrase systems
moreover maximizes the likelihood of being able to use at least one of them in any
given strain. The last module is the cloning module. Our objective for this module was
to permit the cloning and assembly of genes or gene cassettes using a variety of
cloning methods (based on homology regions or on the use of restriction enzymes), as
different projects may require different cloning approaches. Thus, this module was
designed to allow the iterative assembly of genes (or gene cassettes) using the BioBrick
assembly method (23) (see Fig. S1 in the supplemental material). We chose this
assembly method rather than other methods based on the use of type IIS endonu-
cleases (e.g., Golden Gate method [24]), as the latter enzymes cut Streptomyces genomic
DNA with a high frequency (about 1 site every 1 to 1.4 kb for three of the most
frequently used enzymes, BsaI, BsmBI, and BpiI, in S. coelicolor,S. avermitilis, and S. albus
genomes). The BioBrick cloning system is based on the use of restriction enzymes
generating compatible cohesive ends, here NheI and SpeI (Fig. S1). Once ligated, the
two DNA parts are separated by a 6-bp scar sequence devoid of the NheI and SpeI
restriction sites. The NheI and SpeI sites were chosen to avoid the generation of a stop
codon in the scar sequence, thereby allowing the fusion of protein domains if needed,
and because they are relatively rare in Streptomyces genomes. The NsiI and AflII sites
that are also used in the BioBrick cloning system also are relatively scarce in Strepto-
myces genomes (e.g., about one site every 70 to 80 kb for NsiI and one site every 200
to 300 kb for AflII in S. coelicolor,S. avermitilis, and S. albus genomes). A NotI site is
included between the NsiI and NheI sites and between the SpeI and AflII sites to
facilitate the verification of the cloning. The cloning module includes an amilCP gene
between the prefix and suffix sequences (31). This gene codes for a chromoprotein,
giving a blue color to the cell. This cassette is meant to be replaced by the construction
of interest and offers a convenient means of screening the clones containing the new
construction. The five modules are separated by unique restriction sites (BamHI, KpnI,
SbfI, AflII, and NsiI), so that each module (e.g., the antibiotic resistance cassette or the
integration system) can easily be replaced by another one.
On one side of the insert, the sequence is the same in all plasmids, and the primer
on-ori (see Table 4) has been designed in the origin of replication of p15A to facilitate
the verification of the insert by sequencing. On the other side of the insert, the
sequence is that of the various integrase cassettes and, thus, no universal primer could
be designed.
Construction of the vectors. The first vector, pOSV800, was assembled by Gibson
isothermal assembly (19) from five PCR-amplified DNA fragments, one for each module.
The apramycin resistance gene and the
␸
BT1 integration system were used for this first
assembly. The final twelve vectors all derive from pOSV800 (Table 1 and Fig. S2). The
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 4

NheI and the SpeI restriction sites present in the integration cassette of pOSV800 were
removed by site-directed mutagenesis, yielding pOSV801. The vector pOSV802 was
constructed by replacing the
␸
BT1 integration cassette of pOSV800 with the
␸
C31
integration cassette. The vectors pOSV806 (resistance to kanamycin) and pOSV810
(resistance to hygromycin) next were obtained by the replacement in pOSV802 of the
aac(3)-IV gene with the aph and aph(7==) genes by
␭
-Red recombination (32).
The vector pOSV803 was constructed by replacing the
␸
BT1 integration cassette of
pOSV800 with the pSAM2 integration cassette after the removal of the BamHI and KpnI
sites from this cassette by site-directed mutagenesis. The vectors pOSV807 (resistance
to hygromycin) and pOSV811 (resistance to kanamycin) were next obtained by the
replacement in pOSV803 of the apramycin resistance cassette by the hygromycin (from
pOSV806) and kanamycin (from pOSV810) resistance cassettes, respectively.
Similarly, pOSV804 was constructed by replacing the
␸
BT1 integration cassette of
pOSV800 by the VWB integration cassette after the removal of the BamHI site from the
VWB integration cassette by site-directed mutagenesis. The vectors pOSV808 (resis-
tance to hygromycin) and pOSV812 (resistance to kanamycin) were next obtained by
the replacement in pOSV804 of the apramycin resistance cassette with the hygromycin
and kanamycin resistance cassettes, respectively.
Finally, pOSV805 (resistance to hygromycin) and pOSV809 (resistance to kanamycin)
were obtained by the replacement in pOSV801 of the apramycin resistance cassette
with the hygromycin and kanamycin resistance cassettes, respectively.
Verification of the functionality of the vectors: integration into Streptomyces
chromosome. To verify that the 12 vectors we constructed all were functional, we
integrated them in the chromosome of three Streptomyces strains commonly used for
heterologous expression: Streptomyces coelicolor M145, Streptomyces lividans TK23, and
Streptomyces albus J1074. The vectors were introduced into the Streptomyces strains by
intergeneric conjugation from E. coli. The exconjugants were selected for using the
appropriate antibiotics, and resistant clones were verified by PCR on extracted genomic
DNA. The general principle for the PCR verification of the correct integration of the
vectors at the expected chromosomal site is presented in Fig. 2A. Briefly, two DNA
fragments encompassing the attL and attR sites were amplified by PCR (PCR 1 and PCR
2). The results of these PCR verifications for the integration of pOSV802 are presented
in Fig. 2B. DNA fragments with a size of roughly 900 bp were amplified as expected
when using the genomic DNA of the Streptomyces strains bearing the pOSV802 plasmid
as the matrix. The sequences surrounding the attL and attR sites were verified. No PCR
amplification was observed when the genomic DNAs of the wild-type strains were used
as the matrix. Thus, these results confirmed the integration of pOSV802 at the expected
site in the chromosome of the three Streptomyces species.
Results of the PCR verification of the correct integration of the eleven other vectors
are presented in the supplemental material (Fig. S3 to S9). All PCR products had the
TABLE 1 Description of the constructed vectors
Name Accession numbers
a
Drug to which vector
confers resistance
Integration
system
pOSV801 126044/LMBP 11369 Apramycin
␸
BT1
pOSV802 126595/LMBP 11370 Apramycin
␸
C31
pOSV803 126596/LMBP 11371 Apramycin pSAM2
pOSV804 126597/LMBP 11372 Apramycin VWB
pOSV805 126598/LMBP 11373 Hygromycin
␸
BT1
pOSV806 126606/LMBP 11374 Hygromycin
␸
C31
pOSV807 126600/LMBP 11375 Hygromycin pSAM2
pOSV808 126601/LMBP 11376 Hygromycin VWB
pOSV809 126602/LMBP 11377 Kanamycin
␸
BT1
pOSV810 126603/LMBP 11378 Kanamycin
␸
C31
pOSV811 126604/LMBP 11379 Kanamycin pSAM2
pOSV812 126605/LMBP 11380 Kanamycin VWB
a
Accession numbers before slashes are from the Addgene plasmid repository, and those after the slashes are
from the BCCM/GeneCorner Plasmid Collection.
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 5

expected size, indicating that the vectors integrated at the expected location in the
Streptomyces chromosomes. Altogether, these experiments demonstrate that the 12
plasmids (i) are replicative in E. coli, (ii) can be transferred by intergeneric conjugation
into Streptomyces, (iii) confer the expected resistance, and (iv) integrate at the expected
location in the chromosome of Streptomyces.
Excision of modules 1, 2, and 3 using the flp recombinase. One potential
difficulty when multiple genetic constructions need to be integrated in Streptomyces
chromosomes is the limited number of antibiotic resistance markers that are functional
in a given strain. To allow the recycling of resistance markers, we included in our vectors
FRT sites surrounding module 1 (E. coli origin of replication), module 2 (antibiotic
resistance cassette), and module 3 (origin of transfer). Thus, once a vector has been
integrated in a Streptomyces chromosome, these three modules, which are no longer
necessary, can be excised using the Flp recombinase brought in trans by a replicative
plasmid, leaving a scar of 34 bp (33).
To verify that modules 1, 2, and 3 could be excised using the Flp recombinase, we
used the pUWLHFLP plasmid constructed by A. Luzhetskyy’s group (34) and followed
the protocol described in reference 33 to excise modules 1 to 3 in S. coelicolor
M145/pOSV802 as an example. The pUWLHFLP plasmid is a replicative plasmid that
allows the constitutive expression of an flp gene with codon usage optimized for
Streptomyces species. Approximately one apramycin-sensitive clone was obtained for
each 100 clones screened, which is roughly ten times less than what was previously
described (33). One sensitive clone was chosen for PCR verification of the excision of
the modules 1 to 3 (Fig. 3). As expected, a smaller (1.6-kb) fragment was amplified with
the genomic DNA of the sensitive clone M145 containing pOSV802 from which
modules 1 to 3 had been deleted compared to the 4.2-kb fragment obtained with S.
FIG 2 Verification of the integration of pOSV802 in S. coelicolor M145, S. lividans TK23, and S. albus J1074
chromosomes. (A) Principle of the PCR verification of the integration of the pOSV801 to pOSV812 vectors in the
Streptomyces chromosomes (PCR 1 and PCR 2) (PCR 3, PCR verification before excision of modules 1 to 3). (B) PCR
fragments obtained by PCR 1 (attL region; expected sizes, 913 bp for M145 and TK23, 888 bp for J1074) and by PCR
2(attR region; expected sizes, 911 bp for M145 and TK23, 907 bp for J1074) on the three Streptomyces strains
bearing pOSV802. No PCR amplification is expected when the genomic DNA of the wild-type Streptomyces strains
is used as the matrix. MW corresponds to the molecular weight ladder (Thermo Scientific GeneRuler DNA ladder
mix).
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 6

coelicolor M145/pOSV802 genomic DNA. The sequencing of the 1.6-kb fragment con-
firmed the correct excision of modules 1 to 3.
This experiment demonstrated the feasibility of the excision of modules 1 to 3 after
the integration of one of our vectors in the chromosome of a Streptomyces species. As
the pUWLHFLP plasmid is relatively unstable, it can be lost after two rounds of growth
on the solid medium soya flour mannitol (SFM) without selection pressure, allowing the
integration of a second vector bearing the same resistance marker. It should be noted
that it will not be possible to use the pUWLHFLP plasmid, which bears a hygromycin
resistance gene when pOSV805 to pOSV808 (bearing a hygromycin resistance gene) are
used. However, other plasmids for the expression of Flp in Streptomyces have been
constructed harboring different resistance markers, e.g., thiostrepton resistance (33).
Refactoring the albonoursin gene cluster. The pOSV801 to pOSV812 vectors were
mainly designed for the assembly of gene cassettes to form new gene clusters or to
refactor silent gene clusters, although their use may not be limited to these applica-
tions. To illustrate one of the possible uses of our vectors, we decided to refactor the
albonoursin gene cluster. Albonoursin [cyclo(ΔPhe-ΔLeu)], produced by Streptomyces
noursei, belongs to the family of diketopiperazine metabolites studied in our group. Its
biosynthetic gene cluster consists of three genes, albA,albB, and albC (35). We chose to
express the alb gene under the control of the rpsL(TP) constitutive promoter (2) and to
assemble the required elements using the BioBrick assembly method.
The rpsL(TP) promoter followed by the ribosome binding site (RBS) sequence of tipA
(36) was first cloned into pOSV802, yielding pCEA005. Similarly, the alb gene cluster was
cloned in pOSV802, yielding pCEA006. Finally, the NheI/AflII fragment of pCEA006
containing the alb gene cluster was cloned into SpeI/AflII-digested pCEA005, and the
resulting pCEA007 plasmid was introduced into S. coelicolor M145 by intergeneric
conjugation. To verify that S. coelicolor M145/pCEA007 produced albonoursin, the
culture supernatant of this strain, together with the culture supernatants of S. noursei
(positive control) and of S. coelicolor M145/pOSV802 (negative control), were analyzed
by liquid chromatography-mass spectrometry (LC-MS). The chromatograms (Fig. 4) and
the MS spectra and fragmentation patterns (Fig. S10) (37) confirmed that M145/
pCEA007 produces albonoursin.
Genetic complementation of mutant strain: assembly of a gene cassette using
LCR in pOSV812. Cloning methods based on the use of restriction enzymes necessitate
the presence or introduction of restriction sites in the sequence, which may sometimes
be problematic (for example, for the fusion of protein domains or for the cloning of an
RBS sequence in front of a coding sequence). In these cases, the use of seamless cloning
methods is preferable. To demonstrate that gene cassettes could be assembled in our
vectors using such seamless cloning methods, we undertook the genetic complemen-
tation of a mutant constructed previously during the study of the congocidine biosyn-
thetic gene cluster (mutant strain CGCL030) (30). Congocidine is a pyrrolamide antibi-
FIG 3 Verification of the excision of modules 1, 2, and 3 by Flp recombinase. (A) Principle of the PCR
verification of the Flp-catalyzed excision of modules 1 to 3 (PCR 3; Fig. 2A shows PCR 3 on nonexcised
pOSV802). (B) PCR fragments obtained by PCR 3; expected sizes, 4,192 bp for M145/pOSV802 and 1,637
bp for M145 containing pOSV802 after excision of modules 1 to 3 by the Flp recombinase.
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 7

otic assembled by an atypical NRPS. The gene cgc22, deleted in the strain CGCL030,
encodes an acyl-coenzyme A synthetase that activates the pyrrole precursor during
congocidine assembly. To construct the plasmid for genetic complementation, we
assembled three DNA fragments in pOSV802 by LCR (20): the SP22 constitutive
promoter with the RBS of the capsid
␸
C31 gene (15), the cgc22 gene, and the T4
terminator (38). The LCR method is based on the ligation of DNA fragments using
bridging oligonucleotides whose sequences are complementary to the sequences of
the extremities of the DNA fragments to be assembled (Fig. S11). The assembly is
achieved through multiple cycles of denaturation-annealing-ligation using a thermo-
stable ligase. This method has the advantages of working for the assembly of very short
fragments (⬍100 bp) and does not necessitate the existence of homology regions at
the extremities of the DNA fragments that will be assembled.
Each DNA fragment was amplified by PCR. The oligonucleotides used for the
amplification of the promoter and RBS fragment and of the T4 terminator fragment
were designed to reconstitute the prefix and the suffix sequences once all the frag-
ments have been assembled in the vector. All PCR fragments were phosphorylated and
assembled in one step with the NotI/Klenow-digested vector pOSV812. To verify that
the constructed gene cassette was functional, the pCAS008 plasmid was introduced by
intergeneric conjugation in the S. lividans CGCL030 strain expressing the whole cgc
gene cluster except for cgc22 (30). The supernatants of 4-day cultures of CGCL030/
FIG 4 HPLC analysis of albonoursin production. Chromatograms of the analysis of the culture superna-
tants of the native albonoursin producer S. noursei (A), the control S. coelicolor M145/pOSV802 (B), and
S. coelicolor M145/pCEA007 (C).
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 8

pCAS008, CGCL030, and CGCL006 expressing the complete cgc gene cluster were then
analyzed by high-performance liquid chromatography (HPLC). Figure 5 shows that
production of congocidine is restored in CGCL030/pCAS008, demonstrating the func-
tionality of the constructed gene cassette.
In conclusion, we constructed a set of plasmids dedicated to DNA assembly and
integration in Streptomyces chromosomes. We aimed at offering a modular and flexible
platform that can be used in various experimental settings, from the assembly of small
gene cassettes to the assembly of larger DNA fragments, and that will be compatible
with a large variety of cloning methods. Varying the nature of the resistance cassette
(resistance to three different antibiotics) and of the integration system (four different
systems), we constructed a total of 12 plasmids. To increase our plasmid collection, we
plan in the future to add new resistance cassettes (e.g., erythromycin) and integration
systems (e.g., integration systems from TG1,
␸
Joe, or SV1 [39–41]) but also to include
new modules, such as the CEN-ARS module (1) for DNA cloning and assembly in yeast.
All of our plasmids will be made available to the community through deposition in
plasmid collections such as Addgene or the BCCM/GeneCorner Plasmid Collection.
FIG 5 HPLC analysis of the genetic complementation of the Δcgc22 mutant. Chromatograms of the
analysis of the culture supernatant of the CGCL006 strain expressing the complete cgc cluster (A), the
culture supernatant of the CGCL030 mutant strain expressing the cgc cluster except for cgc22 (B),
the culture supernatant of the CGCL083 strain (CGCL030 genetically complemented with pCAS008) (C),
and the congocidine standard (D).
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 9

MATERIALS AND METHODS
Bacterial strains, plasmids, and growth conditions. Strains and plasmids used in this study are
listed in Tables 2 and 3. E. coli strains were grown at 37°C in LB or Super Optimal Broth (SOB) medium
complemented with MgSO
4
(20 mM final), supplemented with appropriate antibiotics as needed. Soya
flour mannitol (SFM) medium (42) was used for genetic manipulations of Streptomyces strains and spore
stock preparations. Streptomyces strains were grown at 28°C in MP5 (43) for congocidine or albonoursin
production.
DNA preparation and manipulations. All oligonucleotides used in this study were purchased from
Eurofins and are listed in Table 4. The high-fidelity DNA polymerase Phusion (Thermo Fisher Scientific)
was used to amplify the fragments used for the construction of the vectors. DreamTaq polymerase
TABLE 2 Strains used during the study
Strain Description Reference or source
Escherichia coli DH5
␣
General cloning host Promega
Escherichia coli ET12567/pUZ8002 Host strain for conjugation from E. coli to Streptomyces 55
Escherichia coli ET12567/pUZ8003 Host strain for conjugation from E. coli to Streptomyces when
using vectors containing the kanamycin resistance cassette
(pUZ8003 is modified pUZ8002 with aph replaced by bla)
Our unpublished data
Escherichia coli S17-1 Host strain for conjugation from E. coli to Streptomyces when
using vectors containing the kanamycin resistance cassette
56
Escherichia coli BW25113/pIJ790 Host strain for PCR targeting 32
S. coelicolor M145 Streptomyces host strain for heterologous expression 42
S. lividans TK23 Streptomyces host strain for heterologous expression 42
S. albus J1074 Streptomyces host strain for heterologous expression 42
S. noursei ATCC11455 Albonoursin native producer ATCC
S. coelicolor M145/pOSV801 M145 containing pOSV801 This work
S. coelicolor M145/pOSV802 M145 containing pOSV802 This work
S. coelicolor M145/pOSV803 M145 containing pOSV803 This work
S. coelicolor M145/pOSV804 M145 containing pOSV804 This work
S. coelicolor M145/pOSV805 M145 containing pOSV805 This work
S. coelicolor M145/pOSV806 M145 containing pOSV806 This work
S. coelicolor M145/pOSV807 M145 containing pOSV807 This work
S. coelicolor M145/pOSV808 M145 containing pOSV808 This work
S. coelicolor M145/pOSV809 M145 containing pOSV809 This work
S. coelicolor M145/pOSV810 M145 containing pOSV810 This work
S. coelicolor M145/pOSV811 M145 containing pOSV811 This work
S. coelicolor M145/pOSV812 M145 containing pOSV812 This work
S. lividans TK23/pOSV801 TK23 containing pOSV801 This work
S. lividans TK23/pOSV802 TK23 containing pOSV802 This work
S. lividans TK23/pOSV803 TK23 containing pOSV803 This work
S. lividans TK23/pOSV804 TK23 containing pOSV804 This work
S. lividans TK23/pOSV805 TK23 containing pOSV805 This work
S. lividans TK23/pOSV806 TK23 containing pOSV806 This work
S. lividans TK23/pOSV807 TK23 containing pOSV807 This work
S. lividans TK23/pOSV808 TK23 containing pOSV808 This work
S. lividans TK23/pOSV809 TK23 containing pOSV809 This work
S. lividans TK23/pOSV810 TK23 containing pOSV810 This work
S. lividans TK23/pOSV811 TK23 containing pOSV811 This work
S. lividans TK23/pOSV812 TK23 containing pOSV812 This work
S. albus J1074/pOSV801 J1074 containing pOSV801 This work
S. albus J1074/pOSV802 J1074 containing pOSV802 This work
S. albus J1074/pOSV803 J1074 containing pOSV803 This work
S. albus J1074/pOSV804 J1074 containing pOSV804 This work
S. albus J1074/pOSV805 J1074 containing pOSV805 This work
S. albus J1074/pOSV806 J1074 containing pOSV806 This work
S. albus J1074/pOSV807 J1074 containing pOSV807 This work
S. albus J1074/pOSV808 J1074 containing pOSV808 This work
S. albus J1074/pOSV809 J1074 containing pOSV809 This work
S. albus J1074/pOSV810 J1074 containing pOSV810 This work
S. albus J1074/pOSV811 J1074 containing pOSV811 This work
S. albus J1074/pOSV812 J1074 containing pOSV812 This work
S. coelicolor M145 containing pOSV802 from
which modules 1 to 3 had been deleted
M145 containing pOSV802 after excision with Flp This work
S. coelicolor M145/pCEA007 M145 containing pCEA007 This work
CGCL006 TK23 containing pCGC002 (cgc cluster) 30
CGCL030 TK23 containing pCGC221 (cgc cluster with cgc22 deleted) 30
CGCL083 CGCL030 containing pCAS008 This work
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 10

(Thermo Fisher Scientific) was used for PCR verification of plasmid integration in Streptomyces strains.
DNA fragments were purified from agarose gels using the NucleoSpin gel and PCR cleanup kit from
Macherey-Nagel. DNA extractions and manipulations, Escherichia coli transformations, and E. coli/Strep-
tomyces conjugations were performed according to standard procedures (42, 44).
Construction of pOSV800. pOSV800 was constructed by assembling five fragments, coming from
five different vectors, using the one-pot isothermal assembly developed by Gibson et al. (19). The first
fragment (
␸
BT1 integrase gene and attP site) was amplified from pRT801 (45) using the CEA_vec01 and
CEA_vec02 primers. The second fragment (oriT origin of transfer) was amplified from pOSV408 (46) using
the CEA_vec03 and CEA_vec04 primers. The third fragment [apramycin resistance cassette aac(3)-IV] was
amplified from pSET152 (47) using CEA_vec05 and CEA_vec06 primers. The fourth fragment (p15A origin
of replication) was amplified from pAC-BETA (48) using CEA_vec07 and CEA_vec08 primers. The fifth and
last fragment (amilCP cassette surrounded by a BioBrick-like prefix [NsiI, NotI, and NheI sites] and suffix
[SpeI, NotI, and AflII]) was amplified from pSB1C3-BBa-K1155003 (iGEM registry of standard biological
parts) using CEA_vec09 and CEA_vec10 primers. Two FRT sites were introduced in the primer sequences
of CEA_vec03 and CEA_vec08. The PCR products were purified and diluted to 100 ng/
␮
l. One microliter
of each of the PCR products was used for the assembly. A mix containing T5 exonuclease (New England
Biolabs [NEB]), Taq ligase (NEB), and Phusion high-fidelity polymerase (Thermo Fisher Scientific) in the
appropriate buffer was prepared by following the protocol described by Gibson (49). The reaction was
carried out by adding 5
␮
l of DNA to 15
␮
l of the mix and incubating at 50°C for 1 h. Five microliters was
used for a standard transformation of E. coli DH5
␣
. The amilCP cassette, coding for a blue protein,
allowed the easy screening of potential correct clones. Plasmid DNA was extracted from a blue clone, and
the sequence of the plasmid was confirmed by sequencing.
Construction of pOSV801. The
␸
BT1 integrase gene in pOSV800 contains NheI and SpeI restriction
sites that were chosen for the BioBrick type of cloning. To remove these sites, one base was modified by
site-directed mutagenesis by following a protocol described previously (50). CEA_vec21 and CEA_vec22
were used to remove the NheI site by replacing an A withaGatposition 123 in the integrase gene
sequence (position 38926 of the
␸
BT1 bacteriophage genome sequence), conserving the amino acid
leucine (CTA becoming CTG) in the protein. Similarly, CEA_vec23 and CEA_vec24 were used to remove
TABLE 3 Plasmids used in this study
Plasmid Description Reference or source
pCR-Blunt E. coli cloning vector Invitrogen
pRT801 Source of the
␸
BT1 integrase fragment 45
pAC-BETA Source of the origin of replication p15A 48
pOSV408 Source of the origin of transfer 46
pSET152 Source of the apramycin resistance cassette and of the
␸
C31 integrase fragment 47
psB1C3-BBa_K1155003 Source of the amilCP cassette iGEM registry of standard
biological parts
pKT02 Source of the VWB integrase fragment 52
pOSV215 Source of the T4 terminator 54
pOSV554 Source of the integrase pSAM2 fragment Our unpublished data
pOSV400 Source of the ORF of hygromycin resistance gene Our unpublished data
pOSV401 Source of the ORF of kanamycin resistance gene Our unpublished data
pSL128 Source of the albonoursin cluster (albA,albB, and albC) 35
pCEA001 pUC57 containing rpsl(TP)p and tipA RBS Genecust
pCEA002 pGEM-T easy containing rpsl(TP)p and tipA RBS with the last 6 nucleotides
replaced by the SpeI site
This work
pCEA003 Plasmid pCR-Blunt containing pSAM2 integrase, used for site-directed mutagenesis This work
pCEA004 Plasmid pCR-Blunt containing VWB integrase, used for site-directed mutagenesis This work
pCEA005 pOSV802 containing rpsl(TP)p and tipA RBS with the last 6 nucleotides replaced by
the SpeI site
This work
pCEA006 pOSV802 containing the genes albA,albB, and albC instead of the amilCP cassette This work
pCEA007 pOSV802 containing rpsl(TP)p and the albonoursin cluster instead of amilCP This work
pOSV800 Plasmid constructed containing apramycin resistance and
␸
BT1 integrase with two
BioBrick sites NheI and SpeI in
␸
BT1 integrase
This work
pOSV801 Plasmid constructed containing apramycin resistance and
␸
BT1 integrase This work
pOSV802 Plasmid constructed containing apramycin resistance and
␸
C31 integrase This work
pOSV803 Plasmid constructed containing apramycin resistance and pSAM2 integrase This work
pOSV804 Plasmid constructed containing apramycin resistance and VWB integrase This work
pOSV805 Plasmid constructed containing hygromycin resistance and
␸
BT1 integrase This work
pOSV806 Plasmid constructed containing hygromycin resistance and
␸
C31 integrase This work
pOSV807 Plasmid constructed containing hygromycin resistance and pSAM2 integrase This work
pOSV808 Plasmid constructed containing hygromycin resistance and VWB integrase This work
pOSV809 Plasmid constructed containing kanamycin resistance and
␸
BT1 integrase This work
pOSV810 Plasmid constructed containing kanamycin resistance and
␸
C31 integrase This work
pOSV811 Plasmid constructed containing kanamycin resistance and pSAM2 integrase This work
pOSV812 Plasmid constructed containing kanamycin resistance and VWB integrase This work
pCAS008 pOSV812 with cassette SP22p-cgc22-T4 terminator instead of amilCP This work
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 11

TABLE 4 Primers used in this study
Name Sequence Description
CEA_vec01 ACTAGTAGCGGCCGCTTAAGCGCTCCCTGCCCGCTGTGG Amplification integrase
␸
BT1, suffix BioBrick (sites SpeI, NotI
and AflII underlined)
CEA_vec02 AATAGGAACTTCCCTGCAGGTGGCGCCGGACGGGGCTTC Amplification integrase
␸
BT1, site SbfI underlined
CEA_vec03 CCTGCAGGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC
GTCCACGACGCCCGTGATTTTG
Amplification oriT, FRT site added in boldface, site SbfI
underlined
CEA_vec04 CTCACCGCGACGTGGTACCCTTTTCCGCTGCATAACCCTG Amplification oriT, site KpnI underlined
CEA_vec05 GGGTACCACGTCGCGGTGAGTTCAGG Amplification aac(3)-IV, site KpnI underlined
CEA_vec06 GGATCCGGTTCATGTGCAGCTCCATCAG Amplification aac(3)-IV, site BamHI underlined
CEA_vec07 GCTGCACATGAACCGGATCCCCTAGCGGAGTGTATACTGG Amplification of p15A origin of replication, site BamHI
underlined
CEA_vec08 GCTAGCAGCGGCCGC ATGCATGAAGTTCCTATACTTTCTAGAG
AATAGGAACTTCACAACTTATATCGTATGGGGCTGAC
Amplification of p15A origin of replication, FRT site added
in boldface, prefix BioBrick (sites NheI, NotI, and NsiI
underlined)
CEA_vec09 TGCATGCGGCCGCTGCTAGCGTTTTTTGATCTCAATCAATAAAG Amplification amilCP cassette, prefix BioBrick (sites NsiI and
NotI underlined)
CEA_vec10 CTTAAGCGGCCGCTACTAGTATATAAACGCAGAAAGGC Amplification amilCP cassette, suffix BioBrick (sites AflII, NotI,
and SpeI underlined)
CEA_vec11 CAGTCCTGCAGGATTCCAGACGTCCCGAAGG Amplification integrase
␸
C31, site SbfI underlined
CEA_vec12 CAGTCTTAAGCAGGCTTCCCGGGTGTCTC Amplification integrase
␸
C31, site AflII underlined
CEA_vec13 CAGTCCTGCAGGAACGGTTCTGGCAAATATTC Amplification integrase pSAM2, site SbfI underlined
CEA_vec14 CAGTCTTAAGGTCAGTCATGCGGGCAAC Amplification integrase pSAM2, site AflII underlined
CEA_vec31 CAGTCCTGCAGGTCTCGAGCTCGCGAAAG Amplification integrase VWB, site SbfI underlined
CEA_vec32 CAGTCTTAAGGTCGACCCGTCTGACGCGTGTG Amplification integrase VWB, site AflII underlined
CEA_vec17 CTATGATCGACTGATGTCATCAGCGGTGGAGTGCAATGTCGTGACACA
AGAATCCCTGTTACTTC
Amplification ORF hygromycin resistance for PCR targeting
CEA_vec18 CCTTGCCCCTCCAACGTCATCTCGTTCTCCGCTCATGAGCTCAGGCGCC
GGGGGCGGTGT
Amplification ORF hygromycin resistance for PCR targeting
CEA_vec19 CTATGATCGACTGATGTCATCAGCGGTGGAGTGCAATGTCTCGCATGAT
TGAACAAGATG
Amplification ORF kanamycin resistance for PCR targeting
CEA_vec20 CCTTGCCCCTCCAACGTCATCTCGTTCTCCGCTCATGAGCTCAGAAGAAC
TCGTCAAGAAG
Amplification ORF kanamycin resistance for PCR targeting
CEA_vec21 CCAACGCACGACCGGCCGCCAGCTGTGCTTCGGTCGACACG Site-directed mutagenesis of NheI site of
␸
BT1 integrase,
base changed underlined (T¡C)
CEA_vec22 CGTGTCGACCGAAGCACAGCTGGCGGCCGGTCGTGCGTTGG Site-directed mutagenesis of NheI site of
␸
BT1 integrase,
base changed underlined (A¡G)
CEA_vec23 GCTGTGGTGACGAAGGAACTACTCGTTAGCCTAACTAACG Site-directed mutagenesis of SpeI site of
␸
BT1 integrase,
base changed underlined ( A¡C)
CEA_vec24 CGTTAGTTAGGCTAACGAGTAGTTCCTTCGTCACCACAGC Site-directed mutagenesis of SpeI site of
␸
BT1 integrase,
base changed underlined (T¡G)
CEA_vec25 CTTCCGGCGCACATGGATACCTGCAATCAAGGC Site-directed mutagenesis of BamHI site of VWB integrase,
base changed underlined (C¡A)
CEA_vec26 GCCTTGATTGCAGGTATCCATGTGCGCCGGAAG Site-directed mutagenesis of BamHI site of VWB integrase,
base changed underlined (G¡T)
CEA_vec27 CATGGAATTCGAGCTCGGTAACCGGGAATCCCCGGGTACGC Site-directed mutagenesis of BamHI and KpnI sites of
integrase pSAM2, bases changed underlined (C¡A and
G¡A)
CEA_vec28 GCGTACCCGGGGATTCCCGGTTACCGAGCTCGAATTCCATG Site-directed mutagenesis of BamHI and KpnI sites of
integrase pSAM2, bases changed underlined (C¡T and
G¡T)
CEA_vec_seq_12 TCTGGCAGCACTTTGAGGAC Verification primer, in pSAM2 integrase, towards attP
CEA_vec_seq_15 TTCGATCACGTGGGCGAAGC Verification primer of flp excision
CEA_vec_seq16 TTGCCAAAGGGTTCGTGTAG Verification primer in oriT, towards attP of
␸
C31 or
␸
BT1
integrases
CEA_vec_seq_17 TCAGGTCACTGTCCTGTTTC Verification primer in
␸
BT1 integrase, towards attP
CEA_vec_seq18 AATCTTCGCCGACTTCAGC Verification primer in
␸
C31 integrase, towards attP
CEA_vec_seq_19 GGTTTGAACTTTCCTCCCAATG Verification primer in amilCP cassette, towards attP of
pSAM2 or VWV integrases
CEA_vec_seq_20 GGTGAAGAACCGGGACACC Verification primer in VWB integrase, towards attP
CEA042 GTGGTGTCGCGGAACAGACG Verification primer in M145 and TK23, upstream of
␸
BT1
attB site
CEA043 TCCGCGACGATCCACGAC Verification primer in M145 and TK23, downstream of
␸
BT1
attB site
CEA044 GCGTGGCGTGGACCATC Verification primer in M145 and TK23, upstream of
␸
C31
attB site
CEA045 AATGACCTCCGGGCTTTCG Verification primer in M145 and TK23, downstream of
␸
C31
attB site
CEA046 ACCGGCACCGCATGGCAG Verification primer in M145 and TK23, upstream of pSAM2
attB site
CEA047 ACGGCGCGTGCGGCATC Verification primer in M145 and TK23, downstream of
pSAM2 attB site
(Continued on next page)
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 12

the SpeI site in the terminator downstream of the
␸
BT1 integrase gene at position 40663 in the
␸
BT1
bacteriophage genome sequence, replacingaTwithaG.
Briefly, the plasmid was amplified using the first pair of oligonucleotides with the Phusion polymer-
ase. One microliter of DpnI was added to the reaction mixture to digest the original vector for 2 h at 37°C,
and competent E. coli DH5
␣
cells were transformed with 5
␮
l of the mixture. The second site-directed
mutagenesis was performed by following the same protocol. The sequence of the resulting plasmid was
verified by sequencing, and the plasmid was named pOSV801.
Construction of pOSV802 to pOSV812. The pOSV802 to pOSV812 vectors all were derived from
pOSV800, except for pOSV805 and pOSV809, which were derived from pSV801 (see Fig. S2 in the
supplemental material). The eleven vectors were confirmed by restriction analyses and by sequencing
each fragment obtained by PCR. The
␸
BT1 integration cassette was replaced either by the
␸
C31, VWB,
or pSAM2 integration cassettes, and the aac(3)-IV gene was replaced by either the aph or the aph(7==)
genes. The use of the pSAM2 (from pOSV554 [51]) and VWB integration (from pKT02 [52]) cassette
necessitated the removal of KpnI and BamHI sites and of a BamHI site, respectively. Thus, these cassettes
were first cloned into pCR-Blunt by following the procedure advised by Invitrogen, yielding pCEA003 and
pCEA004, respectively. The BamHI site from the VWB integrase was removed by site-directed mutagen-
esis using the oligonucleotides CEA_025 and CEA_026 by changing base 1008 of the integrase gene
sequence from C to A, thereby keeping the amino acid unchanged (ATC becoming ATA, isoleucine). The
mutation in the resulting plasmid pCEA004 was verified by sequencing. The KpnI and BamHI sites,
located upstream of the integrase pSAM2 coding sequence and only 3 bp apart, were removed in a
single round of site-directed mutagenesis using the oligonucleotides CEA_027 and CEA_028. The
mutations in the resulting plasmid pCEA003 were verified by sequencing.
To replace the
␸
BT1 integration cassette with the
␸
C31 integration cassette in pOSV800, the
␸
C31
integration cassette was amplified by PCR from pSET152 (47) using the oligonucleotides CEA_vec11 and
CEA_vec12. The PCR product was digested by SbfI and AflII and cloned into the SbfI- and AflII-digested
pOSV800, yielding pOSV802. The replacement of the
␸
BT1 integration cassette by the pSAM2 integration
cassette in pOSV800 was executed likewise, cloning the 1.6-kb SbfI/AflII fragment from pCEA003 into the
SbfI- and AflII-digested pOSV800, yielding pOSV803. The same protocol was used to replace the
␸
BT1
integration cassette by the VWB integration cassette in pOSV800, yielding pOSV804.
The replacement of the aac(3)-IV gene (apramycin resistance) with the aph(7==) gene (hygromycin
resistance) or the aph gene (kanamycin resistance) in pOSV802 was carried out by
␭
-Red recombination
TABLE 4 (Continued)
Name Sequence Description
CEA048 GAAAGACGGCCGACCACC Verification primer in M145 and TK23, upstream of VWB attB
site
CEA049 TGCCCGCCCTCTGCATC Verification primer in M145, downstream of VWB attB site
CEA050 CTGTATGCCGCCGTCCCG Verification primer in TK23, downstream of VWB attB site
CEA051 GGTGGTGTCCCGGACCAG Verification primer in J1074, upstream of
␸
BT1 attB site
CEA052 CCGCGACGATCCAGGACC Verification primer in J1074, downstream of
␸
BT1 attB site
CEA053 GGCGTGGATCATGGTGATCG Verification primer in J1074, upstream of
␸
C31 attB site
CEA054 GGTTGCGGGTGGCAAGTAG Verification primer in J1074, downstream of
␸
C31 attB site
CEA055 CGGCCAGCTCTGCATCCC Verification primer in J1074, upstream of pSAM2 attB site
CEA056 CGGATTGTTTGCCGCCTTC Verification primer in J1074, downstream of pSAM2 attB site
CEA057 GCATGCACGGCGACCTG Verification primer in J1074, upstream of VWB attB site
CEA058 GTGACCCTGCCGGGATGG Verification primer in J1074, upstream of VWB attB site
CEA_seq24 ACCATCGCCCACGCATAAC Verification of the loss of pUWLHFLP
Thio_fwd TTGGACACCATCGCAAATC Verification of the loss of pUWLHFLP
CEA036 AAAATGCATGCGGCCGCTGCTAGCGGTGAGGCGCCACCCATCG Amplification albonoursin cluster (sites NsiI, NotI, and NheI
underlined)
CEA038 AAACTTAAGGCGGCCGCTACTAGTCCGCACCATGAGCAAGTGTC Amplification albonoursin cluster (sites AflII, NotI, and SpeI
underlined)
F_pref_rpslp_TP ATGCATGCGGCCGCTTCTAGAGACCGGGTCCGCGATCGGCGG Amplification rpsl(TP)p (sites NsiI, NotI and XbaI underlined)
R_suff_rpslp_TP CTTAAGGCGGCCGCTACTAGTGCTCCCTTCTCAGAAGCGCAGG Amplification rpsl(TP)p (sites AflII, NotI and SpeI underlined)
onCAS001bis GCTGCTAGCTGTTCACATTCGAACCGTCTCTG Amplification SP22 promoter forward (truncated NotI and
NheI underlined)
onCAS002 ATGGACACTCCTTACTTAGAC Amplification SP22 promoter reverse
onCAS003 GTATAGGAACTTCATGCATGCGGCCGCTGCTAGCTGTTCACATTCGAACCG Bridging oligonucleotide between plasmid pOSV812 and
SP22 promoter
Bridge4 ACGGTTTACAAGCATAACTAGTAGCGGCCGCTTAAGGTCGACCCGTCTG Bridging oligonucleotide between T4 terminator and
pOSV812
onCAS007 TGATCCGGTGGATGACCTTTTG Amplification T4 terminator forward
onCAS008bis GCTACTAGTTATGCTTGTAAACCGTTTTG Amplification T4 terminator reverse (truncated NotI and
SpeI underlined)
onCAS031 ATGGCCACCGAGTCCGCCACC Amplification cgc22 forward
onCAS032 CTACCCGCCGTCGCCGTCGC Amplification cgc22 reverse
onCAS033 GAATACGACAGTCTAAGTAAGGAGTGTCCATATGGCCACCGAGTCCGCC Bridging oligonucleotide between SP22 promoter and cgc22
onCAS034 GACGGCGACGGCGGGTAGTGATCCGGTGGATGACCTTTTGAATGAC Bridging oligonucleotide between cgc22 and T4 terminator
on-ori ATTTCAGTGCAATTTATCTCTTC Universal sequencing primer in p15A origin for verification
of the insert
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 13

as described by Gust and colleagues (32). The aph(7==) and aph genes were amplified by PCR using the
oligonucleotides CEA_vec_017 and CEA_vec_018 for aph(7==) and CEA_vec_019 and CEA_vec_020 for
aph, and the PCR products were used to replace the aac(3)-IV gene in pOSV802, yielding pOSV806 and
pOSV810, respectively. The joining sequences were confirmed by sequencing. Sequencing showed that
the sequences of aph and aph(7==) were as predicted, except for base 188 of aph(7==), in which A was
replaced by G, leading to the replacement of Asp (GAC) by Gly (GGC). However, no functional difference
has been observed, and the plasmid confers full resistance to hygromycin.
To replace the aac(3)-IV gene cassette in pOSV801, pOSV803, and pOSV804 with the aph(7==) gene
cassette, the 1.4-kb KpnI/BamHI fragment of pOSV806 was cloned into KpnI/BamHI-digested pOSV801,
pOSV803, and pOSV804, yielding pOSV805, pOSV807, and pOSV808, respectively. Using the same
protocol, the aac(3)-IV gene was replaced in pOSV801, pOSV803, and pOSV804 by the aph gene cassette,
yielding pOSV809, pOSV811, and pOSV812, respectively. The vectors obtained were verified by restriction
analyses.
Verification of the integration of the vectors in Streptomyces species. The 12 vectors constructed
were introduced in three Streptomyces species (Streptomyces coelicolor M145, Streptomyces lividans TK23,
and Streptomyces albus J1074) by intergeneric conjugation by following the standard procedure (42). E.
coli ET12567/pUZ8002 was used as a donor strain for pOSV801 to pOSV808. For pOSV809 to pSOV812,
which confer resistance to kanamycin, we used E. coli S17-1 as a donor strain to perform conjugation with
S. lividans TK23 and S. albus J1074 and E. coli ET12567/pUZ8003 as a donor strain to perform conjugation
with S. coelicolor M145. Genomic DNA was extracted from the exconjugants obtained. To confirm that
the vectors had been integrated into the host chromosomal DNA at the expected sites, PCR 1 and PCR
2 were performed as shown in Fig. 2, using the primers CEA_vec_seq12, CEA_vec_seq_16 –20, and
CEA_42–58. These PCRs amplify a fragment of about 900 bp only if the plasmid is integrated at the
expected chromosomal attB site.
Excision mediated by the flp recombinase. We used M145/pOSV802 to verify that modules 1, 2,
and 3 could be excised using the Flp recombinase once integrated into the chromosome of Streptomyces.
For this purpose, we used the plasmid pUWLHFLP and followed the protocol described previously (33).
pUWLHFLP is similar to pUWLFLP, but the thiostrepton resistance cassette was replaced by a hygromycin
resistance cassette (34). Briefly, pUWLHFLP was introduced by intergeneric conjugation into the strain
M145/pOSV802, and exconjugants were replicated on SFM plates containing 100
␮
g/ml hygromycin.
After one round of liquid culture in tryptic soy broth, stocks of spores were made. Spore dilutions were
plated on SFM supplemented with nalidixic acid, and the clones were screened for loss of apramycin
resistance by replica plating. The loss of the fragment of the vector was subsequently confirmed by
amplifying the fragment around both FRT sites (PCR 3, primers CEA_vec_seq15 and CEA_045 [Fig. 3]),
which was then sequenced. Stocks of spores of the confirmed clones were prepared on SFM supple-
mented with nalidixic acid, and the loss of the helper vector pUWLHFLP was confirmed by PCR (primers
thio-fwd and CEA_seq24).
Construction of pCEA007. The albonoursin gene cluster, constituted of the three genes albA,albB,
and albC, was cloned into pOSV802 and placed under the control of the rpsL(TP) promoter (2)by
following the BioBrick assembly procedure (Fig. S1). The pCEA001 plasmid was used to amplify the
rpsL(TP) promoter sequence followed by the tipA RBS sequence using the primers F_pref_rpslp_TP and
R_suff_rpslp_TP. The PCR product was cloned into pGEM-T Easy, and the resulting plasmid was named
pCEA002. The 0.4-kb NsiI/SpeI-digested fragment of pCEA002 was ligated into NsiI/SpeI-digested
pOSV802, yielding pCEA005. The insert sequence of pCEA005 was confirmed by sequencing. The
albonoursin gene cluster was amplified from pSL128 (35) using the primers CEA036 and CEA038. The PCR
product was digested by NsiI and SpeI and ligated into NsiI/AflII-digested pOSV802, yielding pCEA006.
The sequence of the insert was confirmed by sequencing. pCEA006 was then digested by AflII and NheI
and the 1.8-kb fragment was ligated into the SpeI/AflII-digested pCEA005, yielding pCEA007. The
resulting plasmid, pCEA007, was confirmed by digestion by NotI and by EcoRI/HindIII. This plasmid was
introduced in S. coelicolor M145 by intergeneric conjugation.
Construction of the pCAS008 plasmid. The pCAS008 plasmid, expressing the cgc22 gene under the
control the SP22 promoter (15), was assembled using the ligase cycling reaction as previously described
(53). pOSV812 was digested by NotI, and Klenow was added to the mix in order to obtain blunt ends. The
5-kb fragment was purified on agarose gel. The gene cgc22 was amplified from the cosmid pCGC002 (30)
with the primers onCAS031 and onCAS032.The promoter SP22 was ordered from Eurofins Genomics as
a synthetic gene fragment and amplified with the primers onCAS001bis and onCAS002. The T4 termi-
nator was amplified from the plasmid pOSV215 (54) with the primers onCAS007 and onCAS008bis. The
primers upstream of the promoter SP22 and downstream of the terminator were designed in order to
recreate the BioBrick prefix and suffix (NsiI, NotI, and NheI and SpeI, NotI, and AflII, respectively). All
fragments were then phosphorylated and ligated via ligase cycling reaction. The sequence of the
resulting plasmid pCAS008 was confirmed by sequencing. The pCAS008 plasmid was introduced in S.
lividans CGCL030 by intergeneric conjugation.
LC and LC-MS analyses. For albonoursin production, S. coelicolor M145/pCEA006, M145/pOSV802,
and S. noursei strains were cultivated for 5 days in MP5 medium at 30°C. Supernatants were filtered using
the Mini-UniPrep syringeless filter devices (0.2
␮
m; Whatman). The samples were analyzed on an Atlantis
C
18
T3 column (250 mm by 4.6 mm, 5
␮
m, column temperature of 30°C) using an Agilent 1200 HPLC
instrument equipped with a quaternary pump. The filtrates were eluted using a 0% to 45% linear
gradient of solvent B (solvent A, 0.1% HCOOH in H
2
O; solvent B, 0.1% HCOOH in CH
3
CN) for 45 min (flow
rate, 1 ml/min). Albonoursin was detected by monitoring absorbance at 318 nm (35). A Bruker Daltonics
Esquire HCT ion trap mass spectrometer equipped with an orthogonal atmospheric pressure interface-
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 14

electrospray ionization (AP-ESI) source was used for LC-MS analyses. The LC flow was split 1/10 to the
mass spectrometer and 9/10 to a diode array detector. The ESI source was operated in positive mode
with the nebulizing gas set to a pressure of 241 kPa. The drying gas was set to 8 liters·min
⫺1
, and the
drying temperature was set to 340°C. Nitrogen served as the drying and nebulizing gas, and helium gas
was introduced into the ion trap both for efficient trapping and cooling of the ions and for fragmentation
processes. Ionization and mass analysis conditions (capillary high voltage, skimmer and capillary exit
voltages, and ion transfer parameters) were optimized for detection of compounds in the m/z range of
50 to 600. For structural characterization by fragmentation, an isolation width of 1 mass unit was used.
A fragmentation energy ramp was used for automatically varying the fragmentation amplitude to
optimize the MS/MS process. For LC-MS analyses, filtrates were eluted using a slightly modified gradient:
after 5 min of an isocratic run at 100% buffer A, the concentration of buffer B was linearly increased over
50 min to reach 50%.
For congocidine production, S. lividans CGCL083, CGCL030, and CGCL006 strains were cultivated in
MP5 medium for 4 days at 30°C. Supernatants were filtered using Mini-UniPrep syringeless filter devices
(0.2
␮
m; Whatman). The samples were analyzed on an Atlantis C
18
T3 column (250 mm by 4.6 mm, 5
␮
m,
column temperature of 30°C) using an Agilent 1200 HPLC instrument with a quaternary pump. Samples
were eluted under isocratic conditions of 0.1% HCOOH in H
2
O (solvent A)-0.1% HCOOH in CH
3
CN (solvent
B) (95:5) at 1 ml/min for 7 min, followed by a gradient to 40:60 A:B over 23 min. Congocidine was
detected by monitoring absorbance at 297 nm (30).
SUPPLEMENTAL MATERIAL
Supplemental material for this article may be found at https://doi.org/10.1128/AEM
.00485-19.
SUPPLEMENTAL FILE 1, PDF file, 0.8 MB.
ACKNOWLEDGMENTS
We thank Hervé Leh for critical reading of the manuscript.
The research received funding from ANR-14-CE16-0003-01. The funders had no role
in study design, data collection and interpretation, or the decision to submit the work
for publication.
REFERENCES
1. Yamanaka K, Reynolds KA, Kersten RD, Ryan KS, Gonzalez DJ, Nizet V,
Dorrestein PC, Moore BS. 2014. Direct cloning and refactoring of a silent
lipopeptide biosynthetic gene cluster yields the antibiotic taromycin A.
Proc Natl Acad SciUSA111:1957–1962. https://doi.org/10.1073/pnas
.1319584111.
2. Shao Z, Rao G, Li C, Abil Z, Luo Y, Zhao H. 2013. Refactoring the silent
spectinabilin gene cluster using a plug-and-play scaffold. ACS Synth Biol
2:662– 669. https://doi.org/10.1021/sb400058n.
3. Greunke C, Duell ER, D’Agostino PM, Glöckle A, Lamm K, Gulder T. 2018.
Direct pathway cloning (DiPaC) to unlock natural product biosynthetic
potential. Metab Eng 47:334 –345. https://doi.org/10.1016/j.ymben.2018
.03.010.
4. Bozhüyük KAJ, Fleischhacker F, Linck A, Wesche F, Tietze A, Niesert C-P,
Bode HB. 2018. De novo design and engineering of non-ribosomal
peptide synthetases. Nat Chem 10:275–281. https://doi.org/10.1038/
nchem.2890.
5. Awakawa T, Fujioka T, Zhang L, Hoshino S, Hu Z, Hashimoto J, Kozone I,
Ikeda H, Shin-Ya K, Liu W, Abe I. 2018. Reprogramming of the antimycin
NRPS-PKS assembly lines inspired by gene evolution. Nat Commun
9:3534. https://doi.org/10.1038/s41467-018-05877-z.
6. Baltz RH. 2018. Synthetic biology, genome mining, and combinatorial
biosynthesis of NRPS-derived antibiotics: a perspective. J Ind Microbiol
Biotechnol 45:635– 649. https://doi.org/10.1007/s10295-017-1999-8.
7. Baltz RH. 2014. Combinatorial biosynthesis of cyclic lipopeptide
antibiotics: a model for synthetic biology to accelerate the evolution of
secondary metabolite biosynthetic pathways. ACS Synth Biol 3:748 –758.
https://doi.org/10.1021/sb3000673.
8. Yuzawa S, Mirsiaghi M, Jocic R, Fujii T, Masson F, Benites VT, Baidoo EEK,
Sundstrom E, Tanjore D, Pray TR, George A, Davis RW, Gladden JM,
Simmons BA, Katz L, Keasling JD. 2018. Short-chain ketone production
by engineered polyketide synthases in Streptomyces albus. Nat Commun
9:4569. https://doi.org/10.1038/s41467-018-07040-0.
9. Yuzawa S, Backman TWH, Keasling JD, Katz L. 2018. Synthetic biology of
polyketide synthases. J Ind Microbiol Biotechnol 45:621– 633. https://doi
.org/10.1007/s10295-018-2021-9.
10. Gomez-Escribano JP, Bibb MJ. 2011. Engineering Streptomyces coelicolor
for heterologous expression of secondary metabolite gene clusters.
Microb Biotechnol 4:207–215. https://doi.org/10.1111/j.1751-7915.2010
.00219.x.
11. Komatsu M, Komatsu K, Koiwai H, Yamada Y, Kozone I, Izumikawa M,
Hashimoto J, Takagi M, Omura S, Shin-Ya K, Cane DE, Ikeda H. 2013.
Engineered Streptomyces avermitilis host for heterologous expression of
biosynthetic gene cluster for secondary metabolites. ACS Synth Biol
2:384 –396. https://doi.org/10.1021/sb3001003.
12. Kallifidas D, Jiang G, Ding Y, Luesch H. 2018. Rational engineering of
Streptomyces albus J1074 for the overexpression of secondary metab-
olite gene clusters. Microb Cell Factories 17:25. https://doi.org/10.1186/
s12934-018-0874-2..
13. Myronovskyi M, Rosenkränzer B, Nadmid S, Pujic P, Normand P, Lu-
zhetskyy A. 2018. Generation of a cluster-free Streptomyces albus chassis
strains for improved heterologous expression of secondary metabolite
clusters. Metab Eng 49:316 –324. https://doi.org/10.1016/j.ymben.2018
.09.004.
14. Baltz RH. 2016. Genetic manipulation of secondary metabolite biosyn-
thesis for improved production in Streptomyces and other actinomyce-
tes. J Ind Microbiol Biotechnol 43:343–370. https://doi.org/10.1007/
s10295-015-1682-x.
15. Bai C, Zhang Y, Zhao X, Hu Y, Xiang S, Miao J, Lou C, Zhang L. 2015.
Exploiting a precise design of universal synthetic modular regulatory
elements to unlock the microbial natural products in Streptomyces. Proc
Natl Acad SciUSA112:12181–12186. https://doi.org/10.1073/pnas
.1511027112.
16. Seghezzi N, Amar P, Koebmann B, Jensen PR, Virolle M-J. 2011. The
construction of a library of synthetic promoters revealed some specific
features of strong Streptomyces promoters. Appl Microbiol Biotechnol
90:615– 623. https://doi.org/10.1007/s00253-010-3018-0.
17. Siegl T, Tokovenko B, Myronovskyi M, Luzhetskyy A. 2013. Design,
construction and characterisation of a synthetic promoter library for
fine-tuned gene expression in actinomycetes. Metab Eng 19:98 –106.
https://doi.org/10.1016/j.ymben.2013.07.006.
18. Sohoni SV, Fazio A, Workman CT, Mijakovic I, Lantz AE. 2014. Synthetic
promoter library for modulation of actinorhodin production in Strepto-
Vectors for Synthetic Biology in Streptomyces Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 15

myces coelicolor A3(2). PLoS One 9:e99701. https://doi.org/10.1371/
journal.pone.0099701.
19. Gibson DG, Young L, Chuang R-Y, Venter JC, Hutchison CA, Smith HO.
2009. Enzymatic assembly of DNA molecules up to several hundred
kilobases. Nat Methods 6:343–345. https://doi.org/10.1038/nmeth.1318.
20. de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D,
Shapland EB, Serber Z, Dean J, Newman JD, Chandran SS. 2014. Rapid
and reliable DNA assembly via ligase cycling reaction. ACS Synth Biol
3:97–106. https://doi.org/10.1021/sb4001992.
21. Shao Z, Zhao H, Zhao H. 2009. DNA assembler, an in vivo genetic
method for rapid construction of biochemical pathways. Nucleic Acids
Res 37:e16. https://doi.org/10.1093/nar/gkn991.
22. Basitta P, Westrich L, Rösch M, Kulik A, Gust B, Apel AK. 2017. AGOS: a
plug-and-play method for the assembly of artificial gene operons into
functional biosynthetic gene clusters. ACS Synth Biol 6:817– 825. https://
doi.org/10.1021/acssynbio.6b00319.
23. Shetty RP, Endy D, Knight T. 2008. Engineering BioBrick vectors from
BioBrick parts. J Biol Eng 2:5. https://doi.org/10.1186/1754-1611-2-5.
24. Engler C, Kandzia R, Marillonnet S. 2008. A one pot, one step, precision
cloning method with high throughput capability. PLoS One 3:e3647.
https://doi.org/10.1371/journal.pone.0003647.
25. Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. 2011. A modular
cloning system for standardized assembly of multigene constructs. PLoS
One 6:e16765. https://doi.org/10.1371/journal.pone.0016765.
26. Sarrion-Perdigones A, Vazquez-Vilar M, Palací J, Castelijns B, Forment J,
Ziarsolo P, Blanca J, Granell A, Orzaez D. 2013. GoldenBraid 2.0: a
comprehensive DNA assembly framework for plant synthetic biology.
Plant Physiol 162:1618 –1631. https://doi.org/10.1104/pp.113.217661.
27. Olorunniji FJ, Merrick C, Rosser SJ, Smith MCM, Stark WM, Colloms SD.
2017. Multipart DNA assembly using site-specific recombinases from the
large serine integrase family. Methods Mol Biol 1642:303–323. https://
doi.org/10.1007/978-1-4939-7169-5_19.
28. Silva-Rocha R, Martínez-García E, Calles B, Chavarría M, Arce-Rodríguez A,
de Las Heras A, Páez-Espino AD, Durante-Rodríguez G, Kim J, Nikel PI,
Platero R, de Lorenzo V. 2013. The standard European vector architec-
ture (SEVA): a coherent platform for the analysis and deployment of
complex prokaryotic phenotypes. Nucleic Acids Res 41:D666 –D675.
https://doi.org/10.1093/nar/gks1119.
29. Phelan RM, Sachs D, Petkiewicz SJ, Barajas JF, Blake-Hedges JM, Thomp-
son MG, Reider Apel A, Rasor BJ, Katz L, Keasling JD. 2017. Development
of next generation synthetic biology tools for use in Streptomyces ven-
ezuelae. ACS Synth Biol 6:159 –166. https://doi.org/10.1021/acssynbio
.6b00202.
30. Juguet M, Lautru S, Francou F-X, Nezbedová S, Leblond P, Gondry M,
Pernodet J-L. 2009. An iterative nonribosomal peptide synthetase as-
sembles the pyrrole-amide antibiotic congocidine in Streptomyces am-
bofaciens. Chem Biol 16:421– 431. https://doi.org/10.1016/j.chembiol
.2009.03.010.
31. Alieva NO, Konzen KA, Field SF, Meleshkevitch EA, Hunt ME, Beltran-
Ramirez V, Miller DJ, Wiedenmann J, Salih A, Matz MV. 2008. Diversity
and evolution of coral fluorescent proteins. PLoS One 3:e2680. https://
doi.org/10.1371/journal.pone.0002680.
32. Gust B, Chandra G, Jakimowicz D, Yuqing T, Bruton CJ, Chater KF. 2004.
Lambda red-mediated genetic manipulation of antibiotic-producing
Streptomyces. Adv Appl Microbiol 54:107–128. https://doi.org/10.1016/
S0065-2164(04)54004-2.
33. Fedoryshyn M, Petzke L, Welle E, Bechthold A, Luzhetskyy A. 2008.
Marker removal from actinomycetes genome using Flp recombinase.
Gene 419:43– 47. https://doi.org/10.1016/j.gene.2008.04.011.
34. Siegl T, Luzhetskyy A. 2012. Actinomycetes genome engineering ap-
proaches. Antonie Van Leeuwenhoek 102:503–516. https://doi.org/10
.1007/s10482-012-9795-y.
35. Lautru S, Gondry M, Genet R, Pernodet JL. 2002. The albonoursin gene
cluster of S. noursei: biosynthesis of diketopiperazine metabolites inde-
pendent of nonribosomal peptide synthetases. Chem Biol 9:1355–1364.
https://doi.org/10.1016/S1074-5521(02)00285-5.
36. Holmes DJ, Caso JL, Thompson CJ. 1993. Autogenous transcriptional acti-
vation of a thiostrepton-induced gene in Streptomyces lividans. EMBO J
12:3183–3191. https://doi.org/10.1002/j.1460-2075.1993.tb05987.x.
37. Li Y, Lai Y-M, Lu Y, Yang Y-L, Chen S. 2014. Analysis of the biosynthesis
of antibacterial cyclic dipeptides in Nocardiopsis alba. Arch Microbiol
196:765–774. https://doi.org/10.1007/s00203-014-1015-x.
38. Prentki P, Krisch HM. 1984. In vitro insertional mutagenesis with a
selectable DNA fragment. Gene 29:303–313. https://doi.org/10.1016/
0378-1119(84)90059-3.
39. Morita K, Yamamoto T, Fusada N, Komatsu M, Ikeda H, Hirano N,
Takahashi H. 2009. The site-specific recombination system of acti-
nophage TG1. FEMS Microbiol Lett 297:234 –240. https://doi.org/10
.1111/j.1574-6968.2009.01683.x.
40. Fayed B, Younger E, Taylor G, Smith M. 2014. A novel Streptomyces spp.
integration vector derived from the S. venezuelae phage, SV1. BMC
Biotechnol 14:51. https://doi.org/10.1186/1472-6750-14-51.
41. Fogg PCM, Haley JA, Stark WM, Smith M. 2017. Genome integration and
excision by a new Streptomyces bacteriophage,
␾
Joe. Appl Environ
Microbiol 83:e02767-16. https://doi.org/10.1128/AEM.02767-16.
42. Kieser T, Bibb M, Buttner M, Hopwood DA. 2000. Practical Streptomyces
genetics. John Innes Foundation, Norwich, UK.
43. Pernodet JL, Alegre MT, Blondelet-Rouault MH, Guérineau M. 1993.
Resistance to spiramycin in Streptomyces ambofaciens, the producer
organism, involves at least two different mechanisms. J Gen Microbiol
139:1003–1011. https://doi.org/10.1099/00221287-139-5-1003.
44. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual,
3rd ed. CSHL Press, Cold Spring Harbor, NY.
45. Gregory MA, Till R, Smith M. 2003. Integration site for Streptomyces phage
␸
BT1 and development of site-specific integrating vectors. J Bacteriol 185:
5320 –5323. https://doi.org/10.1128/jb.185.17.5320-5323.2003.
46. Vingadassalon A, Lorieux F, Juguet M, Le Goff G, Gerbaud C, Pernodet
J-L, Lautru S. 2015. Natural combinatorial biosynthesis involving two
clusters for the synthesis of three pyrrolamides in Streptomyces netropsis.
ACS Chem Biol 10:601– 610. https://doi.org/10.1021/cb500652n.
47. Bierman M, Logan R, O’Brien K, Seno ET, Rao RN, Schoner BE. 1992.
Plasmid cloning vectors for the conjugal transfer of DNA from Esche-
richia coli to Streptomyces spp. Gene 116:43– 49. https://doi.org/10.1016/
0378-1119(92)90627-2.
48. Cunningham FX, Pogson B, Sun Z, McDonald KA, DellaPenna D, Gantt E.
1996. Functional analysis of the beta and epsilon lycopene cyclase
enzymes of Arabidopsis reveals a mechanism for control of cyclic caro-
tenoid formation. Plant Cell 8:1613–1626. https://doi.org/10.1105/tpc.8
.9.1613.
49. Gibson DG. 2011. Enzymatic assembly of overlapping DNA fragments.
Methods Enzymol 498:349 –361. https://doi.org/10.1016/B978-0-12-385120-8
.00015-2.
50. Laible M, Boonrod K. 2009. Homemade site directed mutagenesis of
whole plasmids. J Vis Exp 27:1135. https://doi.org/10.3791/1135.
51. Nguyen HC, Karray F, Lautru S, Gagnat J, Lebrihi A, Ho Huynh TD,
Pernodet J-L. 2010. Glycosylation steps during spiramycin biosynthesis
in Streptomyces ambofaciens: involvement of three glycosyltransferases
and their interplay with two auxiliary proteins. Antimicrob Agents Che-
mother 54:2830 –2839. https://doi.org/10.1128/AAC.01602-09.
52. Van Mellaert L, Mei L, Lammertyn E, Schacht S, Anne J. 1998. Site-specific
integration of bacteriophage VWB genome into Streptomyces venezuelae
and construction of a VWB-based integrative vector. Microbiology 144:
3351–3358. https://doi.org/10.1099/00221287-144-12-3351.
53. Chandran S. 2017. Rapid assembly of DNA via ligase cycling reaction
(LCR). Methods Mol Biol 1472:105–110. https://doi.org/10.1007/978-1
-4939-6343-0_8.
54. Raynal A, Karray F, Tuphile K, Darbon-Rongère E, Pernodet J-L. 2006.
Excisable cassettes: new tools for functional analysis of Streptomyces
genomes. Appl Environ Microbiol 72:4839 – 4844. https://doi.org/10
.1128/AEM.00167-06.
55. Flett F, Mersinias V, Smith CP. 1997. High efficiency intergeneric conjugal
transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting
streptomycetes. FEMS Microbiol Lett 155:223–229. https://doi.org/10
.1111/j.1574-6968.1997.tb13882.x.
56. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization
system for in vivo genetic engineering: transposon mutagenesis in gram
negative bacteria. Nat Biotechnol 1:784 –791. https://doi.org/10.1038/
nbt1183-784.
Aubry et al. Applied and Environmental Microbiology
August 2019 Volume 85 Issue 16 e00485-19 aem.asm.org 16