Huanglongbing, Caused by ‘ Candidatus Liberibacter asiaticus,’ Detected in New Locations Across Southern and Coastal Georgia

Abstract

Huanglongbing (HLB) or citrus greening disease is the most devastating disease of citrus worldwide. This disease, caused by the bacterium Candidatus Liberibacter asiaticus (CLas), leads to low fruit quality and unproductive trees. In 2008, HLB was found in a residential citrus tree in Savannah, Georgia, and, as a result, the state has been quarantined for this disease since 2009. Nonetheless, little is known about the distribution of CLas within Georgia, despite the fact that the commercial planting of citrus in Georgia has increased exponentially in recent years. In 2019, 94 samples from commercial and residential citrus trees within 11 counties in coastal and southern Georgia were collected and tested for the presence of CLas. Molecular testing results revealed the presence of CLas in three counties where HLB had not been previously reported and in 9% of samples overall. This is the first definitive report confirming HLB in southern Georgia counties besides those along the coast

Full text

Plant Health Progress ¿2020 ¿21:31–35 https://doi.org/10.1094/PHP-09-19-0064-S
Survey
Huanglongbing, Caused by ‘Candidatus Liberibacter asiaticus,’
Detected in New Locations Across Southern and Coastal Georgia
Jonathan E. Oliver,
1,†
Md Emran Ali,
1
Sumyya Waliullah,
1
Jake Price,
2
Jessica Warren,
3
James Jacobs,
4
Ashley Hoppers,
5
Richard Evans,
6
Michasia Dowdy,
7
and Shane Curry
8
1
Department of Plant Pathology, Coastal Plain Experiment Station, University of Georgia, Tifton, GA 31793
2
University of Georgia Cooperative Extension, Lowndes County, Valdosta, GA 31601
3
University of Georgia Cooperative Extension, Camden County, Woodbine, GA 31569
4
University of Georgia Cooperative Extension, Pierce County, Blackshear, GA 31516
5
University of Georgia Cooperative Extension, Liberty County, Hinesville, GA 31313
6
University of Georgia Cooperative Extension, Bryan County, Pembroke, GA 31321
7
University of Georgia Cooperative Extension, Brooks County, Quitman, GA 31643
8
University of Georgia Cooperative Extension, Appling County, Baxley, GA 31515
Accepted for publication 18 December 2019.
Abstract
Huanglongbing (HLB) or citrus greening disease is the most
devastating disease of citrus worldwide. This disease, caused
by the bacterium ‘Candidatus Liberibacter asiaticus’(CLas),
leads to low fruit quality and unproductive trees. In 2008, HLB
was found in a residential citrus tree in Savannah, Georgia, and,
as a result, the state has been quarantined for this disease since
2009. Nonetheless, little is known about the distribution of
CLas within Georgia, even though the commercial planting of
citrus in Georgia has increased exponentially in recent years. In
2019, 94 samples from commercial and residential citrus trees
within 11 counties in coastal and southern Georgia were
collected and tested for the presence of CLas. Molecular
testing results revealed the presence of CLas in three counties
where HLB had not been previously reported and in 9% of
samples overall. This is the first definitive report confirming
HLB in southern Georgia counties besides those along the
coast.
Keywords: huanglongbing, HLB, citrus greening, ‘Candidatus
Liberibacter asiaticus’
The citrus industry in Georgia has grown exponentially in recent
years. According to information presented at the 2019 Georgia
Citrus Association Conference in Tifton, over 71,000 citrus trees
are expected to be planted in Georgia during 2019 (Price 2019).
This is a marked increase after an estimated 29,000 new trees were
planted in 2018, 20,000 trees in 2017, 8,500 trees in 2016, and
4,500 trees in each of 2015, 2014, and 2013. Altogether, this would
potentially represent nearly 1,000 acres of citrus in Georgia,
whereas in 2012 there was virtually no commercial citrus pro-
duction in the state. This rapid expansion is primarily due to market
opportunities available for satsumas and other “cold hardy”citrus to
fill the citrus production niche left behind by the extended decline in
Florida citrus production resulting from huanglongbing (HLB) (also
called citrus greening disease).
In the United States, HLB is thought to be caused by the bac-
terium ‘Candidatus Liberibacter asiaticus’(CLas) (Gottwald et al.
2007). Infection with this bacterial species results in disruption of
phloem transport throughout the tree, leading to premature fruit
drop, lower fruit quality, and higher tree mortality (Fig. 1A and B)
(Gottwald et al. 2007). CLas is vectored by the Asian citrus psyllid
(ACP) (Fig. 1C), an invasive species first found in homeowner
citrus in southern Florida in 1998 (Dewdney et al. 2019; Gottwald
et al. 2007). Since first being detected in 2005, HLB has spread
throughout Florida, where it is estimated that over 80% of Florida’s
citrus trees are currently infected (Singerman and Useche 2019).
This has led to a more than 70% decline in citrus production in
Florida (NASS 2019). In 2008, HLB was found in a residential
citrus tree in Savannah, Georgia, and, as a result, the state has been
under USDA-APHIS quarantine for this disease since 2009 (APHIS
2009). The psyllid vector has been previously found in all counties
along Georgia’s Atlantic coast, and it was identified in Lowndes
and Charlton counties in 2018. Prior to 2019, isolated testing of
residential citrus trees has indicated the presence of HLB in Camden
and Chatham counties, but the disease had not been reported in
Georgia outside of these two counties, nor within commercial citrus
plantings. The potential of CLas to spread to commercial plants
from infected, isolated residential trees along the coast is a grave
threat to Georgia’s fledgling citrus industry; however, extensive
HLB surveys have not been conducted within the state. Therefore,
we sampled and tested citrus trees from selected counties in
southern and coastal Georgia to better understand the distribution of
CLas in Georgia.
†
Corresponding author: J. E. Oliver; jonathanoliver@uga.edu
Funding: This research was partially supported by the USDA National Institute of
Food and Agriculture (Hatch project no. 1016575), by the University of Georgia
Cooperative Extension (Extension Innovation Grant), and by the University of
Georgia Department of Plant Pathology.
The author(s) declare no conflict of interest.
© 2020 The American Phytopathological Society
PLANT HEALTH PROGRESS ¿2020, Vol. 21, No. 1 ¿Page 31

Sampling and Identification of CLas
In May through August 2019, citrus leaf samples were collected
from selected residential and commercial citrus sites in southern and
coastal Georgia. Samples were collected, preferentially, from
symptomatic trees where available, and a few trees showing typical
symptoms of HLB were identified and sampled during the course of
the survey (Fig. 1A and B). In total, 94 samples were tested for CLas
from eight commercial and 21 residential sites in 11 Georgia
counties. Samples were initially tested by conventional PCR using
primer set OI1/OI2c (Table 1) targeting CLas 16S rDNA (Jagoueix
et al. 1996). Genomic DNA was extracted from infected leaf
petioles and midribs using the Qiagen DNeasy Plant Mini Kit
(Qiagen, Germantown, MD), and 100 ng was used as a PCR
template for CLas testing. PCR reactions were performed on a Bio-
Rad 96-well T100 thermocycler (Bio-Rad, Hercules, CA) using
EconoTaq PLUS GREEN 2× Master Mix (Lucigen, Madison, WI)
based on the manufacturer’s protocol with some minor modifica-
tions. The reaction conditions were as follows: 1 cycle of 95°C for
3 min; 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min;
followed by 1 cycle of 72°C for 5 min. PCR products (5 ml) were
analyzed on a 1% agarose gel (1× TBE buffer) and visualized using
a UVP UVsolo touch gel doc machine (Analytik Jena US, Upland,
CA). Samples testing positive for CLas by PCR in initial testing
were retested for confirmation by real-time PCR according to the
current USDA-APHIS protocol for detection of HLB. This protocol
targets a conserved partial sequence of the ribonucleotide reductase
(RNR) gene present in five copies per CLas genome (Zheng et al.
2016) (Table 1). This was duplexed with the plant cytochrome
oxidase (COX) internal positive control (Table 1) using a Cepheid
smart cycler II (Sunnyvale, CA) (Li et al. 2006). Each reaction
mixture contained 3 µl of RNR and COX primer-probe mix (240
nM each primer and 120 nM each probe), 2.5 ml of 10× PCR buffer
(1×), 3.0 ml of MgCl
2
(50 mM), 0.6 ml of dNTPs (10 mM each), 0.2
ml of Platinum Taq DNA Polymerase (Invitrogen) (5U/ml), 2 mlof
DNA, and 13.7 ml of molecular-grade water. Optimal thermocy-
cling conditions were used for all reactions beginning with an initial
denaturing step of 95°C for 20 s with optics off, followed by 40
cycles of 95°C for 1 s and optics off, 60°C for 40 s with optics on,
and a temperature ramping rate of 5°C/s for the entire protocol. Prior
to test sample evaluation for each PCR assay, all controls were
determined to be valid based upon the following criteria: (i) there
was no detection in the nontemplate control, and (ii) in the sample
internal control, the TET Ct value of the COX internal control was
between 12.00 and 28.00. Samples in which CLas was detected
were determined to be positive if the FAM Ct £38.00.
HLB Is Present in Residential Citrus Within the Coastal
Plain Region of Georgia
In total, 8/94 (9%) samples tested positive for CLas by PCR and
real-time PCR, with 4/11 (36%) counties and 5/29 (17%) sites
having at least one positive sample (Tables 2 and 3; Fig. 2). The
collected samples included a diversity of different citrus species and
hybrids including satsuma, lemon, grapefruit, orange, kumquat,
tangerine, calamondin, pomelo, and sour orange. The eight samples
testing positive included three satsuma, two lemon, one orange, one
grapefruit, and one kumquat sample. Of the 94 samples tested, 67
came from residential sites and 27 from commercial sites. All eight
samples testing positive for CLas came from noncommercial sites
(Table 2). These consisted of four residential sites and one public
school site across four counties. HLB had not been previously
reported in three of these counties where CLas-positive trees were
detected in 2019 (Lowndes, Pierce, and Bryan). Of the eight
FIGURE 1
A, Huanglongbing (HLB) symptoms on citrus tree in Camden County,
Georgia. Photo by J. Oliver. B, HLB symptoms on citrus tree in Pierce County,
Georgia. Photo by J. Oliver. C, Asian citrus psyllid (Diaphorina citri) feeding on
new growth on citrus tree in Camden County, Georgia. Photo by R. Evans.
PLANT HEALTH PROGRESS ¿2020, Vol. 21, No. 1 ¿Page 32

TABLE 2
Residential sampling locations in Georgia, citrus species, and ‘Candidatus Liberibacter asiaticus’(CLas) testing results
County Orchard site Samples collected Citrus type (scientific name) Positive for CLas/total
Bryan Residential 1 5 Lemon (Citrus limon) 0/2 (0%)
Orange (Citrus ×sinensis) 1/2 (50%)
Satsuma (Citrus unshiu) 0/1 (0%)
Camden Residential 1 5 Kumquat (Citrus japonica) 0/3 (0%)
Grapefruit (Citrus ×paradise) 0/2 (0%)
Residential 2 5 Lemon (Citrus limon) 0/2 (0%)
Pomelo (Citrus maxima) 0/1 (0%)
Satsuma (Citrus unshiu) 0/1 (0%)
Tangerine (Citrus reticulata) 0/1 (0%)
Residential 3 12 Satsuma (Citrus unshiu) 0/4 (0%)
Orange (Citrus ×sinensis) 0/1 (0%)
Calamondin (Citrus microcarpa) 0/1 (0%)
Grapefruit (Citrus ×paradise) 0/2 (0%)
Kumquat (Citrus japonica) 0/1 (0%)
Lemon (Citrus limon) 1/2 (50%)
Tangelo (Citrus ×tangelo) 0/1 (0%)
Residential 4 3 Grapefruit (Citrus ×paradise) 1/1 (100%)
Lemon (Citrus limon) 1/1 (100%)
Satsuma (Citrus unshiu) 1/1 (100%)
Charlton Residential 1 1 Orange (Citrus ×sinensis) 0/1 (0%)
Residential 2 1 Satsuma (Citrus unshiu) 0/1 (0%)
Residential 3 1 Lemon (Citrus limon) 0/1 (0%)
Glynn Residential 1 1 Orange (Citrus ×sinensis) 0/1 (0%)
Liberty Residential 1 3 Satsuma (Citrus unshiu) 0/1 (0%)
Sour orange (Citrus ×aurantium) 0/1 (0%)
Lemon (Citrus limon) 0/1 (0%)
Residential 2 3 Satsuma (Citrus unshiu) 0/3 (0%)
Residential 3 2 Satsuma (Citrus unshiu) 0/2 (0%)
Residential 4 2 Satsuma (Citrus unshiu) 0/2 (0%)
Long Residential 1 2 Lemon (Citrus limon) 0/1 (0%)
Satsuma (Citrus unshiu) 0/1 (0%)
Residential 2 5 Lemon (Citrus limon) 0/1 (0%)
Satsuma (Citrus unshiu) 0/4 (0%)
Lowndes Residential 1 1 Satsuma (Citrus unshiu) 0/1 (0%)
Residential 2 2 Grapefruit (Citrus ×paradise) 0/2 (0%)
Research 1 2 Satsuma (Citrus unshiu) 0/2 (0%)
School 1 6 Orange (Citrus ×sinensis) 0/1 (0%)
Satsuma (Citrus unshiu) 1/5 (20%)
Pierce Residential 1 3 Satsuma (Citrus unshiu) 1/2 (50%)
Kumquat (Citrus japonica) 1/1 (100%)
Tift Residential 1 2 Satsuma (Citrus unshiu) 0/2 (0%)
Totals 21 sites 67 samples 8/67 (12%)
TABLE 1
Primers and probe sequences used for conventional PCR and real-time PCR
Assay Primer Target gene Sequence 59-39Reference
PCR OI1 16S rDNA gene GCGCGTATGCAATACGAGCGGCA Jagoueix et al. (1996)
OI2c GCCTCGCGACTTCGCAACCCAT
qPCR RNR1-F Ribonucleotide reductase (RNR) gene CATGCTCCATGAAGCTACCC Zheng et al. (2016)
RNR1-R GGAGCATTTAACCCCACGAA
RNR-Probe 5-FAM/CCTCGAAATCGCCTATGCAC/3BHQ-1
COXf Plant cytochrome oxidase (COX) gene GTATGCCACGTCGCATTCCAGA Li et al. (2006)
COXr GCCAAAACTGCTAAGGGCATTC
COXprobe 5-TET/ATCCAGATGCTTACGCTGG/3BHQ-2
PLANT HEALTH PROGRESS ¿2020, Vol. 21, No. 1 ¿Page 33

samples testing positive for CLas, six of the eight were sampled
from trees with apparent HLB symptoms. Of note, the satsuma tree
from Lowndes County that tested positive for CLas was one of six
trees at the public school site where ACP was first identified in
Lowndes County in 2018. Despite testing positive for CLas, this
tree was asymptomatic and appeared healthy at the time of testing.
Among the other counties where CLas was detected in this survey,
the ACP had been previously detected in both Camden and Bryan
counties. In fact, ACP adults were seen at the time of sampling at
Camden site “Residential 4”, where symptomatic, CLas-positive
grapefruit, lemon, and satsuma trees were observed (Fig. 1A and C).
Two trees at the Pierce County site “Residential 1”tested positive
TABLE 3
Commercial sampling locations in Georgia, citrus species, and ‘Candidatus Liberibacter asiaticus’(CLas) testing results
County Orchard site Samples collected Species (scientific name) Positive for CLas/total
Appling Commercial 1 5 Satsuma (Citrus unshiu) 0/5 (0%)
Brooks Commercial 1 8 Satsuma (Citrus unshiu) 0/8 (0%)
Commercial 2 9 Satsuma (Citrus unshiu) 0/9 (0%)
Pierce Commercial 1 1 Satsuma (Citrus unshiu) 0/1 (0%)
Commercial 2 1 Satsuma (Citrus unshiu) 0/1 (0%)
Commercial 3 1 Satsuma (Citrus unshiu) 0/1 (0%)
Commercial 4 1 Satsuma (Citrus unshiu) 0/1 (0%)
Commercial 5 1 Satsuma (Citrus unshiu) 0/1 (0%)
Totals 8 sites 27 samples 0/27 (0%)
FIGURE 2
Georgia counties where citrus samples were collected and tested for ‘Candidatus Liberibacter asiaticus’(CLas). Gray indicates counties surveyed in 2019 with no
CLas-positive samples. Red indicates counties where CLas-positive samples were detected through this survey (Bryan, Camden, Lowndes, and Pierce) or were
previously verified by USDA testing (Chatham).
PLANT HEALTH PROGRESS ¿2020, Vol. 21, No. 1 ¿Page 34

for CLas in our survey. Both of these (one satsuma and one
kumquat) are established trees (over 30 years old), and the satsuma
tree is showing clear symptoms of blotchy mottle, chlorosis, and
decline due to HLB (Fig. 1B). To date, no ACP has been detected at
this location, nor elsewhere in Pierce County. However, given the
close proximity of the two CLas-positive trees, ACP-mediated
transmission cannot be ruled out as the source of infection at
this location.
Discussion and Conclusion
Based upon our results and prior USDA testing results from
Chatham County, HLB is now present in residential citrus trees in
at least five counties within the coastal plain of Georgia (Bryan,
Chatham, Camden, Lowndes, and Pierce). Furthermore, it is likely to
be present elsewhere in coastal Georgia where the psyllid vector has
been previously identified. Commercial citrus production in Georgia
using “cold hardy”citrus is still in its infancy; however, the presence
of HLB in residential citrus trees represents a threat to nearby
commercial production. Currently, it is estimated that there may be
as many as 100 predominantly small (<5 acres) commercial citrus
plantings spread across Georgia’s coastal plain. Although these
commercial plantings tend to be relatively isolated from one other,
residential citrus trees are common in many locales throughout
the region and may harbor the disease. Effectively, residential citrus
trees may “bridge the gap”between otherwise isolated commercial
plantings. Our findings suggest that in addition to establishing their
plantings with HLB-free citrus stock, commercial growers must
vigilantly monitor new plantings within the coastal plain of Georgia
for both HLB and ACP. Residents with HLB-infected trees are
encouraged to remove them to prevent further spread of this disease.
Acknowledgments
We thank the members of the University of Georgia Molecular Diag-
nostic Lab as well as Kippy Lewis for their help with sample collection and
processing.
Literature Cited
Animal and Plant Health Inspection Service (APHIS). 2009. Confirmation of
citrus greening in Chatham County, Georgia. Retrieved on September 4,
2019, from https://www.aphis.usda.gov/plant_health/plant_pest_info/citrus_
greening/downloads/pdf_files/spro/DA-2009-26.pdf
Dewdney, M. M., Vashisth, T., and Diepenbrock, L. M. 2019. 2019–2020 Florida
Citrus Production Guide: Huanglongbing (Citrus Greening). Publication PP-
225. UF/IFAS Extension, Gainesville, FL. https://edis.ifas.ufl.edu/cg086.
Gottwald, T. R., da Graça, J. V., and Bassanezi, R. B. 2007. Citrus huanglongbing:
The pathogen and its impact. Plant Health Prog. 8. doi: 10.1094/PHP-2007-
0906-01-RV.
Jagoueix, S., Bove, J. M., and Garnier, M. 1996. PCR detection of the two
‘Candidatus’Liberobacter species associated with greening disease of citrus.
Mol. Cell. Probes 10:43-50.
Li, W., Hartung, J. S., and Levy, L. 2006. Quantitative real-time PCR for
detection and identification of Candidatus Liberibacter species associated
with citrus huanglongbing. J. Microbiol. Methods 66:104-115.
National Agricultural Statistics Service (NASS). 2019. Florida citrus statistics
2017-2018. Retrieved on September 4, 2019, from https://www.nass.usda.
gov/Statistics_by_State/Florida/Publications/Citrus/Citrus_Statistics/2017-
18/fcs1718.pdf.
Price, J. 2019. Citrus in Georgia. Third Annual Georgia Citrus Association Conference.
February 25, 2019. UGA-Tifton Conference Center, Tifton, GA. Retrieved on
September 4, 2019, from https://www.squeezethedayga.com/conference
Singerman, A., and Useche, P. 2019. Impact of Citrus Greening on Citrus
Operations in Florida. Publication FE983. UF/IFAS Extension, Gainesville,
FL. https://edis.ifas.ufl.edu/fe983.
Zheng, Z., Xu, M., Bao, M., Wu, F., Chen, J., and Deng, X. 2016. Unusual five
copies and dual forms of nrdB in “Candidatus Liberibacter asiaticus”: Bi-
ological implications and PCR detection application. Sci. Rep. 6:39020.
PLANT HEALTH PROGRESS ¿2020, Vol. 21, No. 1 ¿Page 35