The dishwasher rubber seal acts as a reservoir of bacteria in the home environment

Abstract

Background:
In modern lifestyles, people make their everyday tasks easier by using household appliances, for example dishwashers. Previous studies showed massive contamination of dishwasher rubber seals with fungi, thus bacterial community, able to survive under harsh conditions, remain undetermined.

Methods:
Bacteria that colonise the extreme environment of household dishwasher rubber seals were investigated using cultivation-dependent and metagenomic approaches. All bacterial isolates were tested for resistance to seven selected antibiotics. Same time bacterial diversity of tap water, connected to the dishwashers was investigated.

Results:
All 30 dishwashers investigated were colonised by various bacteria. Cultivation approaches resulted in 632 bacterial isolates in total, belonging to four phyla, eight classes, 40 genera and 74 species. The majority were Gram-positive, as solely Firmicutes (dominated by the Bacillus cereus group) and Actinobacteria. Gammaproteobacteria were primarily represented by Stenotrophomonas maltophilia, Pseudomonas aeruginosa and Escherichia coli. Metagenomic assessment of the bacterial biodiversity of the dishwasher rubber seals confirmed the predominance of Gram-positive bacteria, as primarily Actinobacteria, followed by Proteobacteria dominated by Gammaproteobacteria, and by pathogenic species such as Escherichia sp., Acinetobacter baumannii, Pseudomonas sp., Stenotrophomonas maltophilia, and Enterobacter sp.. Metagenomic assessment of bacterial biodiversity in the tap water connected to dishwashers revealed predominance of Gram-negative bacteria, in particular Proteobacteria, mainly represented by Tepidimonas sp.. Actinobacteria showed low numbers while no Firmicutes were detected in the tap water. The bacterial diversity of tap water was also lower, 23 genera compared to 39 genera on dishwasher rubber seals. Only 13 out of 49 genera identified by metagenomics approach was found in both environments, of those Gordonia was enriched while half of 13 genera were depleted in dishwashers compared to tap water.

Conclusions:
These data indicate that colonisation of dishwasher rubber seals probably depends primarily on the bacterial input from the dirty vessels, and much less on the bacteria in the tap water. Based on the antibiotic resistance data, the dishwasher rubber seal bacterial isolates do not represent a serious threat for the spread of antibiotic resistance into the household environment. Nevertheless dishwashers cannot be ignored as potential sources of human infections, in particular for immuno-compromised individuals.

Full text

R E S E A R C H A R T I C L E Open Access
The dishwasher rubber seal acts as a
reservoir of bacteria in the home
environment
Jerneja Zupančič
1*
, Martina Turk
1
, Miha Črnigoj
1
, Jerneja AmbrožičAvguštin
1
and Nina Gunde-Cimerman
1,2
Abstract
Background: In modern lifestyles, people make their everyday tasks easier by using household appliances, for
example dishwashers. Previous studies showed massive contamination of dishwasher rubber seals with fungi, thus
bacterial community, able to survive under harsh conditions, remain undetermined.
Methods: Bacteria that colonise the extreme environment of household dishwasher rubber seals were investigated
using cultivation-dependent and metagenomic approaches. All bacterial isolates were tested for resistance to seven
selected antibiotics. Same time bacterial diversity of tap water, connected to the dishwashers was investigated.
Results: All 30 dishwashers investigated were colonised by various bacteria. Cultivation approaches resulted in 632
bacterial isolates in total, belonging to four phyla, eight classes, 40 genera and 74 species. The majority were Gram-
positive, as solely Firmicutes (dominated by the Bacillus cereus group) and Actinobacteria. Gammaproteobacteria
were primarily represented by Stenotrophomonas maltophilia,Pseudomonas aeruginosa and Escherichia coli.
Metagenomic assessment of the bacterial biodiversity of the dishwasher rubber seals confirmed the predominance
of Gram-positive bacteria, as primarily Actinobacteria, followed by Proteobacteria dominated by Gammaproteobacteria,
and by pathogenic species such as Escherichia sp., Acinetobacter baumannii,Pseudomonas sp., Stenotrophomonas
maltophilia,andEnterobacter sp.. Metagenomic assessment of bacterial biodiversity in the tap water connected to
dishwashers revealed predominance of Gram-negative bacteria, in particular Proteobacteria, mainly represented by
Tepidimonas sp.. Actinobacteria showed low numbers while no Firmicutes were detected in the tap water. The
bacterial diversity of tap water was also lower, 23 genera compared to 39 genera on dishwasher rubber seals. Only 13
out of 49 genera identified by metagenomics approach was found in both environments, of those Gordonia was
enriched while half of 13 genera were depleted in dishwashers compared to tap water.
Conclusions: These data indicate that colonisation of dishwasher rubber seals probably depends primarily on the
bacterial input from the dirty vessels, and much less on the bacteria in the tap water. Based on the antibiotic resistance
data, the dishwasher rubber seal bacterial isolates do not represent a serious threat for the spread of antibiotic
resistance into the household environment. Nevertheless dishwashers cannot be ignored as potential sources of
human infections, in particular for immuno-compromised individuals.
Keywords: Kitchen, Dishwasher, Bacteria, Antibiotic resistance, Tap water
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
* Correspondence: jerneja.zupancic@bf.uni-lj.si
1
Department of Biology, Biotechnical Faculty, University of Ljubljana,
Ljubljana, Slovenia
Full list of author information is available at the end of the article
Zupančičet al. BMC Microbiology (2019) 19:300
https://doi.org/10.1186/s12866-019-1674-5
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Background
Humans have modified the environment in which they
live throughout their entire history. As a consequence,
indoor dwellings have become increasingly isolated from
the outdoor environment [55], and subject to increased
sanitation due to intensive use of chemicals and disinfec-
tants. As nowadays we spend most of our time indoors,
conditions in these indoor environments are increasingly
influencing our health [14,28,36,50].
On the other hand, stress tolerance and the great
adaptability of some microorganisms means that they
can inhabit novel habitats that have previously been con-
sidered as hostile to abundant microbial growth [24].
Surveys of indoor habitats have, for example, uncovered
a surprising diversity of polyextremotolerant opportunis-
tic and pathogenic bacteria [17,18] and fungi [27].
In these indoor habitats, the microbes are exposed to
conditions that are similar to those encountered in na-
ture, but are nevertheless different in important details.
Kitchens are characterised by the presence of running
water, food remains, frequent contact with humans, and
intense use of chemicals and disinfectants [20,43], and
can be heavily colonised by bacteria and other microbes
[19,20,47,48,57,61]. These adapted microorganisms
invade not only different surfaces and wet environments
in the kitchen [20], but also within household appliances.
Domestic dishwashers as an environment were not
considered to pose any threat to humans until Zalar
et al. [70] revealed heavy contamination of dishwasher
rubber seals with selected opportunistic pathogenic fungi
[13,23,71]. This fungal contamination was not limited
to the rubber seals, but was spread over the entire interiors
of the dishwashers, which provided an environment that in-
fluenced the microbiota throughout the kitchen [71].
Besides fungi, also bacteria can contaminate dishwashers
as revealed in limited studies focusing on dishwasher bac-
terial contamination [52,53,72]. Surprisingly, the prevous
studies performed on bacteria in dishwashers were
focused on dishwasher sanitising performance, in terms of
the determination of the survival of certain selected patho-
genic bacterial species during the washing cycle and on
the washed eating utensils [40,46,62].
The present study was thus focused on the diversity of
the bacterial communities that might be found to col-
onise dishwasher rubber seals, with the sampling of 30
randomly picked household dishwashers, and in the
tap water systems connected to them, using both
cultivation-dependent and metagenomic approaches.
As a significant number of people are affected by
infections each year that are caused by antibiotic-
resistant bacteria, which very often cause severe
complications or death, all of the bacterial isolates ob-
tained from these dishwasher seals were tested for re-
sistance to a selection of antibiotics.
Results
Dishwasher rubber seals are populated with diverse
bacterial communities dominated by gram-positive
bacteria
All 30 sampled residential dishwasher rubber seals were
colonised by bacteria. In total, 632 bacterial isolates were
obtained that belonged to four phyla, eight classes, 40
genera and 74 species (Table 1). On average, the dish-
washers were contaminated with four to eight different
bacterial species, while three of the 30 dishwashers
showed higher cultivable bacterial diversity, as 15, 17
and 22 different bacterial species were isolated from
three separate dishwasher rubber seals (Additional file 1:
Table S1).
Sixty-five percent (48/74) of the isolated species were
Gram-positive, which were represented solely by Firmi-
cutes and Actinobacteria. Class Bacilli represented 50%
(24/48) of all Gram-positive isolates. The remaining 35%
(26/74) of the isolate species were Gram-negative, and
these were most abundantly represented by class
Gammaproteobacteria (65%; 17/26) (Table 1). On aver-
age, the dominant classes were represented by Bacilli
(53%), Actinobacteria (16%) and Gammaproteobacteria
(23%) (Fig. 1).
The Bacillus cereus group is the dominant contaminant of
the dishwasher rubber seals
Bacilli (Firmicutes), as primarily the Bacillus cereus
group, the Bacillus subtilis group, Bacillus flexus,
Bacillus sp. and Paenibacillus sp. were most frequently
isolated from the dishwasher rubber seals (Table 1). The
overall predominance was for isolates of the B. cereus
group, which were isolated from 80% (24/30) of the
dishwashers sampled. The second most commonly iso-
lated species were Bacillus sp. and B. flexus (both 47%;
14/30), followed by the B. subtilis group and Paenibacil-
lus sp. (43%; 13/30). Amongst Actinobacteria, Micrococ-
cus luteus was most frequent (30%; 9/30), followed by
Micrococcus sp. (20%; 6/30) and Brevibacterium casei
(17%; 5/30). Gammaproteobacteria were primarily repre-
sented by Stenotrophomonas maltophilia (33%; 10/30),
Pseudomonas aeruginosa and Escherichia sp. (both 20%;
6/30) (Fig. 1).
Metagenomic assessment of bacterial biodiversity from
dishwasher rubber seals confirms predominance of gram-
positive bacteria
To gain further insight into the diversity of the non-
cultivable part of the bacterial communities that
inhabited these dishwasher rubber seals, pyrosequenc-
ingwasperformedforthe16SrRNAgenefromDNA
isolated from the biofilms on the dishwasher rubber
seals and from the tap water connected to the dish-
washers. Analysis of these metagenomic data resulted
Zupančičet al. BMC Microbiology (2019) 19:300 Page 2 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Table 1 Bacterial species found across the 30 sampled dishwasher rubber seals
Phylum Class Genus Species Dishwasher
123456789101112131415192021222324252728293031323334
Proteobacteria Alphaproteobacteria Rhizobium radiobacter xx
Ochrobactrum sp. x x
Brevundimonas diminuta x
Roseomonas cervicalis xx
Sphingomonas mucosissima x
paucimobilis xx
Betaproteobacteria Achromobacter insolitus x
Comamonas aquatica x
Gammaproteobacteria Acinetobacter calcoaceticus xx x
junii x
ursingii x
Acinetobacter sp. x x x
Pseudomonas aeruginosa xx x x x x
pseudoalcaligenes xx xxx
stutzeri xx
Pseudomonas sp. x x x x
Cronobacter sakazakii xx
Enterobacter sp. x x x x
Escherichia sp. x x x x x x
Escherichia hermannii x
Klebsiella oxytoca xx x
pneumoniae xx x x
Pantoea agglomerans x
Raoultella ornithinolytica xx x
Stenotrophomonas maltophilia xx xxxx x xxx
Firmicutes Bacilli Bacillus amyloliquefaciens xxx
cereus group xxxxxx xxx x x x x x x x x x x x x x x x
circulans x
firmus x
flexus x xx xxx xxx xx x x x
horneckiae xx
licheniformis x
Zupančičet al. BMC Microbiology (2019) 19:300 Page 3 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Table 1 Bacterial species found across the 30 sampled dishwasher rubber seals (Continued)
Phylum Class Genus Species Dishwasher
123456789101112131415192021222324252728293031323334
pumilus xx xx xx
safensis xxx
subtilis group x x x x x x x x x x x x x
Bacillus sp. xxxxxxxxxxxxxx
Brevibacillus parabrevis xx
Paenibacillus sp. x xxx x x xx xxxx
Staphylococcus pasteuri x
saprophyticus xxxx
succinus x
Staphylococcus sp. x x x
Kurthia gibsonii xx x
Lysinibacillus fusiformis xx x xxx
Exiguobacterium sp. x x x x x x x x x
Aerococcus viridans xx
Aerococcus sp. x x
Enterococcus casseliflavus xx x x x x x x x
faecium xx
Clostridia Clostridium xylanolyticum x
Bacterioidetes Flavobacteria Chryseobacterium sp. x x x x
Flavobacterium lindanitolerans x
Sphingobacteria Sphingobacterium multivorum x
Actinobacteria Actinobacteria Aeromicrobium sp. x
Gordonia bronchialis x
paraffinivorans xxx
polyisoprenivorans x
terrae x
Brachybacterium sp. x
Brevibacterium casei xxxx x
sanguinus x
Corynebacterium sp. x
Kocuria kristinae x
rhizophila x
Zupančičet al. BMC Microbiology (2019) 19:300 Page 4 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Table 1 Bacterial species found across the 30 sampled dishwasher rubber seals (Continued)
Phylum Class Genus Species Dishwasher
123456789101112131415192021222324252728293031323334
Microbacterium aurum x
lacticum x
oxydans xx
Microbacterium sp. x
Micrococcus luteus xxx x x xxx x
Micrococcus sp. x x x x x x
Cellulosimicrobium cellulans xx x
Naumannella halotolerans x
Zupančičet al. BMC Microbiology (2019) 19:300 Page 5 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

in 4638 reads assigned to OTUs from the dishwasher bio-
films, and 1503 reads assigned to OTUs from the water
samples (Fig. 2, Additional file 1: Table S2). The majority
of the OTUs from the biofilms were assigned to Gram-
positive bacteria (76%), and primarily to phylum Actino-
bacteria (70%), which was mainly represented by Gordonia
sp. (66%), followed by 14 other genera. Proteobacteria
were the second most common bacterial phylum (14%),
with a predominance of Gammaproteobacteria (73%)
where opportunistic pathogenic species such as Escheri-
chia sp., Acinetobacter baumannii,Pseudomonas sp.,
Stenotrophomonas maltophilia and Enterobacter sp. were
detected, together with 3 other genera. Other abundant
sequences were affiliated to the phylum Firmicutes (6%),
out of which Exiguobacterium sp. was the most numerous
representative (51%).
Fig. 1 Diversity and abundance of the bacterial species isolated from the swab samples from the 30 residential dishwasher rubber seals. The
most represented phylum was Firmicutes (54%), followed by Proteobacteria (28%), Actinobacteria (16%) and Bacteroidetes (2%). The dominant
classes were Bacilli (53%), Actinobacteria (16%) and Gammaproteobacteria (23%)
Zupančičet al. BMC Microbiology (2019) 19:300 Page 6 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Metagenomic assessment of bacterial biodiversity in the
tap water reveals apredominance of gram-negative
bacteria
The metagenomics analysis of the tap water samples
demonstrated the prevalence of OTUs assigned to
Gram-negative bacteria (95%), among which Proteobac-
teria (95%) in particular were detected (Fig. 2, Additional
file 1: Table S2). Betaproteobacteria were the most abun-
dant (62%) among Proteobacteria, but were mainly rep-
resented by Tepidimonas sp. (92%), followed by 4 other
genera. Actinobacteria were present in low numbers
(2%, 3 genera) while Firmicutes were not present at all
in tap water. Both Alphaproteobacteria and Betaproteo-
bacteria were markedly more present in the tap water
(85%; 352/1503 OTUs plus 929/1503 OTUs, respect-
ively) with observed greater diversity for these two tax-
ons as well (10 and 5 genera, respectively), and were
hardly found in the dishwasher biofilms (4%; 99/4638
OTUs plus 75/4638 OTUs, respectively). The reverse
situation was observed for Gammaproteobacteria, which
were present only at 9% in the tap water (139/1503
OTUs) with lower diversity (4 genera), but were abun-
dant and showed greater diversity in the dishwasher
biofilms (467/4638OTUs and 8 genera) (Fig. 2). Of 49
genera identified, 10 were detected only in tab water
and26onlyondishwasherrubberseals.Additionalfile1:
Table S2 presents all of the reads obtained.
Bacterial diversity on dishwasher rubber seals is mostly
influenced by water hardness and washing temperature
These randomly selected dishwashers were characterised
according to the type of water supply (from hard to soft),
age (years since purchased), frequency of use (times per
week), cleaning (method) and temperature of washing
(Table 2; for full details, see Additional file 1: Table S1).
The highest cultivation-dependent bacterial diversity for
the rubber seals (15–22 different bacterial species) was
detected in dishwashers connected to hard or moder-
ately hard tap water (1.5–2.0 mmol/L CaCO
3
) (Fig. 3). A
closer look at isolates from these three dishwashers with
the highest bacterial diversity (Table 1) showed that the
most frequent species on the rubber seals was Exiguo-
bacterium sp., which represented 26% of all of the iso-
lated species (dishwashers 10, 29), and Enterococcus
casseliflavus, which represented 17% of all of the isolated
species (dishwasher 6). For the rubber seals, dishwashers
10 and 29 had 61 and 70% Bacilli, 24 and 29% Proteo-
bacteria, and 4 and 10% Actinobacteria, respectively,
while dishwasher 6 had equal levels of Bacilli and Pro-
teobacteria (44%), with 8% Actinobacteria. Escherichia
sp. was present on the rubber seals of both dishwashers
6 and 10 (8 and 12% of all isolates, respectively), but not
of dishwasher 29 (Fig. 3).
In comparison, for the rubber seals of the two dish-
washers connected to soft tap water (0.5 mmol/L
Fig. 2 Proportions of the different bacterial phyla from the tap water system and the biofilms from the dishwasher rubber seals. Although the
broad composition of bacterial taxa was similar across the different samples, their relative abundances varied, indicating that dishwashers are
highly selective environments
Zupančičet al. BMC Microbiology (2019) 19:300 Page 7 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

CaCO
3
), only up to six different bacterial species were
detected. These isolated species belonged to Firmicutes
(B. cereus group, Paenibacillus sp.) and Actinobacteria
(Brevibacterium casei,Brevibacterium sanguinus,Kocuria
rhizophila)(Table1). Proteobacteria (which includes
Escherichia sp. and P. aeruginosa) and Bacteroidetes were
not detected on the rubber seals of these dishwashers,
whereas K. rhizophila was isolated only from the rubber
seals of dishwashers connected to soft tap water.
Bacterial diversity was influenced also by the frequency
of use and the age of the dishwashers (i.e., years from
purchase). More frequent use and up to 1 year of oper-
ation time was associated with higher bacterial diversity
here, while the number of isolated species decreased
Table 2 Characteristics of the dishwashers in relation to the mean numbers of different bacterial species isolated
Characteristic Specific Mean bacterial species per dishwasher
Water hardness (mmol/L CaCO
3
) Hard (2.0) 7.8
Moderately hard (1.6) 9.6
Slightly hard (1.0) 9.0
Soft (0.5) 4.5
Type of cleaning None 8.9
Chemical 8.5
Mechanical 11.0
Temperature of washing (°C) 50 10.3
60 9.1
65 8.9
70 2.0
Frequency of use (per week) < 7 9.2
7 7.9
8–14 11.0
Age of dishwasher (years) 0.5–1.0 10.9
1.1–2.0 9.8
2.1–3.0 7.8
3.1–6.0 8.3
6.1–8.0 7.7
Fig. 3 Comparisons of the bacterial species diversity on the rubber seals of the three sampled dishwashers that showed the highest cultivation-
dependent bacterial diversity, which were supplied with hard tap water. Dishwasher 6 (a) and dishwasher 10 (b) were both supplied with
moderately hard tap water (1.6 mmol/L CaCO
3
), and dishwasher 29 (c) was supplied with hard tap water (2.0 mmol/L CaCO
3
). Different colors
convey bacterial classes e.g. Bacilli are represented in red, Proteobacteria are represented in green, Actinomycetes are represented in blue and
Bacteroidetes are represented in purple colour
Zupančičet al. BMC Microbiology (2019) 19:300 Page 8 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

with the age of the dishwashers, reaching the lowest
levels for 6–8-year-old dishwashers (Table 2).
With a temperature of washing of approximately
50 °C, this was associated with the highest diversity of
isolated bacteria (as a mean of 10.3 different bacterial
species per rubber seal), with the higher temperatures
indicating lower numbers of species detected (Table 2).
No differences in the cultivable bacterial diversity were
observed in relation to the method of cleaning of the
dishwashers (Table 2).
Selected gram-positive bacteria can contaminate washed
dishes
The presence and diversity of bacteria on the dishes and
cutlery immediately after the end of the washing process
were also investigated. All of the isolates obtained (15)
were Gram-positive species that belong to the phyla Fir-
micutes and Actinobacteria. The highest bacterial diver-
sity was observed after the sampling of some plastic
items, whereas this was lower for the metal and ceramic
objects. For example, Gordonia paraffinivorans,Brachy-
bacterium nesterenkovii,Micrococcus sp., and M. luteus
were isolated from a plastic meat-cutting board, Bacillus
flexus,Bacillus marisflavi, and M. luteus from a glass lid,
and M. luteus from a ceramic plate and from metal
cutlery.
Bacterial communities that contaminate dishwasher
rubber seals do not represent a serious threat for the
spread of antibiotic resistance
From 632 isolates tested for antibiotic resistance against
the seven selected antibiotics, the majority (48%) was
represented by Firmicutes from the order Bacilliales
(Bacillaceae,Paenibacillaceae,Planococcaceae,Staphylo-
coccaceae) and are presented in Additional file 1: Table
S3. This group showed relatively low levels of antibiotic
resistance, with the highest seen for the third generation
cephalosporins (cefotaxime 57%, ceftazidime 70%), while
the resistance against the other screened antibiotics was
10 to 12%, or lower (for full details, see Additional file 1:
Table S3).
For the order of the Firmicutes, Lactobacillales (e.g.,
Enterococccaceae), there was high antibiotic resistance
against cefotaxime, ceftazidime, ertapenem and ciprofloxacin
(90% of isolates). The order of Actinomycetales showed
slightly elevated resistance against ceftazidime (60%) and
cefotaxime (81%).
Among the Proteobacteria, Pseudomonadales showed
the highest levels of resistance against cefotaxime (80%)
and ertapenem (51%). The order of Enterobacteriales did
not show any particularly resistance, as all of these
were < 8%, with the exception of resistance to imipenem
(25%).
Isolates belonging to the orders of Xanthomonadales
(Proteobacteria) and Flavobacteriales (Bacterioidetes)
were not as numerous as for the previous groups; how-
ever, they showed relatively high levels of antibiotic re-
sistance. In Xanthomonadales, the resistance against all
used antibiotics except tetracycline was between 76 and
100%, and was indeed mainly > 90%, while in Flavobac-
teriales all of the resistance was between 80 and 90%, ex-
cept for ceftazidime (60%).
The groups of Sphingomonadales, Rhizobiales and
Rhodospirillales showed higher resistance against cefo-
taxime and ceftazidime (both at 86%).
Discussion
Over the last two decades there have been several reports
of home-related microbial infections [6,8,37,58,60]. Out
of all of the indoor locations, bathrooms [18,19,35]and
kitchens [20,47,48,57,61] are among the most heavily
colonised by opportunistic pathogenic bacteria, both in
terms of abundance and diversity. Although the spread of
most food-related pathogenic bacteria (e.g., Campylobac-
ter,Salmonella,Listeria)[3,29,42] can be minimised
using correct hygiene practices and disinfectants [10,11,
54,59], advances in technology and increasingly inhospit-
able indoor habitats to microbes have driven the selection
of different and more stress-resistant species.
Some studies have reported that there is a link between
the metabolism of phenols and hydrocarbons and the mi-
crobial tendency to infect the central nervous system [51].
Repeated cycles of thermal stress in house appliances se-
lect for thermotolerant, opportunistic pathogens [24,25].
Opportunistic pathogenic bacteria [56,69] and fungi
(Novak [1]) contaminate washing machines. Bacteraemia
outbreaks of B. cereus have been reported for hospitals
using linen that was washed in contaminated washing ma-
chines [56], and for Gordonia bronchialis after laundering
of surgical scrubs in domestic washing machines [69].
Although dishwashers are also heavily contaminated with
selected opportunisticpathogenicfungi[13,23,70,71], so
far there is one report on the diversity and characteristics of
the bacterial contaminants in the mixed bacterial-fungal
biofilms that can colonise dishwasher rubber seals [72].
Comparisons between the non-cultivable and cultivable
bacterial communities that have been isolated from dish-
washers have shown the differences in their structures.
The predominance of the Firmicutes (54%, 10 genera),
followed by Proteobacteria (28%, 16 genera) and Actino-
bacteria (16%, 10 genera), has been reported among cultiv-
able microorganisms. Analysis of metagenomic data has
provided a different picture, with the dominance of Acti-
nobacteria (70%, 15 genera), followed by Proteobacteria
(14%, 21 genera), a small percentage of Firmicutes (6%, 2
genera) and some candidate phyla. One of the reasons for
the discrepancy is probably the selection of the chosen
Zupančičet al. BMC Microbiology (2019) 19:300 Page 9 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

synthetic microbial media and the cultivation conditions,
which favoured the isolation of Firmicutes, and primarily
the genus Bacillus.
Plumbing systems that supply water to household
dishwashers represent the most probable route of con-
tamination of appliances with fungi [71]. Therefore, 30
tap water samples from the kitchens with dishwashers
were analysed for the presence of bacteria using a
metagenomic approach. A prevalence of Gram-negative
bacteria was shown here, and in particular of Proteo-
bacteria, with high prevalence of Tepidimonas sp.
(Betaproteobacteria), a very low number of Actinobac-
teria and no Firmicutes. Compared to the biofilms on
dishwasher rubber seals the bacterial diversity of tap
water was also lower, 23 genera compared to 39 genera
on rubber seals. The greatest difference in diversity was
observed for Actinobacteria (3 genera in tap water ver-
sus 15 genera on dishwasher rubber seals). Only 13 out
of 49 genera identified by metagenomics approach was
found in both environments, of those Gordonia was
enriched while half of 13 genera were reduced in dish-
washers. This piece of information together with the
fact that the microbial communities in these dish-
washer rubber seal biofilms were dominated by com-
pletely different Gram-positive bacteria show that we
can probably rule out the tap water as the main route
for introduction of bacteria into these dishwashers, in
contrast to what was observed in fungi [71]. Therefore,
dirty vessels probably represent the major vehicle of
bacterial transfer into these dishwashers.
Close contact of different microbes in well-established
microbial biofilms that cover the dishwasher rubber seals
can facilitate the spread of antibiotic resistance amongst
these, and thus we characterised all of these bacterial
isolates in relation to seven selected antibiotics. Among
the isolated strains in Firmicutes, B. amyloliquefaciens
from one dishwasher, together with B. pumilus and B.
subtilis, were resistant to cephalosporins. Bacillus hor-
neckiae showed resistance to carbapenem antibiotics
(imipenem, ertapenem) and some B. pumilus isolates
were also resistant to ciprofloxacin and ertapenem. This
is in contrast with literature reports that have indicated
that species from the genus Bacillus are usually suscep-
tible to imipenem, ciprofloxacin and tetracycline, and
except for B. cereus (which produces a broad spectrum
β-lactamase), also to cephalosporins (cefotaxime, ceftazi-
dime) and penicillins [68]. According to the literature
data, Paenibacillus species are usually susceptible to all
of the antibiotics that were used in the present study
[68], while these isolates here were resistant to one up to
three of the antibiotics tested, with the exception of
tetracycline. Although Staphylococcus saprophyticus, the
second most common pathogen identified in urinary
tract infections, is a relatively susceptible organism [30],
the isolates in the present study were resistant to the
cephalosporins tested.
Among the isolated Exiguobacterium sp. strains, only
one isolate showed multiple resistance to the antibiotics
tested. The genus Enterococcus (Lactobacillales) includes
some of the most important nosocomial multidrug-
resistant organisms. Enterococcus faecium is an emergent
nosocomial pathogen that is intrinsically resistant to
aminoglycosides (kanamycin), tetracyclines, cephalospo-
rins and quinolones, and that can acquire resistance to
other antibiotics [31]. This very high occurrence of anti-
biotic resistance was shown also for dishwasher isolates.
In Actinomycetales, Micrococcus spp. and the closely re-
lated genera are ubiquitous and are generally considered
as harmless saprophytes that are relatively susceptible to
most antibiotics. The majority of the M. luteus isolates
from these dishwasher rubber seals were resistant to cip-
rofloxacin, which is contrary to the literature data (MIC,
0.8 μg/ml [73];), while the Gordonia isolates were sus-
ceptible to all of the antibiotics tested [4]. The Brevibac-
terium casei isolates should be susceptible to the
majority of the antibiotics tested, except ciprofloxacin
[65]; here B. casei was also resistant to cephalosporins
and carbapenem antibiotics.
As representatives of Proteobacteria, most strains of P.
aeruginosa are significantly more resistant to many anti-
microbial agents than other closely related genera [22].
All of the dishwasher rubber seal isolates of P. aerugi-
nosa were resistant to the tested carbapenems, cefotax-
ime and kanamycin, and some of them also to
ciprofloxacin. Not surprisingly, only a few of other iso-
lated pseudomonads, like Acinetobacter spp., where re-
sistant to the carbapenems and/or cephalosporins tested
[34]. Amongst the tested isolates of enterobacteria, the
majority (Klebsiella,Enterobacter,and Escherichia) were
susceptible to the tested antibiotics, except imipenem
(Enterobacter)[5].
Amongst Xanthomonadales, S. maltophilia represents
an emerging opportunistic pathogen, in particular due to
its known resistance to many classes of antimicrobial
agents [34]. All of these S. maltophilia dishwasher rubber
seal isolates were resistant to all of the antibiotics tested.
The Bacterioidetes Chryseobacterium spp. isolates are
known to be intrinsically resistant to most β-lactams, in-
cluding carbapenems, and to aminoglycosides, tetracyclines,
fluoroquinolones and chloramphenicol [21], which was
confirmed also in these dishwasher rubber seal isolates.
Although the overall antibiotic resistance data of the dish-
washer rubber seal bacterial isolates indicate that they do
not represent a serious threat for the spread of antibiotic re-
sistance into the household environment, dishwashers
should nevertheless be considered as a potential source of
infection with antibiotic resistant bacteria, in particular for
immuno-compromised individuals.
Zupančičet al. BMC Microbiology (2019) 19:300 Page 10 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

The bacteria that colonise dishwashers can be released
into the kitchens via aerosols and waste water, and by
direct contact between contaminated surfaces and
humans. Thus, dishwashers are possible sources of bac-
terial infections. Immuno-compromised patients with
cystic fibrosis are an especially endangered group, par-
ticularly as they can often have chronic P. aeruginosa
lung infections [12]. Although its deadliness is most
apparent in patients with cystic fibrosis, P. aeruginosa is
an opportunistic pathogen and therefore also a major
problem in nosocomial infections in terms of burn and
chronic wounds, chronic obstructive pulmonary dis-
order, surface growth on implanted biomaterials, and on
hospital surfaces and in the water supply [7,45,49].
Amongst the 632 dishwasher rubber seal bacterial iso-
lates, 12 were P. aeruginosa. Interiors of washing ma-
chines have been reported previously to harbour strains
of P. aeruginosa [41], while this study also confirmed
their presence in well-established biofilms on dishwasher
rubber seals. Six out of 30 dishwashers were contami-
nated with P. aeruginosa, and these thus represented a
major indoor environmental reservoir.
Another commonly encountered opportunistic patho-
gen E. coli was found in six out of 30 dishwashers exam-
ined. As E. coli strains are traditionally considered to be
commensals of the microbiota in the intestinal tract of
warm-blooded animals and humans, strains equipped
with virulence factor genes can cause a wide spectrum
of mild to severe extra-intestinal and intestinal infections
[63]. Environmental E. coli strains are considered to arise
primarily as a result of faecal contamination of soil,
drinking water, recreational water, and groundwater
[32]. Recent studies have suggested, however, that hu-
man opportunistic pathogenic E. coli strains can persist
over longer periods of time as viable entities also in dif-
ferent hostile environments, especially when embedded
in biofilms [32,67]. To the best of our knowledge, this is
the first description of E. coli isolates from biofilms that
colonise dishwasher rubber seals. The primary source of
these isolates might be both the household water supply
system connected to the dishwasher and the contami-
nated vessels. Of interest also, the same sequence type of
isolated E. coli strain was found in different dishwashers,
which were even geographically located in different cit-
ies, thus indicating the strong selective pressure of this
specific extreme environment. This has resulted in the
enrichment of these not very virulent E. coli isolates,
which have instead an emphasis on the ability to form
adherent and persistent biofilms, and to take up sulphur
and iron from the environment.
Conclusion
We can conclude here that repeated mechanical, oxida-
tive, water activity, and thermal stress inside dishwashers
select for, and consequently enrich, biofilm-forming bac-
teria species, which in many instances are antibiotic re-
sistant and virulent thermotolerant bacterial species. As
these are the crucial factors that define most microbes
in terms of their potential pathogenicity, as potential
sources of human infections, domestic dishwashers can-
not be ignored.
Methods
Sample collection
For the sampling of the dishwasher seals, 30 dishwashers
were randomly selected in kitchens inside private dwellings
located in seven Slovenian cities (i.e., Ljubljana, Velenje,
Žalec, Celje, Mislinja, Sežana, and Portorož). These dish-
washers differed in age (1–8 years), brand (four different
ones), frequency of use (once a week, to twice a day), and
cleaning techniques (chemical, mechanical). Swab samples
from their rubber seals (Fig. 4) were obtained by rubbing a
cotton swab moistened with physiological saline over the
seal surface at the end of the regular washing cycle. These
swabs were immediately placed into sterile tubes, stored at
4 °C, and processed within 1 day. Further swab sampling
was performed on washed vessels that had remained after
washing in the dishwasher following an overnight wash
cycle, such as glass lids of kitchenware, plastic kitchen
boards, ceramic plates, and metal spoons. Additionally, 1.0
L tap water was taken from each of these 30 kitchens where
these dishwashers were located. Sampling the biofilms
formed on rubber seals of the 30 dishwashers was per-
formed by scraping the seal surface with a sterile scalpel,
and then placing the scraped material into sterile sampling
tubes. The samples were stored at −20 °C, and later com-
bined following the DNA isolation.
Isolation of bacterial isolates
For each swab, a separate agar plate was used. The
swabs were streaked on nutrient agar, brain–heart infu-
sion agar, Reasoner’s 2A agar, and M9 minimal medium
[66]. These plates were incubated aerobically at 37 °C for
2 days (nutrient agar and brain–heart infusion agar) or
for up to 7 days for minimal medium, and for 7 days at
37 °C for Reasoner’s 2A agar. For the isolation of anaer-
obes, swabs were streaked on brain–heart infusion agar
plates and incubated anaerobically at 37 °C for 7 days.
Colonies representing all of the morphotypes were re-
streaked several times on the chosen medium to obtain
pure cultures, which were deposited at the Ex Culture
Collection, which is part of the Mycosmo Infrastructural
Centre at the Department of Biology, Biotechnical Fac-
ulty, University of Ljubljana, Slovenia.
Antibiotic resistance
All of the bacterial isolates were tested for resistance to
a selection of antibiotics that was based on their
Zupančičet al. BMC Microbiology (2019) 19:300 Page 11 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

importance in present curative treatments of stubborn
bacterial infections. The seven chosen antibiotics were
diluted in Lysogeny broth [LB] medium with agar, and
used at the following final concentrations: 2 mg/L cefotax-
ime; 8 mg/L ceftazidime; 0.5 mg/L ertapenem; 2 mg/L imi-
penem; 0.25 mg/L ciprofloxacin; 15 mg/L tetracycline; and
50 mg/L kanamycin. The antibiotic solutions were steri-
lised by filtration (0.22 μm; Millipore) and added to LB
agar medium cooled to 55 °C (in a water bath). The resist-
ance against these antibiotics was checked with antibiotic
susceptibility testing, with the bacterial isolates streaked to
single colonies to LB agar plates with chosen antibiotics.
Inoculated plates were incubated at 37 °C for up to 2 days
(depending on the growth of the isolates). Additionally, all
of these plates were incubated at 24 °C for another 2days,
and their growth was compared to the positive control
(i.e., in LB agar plates without added antibiotics).
Genomic DNA extraction and identification of bacterial
isolates
Genomic DNA extraction was performed from overnight
bacterial cultures grown on LB agar plates at 37 °C,
using PrepMan Ultra Sample Preparation Reagent
(Applied Biosystems), according to the manufacturer
instructions.
The 16S rRNA genes were PCR amplified with oligo-
nucleotide primers 27F (AGAGTTTGATCMTGGCTCAG
[39];) and 1495r (CGGTTACCTTGTTACGACTT [2];).
The PCR mixtures (35 μL) contained 1 μLisolatedDNA,
0.45 U DreamTaq DNA polymerase (Thermo Fisher Scien-
tific), 1× DreamTaq buffer with MgCl
2
(Thermo Fisher
Scientific), 0.1 mM dNTP (Thermo Fisher Scientific), and
0.1 μM of each primer. The reaction mixtures were first de-
natured at 94 °C for 5 min, and then subjected to 5 cycles of
94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min, 5 cycles of
94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and 30 cycles
of94°C for 30s, 50°C for 30s, and 72°C for 1min. Elong-
ation in the last cycle lasted 7 min, followed by a final incu-
bation at 4 °C. The PCR products were separated on 1%
(w/v) agarose gels by electrophoresis in 1× TAE buffer, and
subsequently purified and sequenced at Microsynth AG
(Balgach, Switzerland) using the 27F sequencing primer.
The retrieved 16S rDNA sequences were identified on
the basis of an approximately 800-bp-long amplicon,
using the Ribosomal Database Project-II (RDP-II; http://
rdp.cme.msu.edu) and National Centre for Biotechnol-
ogy Information Basic Local Alignment Search Tool
(NCBI BLAST) to search the GenBank non-redundant
nucleotide database. Identification to the species level
was defined as a 16S rDNA sequence similarity ≥99%
with that of the prototype strain sequence in RDP-II;
identification at the genus level was defined as a 16S
rDNA sequence similarity ≥97% with that of the proto-
type strain sequence in RDP-II.
Molecular and data analysis of biofilms and tap water
DNA from the biofilms from the scraping of the 30 sam-
pled dishwasher rubber seals was isolated from 0.05 g to
0.1 g of biofilm biomass, using DNA isolation kit (Power
Biofilm; MoBio, Carlsbad, CA, USA), according to the
manufacturer instructions. Additionally, total DNA was
Fig. 4 Dishwasher rubber seal. Sampling was performed in household dishawshers (a), on rubber seals where the outer edge of the dishwasher
and the dishwasher door are in close contact (b)
Zupančičet al. BMC Microbiology (2019) 19:300 Page 12 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

isolated from the respective 30 tap water samples by filter-
ing 1 L of water through 0.45-μm membrane filters (Merck,
Millipore), and using DNA isolation kit (PowerWater;
MoBio, Carlsbad, CA, USA), following the manufacturer
instructions.
For the downstream sequencing, all 30 samples of
these total DNA from biofilms were combined to a 5 ng/
μL equimolar concentration and all of these 30 total DNA
samples from water to a 3 ng/μL equimolar concentration.
To target prokaryotic 16S rRNA genes for each of the
pooled samples, PCR amplicon libraries were constructed
using the 27F and 1495r bacterial primer sets [33]. Ampli-
con sequencing was carried out by Microsynth AG using
a pyrosequencing platform (Roche 454). Initially, the se-
quences were quality trimmed with the threshold 25 and
all reads shorter than 250 bp were removed. The reads
were then processed bioinformatically with the QIIME
software package [9]. The mean read length of the se-
quences was 535 bp, which covered the V1, V2 and V3
hyper-variable regions of 16S rDNA. Chimeric sequences
were identified using the UCHIME algorithm [16] and dis-
carded. Linker and reverse primers were trimmed. The
maximum number of allowed homopolymers in a single
bacterial sequence was set to six. The sequences were then
clustered into operational taxonomic units (OTUs) by
subsampling open reference clustering against the Green-
Genes reference set, constructed at 97% similarity in the
case of 16S rDNA analysis [38,44]. The clustering was
performed using the usearch61 algorithm [15]with97%
similarity preference as the standard definition of a bacter-
ial species. Singletons were removed from further analysis.
Alignments of the resulting 16S rDNA representative se-
quence sets were constructed using the ClustalX software
[64]. Maximum likelihood methods implemented in
PhyML 3.0 [26] were used to build phylogenetic trees to
assign the taxonomy to new reference OTUs where
possible. When the reference collections did not yield any
results, taxonomy assignment was attempted using UNI-
TE+INSD (International Nucleotide Sequence Databases:
National Centre for Biotechnology Information; European
Molecular Biology Laboratory;DNA Data Bank of Japan).
Supplementary information
Supplementary information accompanies this paper at https://doi.org/10.
1186/s12866-019-1674-5.
Additional file 1: Table S1. Characteristics of the individual
dishwashers sampled. Table S2. Bacterial phyla detected in the water
and biofilm samples. Table S3. Antibiogram results, showing all of the
isolated bacteria from the rubber seals of the 30 residential dishwashers
in terms of their antibiotic resistance against the chosen antibiotics.
Abbreviations
CFZ: ceftazidime; CIP: ciprofloxacin; CTX: cefotaxime; ETP: ertapenem;
IMP: imipenem; KN: kanamycin; LB: Lysogeny broth medium with agar;
MIC: Minimum inhibitory concentration; OTUs: operational taxonomic units;
RDP-II: the Ribosomal Database Project-II; TC: tetracycline
Acknowledgments
Our acknowledgments go to all the people who kindly provided samples
from their dishwashers. We also thank Christopher Berrie for language
assistence and prof. Børge Diderichsen for careful and critical reading of the
manuscript.
Authors’contributions
NGC, JAA and MT designed the study. JZ, MČ, MT, JAA performed the
experiments and analyzed the data. JZ, MT, JAA, MČand NGC compiled the
manuscript. All authors have read and approved the manuscript.
Funding
This research was funded by the Ministry of Higher Education, Science and
Technology of the Republic of Slovenia, as a Young Researcher grant to JZ
(grant no. 382228–1/2013). This work was also supported by the Slovenian
Research Agency (Infrastructural centre Mycosmo MRIC UL, Research
Programmes P1–0170). The funding sources had no role in the study design,
analysis, collection, data interpretation and manuscript writing.
Availability of data and materials
All data generated or analysed during this study are included in this
published article (and its supplementary information files).
Ethics approval and consent to participate
In this study, field sampling was performed, and to our knowledge, no
endangered or protected species were involved. All of the samples studied
here were obtained from the discussed sampling area, for which permission
was obtained from the owners.
Consent for publication
Not applicable.
Competing interests
The authors declare that the research was conducted in the absence of any
commercial or financial relationships that could be construed as a potential
conflict of interest. The authors declare that they have no competing
interests.
Author details
1
Department of Biology, Biotechnical Faculty, University of Ljubljana,
Ljubljana, Slovenia.
2
Centre of Excellence for Integrated Approaches in
Chemistry and Biology of Proteins (CIPKeBiP), Ljubljana, Slovenia.
Received: 14 June 2019 Accepted: 4 December 2019
References
1. BabičMN, Zalar P, Ženko B, Schroers HJ, Džeroski S, Gunde-Cimerman N.
Candida and Fusarium species known as opportunistic human pathogens
from customer-accessible parts of residential washing machines. Fungal
Biol. 2015;119:95–113.
2. Bandi C, Damiani G, Magrassi L, Grigolo A, Fani R, Sacchi L. Flavobacteria as
intracellular symbionts in cockroaches. Proc Biol Sci. 1994;257:43–8.
3. Berger CN, Sodha SV, Shaw RK, Griffin PM, Pink D, Hand P, Frankel G. Fresh
fruit and vegetables as vehicles for the transmission of human pathogens.
Environ Microbiol. 2010;12:2385–97.
4. Blaschke AJ, Bender J, Byington CL, Korgenski K, Daly J, Petti CA, Pavia AT,
Ampofo K. Gordonia species: emerging pathogens in pediatric patients that
are identified by 16S ribosomal RNA gene sequencing. Clin Infect Dis. 2007;
45:483–6.
5. Bornet C, Davin-Regli A, Bosi C, Pages JM, Bollet C. Imipenem resistance of
Enterobacter aerogenes mediated by outer membrane permeability. J Clin
Microbiol. 2000;38:1048–52.
6. Bradford PA, Urban C, Jaiswal A, Mariano N, Rasmussen BA, Projan SJ, Rahal
JJ, Bush K. SHV-7, a novel cefotaxime-hydrolyzing beta-lactamase, identified
in Escherichia coli isolates from hospitalized nursing home patients.
Antimicrob Agents Chemother. 1995;39:899–905.
Zupančičet al. BMC Microbiology (2019) 19:300 Page 13 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

7. Breathnach AS, Cubbon MD, Karunaharan RN, Pope CF, Planche TD. Multidrug-
resistant Pseudomonas aeruginosa outbreaks in two hospitals: association with
contaminated hospital waste-water systems. J Hosp Infect. 2012;82:19–24.
8. Byrd-Bredbenner C, Berning J, Martin-Biggers J, Quick V. Food safety in
home kitchens: a synthesis of the literature. Int J Environ Res Public
Health. 2013;10:4060–85.
9. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman DF,
CostelloEK,FiererN,PeñaAG,GoodrichJK,GordonJI,HuttleyGA,
Kelley ST, Knights D, Koenig JE, Ley RE, Lozupone CA, McDonald D,
Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ, Walters
WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. QIIME allows
analysis of high-throughput community sequencing data. Nat Methods.
2010;7:335–6.
10. Cogan TA, Bloomfield SF, Humphrey TJ. The effectiveness of hygiene
procedures for prevention of cross-contamination from chicken carcases
in the domestic kitchen. Lett Appl Microbiol. 1999;29:354–8.
11. Cogan TA, Slader J, Bloomfield SF, Humphrey TJ. Achieving hygiene in
the domestic kitchen: the effectiveness of commonly used cleaning
procedures. J Appl Microbiol. 2002;92:885–92.
12. Costerton JW. Pseudomonas aeruginosa. In: Sabath CD, editor. The
organism, diseases it causes, and their treatment. Switzerland: Hans
Huber Publishers; 1980. p. 15–24.
13. Döğen A, Kaplan E, Oksüz Z, Serin MS, Ilkit M, de Hoog GS. Dishwashers are
a major source of human opportunistic yeast-like fungi in indoor
environments in Mersin, Turkey. Med Mycol. 2013;5:493–8.
14. Dunn RR, Fierer N, Henley JB, Leff JW, Menninger HL. Home life: factors
structuring the bacterial diversity found within and between homes.
PLoS One. 2013. https://doi.org/10.1371/journal.pone.0064133.
15. Edgar RC. Search and clustering orders of magnitude faster than BLAST.
Bioinformatics. 2010;26:2460–1.
16. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves
sensitivity and speed of chimera detection. Bioinformatics. 2011. https://
doi.org/10.1093/bioinformatics/btr381.
17. Eguchi H, Miyamoto T, Kuwahara T, Mitamura S, Mitamura Y. Infectious
conjunctivitis caused by Pseudomonas aeruginosa isolated from a bathroom.
BMC Res Notes. 2013. https://doi.org/10.1186/1756-0500-6-245.
18. Feazel LM, Baumgartner LK, Peterson KL, Frank DN, Harris JK, Pace NR.
Opportunistic pathogens enriched in showerhead biofilms. Proc Natl Acad
Sci U S A. 2009;106:16393–9.
19. Flores GE, Bates ST, Knights D, Lauber CL, Stombaugh J, Knight R, Fierer N.
Microbial biogeography of public restroom surfaces. PLoS One. 2011;6:e28132.
20. Flores GE, Bates ST, Caporaso JG, Lauber CL, Leff JW, Knight R, Fierer N.
Diversity, distribution and sources of bacteria in residential kitchens. Environ
Microbiol. 2013;15:588–96.
21. Gales AC, Jones RN, Andrade SS, Sader HS. Antimicrobial susceptibility
patterns of unusual nonfermentative gram-negative bacilli isolated from
Latin America: report from the SENTRY antimicrobial surveillance program
(1997-2002). Mem Inst Oswaldo Cruz. 2005;100:571–7.
22. Garrity G, Brenner DJ, Krieg NR, Staley JR. Bergey’s manual of systematic
bacteriology, Vol. 2: the proteobacteria, Part B: the Gammaproteobacteria.
Berlin: Springer; 2005.
23. Gümral R, Özhak-Baysan B, Tümgör A, Saraçli MA, Yildiran ŞT, Ilkit M,
ZupančičJ, Novak-BabičM, Gunde-Cimerman N, Zalar P, de Hoog GS.
Dishwashers provide a selective extreme environment for human-
opportunistic yeast-like fungi. Fungal Divers. 2016;76:1–9.
24. Gostinčar C, Grube M, Gunde-Cimerman N. Evolution of fungal pathogens
in domestic environments. Fungal Biol. 2011;115:1008–18.
25. Gostinčar C, Gunde-Cimerman N, Grube M. Polyextremotolerance as the
fungal answer to changing environments. In: Bakermans C, editor. Microbial
evolution under extreme conditions, (life in extreme environments, vol. 2).
Berlin: De Gruyter; 2015. p. 185–208.
26. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O.
New algorithms and methods to estimate maximum-likelihood
phylogenies: assessing the performance of PhyML 3.0. Syst Biol.
2010;59:307–21.
27. Hamada N, Abe N. Comparison of fungi found in bathrooms and sinks.
Biocontrol Sci. 2010;15:51–6.
28. Hanski I, von Hertzen L, Fyhrquist N, Koskinen K, Torppa K, Laatikainen T,
Karisola P, Auvinen P, Paulin L, Mäkelä MJ, Vartiainen E, Kosunen TU, Alenius
H, Haahtela T. Environmental biodiversity, human microbiota, and allergy
are interrelated. Proc Natl Acad Sci U S A. 2012;109:8334–9.
29. Heaton JC, Jones K. Microbial contaminationof fruit and vegetables and the
behaviour of enteropathogens in the phyllosphere: a review. J Appl
Microbiol. 2008;104:613–26.
30. Higashide M, Kuroda M, Omura CT, Kumano M, Ohkawa S, Ichimura S, Ohta
T. Methicillin-resistant Staphylococcus saprophyticus isolates carrying
staphylococcal cassette chromosome mec have emerged in urogenital tract
infections. Antimicrob Agents Chemother. 2008;52:2061–8.
31. Hollenbeck BL, Rice LB. Intrinsic and acquired resistance mechanisms in
enterococcus. Virulence. 2012;3:421–33.
32. Ishii S, Sadowsky M. Escherichia coli in the environment: implications for
water quality and human health. Microbes Environ. 2008;23:101–8.
33. Jiang H, Dong H, Zhang G, Yu B, Chapman LR, Fields MW. Microbial
diversity in water and sediment of Lake Chaka, an Athalassohaline lake in
northwestern China. Appl Environ Microbiol. 2006;72:3832–45.
34. Jones RN, Sader HS, Beach ML. Contemporary in-vitro spectrum of activity
summary for antimicrobial agents tested against 18569 strains non-
fermentative gram-negative bacilli isolated in the SENTRY antimicrobial
surveillance program (1997-2001). Int J Antimicrob Agents. 2003;22:551–6.
35. Kelley ST, Theisen U, Angenent LT, St Amand A, Pace NR. Molecular analysis of
shower curtain biofilm microbes. Appl Environ Microbiol. 2004;70:4187–92.
36. Klepeis NE, Nelson WC, Ott WR, Robinson JP, Tsang AM, Switzer P, Behar JV,
Hern SC, Engelmann WH. The National Human Activity Pattern Survey
(NHAPS): a resource for assessing exposure to environmental pollutants. J
Expo Anal Environ Epidemiol. 2001;11:231–52.
37. Knabel SJ. Foodborne illness: role of home food handling practices. Food
Technol. 1995;49:119–31.
38. Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AFS, Bahram M, Bates
ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, Douglas B, Drenkhan T,
Eberhardt U, Dueñas M, Grebenc T, Griffith GW, Hartmann M, Kirk PM,
Kohout P, Larsson E, Lindahl BD, Lücking R, Martín MP, Matheny PB, Nguyen
NH, Niskanen T, Oja J, Peay KG, Peintner U, Peterson M, Põldmaa K, Saag L,
Saar I, Schüßler A, Scott JA, Senés C, Smith ME, Suija A, Taylor DL, Telleria
MT, Weiss M, Larsson KH. Towards a unified paradigm for sequence-based
identification of Fungi. Mol Ecol. 2013;22:5271–7.
39. Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M,
editors. Nucleic acid techniques in bacterial systematics. Chichester: John
Wiley and Sons; 1991. p. 115–75.
40. Lee J, Cartwright R, Grueser T, Pascall MA. Efficiency of manual dishwashing
conditions on bacterial survival on eating utensils. J Food Eng. 2007;80:885–91.
41. Legnani PP, Leoni E. Factors affecting the bacteriological contamination of
commercial washing machines. Zentralbl Hyg Umweltmed. 1997;200:319–33.
42. Luber P. Cross-contamination versus undercooking of poultry meat or eggs
–which risks need to be managedfirst? Int J Food Microbiol. 2009;134:21–8.
43. Marshall BM, Robleto E, Dumont T, Levy SB. The frequency of antibiotic-
resistant bacteria in homes differing in their use of surface antibacterial
agents. Curr Microbiol. 2012;65:407–15.
44. McDonald D, Price MN, Goodrich J, Nawrocki EP, DeSantis TZ, Probst A,
Andersen GL, Knight R, Hugenholtz P. An improved Greengenes taxonomy
with explicit ranks for ecological and evolutionary analyses of bacteria and
archaea. ISME J. 2012;6:610–8.
45. Mulcahy LR, Isabella VM, Lewis K. Pseudomonas aeruginosa biofilms in
disease. Microb Ecol. 2014;68:1–12.
46. Nicolella C, Casini B, Rossi F, Chericoni A, Pardini G. Thermal sanitizing in a
commercial dishwashing machine. J Food Saf. 2011;31:81–90.
47. Ojima M, Toshima Y, Koya E, Ara K, Kawai S, Ueda N. Bacterial contamination
of Japanese households and related concern about sanitation. Int J Environ
Health Res. 2002a;12:41–52.
48. Ojima M, Toshima Y, Koya E, Ara K, Tokuda H, Kawai S, Kasuga F, Ueda N.
Hygiene measures considering actual distributions of microorganisms in
Japanese households. J Appl Microbiol. 2002b;93:800–9.
49. Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative
bacteria. N Engl J Med. 2010;362:1804–13.
50. Portnoy JM, Kwak K, Dowling P, VanOsdol T, Barnes C. Health effects of
indoor fungi. Ann Allergy Asthma Immunol. 2005;94:313–9.
51. Prenafeta-Boldú FX, Guivernau M, Gallastegui G, Viñas M, de Hoog GS,
Elías A. Fungal/bacterial interactions during the biodegradation of TEX
hydrocarbons (toluene, ethylbenzene and p-xylene) in gas biofilters
operated under xerophilic conditions. FEMS Microbiol Ecol. 2012;80:
722–34.
52. Raghupathi PK, ZupančičJ, Brejnrod AD, Jacquiod S, Houf K, Burmølle M,
Gunde-Cimerman N, Sørensen SJ. Microbial diversity and putative
Zupančičet al. BMC Microbiology (2019) 19:300 Page 14 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

opportunistic pathogens in dishwasher biofilm communities. Appl Environ
Microbiol. 2018. https://doi.org/10.1128/AEM.02755-17.
53. Rehberg L, Frontzek A, Melhus Å, Bockmühl DP. Prevalence of β-lactamase
genes in domestic washing machines and dishwashers and the impact of
laundering processes on antibiotic resistant bacteria. J Appl Microbiol. 2017;
123:1396–406.
54. Rusin P, Orosz-Coughlin P, Gerba C. Reduction of faecal coliform, coliform and
heterotrophic platecount bacteria in the household kitchen and bathroom by
disinfection with hypochlorite cleaners. J Appl Microbiol. 1998;85:819–28.
55. Samet JM, Spengler JD. Indoor environments and health: moving into the
21st century. Am J Public Health. 2003;93:1489–93.
56. Sasahara T, Hayashi S, Morisawa Y, Sakihama T, Yoshimura A, Hirai Y. Bacillus
cereus bacteremia outbreak due to contaminated hospital linens. Eur J Clin
Microbiol Infect Dis. 2011;30:219–26.
57. Scott E, Bloomfield SF, Barlow CG. An investigation of microbial
contamination in the home. J Hyg. 1982;89:279–93.
58. Scott E. Food safety and foodborne disease in 21st century homes. Can J
Infect Dis. 2003;14:277–80.
59. Scott E. Relationship between cross-contamination and the transmission of
foodborne pathogens in the home. Pediatr Infect Dis J. 2000;19:111–3.
60. Scuderi G, Fantasia M, Filetici E, Anastasio MP. Foodborne outbreaks caused
by Salmonella in Italy, 1991-1994. Epidemiol Infect. 1996;116:257–65.
61. Sinclair RG, Gerba CP. Microbial contamination in kitchens and bathrooms
of rural Cambodian villagehouseholds. Lett Appl Microbiol. 2011;52:144–9.
62. Ståhl Wernersson E, Johansson E, Håkanson H. Cross-contamination in
dishwashers. J Hosp Infect. 2004;56:312–7.
63. Tenaillon O, Skurnik D, Picard B, Denamur E. The population genetics of
commensal Escherichia coli. Nat Rev Microbiol. 2010;8:207–17.
64. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The
CLUSTAL_X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–82.
65. Troxler R, Funke G, Von Graevenitz A, Stock I. Natural antibiotic susceptibility
of recently established coryneform bacteria. Eur J Clin Microbiol Infect Dis.
2001;20:315–23.
66. Vogel HJ, Bonner DM. Acetylornithinase of Escherichia coli: partial
purification and some properties. J Biol Chem. 1956;218:97–106.
67. Vogeleer P, Tremblay YD, Mafu A, Jacques M, Harel J. Life on the outside:
role of biofilms in environmental persistence of Shiga-toxin producing
Escherichia coli. Front Microbiol. 2014;5:317. https://doi.org/10.3389/fmicb.
2014.00317.
68. Vos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH,
Whitman W. Bergey’s manual of systematic bacteriology, Vol. 3: the
firmicutes. Berlin: Springer; 2009.
69. Wright SN, Gerry JS, Busowski MT, Klochko AY, McNulty SG, Brown SA, Sieger
BE, Ken Michaels P, Wallace MR. Gordonia bronchialis sternal wound infection
in 3 patients following open heart surgery: intraoperative transmission from a
healthcare worker. Infect Control Hosp Epidemiol. 2012;33:1238–41.
70. Zalar P, Novak M, de Hoog GS, Gunde-Cimerman N. Dishwashers - a man-
made ecological niche accommodating human opportunistic fungal
pathogens. Fungal Biol. 2011;115:997–1007.
71. ZupančičJ, Novak BabičM, Zalar P, Gunde-Cimerman N. The black yeast
Exophiala dermatitidis and other selected opportunistic human fungal
pathogens spread from dishwashers to kitchens. PLoS One. 2016;11(2):
0148166. https://doi.org/10.1371/journal.pone.0148166.
72. ZupančičJ, Raghupathi PK, Houf K, Burmølle M, Sørensen SJ, Gunde-
Cimerman N. Synergistic interactions in microbial biofilms facilitate the
establishment of opportunistic pathogenic Fungi in household dishwashers.
Front Microbiol. 2018. https://doi.org/10.3389/fmicb.2018.00021.
73. Zweerink MM, Edison A. Inhibition of Micrococcus luteus DNA gyrase by
norfloxacin and 10 other quinolone carboxylic acids. Antimicrob Agents
Chemother. 1986;29:598–601.
Publisher’sNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Zupančičet al. BMC Microbiology (2019) 19:300 Page 15 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com