ArticlePDF Available

The dishwasher rubber seal acts as a reservoir of bacteria in the home environment

Authors:

Abstract and Figures

Background: In modern lifestyles, people make their everyday tasks easier by using household appliances, for example dishwashers. Previous studies showed massive contamination of dishwasher rubber seals with fungi, thus bacterial community, able to survive under harsh conditions, remain undetermined. Methods: Bacteria that colonise the extreme environment of household dishwasher rubber seals were investigated using cultivation-dependent and metagenomic approaches. All bacterial isolates were tested for resistance to seven selected antibiotics. Same time bacterial diversity of tap water, connected to the dishwashers was investigated. Results: All 30 dishwashers investigated were colonised by various bacteria. Cultivation approaches resulted in 632 bacterial isolates in total, belonging to four phyla, eight classes, 40 genera and 74 species. The majority were Gram-positive, as solely Firmicutes (dominated by the Bacillus cereus group) and Actinobacteria. Gammaproteobacteria were primarily represented by Stenotrophomonas maltophilia, Pseudomonas aeruginosa and Escherichia coli. Metagenomic assessment of the bacterial biodiversity of the dishwasher rubber seals confirmed the predominance of Gram-positive bacteria, as primarily Actinobacteria, followed by Proteobacteria dominated by Gammaproteobacteria, and by pathogenic species such as Escherichia sp., Acinetobacter baumannii, Pseudomonas sp., Stenotrophomonas maltophilia, and Enterobacter sp.. Metagenomic assessment of bacterial biodiversity in the tap water connected to dishwashers revealed predominance of Gram-negative bacteria, in particular Proteobacteria, mainly represented by Tepidimonas sp.. Actinobacteria showed low numbers while no Firmicutes were detected in the tap water. The bacterial diversity of tap water was also lower, 23 genera compared to 39 genera on dishwasher rubber seals. Only 13 out of 49 genera identified by metagenomics approach was found in both environments, of those Gordonia was enriched while half of 13 genera were depleted in dishwashers compared to tap water. Conclusions: These data indicate that colonisation of dishwasher rubber seals probably depends primarily on the bacterial input from the dirty vessels, and much less on the bacteria in the tap water. Based on the antibiotic resistance data, the dishwasher rubber seal bacterial isolates do not represent a serious threat for the spread of antibiotic resistance into the household environment. Nevertheless dishwashers cannot be ignored as potential sources of human infections, in particular for immuno-compromised individuals.
This content is subject to copyright. Terms and conditions apply.
R E S E A R C H A R T I C L E Open Access
The dishwasher rubber seal acts as a
reservoir of bacteria in the home
environment
Jerneja Zupančič
1*
, Martina Turk
1
, Miha Črnigoj
1
, Jerneja AmbrožičAvguštin
1
and Nina Gunde-Cimerman
1,2
Abstract
Background: In modern lifestyles, people make their everyday tasks easier by using household appliances, for
example dishwashers. Previous studies showed massive contamination of dishwasher rubber seals with fungi, thus
bacterial community, able to survive under harsh conditions, remain undetermined.
Methods: Bacteria that colonise the extreme environment of household dishwasher rubber seals were investigated
using cultivation-dependent and metagenomic approaches. All bacterial isolates were tested for resistance to seven
selected antibiotics. Same time bacterial diversity of tap water, connected to the dishwashers was investigated.
Results: All 30 dishwashers investigated were colonised by various bacteria. Cultivation approaches resulted in 632
bacterial isolates in total, belonging to four phyla, eight classes, 40 genera and 74 species. The majority were Gram-
positive, as solely Firmicutes (dominated by the Bacillus cereus group) and Actinobacteria. Gammaproteobacteria
were primarily represented by Stenotrophomonas maltophilia,Pseudomonas aeruginosa and Escherichia coli.
Metagenomic assessment of the bacterial biodiversity of the dishwasher rubber seals confirmed the predominance
of Gram-positive bacteria, as primarily Actinobacteria, followed by Proteobacteria dominated by Gammaproteobacteria,
and by pathogenic species such as Escherichia sp., Acinetobacter baumannii,Pseudomonas sp., Stenotrophomonas
maltophilia,andEnterobacter sp.. Metagenomic assessment of bacterial biodiversity in the tap water connected to
dishwashers revealed predominance of Gram-negative bacteria, in particular Proteobacteria, mainly represented by
Tepidimonas sp.. Actinobacteria showed low numbers while no Firmicutes were detected in the tap water. The
bacterial diversity of tap water was also lower, 23 genera compared to 39 genera on dishwasher rubber seals. Only 13
out of 49 genera identified by metagenomics approach was found in both environments, of those Gordonia was
enriched while half of 13 genera were depleted in dishwashers compared to tap water.
Conclusions: These data indicate that colonisation of dishwasher rubber seals probably depends primarily on the
bacterial input from the dirty vessels, and much less on the bacteria in the tap water. Based on the antibiotic resistance
data, the dishwasher rubber seal bacterial isolates do not represent a serious threat for the spread of antibiotic
resistance into the household environment. Nevertheless dishwashers cannot be ignored as potential sources of
human infections, in particular for immuno-compromised individuals.
Keywords: Kitchen, Dishwasher, Bacteria, Antibiotic resistance, Tap water
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
* Correspondence: jerneja.zupancic@bf.uni-lj.si
1
Department of Biology, Biotechnical Faculty, University of Ljubljana,
Ljubljana, Slovenia
Full list of author information is available at the end of the article
Zupančičet al. BMC Microbiology (2019) 19:300
https://doi.org/10.1186/s12866-019-1674-5
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Background
Humans have modified the environment in which they
live throughout their entire history. As a consequence,
indoor dwellings have become increasingly isolated from
the outdoor environment [55], and subject to increased
sanitation due to intensive use of chemicals and disinfec-
tants. As nowadays we spend most of our time indoors,
conditions in these indoor environments are increasingly
influencing our health [14,28,36,50].
On the other hand, stress tolerance and the great
adaptability of some microorganisms means that they
can inhabit novel habitats that have previously been con-
sidered as hostile to abundant microbial growth [24].
Surveys of indoor habitats have, for example, uncovered
a surprising diversity of polyextremotolerant opportunis-
tic and pathogenic bacteria [17,18] and fungi [27].
In these indoor habitats, the microbes are exposed to
conditions that are similar to those encountered in na-
ture, but are nevertheless different in important details.
Kitchens are characterised by the presence of running
water, food remains, frequent contact with humans, and
intense use of chemicals and disinfectants [20,43], and
can be heavily colonised by bacteria and other microbes
[19,20,47,48,57,61]. These adapted microorganisms
invade not only different surfaces and wet environments
in the kitchen [20], but also within household appliances.
Domestic dishwashers as an environment were not
considered to pose any threat to humans until Zalar
et al. [70] revealed heavy contamination of dishwasher
rubber seals with selected opportunistic pathogenic fungi
[13,23,71]. This fungal contamination was not limited
to the rubber seals, but was spread over the entire interiors
of the dishwashers, which provided an environment that in-
fluenced the microbiota throughout the kitchen [71].
Besides fungi, also bacteria can contaminate dishwashers
as revealed in limited studies focusing on dishwasher bac-
terial contamination [52,53,72]. Surprisingly, the prevous
studies performed on bacteria in dishwashers were
focused on dishwasher sanitising performance, in terms of
the determination of the survival of certain selected patho-
genic bacterial species during the washing cycle and on
the washed eating utensils [40,46,62].
The present study was thus focused on the diversity of
the bacterial communities that might be found to col-
onise dishwasher rubber seals, with the sampling of 30
randomly picked household dishwashers, and in the
tap water systems connected to them, using both
cultivation-dependent and metagenomic approaches.
As a significant number of people are affected by
infections each year that are caused by antibiotic-
resistant bacteria, which very often cause severe
complications or death, all of the bacterial isolates ob-
tained from these dishwasher seals were tested for re-
sistance to a selection of antibiotics.
Results
Dishwasher rubber seals are populated with diverse
bacterial communities dominated by gram-positive
bacteria
All 30 sampled residential dishwasher rubber seals were
colonised by bacteria. In total, 632 bacterial isolates were
obtained that belonged to four phyla, eight classes, 40
genera and 74 species (Table 1). On average, the dish-
washers were contaminated with four to eight different
bacterial species, while three of the 30 dishwashers
showed higher cultivable bacterial diversity, as 15, 17
and 22 different bacterial species were isolated from
three separate dishwasher rubber seals (Additional file 1:
Table S1).
Sixty-five percent (48/74) of the isolated species were
Gram-positive, which were represented solely by Firmi-
cutes and Actinobacteria. Class Bacilli represented 50%
(24/48) of all Gram-positive isolates. The remaining 35%
(26/74) of the isolate species were Gram-negative, and
these were most abundantly represented by class
Gammaproteobacteria (65%; 17/26) (Table 1). On aver-
age, the dominant classes were represented by Bacilli
(53%), Actinobacteria (16%) and Gammaproteobacteria
(23%) (Fig. 1).
The Bacillus cereus group is the dominant contaminant of
the dishwasher rubber seals
Bacilli (Firmicutes), as primarily the Bacillus cereus
group, the Bacillus subtilis group, Bacillus flexus,
Bacillus sp. and Paenibacillus sp. were most frequently
isolated from the dishwasher rubber seals (Table 1). The
overall predominance was for isolates of the B. cereus
group, which were isolated from 80% (24/30) of the
dishwashers sampled. The second most commonly iso-
lated species were Bacillus sp. and B. flexus (both 47%;
14/30), followed by the B. subtilis group and Paenibacil-
lus sp. (43%; 13/30). Amongst Actinobacteria, Micrococ-
cus luteus was most frequent (30%; 9/30), followed by
Micrococcus sp. (20%; 6/30) and Brevibacterium casei
(17%; 5/30). Gammaproteobacteria were primarily repre-
sented by Stenotrophomonas maltophilia (33%; 10/30),
Pseudomonas aeruginosa and Escherichia sp. (both 20%;
6/30) (Fig. 1).
Metagenomic assessment of bacterial biodiversity from
dishwasher rubber seals confirms predominance of gram-
positive bacteria
To gain further insight into the diversity of the non-
cultivable part of the bacterial communities that
inhabited these dishwasher rubber seals, pyrosequenc-
ingwasperformedforthe16SrRNAgenefromDNA
isolated from the biofilms on the dishwasher rubber
seals and from the tap water connected to the dish-
washers. Analysis of these metagenomic data resulted
Zupančičet al. BMC Microbiology (2019) 19:300 Page 2 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Table 1 Bacterial species found across the 30 sampled dishwasher rubber seals
Phylum Class Genus Species Dishwasher
123456789101112131415192021222324252728293031323334
Proteobacteria Alphaproteobacteria Rhizobium radiobacter xx
Ochrobactrum sp. x x
Brevundimonas diminuta x
Roseomonas cervicalis xx
Sphingomonas mucosissima x
paucimobilis xx
Betaproteobacteria Achromobacter insolitus x
Comamonas aquatica x
Gammaproteobacteria Acinetobacter calcoaceticus xx x
junii x
ursingii x
Acinetobacter sp. x x x
Pseudomonas aeruginosa xx x x x x
pseudoalcaligenes xx xxx
stutzeri xx
Pseudomonas sp. x x x x
Cronobacter sakazakii xx
Enterobacter sp. x x x x
Escherichia sp. x x x x x x
Escherichia hermannii x
Klebsiella oxytoca xx x
pneumoniae xx x x
Pantoea agglomerans x
Raoultella ornithinolytica xx x
Stenotrophomonas maltophilia xx xxxx x xxx
Firmicutes Bacilli Bacillus amyloliquefaciens xxx
cereus group xxxxxx xxx x x x x x x x x x x x x x x x
circulans x
firmus x
flexus x xx xxx xxx xx x x x
horneckiae xx
licheniformis x
Zupančičet al. BMC Microbiology (2019) 19:300 Page 3 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Table 1 Bacterial species found across the 30 sampled dishwasher rubber seals (Continued)
Phylum Class Genus Species Dishwasher
123456789101112131415192021222324252728293031323334
pumilus xx xx xx
safensis xxx
subtilis group x x x x x x x x x x x x x
Bacillus sp. xxxxxxxxxxxxxx
Brevibacillus parabrevis xx
Paenibacillus sp. x xxx x x xx xxxx
Staphylococcus pasteuri x
saprophyticus xxxx
succinus x
Staphylococcus sp. x x x
Kurthia gibsonii xx x
Lysinibacillus fusiformis xx x xxx
Exiguobacterium sp. x x x x x x x x x
Aerococcus viridans xx
Aerococcus sp. x x
Enterococcus casseliflavus xx x x x x x x x
faecium xx
Clostridia Clostridium xylanolyticum x
Bacterioidetes Flavobacteria Chryseobacterium sp. x x x x
Flavobacterium lindanitolerans x
Sphingobacteria Sphingobacterium multivorum x
Actinobacteria Actinobacteria Aeromicrobium sp. x
Gordonia bronchialis x
paraffinivorans xxx
polyisoprenivorans x
terrae x
Brachybacterium sp. x
Brevibacterium casei xxxx x
sanguinus x
Corynebacterium sp. x
Kocuria kristinae x
rhizophila x
Zupančičet al. BMC Microbiology (2019) 19:300 Page 4 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Table 1 Bacterial species found across the 30 sampled dishwasher rubber seals (Continued)
Phylum Class Genus Species Dishwasher
123456789101112131415192021222324252728293031323334
Microbacterium aurum x
lacticum x
oxydans xx
Microbacterium sp. x
Micrococcus luteus xxx x x xxx x
Micrococcus sp. x x x x x x
Cellulosimicrobium cellulans xx x
Naumannella halotolerans x
Zupančičet al. BMC Microbiology (2019) 19:300 Page 5 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
in 4638 reads assigned to OTUs from the dishwasher bio-
films, and 1503 reads assigned to OTUs from the water
samples (Fig. 2, Additional file 1: Table S2). The majority
of the OTUs from the biofilms were assigned to Gram-
positive bacteria (76%), and primarily to phylum Actino-
bacteria (70%), which was mainly represented by Gordonia
sp. (66%), followed by 14 other genera. Proteobacteria
were the second most common bacterial phylum (14%),
with a predominance of Gammaproteobacteria (73%)
where opportunistic pathogenic species such as Escheri-
chia sp., Acinetobacter baumannii,Pseudomonas sp.,
Stenotrophomonas maltophilia and Enterobacter sp. were
detected, together with 3 other genera. Other abundant
sequences were affiliated to the phylum Firmicutes (6%),
out of which Exiguobacterium sp. was the most numerous
representative (51%).
Fig. 1 Diversity and abundance of the bacterial species isolated from the swab samples from the 30 residential dishwasher rubber seals. The
most represented phylum was Firmicutes (54%), followed by Proteobacteria (28%), Actinobacteria (16%) and Bacteroidetes (2%). The dominant
classes were Bacilli (53%), Actinobacteria (16%) and Gammaproteobacteria (23%)
Zupančičet al. BMC Microbiology (2019) 19:300 Page 6 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
Metagenomic assessment of bacterial biodiversity in the
tap water reveals apredominance of gram-negative
bacteria
The metagenomics analysis of the tap water samples
demonstrated the prevalence of OTUs assigned to
Gram-negative bacteria (95%), among which Proteobac-
teria (95%) in particular were detected (Fig. 2, Additional
file 1: Table S2). Betaproteobacteria were the most abun-
dant (62%) among Proteobacteria, but were mainly rep-
resented by Tepidimonas sp. (92%), followed by 4 other
genera. Actinobacteria were present in low numbers
(2%, 3 genera) while Firmicutes were not present at all
in tap water. Both Alphaproteobacteria and Betaproteo-
bacteria were markedly more present in the tap water
(85%; 352/1503 OTUs plus 929/1503 OTUs, respect-
ively) with observed greater diversity for these two tax-
ons as well (10 and 5 genera, respectively), and were
hardly found in the dishwasher biofilms (4%; 99/4638
OTUs plus 75/4638 OTUs, respectively). The reverse
situation was observed for Gammaproteobacteria, which
were present only at 9% in the tap water (139/1503
OTUs) with lower diversity (4 genera), but were abun-
dant and showed greater diversity in the dishwasher
biofilms (467/4638OTUs and 8 genera) (Fig. 2). Of 49
genera identified, 10 were detected only in tab water
and26onlyondishwasherrubberseals.Additionalfile1:
Table S2 presents all of the reads obtained.
Bacterial diversity on dishwasher rubber seals is mostly
influenced by water hardness and washing temperature
These randomly selected dishwashers were characterised
according to the type of water supply (from hard to soft),
age (years since purchased), frequency of use (times per
week), cleaning (method) and temperature of washing
(Table 2; for full details, see Additional file 1: Table S1).
The highest cultivation-dependent bacterial diversity for
the rubber seals (1522 different bacterial species) was
detected in dishwashers connected to hard or moder-
ately hard tap water (1.52.0 mmol/L CaCO
3
) (Fig. 3). A
closer look at isolates from these three dishwashers with
the highest bacterial diversity (Table 1) showed that the
most frequent species on the rubber seals was Exiguo-
bacterium sp., which represented 26% of all of the iso-
lated species (dishwashers 10, 29), and Enterococcus
casseliflavus, which represented 17% of all of the isolated
species (dishwasher 6). For the rubber seals, dishwashers
10 and 29 had 61 and 70% Bacilli, 24 and 29% Proteo-
bacteria, and 4 and 10% Actinobacteria, respectively,
while dishwasher 6 had equal levels of Bacilli and Pro-
teobacteria (44%), with 8% Actinobacteria. Escherichia
sp. was present on the rubber seals of both dishwashers
6 and 10 (8 and 12% of all isolates, respectively), but not
of dishwasher 29 (Fig. 3).
In comparison, for the rubber seals of the two dish-
washers connected to soft tap water (0.5 mmol/L
Fig. 2 Proportions of the different bacterial phyla from the tap water system and the biofilms from the dishwasher rubber seals. Although the
broad composition of bacterial taxa was similar across the different samples, their relative abundances varied, indicating that dishwashers are
highly selective environments
Zupančičet al. BMC Microbiology (2019) 19:300 Page 7 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
CaCO
3
), only up to six different bacterial species were
detected. These isolated species belonged to Firmicutes
(B. cereus group, Paenibacillus sp.) and Actinobacteria
(Brevibacterium casei,Brevibacterium sanguinus,Kocuria
rhizophila)(Table1). Proteobacteria (which includes
Escherichia sp. and P. aeruginosa) and Bacteroidetes were
not detected on the rubber seals of these dishwashers,
whereas K. rhizophila was isolated only from the rubber
seals of dishwashers connected to soft tap water.
Bacterial diversity was influenced also by the frequency
of use and the age of the dishwashers (i.e., years from
purchase). More frequent use and up to 1 year of oper-
ation time was associated with higher bacterial diversity
here, while the number of isolated species decreased
Table 2 Characteristics of the dishwashers in relation to the mean numbers of different bacterial species isolated
Characteristic Specific Mean bacterial species per dishwasher
Water hardness (mmol/L CaCO
3
) Hard (2.0) 7.8
Moderately hard (1.6) 9.6
Slightly hard (1.0) 9.0
Soft (0.5) 4.5
Type of cleaning None 8.9
Chemical 8.5
Mechanical 11.0
Temperature of washing (°C) 50 10.3
60 9.1
65 8.9
70 2.0
Frequency of use (per week) < 7 9.2
7 7.9
814 11.0
Age of dishwasher (years) 0.51.0 10.9
1.12.0 9.8
2.13.0 7.8
3.16.0 8.3
6.18.0 7.7
Fig. 3 Comparisons of the bacterial species diversity on the rubber seals of the three sampled dishwashers that showed the highest cultivation-
dependent bacterial diversity, which were supplied with hard tap water. Dishwasher 6 (a) and dishwasher 10 (b) were both supplied with
moderately hard tap water (1.6 mmol/L CaCO
3
), and dishwasher 29 (c) was supplied with hard tap water (2.0 mmol/L CaCO
3
). Different colors
convey bacterial classes e.g. Bacilli are represented in red, Proteobacteria are represented in green, Actinomycetes are represented in blue and
Bacteroidetes are represented in purple colour
Zupančičet al. BMC Microbiology (2019) 19:300 Page 8 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
with the age of the dishwashers, reaching the lowest
levels for 68-year-old dishwashers (Table 2).
With a temperature of washing of approximately
50 °C, this was associated with the highest diversity of
isolated bacteria (as a mean of 10.3 different bacterial
species per rubber seal), with the higher temperatures
indicating lower numbers of species detected (Table 2).
No differences in the cultivable bacterial diversity were
observed in relation to the method of cleaning of the
dishwashers (Table 2).
Selected gram-positive bacteria can contaminate washed
dishes
The presence and diversity of bacteria on the dishes and
cutlery immediately after the end of the washing process
were also investigated. All of the isolates obtained (15)
were Gram-positive species that belong to the phyla Fir-
micutes and Actinobacteria. The highest bacterial diver-
sity was observed after the sampling of some plastic
items, whereas this was lower for the metal and ceramic
objects. For example, Gordonia paraffinivorans,Brachy-
bacterium nesterenkovii,Micrococcus sp., and M. luteus
were isolated from a plastic meat-cutting board, Bacillus
flexus,Bacillus marisflavi, and M. luteus from a glass lid,
and M. luteus from a ceramic plate and from metal
cutlery.
Bacterial communities that contaminate dishwasher
rubber seals do not represent a serious threat for the
spread of antibiotic resistance
From 632 isolates tested for antibiotic resistance against
the seven selected antibiotics, the majority (48%) was
represented by Firmicutes from the order Bacilliales
(Bacillaceae,Paenibacillaceae,Planococcaceae,Staphylo-
coccaceae) and are presented in Additional file 1: Table
S3. This group showed relatively low levels of antibiotic
resistance, with the highest seen for the third generation
cephalosporins (cefotaxime 57%, ceftazidime 70%), while
the resistance against the other screened antibiotics was
10 to 12%, or lower (for full details, see Additional file 1:
Table S3).
For the order of the Firmicutes, Lactobacillales (e.g.,
Enterococccaceae), there was high antibiotic resistance
against cefotaxime, ceftazidime, ertapenem and ciprofloxacin
(90% of isolates). The order of Actinomycetales showed
slightly elevated resistance against ceftazidime (60%) and
cefotaxime (81%).
Among the Proteobacteria, Pseudomonadales showed
the highest levels of resistance against cefotaxime (80%)
and ertapenem (51%). The order of Enterobacteriales did
not show any particularly resistance, as all of these
were < 8%, with the exception of resistance to imipenem
(25%).
Isolates belonging to the orders of Xanthomonadales
(Proteobacteria) and Flavobacteriales (Bacterioidetes)
were not as numerous as for the previous groups; how-
ever, they showed relatively high levels of antibiotic re-
sistance. In Xanthomonadales, the resistance against all
used antibiotics except tetracycline was between 76 and
100%, and was indeed mainly > 90%, while in Flavobac-
teriales all of the resistance was between 80 and 90%, ex-
cept for ceftazidime (60%).
The groups of Sphingomonadales, Rhizobiales and
Rhodospirillales showed higher resistance against cefo-
taxime and ceftazidime (both at 86%).
Discussion
Over the last two decades there have been several reports
of home-related microbial infections [6,8,37,58,60]. Out
of all of the indoor locations, bathrooms [18,19,35]and
kitchens [20,47,48,57,61] are among the most heavily
colonised by opportunistic pathogenic bacteria, both in
terms of abundance and diversity. Although the spread of
most food-related pathogenic bacteria (e.g., Campylobac-
ter,Salmonella,Listeria)[3,29,42] can be minimised
using correct hygiene practices and disinfectants [10,11,
54,59], advances in technology and increasingly inhospit-
able indoor habitats to microbes have driven the selection
of different and more stress-resistant species.
Some studies have reported that there is a link between
the metabolism of phenols and hydrocarbons and the mi-
crobial tendency to infect the central nervous system [51].
Repeated cycles of thermal stress in house appliances se-
lect for thermotolerant, opportunistic pathogens [24,25].
Opportunistic pathogenic bacteria [56,69] and fungi
(Novak [1]) contaminate washing machines. Bacteraemia
outbreaks of B. cereus have been reported for hospitals
using linen that was washed in contaminated washing ma-
chines [56], and for Gordonia bronchialis after laundering
of surgical scrubs in domestic washing machines [69].
Although dishwashers are also heavily contaminated with
selected opportunisticpathogenicfungi[13,23,70,71], so
far there is one report on the diversity and characteristics of
the bacterial contaminants in the mixed bacterial-fungal
biofilms that can colonise dishwasher rubber seals [72].
Comparisons between the non-cultivable and cultivable
bacterial communities that have been isolated from dish-
washers have shown the differences in their structures.
The predominance of the Firmicutes (54%, 10 genera),
followed by Proteobacteria (28%, 16 genera) and Actino-
bacteria (16%, 10 genera), has been reported among cultiv-
able microorganisms. Analysis of metagenomic data has
provided a different picture, with the dominance of Acti-
nobacteria (70%, 15 genera), followed by Proteobacteria
(14%, 21 genera), a small percentage of Firmicutes (6%, 2
genera) and some candidate phyla. One of the reasons for
the discrepancy is probably the selection of the chosen
Zupančičet al. BMC Microbiology (2019) 19:300 Page 9 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
synthetic microbial media and the cultivation conditions,
which favoured the isolation of Firmicutes, and primarily
the genus Bacillus.
Plumbing systems that supply water to household
dishwashers represent the most probable route of con-
tamination of appliances with fungi [71]. Therefore, 30
tap water samples from the kitchens with dishwashers
were analysed for the presence of bacteria using a
metagenomic approach. A prevalence of Gram-negative
bacteria was shown here, and in particular of Proteo-
bacteria, with high prevalence of Tepidimonas sp.
(Betaproteobacteria), a very low number of Actinobac-
teria and no Firmicutes. Compared to the biofilms on
dishwasher rubber seals the bacterial diversity of tap
water was also lower, 23 genera compared to 39 genera
on rubber seals. The greatest difference in diversity was
observed for Actinobacteria (3 genera in tap water ver-
sus 15 genera on dishwasher rubber seals). Only 13 out
of 49 genera identified by metagenomics approach was
found in both environments, of those Gordonia was
enriched while half of 13 genera were reduced in dish-
washers. This piece of information together with the
fact that the microbial communities in these dish-
washer rubber seal biofilms were dominated by com-
pletely different Gram-positive bacteria show that we
can probably rule out the tap water as the main route
for introduction of bacteria into these dishwashers, in
contrast to what was observed in fungi [71]. Therefore,
dirty vessels probably represent the major vehicle of
bacterial transfer into these dishwashers.
Close contact of different microbes in well-established
microbial biofilms that cover the dishwasher rubber seals
can facilitate the spread of antibiotic resistance amongst
these, and thus we characterised all of these bacterial
isolates in relation to seven selected antibiotics. Among
the isolated strains in Firmicutes, B. amyloliquefaciens
from one dishwasher, together with B. pumilus and B.
subtilis, were resistant to cephalosporins. Bacillus hor-
neckiae showed resistance to carbapenem antibiotics
(imipenem, ertapenem) and some B. pumilus isolates
were also resistant to ciprofloxacin and ertapenem. This
is in contrast with literature reports that have indicated
that species from the genus Bacillus are usually suscep-
tible to imipenem, ciprofloxacin and tetracycline, and
except for B. cereus (which produces a broad spectrum
β-lactamase), also to cephalosporins (cefotaxime, ceftazi-
dime) and penicillins [68]. According to the literature
data, Paenibacillus species are usually susceptible to all
of the antibiotics that were used in the present study
[68], while these isolates here were resistant to one up to
three of the antibiotics tested, with the exception of
tetracycline. Although Staphylococcus saprophyticus, the
second most common pathogen identified in urinary
tract infections, is a relatively susceptible organism [30],
the isolates in the present study were resistant to the
cephalosporins tested.
Among the isolated Exiguobacterium sp. strains, only
one isolate showed multiple resistance to the antibiotics
tested. The genus Enterococcus (Lactobacillales) includes
some of the most important nosocomial multidrug-
resistant organisms. Enterococcus faecium is an emergent
nosocomial pathogen that is intrinsically resistant to
aminoglycosides (kanamycin), tetracyclines, cephalospo-
rins and quinolones, and that can acquire resistance to
other antibiotics [31]. This very high occurrence of anti-
biotic resistance was shown also for dishwasher isolates.
In Actinomycetales, Micrococcus spp. and the closely re-
lated genera are ubiquitous and are generally considered
as harmless saprophytes that are relatively susceptible to
most antibiotics. The majority of the M. luteus isolates
from these dishwasher rubber seals were resistant to cip-
rofloxacin, which is contrary to the literature data (MIC,
0.8 μg/ml [73];), while the Gordonia isolates were sus-
ceptible to all of the antibiotics tested [4]. The Brevibac-
terium casei isolates should be susceptible to the
majority of the antibiotics tested, except ciprofloxacin
[65]; here B. casei was also resistant to cephalosporins
and carbapenem antibiotics.
As representatives of Proteobacteria, most strains of P.
aeruginosa are significantly more resistant to many anti-
microbial agents than other closely related genera [22].
All of the dishwasher rubber seal isolates of P. aerugi-
nosa were resistant to the tested carbapenems, cefotax-
ime and kanamycin, and some of them also to
ciprofloxacin. Not surprisingly, only a few of other iso-
lated pseudomonads, like Acinetobacter spp., where re-
sistant to the carbapenems and/or cephalosporins tested
[34]. Amongst the tested isolates of enterobacteria, the
majority (Klebsiella,Enterobacter,and Escherichia) were
susceptible to the tested antibiotics, except imipenem
(Enterobacter)[5].
Amongst Xanthomonadales, S. maltophilia represents
an emerging opportunistic pathogen, in particular due to
its known resistance to many classes of antimicrobial
agents [34]. All of these S. maltophilia dishwasher rubber
seal isolates were resistant to all of the antibiotics tested.
The Bacterioidetes Chryseobacterium spp. isolates are
known to be intrinsically resistant to most β-lactams, in-
cluding carbapenems, and to aminoglycosides, tetracyclines,
fluoroquinolones and chloramphenicol [21], which was
confirmed also in these dishwasher rubber seal isolates.
Although the overall antibiotic resistance data of the dish-
washer rubber seal bacterial isolates indicate that they do
not represent a serious threat for the spread of antibiotic re-
sistance into the household environment, dishwashers
should nevertheless be considered as a potential source of
infection with antibiotic resistant bacteria, in particular for
immuno-compromised individuals.
Zupančičet al. BMC Microbiology (2019) 19:300 Page 10 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
The bacteria that colonise dishwashers can be released
into the kitchens via aerosols and waste water, and by
direct contact between contaminated surfaces and
humans. Thus, dishwashers are possible sources of bac-
terial infections. Immuno-compromised patients with
cystic fibrosis are an especially endangered group, par-
ticularly as they can often have chronic P. aeruginosa
lung infections [12]. Although its deadliness is most
apparent in patients with cystic fibrosis, P. aeruginosa is
an opportunistic pathogen and therefore also a major
problem in nosocomial infections in terms of burn and
chronic wounds, chronic obstructive pulmonary dis-
order, surface growth on implanted biomaterials, and on
hospital surfaces and in the water supply [7,45,49].
Amongst the 632 dishwasher rubber seal bacterial iso-
lates, 12 were P. aeruginosa. Interiors of washing ma-
chines have been reported previously to harbour strains
of P. aeruginosa [41], while this study also confirmed
their presence in well-established biofilms on dishwasher
rubber seals. Six out of 30 dishwashers were contami-
nated with P. aeruginosa, and these thus represented a
major indoor environmental reservoir.
Another commonly encountered opportunistic patho-
gen E. coli was found in six out of 30 dishwashers exam-
ined. As E. coli strains are traditionally considered to be
commensals of the microbiota in the intestinal tract of
warm-blooded animals and humans, strains equipped
with virulence factor genes can cause a wide spectrum
of mild to severe extra-intestinal and intestinal infections
[63]. Environmental E. coli strains are considered to arise
primarily as a result of faecal contamination of soil,
drinking water, recreational water, and groundwater
[32]. Recent studies have suggested, however, that hu-
man opportunistic pathogenic E. coli strains can persist
over longer periods of time as viable entities also in dif-
ferent hostile environments, especially when embedded
in biofilms [32,67]. To the best of our knowledge, this is
the first description of E. coli isolates from biofilms that
colonise dishwasher rubber seals. The primary source of
these isolates might be both the household water supply
system connected to the dishwasher and the contami-
nated vessels. Of interest also, the same sequence type of
isolated E. coli strain was found in different dishwashers,
which were even geographically located in different cit-
ies, thus indicating the strong selective pressure of this
specific extreme environment. This has resulted in the
enrichment of these not very virulent E. coli isolates,
which have instead an emphasis on the ability to form
adherent and persistent biofilms, and to take up sulphur
and iron from the environment.
Conclusion
We can conclude here that repeated mechanical, oxida-
tive, water activity, and thermal stress inside dishwashers
select for, and consequently enrich, biofilm-forming bac-
teria species, which in many instances are antibiotic re-
sistant and virulent thermotolerant bacterial species. As
these are the crucial factors that define most microbes
in terms of their potential pathogenicity, as potential
sources of human infections, domestic dishwashers can-
not be ignored.
Methods
Sample collection
For the sampling of the dishwasher seals, 30 dishwashers
were randomly selected in kitchens inside private dwellings
located in seven Slovenian cities (i.e., Ljubljana, Velenje,
Žalec, Celje, Mislinja, Sežana, and Portorož). These dish-
washers differed in age (18 years), brand (four different
ones), frequency of use (once a week, to twice a day), and
cleaning techniques (chemical, mechanical). Swab samples
from their rubber seals (Fig. 4) were obtained by rubbing a
cotton swab moistened with physiological saline over the
seal surface at the end of the regular washing cycle. These
swabs were immediately placed into sterile tubes, stored at
4 °C, and processed within 1 day. Further swab sampling
was performed on washed vessels that had remained after
washing in the dishwasher following an overnight wash
cycle, such as glass lids of kitchenware, plastic kitchen
boards, ceramic plates, and metal spoons. Additionally, 1.0
L tap water was taken from each of these 30 kitchens where
these dishwashers were located. Sampling the biofilms
formed on rubber seals of the 30 dishwashers was per-
formed by scraping the seal surface with a sterile scalpel,
and then placing the scraped material into sterile sampling
tubes. The samples were stored at 20 °C, and later com-
bined following the DNA isolation.
Isolation of bacterial isolates
For each swab, a separate agar plate was used. The
swabs were streaked on nutrient agar, brainheart infu-
sion agar, Reasoners 2A agar, and M9 minimal medium
[66]. These plates were incubated aerobically at 37 °C for
2 days (nutrient agar and brainheart infusion agar) or
for up to 7 days for minimal medium, and for 7 days at
37 °C for Reasoners 2A agar. For the isolation of anaer-
obes, swabs were streaked on brainheart infusion agar
plates and incubated anaerobically at 37 °C for 7 days.
Colonies representing all of the morphotypes were re-
streaked several times on the chosen medium to obtain
pure cultures, which were deposited at the Ex Culture
Collection, which is part of the Mycosmo Infrastructural
Centre at the Department of Biology, Biotechnical Fac-
ulty, University of Ljubljana, Slovenia.
Antibiotic resistance
All of the bacterial isolates were tested for resistance to
a selection of antibiotics that was based on their
Zupančičet al. BMC Microbiology (2019) 19:300 Page 11 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
importance in present curative treatments of stubborn
bacterial infections. The seven chosen antibiotics were
diluted in Lysogeny broth [LB] medium with agar, and
used at the following final concentrations: 2 mg/L cefotax-
ime; 8 mg/L ceftazidime; 0.5 mg/L ertapenem; 2 mg/L imi-
penem; 0.25 mg/L ciprofloxacin; 15 mg/L tetracycline; and
50 mg/L kanamycin. The antibiotic solutions were steri-
lised by filtration (0.22 μm; Millipore) and added to LB
agar medium cooled to 55 °C (in a water bath). The resist-
ance against these antibiotics was checked with antibiotic
susceptibility testing, with the bacterial isolates streaked to
single colonies to LB agar plates with chosen antibiotics.
Inoculated plates were incubated at 37 °C for up to 2 days
(depending on the growth of the isolates). Additionally, all
of these plates were incubated at 24 °C for another 2days,
and their growth was compared to the positive control
(i.e., in LB agar plates without added antibiotics).
Genomic DNA extraction and identification of bacterial
isolates
Genomic DNA extraction was performed from overnight
bacterial cultures grown on LB agar plates at 37 °C,
using PrepMan Ultra Sample Preparation Reagent
(Applied Biosystems), according to the manufacturer
instructions.
The 16S rRNA genes were PCR amplified with oligo-
nucleotide primers 27F (AGAGTTTGATCMTGGCTCAG
[39];) and 1495r (CGGTTACCTTGTTACGACTT [2];).
The PCR mixtures (35 μL) contained 1 μLisolatedDNA,
0.45 U DreamTaq DNA polymerase (Thermo Fisher Scien-
tific), 1× DreamTaq buffer with MgCl
2
(Thermo Fisher
Scientific), 0.1 mM dNTP (Thermo Fisher Scientific), and
0.1 μM of each primer. The reaction mixtures were first de-
natured at 94 °C for 5 min, and then subjected to 5 cycles of
94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min, 5 cycles of
94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and 30 cycles
of9C for 30s, 5C for 30s, and 7C for 1min. Elong-
ation in the last cycle lasted 7 min, followed by a final incu-
bation at 4 °C. The PCR products were separated on 1%
(w/v) agarose gels by electrophoresis in 1× TAE buffer, and
subsequently purified and sequenced at Microsynth AG
(Balgach, Switzerland) using the 27F sequencing primer.
The retrieved 16S rDNA sequences were identified on
the basis of an approximately 800-bp-long amplicon,
using the Ribosomal Database Project-II (RDP-II; http://
rdp.cme.msu.edu) and National Centre for Biotechnol-
ogy Information Basic Local Alignment Search Tool
(NCBI BLAST) to search the GenBank non-redundant
nucleotide database. Identification to the species level
was defined as a 16S rDNA sequence similarity 99%
with that of the prototype strain sequence in RDP-II;
identification at the genus level was defined as a 16S
rDNA sequence similarity 97% with that of the proto-
type strain sequence in RDP-II.
Molecular and data analysis of biofilms and tap water
DNA from the biofilms from the scraping of the 30 sam-
pled dishwasher rubber seals was isolated from 0.05 g to
0.1 g of biofilm biomass, using DNA isolation kit (Power
Biofilm; MoBio, Carlsbad, CA, USA), according to the
manufacturer instructions. Additionally, total DNA was
Fig. 4 Dishwasher rubber seal. Sampling was performed in household dishawshers (a), on rubber seals where the outer edge of the dishwasher
and the dishwasher door are in close contact (b)
Zupančičet al. BMC Microbiology (2019) 19:300 Page 12 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
isolated from the respective 30 tap water samples by filter-
ing 1 L of water through 0.45-μm membrane filters (Merck,
Millipore), and using DNA isolation kit (PowerWater;
MoBio, Carlsbad, CA, USA), following the manufacturer
instructions.
For the downstream sequencing, all 30 samples of
these total DNA from biofilms were combined to a 5 ng/
μL equimolar concentration and all of these 30 total DNA
samples from water to a 3 ng/μL equimolar concentration.
To target prokaryotic 16S rRNA genes for each of the
pooled samples, PCR amplicon libraries were constructed
using the 27F and 1495r bacterial primer sets [33]. Ampli-
con sequencing was carried out by Microsynth AG using
a pyrosequencing platform (Roche 454). Initially, the se-
quences were quality trimmed with the threshold 25 and
all reads shorter than 250 bp were removed. The reads
were then processed bioinformatically with the QIIME
software package [9]. The mean read length of the se-
quences was 535 bp, which covered the V1, V2 and V3
hyper-variable regions of 16S rDNA. Chimeric sequences
were identified using the UCHIME algorithm [16] and dis-
carded. Linker and reverse primers were trimmed. The
maximum number of allowed homopolymers in a single
bacterial sequence was set to six. The sequences were then
clustered into operational taxonomic units (OTUs) by
subsampling open reference clustering against the Green-
Genes reference set, constructed at 97% similarity in the
case of 16S rDNA analysis [38,44]. The clustering was
performed using the usearch61 algorithm [15]with97%
similarity preference as the standard definition of a bacter-
ial species. Singletons were removed from further analysis.
Alignments of the resulting 16S rDNA representative se-
quence sets were constructed using the ClustalX software
[64]. Maximum likelihood methods implemented in
PhyML 3.0 [26] were used to build phylogenetic trees to
assign the taxonomy to new reference OTUs where
possible. When the reference collections did not yield any
results, taxonomy assignment was attempted using UNI-
TE+INSD (International Nucleotide Sequence Databases:
National Centre for Biotechnology Information; European
Molecular Biology Laboratory;DNA Data Bank of Japan).
Supplementary information
Supplementary information accompanies this paper at https://doi.org/10.
1186/s12866-019-1674-5.
Additional file 1: Table S1. Characteristics of the individual
dishwashers sampled. Table S2. Bacterial phyla detected in the water
and biofilm samples. Table S3. Antibiogram results, showing all of the
isolated bacteria from the rubber seals of the 30 residential dishwashers
in terms of their antibiotic resistance against the chosen antibiotics.
Abbreviations
CFZ: ceftazidime; CIP: ciprofloxacin; CTX: cefotaxime; ETP: ertapenem;
IMP: imipenem; KN: kanamycin; LB: Lysogeny broth medium with agar;
MIC: Minimum inhibitory concentration; OTUs: operational taxonomic units;
RDP-II: the Ribosomal Database Project-II; TC: tetracycline
Acknowledgments
Our acknowledgments go to all the people who kindly provided samples
from their dishwashers. We also thank Christopher Berrie for language
assistence and prof. Børge Diderichsen for careful and critical reading of the
manuscript.
Authorscontributions
NGC, JAA and MT designed the study. JZ, MČ, MT, JAA performed the
experiments and analyzed the data. JZ, MT, JAA, MČand NGC compiled the
manuscript. All authors have read and approved the manuscript.
Funding
This research was funded by the Ministry of Higher Education, Science and
Technology of the Republic of Slovenia, as a Young Researcher grant to JZ
(grant no. 3822281/2013). This work was also supported by the Slovenian
Research Agency (Infrastructural centre Mycosmo MRIC UL, Research
Programmes P10170). The funding sources had no role in the study design,
analysis, collection, data interpretation and manuscript writing.
Availability of data and materials
All data generated or analysed during this study are included in this
published article (and its supplementary information files).
Ethics approval and consent to participate
In this study, field sampling was performed, and to our knowledge, no
endangered or protected species were involved. All of the samples studied
here were obtained from the discussed sampling area, for which permission
was obtained from the owners.
Consent for publication
Not applicable.
Competing interests
The authors declare that the research was conducted in the absence of any
commercial or financial relationships that could be construed as a potential
conflict of interest. The authors declare that they have no competing
interests.
Author details
1
Department of Biology, Biotechnical Faculty, University of Ljubljana,
Ljubljana, Slovenia.
2
Centre of Excellence for Integrated Approaches in
Chemistry and Biology of Proteins (CIPKeBiP), Ljubljana, Slovenia.
Received: 14 June 2019 Accepted: 4 December 2019
References
1. BabičMN, Zalar P, Ženko B, Schroers HJ, Džeroski S, Gunde-Cimerman N.
Candida and Fusarium species known as opportunistic human pathogens
from customer-accessible parts of residential washing machines. Fungal
Biol. 2015;119:95113.
2. Bandi C, Damiani G, Magrassi L, Grigolo A, Fani R, Sacchi L. Flavobacteria as
intracellular symbionts in cockroaches. Proc Biol Sci. 1994;257:438.
3. Berger CN, Sodha SV, Shaw RK, Griffin PM, Pink D, Hand P, Frankel G. Fresh
fruit and vegetables as vehicles for the transmission of human pathogens.
Environ Microbiol. 2010;12:238597.
4. Blaschke AJ, Bender J, Byington CL, Korgenski K, Daly J, Petti CA, Pavia AT,
Ampofo K. Gordonia species: emerging pathogens in pediatric patients that
are identified by 16S ribosomal RNA gene sequencing. Clin Infect Dis. 2007;
45:4836.
5. Bornet C, Davin-Regli A, Bosi C, Pages JM, Bollet C. Imipenem resistance of
Enterobacter aerogenes mediated by outer membrane permeability. J Clin
Microbiol. 2000;38:104852.
6. Bradford PA, Urban C, Jaiswal A, Mariano N, Rasmussen BA, Projan SJ, Rahal
JJ, Bush K. SHV-7, a novel cefotaxime-hydrolyzing beta-lactamase, identified
in Escherichia coli isolates from hospitalized nursing home patients.
Antimicrob Agents Chemother. 1995;39:899905.
Zupančičet al. BMC Microbiology (2019) 19:300 Page 13 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
7. Breathnach AS, Cubbon MD, Karunaharan RN, Pope CF, Planche TD. Multidrug-
resistant Pseudomonas aeruginosa outbreaks in two hospitals: association with
contaminated hospital waste-water systems. J Hosp Infect. 2012;82:1924.
8. Byrd-Bredbenner C, Berning J, Martin-Biggers J, Quick V. Food safety in
home kitchens: a synthesis of the literature. Int J Environ Res Public
Health. 2013;10:406085.
9. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman DF,
CostelloEK,FiererN,PeñaAG,GoodrichJK,GordonJI,HuttleyGA,
Kelley ST, Knights D, Koenig JE, Ley RE, Lozupone CA, McDonald D,
Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ, Walters
WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. QIIME allows
analysis of high-throughput community sequencing data. Nat Methods.
2010;7:3356.
10. Cogan TA, Bloomfield SF, Humphrey TJ. The effectiveness of hygiene
procedures for prevention of cross-contamination from chicken carcases
in the domestic kitchen. Lett Appl Microbiol. 1999;29:3548.
11. Cogan TA, Slader J, Bloomfield SF, Humphrey TJ. Achieving hygiene in
the domestic kitchen: the effectiveness of commonly used cleaning
procedures. J Appl Microbiol. 2002;92:88592.
12. Costerton JW. Pseudomonas aeruginosa. In: Sabath CD, editor. The
organism, diseases it causes, and their treatment. Switzerland: Hans
Huber Publishers; 1980. p. 1524.
13. Döğen A, Kaplan E, Oksüz Z, Serin MS, Ilkit M, de Hoog GS. Dishwashers are
a major source of human opportunistic yeast-like fungi in indoor
environments in Mersin, Turkey. Med Mycol. 2013;5:4938.
14. Dunn RR, Fierer N, Henley JB, Leff JW, Menninger HL. Home life: factors
structuring the bacterial diversity found within and between homes.
PLoS One. 2013. https://doi.org/10.1371/journal.pone.0064133.
15. Edgar RC. Search and clustering orders of magnitude faster than BLAST.
Bioinformatics. 2010;26:24601.
16. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves
sensitivity and speed of chimera detection. Bioinformatics. 2011. https://
doi.org/10.1093/bioinformatics/btr381.
17. Eguchi H, Miyamoto T, Kuwahara T, Mitamura S, Mitamura Y. Infectious
conjunctivitis caused by Pseudomonas aeruginosa isolated from a bathroom.
BMC Res Notes. 2013. https://doi.org/10.1186/1756-0500-6-245.
18. Feazel LM, Baumgartner LK, Peterson KL, Frank DN, Harris JK, Pace NR.
Opportunistic pathogens enriched in showerhead biofilms. Proc Natl Acad
Sci U S A. 2009;106:163939.
19. Flores GE, Bates ST, Knights D, Lauber CL, Stombaugh J, Knight R, Fierer N.
Microbial biogeography of public restroom surfaces. PLoS One. 2011;6:e28132.
20. Flores GE, Bates ST, Caporaso JG, Lauber CL, Leff JW, Knight R, Fierer N.
Diversity, distribution and sources of bacteria in residential kitchens. Environ
Microbiol. 2013;15:58896.
21. Gales AC, Jones RN, Andrade SS, Sader HS. Antimicrobial susceptibility
patterns of unusual nonfermentative gram-negative bacilli isolated from
Latin America: report from the SENTRY antimicrobial surveillance program
(1997-2002). Mem Inst Oswaldo Cruz. 2005;100:5717.
22. Garrity G, Brenner DJ, Krieg NR, Staley JR. Bergeys manual of systematic
bacteriology, Vol. 2: the proteobacteria, Part B: the Gammaproteobacteria.
Berlin: Springer; 2005.
23. Gümral R, Özhak-Baysan B, Tümgör A, Saraçli MA, Yildiran ŞT, Ilkit M,
ZupančičJ, Novak-BabičM, Gunde-Cimerman N, Zalar P, de Hoog GS.
Dishwashers provide a selective extreme environment for human-
opportunistic yeast-like fungi. Fungal Divers. 2016;76:19.
24. Gostinčar C, Grube M, Gunde-Cimerman N. Evolution of fungal pathogens
in domestic environments. Fungal Biol. 2011;115:100818.
25. Gostinčar C, Gunde-Cimerman N, Grube M. Polyextremotolerance as the
fungal answer to changing environments. In: Bakermans C, editor. Microbial
evolution under extreme conditions, (life in extreme environments, vol. 2).
Berlin: De Gruyter; 2015. p. 185208.
26. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O.
New algorithms and methods to estimate maximum-likelihood
phylogenies: assessing the performance of PhyML 3.0. Syst Biol.
2010;59:30721.
27. Hamada N, Abe N. Comparison of fungi found in bathrooms and sinks.
Biocontrol Sci. 2010;15:516.
28. Hanski I, von Hertzen L, Fyhrquist N, Koskinen K, Torppa K, Laatikainen T,
Karisola P, Auvinen P, Paulin L, Mäkelä MJ, Vartiainen E, Kosunen TU, Alenius
H, Haahtela T. Environmental biodiversity, human microbiota, and allergy
are interrelated. Proc Natl Acad Sci U S A. 2012;109:83349.
29. Heaton JC, Jones K. Microbial contaminationof fruit and vegetables and the
behaviour of enteropathogens in the phyllosphere: a review. J Appl
Microbiol. 2008;104:61326.
30. Higashide M, Kuroda M, Omura CT, Kumano M, Ohkawa S, Ichimura S, Ohta
T. Methicillin-resistant Staphylococcus saprophyticus isolates carrying
staphylococcal cassette chromosome mec have emerged in urogenital tract
infections. Antimicrob Agents Chemother. 2008;52:20618.
31. Hollenbeck BL, Rice LB. Intrinsic and acquired resistance mechanisms in
enterococcus. Virulence. 2012;3:42133.
32. Ishii S, Sadowsky M. Escherichia coli in the environment: implications for
water quality and human health. Microbes Environ. 2008;23:1018.
33. Jiang H, Dong H, Zhang G, Yu B, Chapman LR, Fields MW. Microbial
diversity in water and sediment of Lake Chaka, an Athalassohaline lake in
northwestern China. Appl Environ Microbiol. 2006;72:383245.
34. Jones RN, Sader HS, Beach ML. Contemporary in-vitro spectrum of activity
summary for antimicrobial agents tested against 18569 strains non-
fermentative gram-negative bacilli isolated in the SENTRY antimicrobial
surveillance program (1997-2001). Int J Antimicrob Agents. 2003;22:5516.
35. Kelley ST, Theisen U, Angenent LT, St Amand A, Pace NR. Molecular analysis of
shower curtain biofilm microbes. Appl Environ Microbiol. 2004;70:418792.
36. Klepeis NE, Nelson WC, Ott WR, Robinson JP, Tsang AM, Switzer P, Behar JV,
Hern SC, Engelmann WH. The National Human Activity Pattern Survey
(NHAPS): a resource for assessing exposure to environmental pollutants. J
Expo Anal Environ Epidemiol. 2001;11:23152.
37. Knabel SJ. Foodborne illness: role of home food handling practices. Food
Technol. 1995;49:11931.
38. Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AFS, Bahram M, Bates
ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, Douglas B, Drenkhan T,
Eberhardt U, Dueñas M, Grebenc T, Griffith GW, Hartmann M, Kirk PM,
Kohout P, Larsson E, Lindahl BD, Lücking R, Martín MP, Matheny PB, Nguyen
NH, Niskanen T, Oja J, Peay KG, Peintner U, Peterson M, Põldmaa K, Saag L,
Saar I, Schüßler A, Scott JA, Senés C, Smith ME, Suija A, Taylor DL, Telleria
MT, Weiss M, Larsson KH. Towards a unified paradigm for sequence-based
identification of Fungi. Mol Ecol. 2013;22:52717.
39. Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M,
editors. Nucleic acid techniques in bacterial systematics. Chichester: John
Wiley and Sons; 1991. p. 11575.
40. Lee J, Cartwright R, Grueser T, Pascall MA. Efficiency of manual dishwashing
conditions on bacterial survival on eating utensils. J Food Eng. 2007;80:88591.
41. Legnani PP, Leoni E. Factors affecting the bacteriological contamination of
commercial washing machines. Zentralbl Hyg Umweltmed. 1997;200:31933.
42. Luber P. Cross-contamination versus undercooking of poultry meat or eggs
which risks need to be managedfirst? Int J Food Microbiol. 2009;134:218.
43. Marshall BM, Robleto E, Dumont T, Levy SB. The frequency of antibiotic-
resistant bacteria in homes differing in their use of surface antibacterial
agents. Curr Microbiol. 2012;65:40715.
44. McDonald D, Price MN, Goodrich J, Nawrocki EP, DeSantis TZ, Probst A,
Andersen GL, Knight R, Hugenholtz P. An improved Greengenes taxonomy
with explicit ranks for ecological and evolutionary analyses of bacteria and
archaea. ISME J. 2012;6:6108.
45. Mulcahy LR, Isabella VM, Lewis K. Pseudomonas aeruginosa biofilms in
disease. Microb Ecol. 2014;68:112.
46. Nicolella C, Casini B, Rossi F, Chericoni A, Pardini G. Thermal sanitizing in a
commercial dishwashing machine. J Food Saf. 2011;31:8190.
47. Ojima M, Toshima Y, Koya E, Ara K, Kawai S, Ueda N. Bacterial contamination
of Japanese households and related concern about sanitation. Int J Environ
Health Res. 2002a;12:4152.
48. Ojima M, Toshima Y, Koya E, Ara K, Tokuda H, Kawai S, Kasuga F, Ueda N.
Hygiene measures considering actual distributions of microorganisms in
Japanese households. J Appl Microbiol. 2002b;93:8009.
49. Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative
bacteria. N Engl J Med. 2010;362:180413.
50. Portnoy JM, Kwak K, Dowling P, VanOsdol T, Barnes C. Health effects of
indoor fungi. Ann Allergy Asthma Immunol. 2005;94:3139.
51. Prenafeta-Boldú FX, Guivernau M, Gallastegui G, Viñas M, de Hoog GS,
Elías A. Fungal/bacterial interactions during the biodegradation of TEX
hydrocarbons (toluene, ethylbenzene and p-xylene) in gas biofilters
operated under xerophilic conditions. FEMS Microbiol Ecol. 2012;80:
72234.
52. Raghupathi PK, ZupančičJ, Brejnrod AD, Jacquiod S, Houf K, Burmølle M,
Gunde-Cimerman N, Sørensen SJ. Microbial diversity and putative
Zupančičet al. BMC Microbiology (2019) 19:300 Page 14 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
opportunistic pathogens in dishwasher biofilm communities. Appl Environ
Microbiol. 2018. https://doi.org/10.1128/AEM.02755-17.
53. Rehberg L, Frontzek A, Melhus Å, Bockmühl DP. Prevalence of β-lactamase
genes in domestic washing machines and dishwashers and the impact of
laundering processes on antibiotic resistant bacteria. J Appl Microbiol. 2017;
123:1396406.
54. Rusin P, Orosz-Coughlin P, Gerba C. Reduction of faecal coliform, coliform and
heterotrophic platecount bacteria in the household kitchen and bathroom by
disinfection with hypochlorite cleaners. J Appl Microbiol. 1998;85:81928.
55. Samet JM, Spengler JD. Indoor environments and health: moving into the
21st century. Am J Public Health. 2003;93:148993.
56. Sasahara T, Hayashi S, Morisawa Y, Sakihama T, Yoshimura A, Hirai Y. Bacillus
cereus bacteremia outbreak due to contaminated hospital linens. Eur J Clin
Microbiol Infect Dis. 2011;30:21926.
57. Scott E, Bloomfield SF, Barlow CG. An investigation of microbial
contamination in the home. J Hyg. 1982;89:27993.
58. Scott E. Food safety and foodborne disease in 21st century homes. Can J
Infect Dis. 2003;14:27780.
59. Scott E. Relationship between cross-contamination and the transmission of
foodborne pathogens in the home. Pediatr Infect Dis J. 2000;19:1113.
60. Scuderi G, Fantasia M, Filetici E, Anastasio MP. Foodborne outbreaks caused
by Salmonella in Italy, 1991-1994. Epidemiol Infect. 1996;116:25765.
61. Sinclair RG, Gerba CP. Microbial contamination in kitchens and bathrooms
of rural Cambodian villagehouseholds. Lett Appl Microbiol. 2011;52:1449.
62. Ståhl Wernersson E, Johansson E, Håkanson H. Cross-contamination in
dishwashers. J Hosp Infect. 2004;56:3127.
63. Tenaillon O, Skurnik D, Picard B, Denamur E. The population genetics of
commensal Escherichia coli. Nat Rev Microbiol. 2010;8:20717.
64. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The
CLUSTAL_X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:487682.
65. Troxler R, Funke G, Von Graevenitz A, Stock I. Natural antibiotic susceptibility
of recently established coryneform bacteria. Eur J Clin Microbiol Infect Dis.
2001;20:31523.
66. Vogel HJ, Bonner DM. Acetylornithinase of Escherichia coli: partial
purification and some properties. J Biol Chem. 1956;218:97106.
67. Vogeleer P, Tremblay YD, Mafu A, Jacques M, Harel J. Life on the outside:
role of biofilms in environmental persistence of Shiga-toxin producing
Escherichia coli. Front Microbiol. 2014;5:317. https://doi.org/10.3389/fmicb.
2014.00317.
68. Vos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH,
Whitman W. Bergeys manual of systematic bacteriology, Vol. 3: the
firmicutes. Berlin: Springer; 2009.
69. Wright SN, Gerry JS, Busowski MT, Klochko AY, McNulty SG, Brown SA, Sieger
BE, Ken Michaels P, Wallace MR. Gordonia bronchialis sternal wound infection
in 3 patients following open heart surgery: intraoperative transmission from a
healthcare worker. Infect Control Hosp Epidemiol. 2012;33:123841.
70. Zalar P, Novak M, de Hoog GS, Gunde-Cimerman N. Dishwashers - a man-
made ecological niche accommodating human opportunistic fungal
pathogens. Fungal Biol. 2011;115:9971007.
71. ZupančičJ, Novak BabičM, Zalar P, Gunde-Cimerman N. The black yeast
Exophiala dermatitidis and other selected opportunistic human fungal
pathogens spread from dishwashers to kitchens. PLoS One. 2016;11(2):
0148166. https://doi.org/10.1371/journal.pone.0148166.
72. ZupančičJ, Raghupathi PK, Houf K, Burmølle M, Sørensen SJ, Gunde-
Cimerman N. Synergistic interactions in microbial biofilms facilitate the
establishment of opportunistic pathogenic Fungi in household dishwashers.
Front Microbiol. 2018. https://doi.org/10.3389/fmicb.2018.00021.
73. Zweerink MM, Edison A. Inhibition of Micrococcus luteus DNA gyrase by
norfloxacin and 10 other quinolone carboxylic acids. Antimicrob Agents
Chemother. 1986;29:598601.
PublishersNote
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Zupančičet al. BMC Microbiology (2019) 19:300 Page 15 of 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
... and Aspergillus spp. can represent a scaffold for microbial attachment (Zupančič et al. 2019;Richardson and Rautemaa-Richardson 2019;Fernandes et al. 2019) and food for protozoa (Defra 2011). Mainly, filamentous fungi also contribute to the formation of biofilms by cross-linking particulate matter and microbial polymers with hyphae (Richardson and Rautemaa-Richardson 2019;Fernandes et al. 2019). ...
... The presence of bacteria in dishwashers was investigated later than the presence of fungi. A study conducted on 30 dishwasher rubber seals in Slovenia (Zupančič et al. 2019) revealed the presence of 74 species of bacteria. The majority were Gram-positive and sporogenic. ...
... The study showed t h e d o m i n a n c e o f A l p h a p r o t e o b a c t e r i a a n d Betaproteobacteria in the water, while Actinobacteria and Firmicutes were present in much lower numbers. These results indicate that food and used dishes are the main source of bacteria found in dishwashers (Zupančič et al. 2019). ...
Article
Full-text available
Modernisation of our households created novel opportunities for microbial growth and thus changed the array of microorganisms we come in contact with. While many studies have investigated microorganisms in the air and dust, tap water, another major input of microbial propagules, has received far less attention. The quality of drinking water in developed world is strictly regulated to prevent immediate danger to human health. However, fungi, algae, protists and bacteria of less immediate concern are usually not screened for. These organisms can thus use water as a vector of transmission into the households, especially if they are resistant to various water treatment procedures. Good tolerance of unfavourable abiotic conditions is also important for survival once microbes enter the household. Limitation of water availability, high or low temperatures, application of antimicrobial chemicals and other measures are taken to prevent indoor microbial overgrowth. These conditions, together with a large number of novel chemicals in our homes, shape the diversity and abundance of indoor microbiota through constant selection of the most resilient species, resulting in a substantial overlap in diversity of indoor and natural extreme environments. At least in fungi, extremotolerance has been linked to human pathogenicity, explaining why many species found in novel indoor habitats (such as dishwasher) are notable opportunistic pathogens. As a result, microorganisms that often enter our households with water and are then enriched in novel indoor habitats might have a hitherto underestimated impact on the well-being of the increasingly indoor-bound human population. Key points Domestic environment harbours a large diversity of microorganisms. Microbiota of water-related indoor habitats mainly originates from tap water. Bathrooms, kitchens and household appliances select for polyextremotolerant species. Many household-related microorganisms are human opportunistic pathogens.
... Previous studies revealed the presence of bla genes (32) and the correlation of multiresistance with intI1 (15) in the domestic environment, but no studies on the quantitative prevalence of bla genes and their co-occurrence in private households, especially in relation to phenotypic resistance, have been conducted so far. SD, WM, and DW provide good habitats for microbial communities with a steady nutrient supply in a humid environment, promoting bacterial growth and biofilm formation (39,(47)(48)(49). ...
... No bacterial growth was detected in dishwashers after test runs, except with the ecoprogram; thus, cleaned dishes do not seem to be a source of the tested strains. However, antibiotic-resistant bacteria were isolated from rubber door seals and DW sieves and have already been identified to be a source of pathogenic and opportunistic pathogenic bacteria and fungi (40,49,74). Zupančič et al. (49) determined a low phenotypic ABR potential for strains from DW, a finding which was confirmed by our study, since fewer resistant strains were isolated from DW than from SD and WM. ...
... However, antibiotic-resistant bacteria were isolated from rubber door seals and DW sieves and have already been identified to be a source of pathogenic and opportunistic pathogenic bacteria and fungi (40,49,74). Zupančič et al. (49) determined a low phenotypic ABR potential for strains from DW, a finding which was confirmed by our study, since fewer resistant strains were isolated from DW than from SD and WM. Nevertheless, DW samples revealed a high absolute abundance of ARGs, and the strains that were isolated still harbored bla genes and thus can be considered a potential source of antibiotic-resistant bacteria as well. ...
Article
Full-text available
The abundance of antibiotic-resistant bacteria and ARGs is steadily increasing and has been comprehensively analyzed in natural environments, animals, foods, and wastewater treatment plants. In this respect, β-lactams and colistin are of particular interest due to the emergence of multidrug-resistant Gram-negative bacteria. Despite the connection of private households to these environments, only a few studies have focused on the domestic environment so far. Therefore, the present study further investigated the occurrence of ARGs and antibiotic-resistant bacteria in shower drains, washing machines, and dishwashers. The analysis of the domestic environment as a potential reservoir of resistant bacteria is crucial to determine whether households contribute to the spread of ABR or may be a habitat where resistant bacteria from the natural environment, humans, food, or water are selected due to the use of detergents, antimicrobial products, and antibiotics. Furthermore, ABR could limit the options for the treatment of infections arising in the domestic environment.
... A 2006 study by Weese et al in which food dishes were inoculated with Salmonella-containing raw meat showed persistent contamination in the majority of pet dishes after washing with routine measures including a dishwasher or with soap and water [14]. Other studies have found dishwashers can disperse and harbor bacteria [15,16]. Concerns regarding cross-contamination may extend beyond bacteria when one considers that 9% of pet owners reported adding medications or supplements into their pets' food bowls. ...
Article
Full-text available
In-home pet food handling and food dish hygiene practices can have adverse health impacts for both humans and pets. Safe food and dish handling guidelines are not easily evidenced for pet owners. The study was designed to investigate dog owners’ feeding habits and evaluate the impact of the Food and Drug Association (FDA) hygiene protocols on dog food dish contamination. Procedures and surveys were approved by North Carolina State University Institutional Animal Care and Use Committee and Institutional Review Board. Pet feeding and food dish hygiene data were collected from 417 dog owner surveys and 68 food dish swabs. Total aerobic plate counts (APC) were performed on 68 dishes and randomly assigned into Group A (FDA pet food handling and dish hygiene guidelines), Group B (FDA pet and human food handling and dish hygiene guidelines), or Group C (no guidelines). Hygiene protocols were instituted in-home for 1 week, followed by a second APC and follow-up survey. Survey from dog owners-households indicated: 4.7% were aware of FDA pet food handling and dish hygiene guidelines; 36% have individuals ≤ 13 years old and/or immunocompromised; 43% stored dog food 0–5 feet from human food; 34% washed their hands after feeding; and 33% prepared their dog food on human food preparation surfaces. The hygiene protocols followed by Groups A and B resulted in significant decreases in food dish APC (p<0.001; 1.4; (0.9, 2.0); p<0.05; 0.604 (0.02, 1.2), respectively), as compared to Group C (p≥0.05). Hot water (>160° F or 71.1°C) washing decreased APC (p<0.01; 1.5 (0.4, 2.6)) over cold/lukewarm water. In the follow-up survey, 8% of Group A and B respondents reported likely to adhere to protocols long-term. This study suggests a need for pet food handling and dish hygiene guideline education to minimize bacterial contamination of dishes, especially for high-risk populations.
... The genus Pseudomonas and Acinetobacter, containing ammonia-producing bacteria, were detected only in samples from the floor in the men's restroom in Station C. These genera are also reported to have been detected in households [15,16] and in soil [17,18]. ...
Article
There are two types of method for cleaning station restrooms. One method uses water for cleaning floors, whereas the second does not. This study describes quantitative and qualitative research into the surface bacteria found on station restroom floors where these two cleaning methods were used. Samples for analysis were collected from five positions on the floor of each restroom in each railway station investigated. Samples were treated using a conventional culture method to measure the concentrations of surface bacteria on each restroom floor. Samples were then analyzed with bacterial 16S rRNA genes to analysis the microbiomes on these restroom floors. Results showed that the restrooms cleaned without water had lower concentrations of bacteria, than the microbiomes from restroom floors cleaned with water.
... In the case of Firmicutes, clinical species are susceptible to carbapenems, quinolones and tetracyclines, and in lesser extension to cephalosporins and ß-lactams. However, in strains isolated from tapwater, Zupancic et al. (2019) found that the strains of this taxonomic group showed between 57 and 70% of resistance to cephalosporins, and between 10 and 12% of resistance to carbapenems and quinolones. In our study, none of the strains tested were resistant to carbapenems nor tetracyclines, although 71.4% showed resistance to quinolones, 57.1% to cephalosporins, 28.6% to ß-lactams, and 14.3% to macrolides. ...
Article
Membrane processes such as, reverse osmosis (RO), is one option for drinking water treatment where a high product quality is desired. RO membranes are able to effectively remove organic and inorganic compounds and microorganisms from water. One of the most serious problems in this system is membrane fouling caused by the microbial biofilm formation. Biofilms contributes to RO membrane deterioration, but it also were associated with human health risks, since they can be reservoirs of human opportunistic pathogens and/or antibiotic resistant bacteria. In the present study, samples from a drinking-water RO system were analyzed to determine the bacterial composition of the different frames of RO system: feed water, rejection water and permeate water. A total of 215 strains were identified using two methodologies, one genomic (16S rRNA gene) and other proteomic (MALDI-TOF MS). The majority bacterial groups identified were Gammaproteobacteria, Firmicutes and Betaproteobacteria, whereas Alfaproteobacteria, Bacteroidetes, and Actinomycetales were the minority bacterial identified groups. Antibiotic resistance analysis of the bacterial strains to 14 antibiotics tested revealed that resistance to three or more classes of antibiotics was observed in 37.2% of the isolates, being the occurrence of multiple antibiotic resistance phenotypes mainly related to the taxonomic affiliation of the microorganisms. Regarding of the bacterial groups, the antibiotic resistance percentages among the strains were 68.2% to ß-lactams, 56.8% to macrolides, 36.4% to quinolones, 34.1% to cephalosporins, 22.7% to aminoglycosides and 9.1% to tetracyclines. On the other hand, more than 60% of the bacterial strains produced biofilms in vitro; from them, Aeromonas caviae, Pseudomonas aeruginosa and Sphingopyxis terrae were strong biofilm formers.
... PsA has been isolated from the rubber seals of dishwashers in 6/30 (20%) machines tested (and S.maltophilia in 10/30) [53] , so clearly these must be kept cleaned, and less bacteria are found when they are used at the higher temperature settings. ...
Article
Pseudomonas aeruginosa (PsA) is commonly found in soil and water so is impossible to avoid completely. Parents/carers of children with cystic fibrosis (CF) are concerned about them acquiring PsA from the environment, and different families view risk differently. Our ethos is to enable children with CF to take part as much as possible in educational and fun home activities, in order to maintain their quality of life (and their family's), and not have them feel different from other children. This review presents advice for families as to what they must definitely avoid, what they must take precautions with but can allow, and what they must not avoid. It is mostly evidence-based, but where evidence is lacking it a consensus view from the Paediatric CF Unit at the Royal Brompton Hospital.
Article
Full-text available
Opportunistic premise plumbing pathogens (OPPP) are microorganisms that are native to the plumbing environment and that present an emerging infectious disease problem. They share characteristics, such as disinfectant resistance, thermal tolerance, and biofilm formation. The colonisation of domestic water systems presents an elevated health risk for immune-compromised individuals who receive healthcare at home. The literature that has identified the previously described OPPPs (Aeromonas spp., Acinetobacter spp., Helicobacter spp., Legionella spp., Methylobacterium spp., Mycobacteria spp., Pseudomonas spp., and Stenotrophomonas spp.) in residential drinking water systems were systematically reviewed. By applying the Preferred reporting items for systematic reviews and meta-analyses guidelines, 214 studies were identified from the Scopus and Web of Science databases, which included 30 clinical case investigations. Tap components and showerheads were the most frequently identified sources of OPPPs. Sixty-four of these studies detected additional clinically relevant pathogens that are not classified as OPPPs in these reservoirs. There was considerable variation in the detection methods, which included traditional culturing and molecular approaches. These identified studies demonstrate that the current drinking water treatment methods are ineffective against many waterborne pathogens. It is critical that, as at-home healthcare services continue to be promoted, we understand the emergent risks that are posed by OPPPs in residential drinking water. Future research is needed in order to provide consistent data on the prevalence of OPPPs in residential water, and on the incidence of waterborne homecare-associated infections. This will enable the identification of the contributing risk factors, and the development of effective controls.
Article
Full-text available
Although the dishwashers and specialized cleaning agents are designed to assure conditions for cleaning the inlet, the dishwasher itself may still be a reservoir of unwanted microbiota. In this study, we isolated and molecular identified two isolates of Bacillus boroniphilus sp.nov.. from domestic dishwashers. A total of 51 bacterial isolates were isolated from samples collected from six domestic old household dishwasher in Mosul/Iraq. The swab collecting, followed by bacterial cultivation and identification revealed that two isolates were belonged to a novel Bacillus species Bacillus boroniphilus sp.nov. and were designated as KAAI1 and KAAI2 isolated from drain water part and basket part respectively. The results of phylogenetic analyses showed that B. boroniphilus KAAI1and KAAI2 were most related to Bacillus sp. (GQ284386), Bacillus subterraneus (KT719820) based on the 16S RNA genes tree. The two isolates demonstrated differences for Boron tolerance. For the ability to grow on free B different media, colonies growth were observed for KAAI1 isolate where's no growth for KAAI2 isolate. The 16S rRNA gene of KAAI1and KAAI2 novel isolates were deposited in the GenBank database (NCBI) under the accession numbers (MW193122) and (MW193123) respectively. This study concluded that the two isolates belong to a novel species B. boroniphilus KAAI1and KAAI2 is a boron-tolerant bacterium that also requires this element for its growth. Dishwashers environments with high temperatures and contained the element boron in varying quantities in a detergents, this features makes it an excellent candidate for being a model organism to investigate the boron-bacterium relationship using molecular and biochemical approaches.
Article
Stenotrophomonas maltophilia is an opportunistic pathogen of significant concern to susceptible patient populations. This pathogen can cause nosocomial and community-acquired respiratory and bloodstream infections and various other infections in humans. Sources include water, plant rhizospheres, animals, and foods. Studies of the genetic heterogeneity of S. maltophilia strains have identified several new genogroups and suggested adaptation of this pathogen to its habitats. The mechanisms used by S. maltophilia during pathogenesis continue to be uncovered and explored. S. maltophilia virulence factors include use of motility, biofilm formation, iron acquisition mechanisms, outer membrane components, protein secretion systems, extracellular enzymes, and antimicrobial resistance mechanisms. S. maltophilia is intrinsically drug resistant to an array of different antibiotics and uses a broad arsenal to protect itself against antimicrobials. Surveillance studies have recorded increases in drug resistance for S. maltophilia, prompting new strategies to be developed against this opportunist. The interactions of this environmental bacterium with other microorganisms are being elucidated. S. maltophilia and its products have applications in biotechnology, including agriculture, biocontrol, and bioremediation.
Article
Full-text available
Biofilms formed on rubber seals in dishwashers harbor diverse microbiota. In this study, we focussed on the microbial composition of bacteria and fungi, isolated from a defined area of one square centimeter of rubber from four domestic dishwashers and assessed their abilities to in vitro multispecies biofilm formation. A total of 80 isolates (64 bacterial and 16 fungal) were analyzed. Multiple combinations of bacterial isolates from each dishwasher were screened for synergistic interactions. 32 out of 140 tested (23%) four-species bacterial combinations displayed consistent synergism leading to an overall increase in biomass, in all experimental trails. Bacterial isolates from two of the four dishwashers generated a high number of synergistically interacting four-species consortia. Network based correlation analyses also showed higher co-occurrence patterns observed between bacterial members in the same two dishwasher samples, indicating cooperative effects. Furthermore, two synergistic four-species bacterial consortia were tested for their abilities to incorporate an opportunistic fungal pathogen, Exophiala dermatitidis and their establishment as biofilms on sterile ethylene propylene diene monomer M-class (EPDM) rubber and polypropylene (PP) surfaces. When the bacterial consortia included E. dermatitidis, the overall cell numbers of both bacteria and fungi increased and a substantial increase in biofilm biomass was observed. These results indicate a novel phenomenon of cross kingdom synergy in biofilm formation and these observations could have potential implications for human health. © 2018 Zupancic, Raghupathi, Houf, Burmølle, Sørensen and Gunde-Cimerman.
Article
Full-text available
Extreme habitats are not only limited to natural environments, but also exist in manmade systems, for instance, household appliances such as dishwashers. Limiting factors, such as high temperatures, high and low pHs, high NaCl concentrations, presence of detergents, and shear force from water during washing cycles, define microbial survival in this extreme system. Fungal and bacterial diversity in biofilms isolated from rubber seals of 24 different household dishwashers was investigated using next-generation sequencing. Bacterial genera such as Pseudomonas, Escherichia, and Acinetobacter, known to include opportunistic pathogens, were represented in most samples. The most frequently encountered fungal genera in these samples belonged to Candida, Cryptococcus, and Rhodotorula, also known to include opportunistic pathogenic representatives. This study showed how specific conditions of the dishwashers impact the abundance of microbial groups and investigated the interkingdom and intrakingdom interactions that shape these biofilms. The age, usage frequency, and hardness of incoming tap water of dishwashers had significant impact on bacterial and fungal community compositions. Representatives of Candida spp. were found at the highest prevalence (100%) in all dishwashers and are assumed to be one of the first colonizers in recently purchased dishwashers. Pairwise correlations in tested microbiomes showed that certain bacterial groups cooccur, as did the fungal groups. In mixed bacterial-fungal biofilms, early adhesion, contact, and interactions were vital in the process of biofilm formation, where mixed complexes of bacteria and fungi could provide a preliminary biogenic structure for the establishment of these biofilms.
Article
Full-text available
Aims: To investigate the prevalence of β-lactamase genes in domestic washing machines and dishwashers, and the decontamination efficacy of laundering. Methods and results: For the first investigation, swab samples from washing machines (n = 29) and dishwashers (n = 24) were analysed by real-time quantitative PCR to detect genes encoding β-lactamases. To test the impact of laundering on resistant bacteria, cotton test swatches were artificially contaminated with susceptible and resistant strains of Pseudomonas aeruginosa, Klebsiella pneumoniae and Staphylococcus aureus within a second investigation. They were washed in a domestic washing machine with or without activated oxygen bleach (AOB)-containing detergent at 20-50°C. β-Lactamase genes (most commonly of the AmpC- and OXA-type) were detected in 79% of the washing machines and in 96% of the dishwashers and Pseudomonadaceae dominated the microbiota. The level of bacterial reduction after laundering was ≥80% for all Ps. aeruginosa and Kl. pneumoniae strains, while it was only 37-61% for the methicillin-resistant Staph. aureus outbreak strain. In general, the reduction was tendentially higher for susceptible bacteria than for the resistant outbreak strains, especially for Staph. aureus. Conclusions: β-Lactamase genes seem to be frequently present in domestic appliances and may pose a potential risk for cross-contamination and horizontal transfer of genes encoding resistance against clinically important β-lactams. In general, higher temperatures and the use of AOB can improve the reduction of antibiotic-resistant bacteria, including Staph. aureus which appears to be less susceptible to the decontamination effect of laundering. Significance and impact of this study: Data on the presence of antibiotic-resistant bacteria in the domestic environment are limited. This study suggests that β-lactamase genes in washing machines and dishwashers are frequent, and that antibiotic-resistant strains are generally more resistant to the used washing conditions.
Article
Full-text available
Over the past decade there has been a growing recognition of the involvement of the home in several public health and hygiene issues. Perhaps the best understood of these issues is the role of the home in the transmission and acquisition of foodborne disease. The incidence of foodborne disease is increasing globally. Although foodborne disease data collection systems often miss the mass of home-based outbreaks of sporadic infection, it is now accepted that many cases of foodborne illness occur as a result of improper food handling and preparation by consumers in their own kitchens. Some of the most compelling evidence has come from the international data on Salmonella species and Campylobacter species infections. By its very nature, the home is a multifunctional setting and this directly impacts upon the need for better food safety in the home. In particular, the growing population of elderly and other immnocompromised individuals living at home who are likely to be more vulnerable to the impact of foodborne disease is an important aspect to consider. In addition, some developed nations are currently undergoing a dramatic shift in healthcare delivery, resulting in millions of patients nursed at home. Other aspects of the home that are unique in terms of food safety are the use of the home as a daycare centre for preschool age children, the presence of domestic animals in the home and the use of the domestic kitchen for small-scale commercial catering operations. At the global level, domestic food safety issues for the 21 st century include the continued globalization of the food supply, the impact of international travel and tourism, and the impact of foodborne disease on developing nations. A number of countries have launched national campaigns to reduce the burden of foodborne disease, including alerting consumers to the need to practice food safety at home. Home hygiene practice and consumer hygiene products are being refined and targeted to areas of risk, including preventing the onward transmission of foodborne illness via the inanimate environment. It has been said that food safety in the home is the last line of defense against foodborne disease, and it is likely that this will remain true for the global population in the foreseeable future.
Article
Full-text available
We investigated the diversity and distribution of fungi in nine different sites inside 30 residential dishwashers. In total, 503 fungal strains were isolated, which belong to 10 genera and 84 species. Irrespective of the sampled site, 83% of the dishwashers were positive for fungi. The most frequent opportunistic pathogenic species were Exophiala dermatitidis, Candida parapsilosis sensu stricto, Exophiala phaeomuriformis, Fusarium dimerum, and the Saprochaete/Magnusiomyces clade. The black yeast E. dermatitidis was detected in 47% of the dishwashers, primarily at the dishwasher rubber seals, at up to 106 CFU/cm2; the other fungi detected were in the range of 102 to 105 CFU/cm2. The other most heavily contaminated dishwasher sites were side nozzles, doors and drains. Only F. dimerum was isolated from washed dishes, while dishwasher waste water contained E. dermatitidis, Exophiala oligosperma and Sarocladium killiense. Plumbing systems supplying water to household appliances represent the most probable route for contamination of dishwashers, as the fungi that represented the core dishwasher mycobiota were also detected in the tap water. Hot aerosols from dishwashers contained the human opportunistic yeast C. parapsilosis, Rhodotorula mucilaginosa and E. dermatitidis (as well as common air-borne genera such as Aspergillus, Penicillium, Trichoderma and Cladosporium). Comparison of fungal contamination of kitchens without and with dishwashers revealed that virtually all were contaminated with fungi. In both cases, the most contaminated sites were the kitchen drain and the dish drying rack. The most important difference was higher prevalence of black yeasts (E. dermatitidis in particular) in kitchens with dishwashers. In kitchens without dishwashers, C. parapsilosis strongly prevailed with negligible occurrence of E. dermatitidis. F. dimerum was isolated only from kitchens with dishwashers, while Saprochaete/Magnusiomyces isolates were only found within dishwashers. We conclude that dishwashers represent a reservoir of enriched opportunistic pathogenic species that can spread from the dishwasher into the indoor biome.
Article
Four ceftazidime-resistant Escherichia coli strains were isolated from elderly nursing home patients in a New York hospital during 1993. Strains MCQ-2, MCQ-3, and MCQ-4 were determined to be identical by pulsed-field gel electrophoresis and plasmid profiles, whereas strain MCQ-1 was unique. Strain MCQ-1 was determined to produce a TEM-10 beta-lactamase. Strains MCQ-2, MCQ-3, and MCQ-4 were also noted to be resistant to cefotaxime. These three strains produced two beta-lactamases with pIs of 5.4 (TEM-1) and 7.6. beta-Lactamase assays revealed that the pI 7.6 enzyme hydrolyzed cefotaxime faster (at a relative hydrolysis rate of 30% compared with that of benzylpenicillin) than either ceftazidime or aztreonam (relative hydrolysis rates of 13 and 3.3%, respectively). Nucleotide sequencing of the gene encoding the pI 7.6 beta-lactamase from strain MCQ-3 revealed a blaSHV-type gene differing from the gene encoding SHV-1 at four nucleotides which resulted in amino acid substitutions: phenylalanine for isoleucine at position 8, serine for arginine at position 43, serine for glycine at position 238, and lysine for glutamate at position 240. This novel SHV-type extended-spectrum beta-lactamase is designated SHV-7.
Article
Energy constraints have altered consumer practice regarding the use of household washing machines. Washing machines were developed that use lower washing temperatures, smaller amounts of water and biodegradable detergents. These conditions may favour the enrichment of opportunistic human pathogenic fungi. We focused on the isolation of fungi from two user-accessible parts of washing machines that often contain microbial biofilms: drawers for detergents and rubber door seals. Out of 70 residential washing machines sampled in Slovenia, 79% were positive for fungi. In total, 72 strains belonging to 12 genera and 26 species were isolated. Among these, members of the Fusarium oxysporum and Fusarium solani species complexes, Candida parapsilosis and Exophiala phaeomuriformis represented 44% of fungi detected. These species are known as opportunistic human pathogens and can cause skin, nail or eye infections also in healthy humans. A machine learning analysis revealed that presence of detergents and softeners followed by washing temperature, represent most critical factors for fungal colonization. Three washing machines with persisting malodour that resulted in bad smelling laundry were analysed for the presence of fungi and bacteria. In these cases, fungi were isolated in low numbers (7.5 %), while bacteria Micrococcus luteus, Pseudomonas aeruginosa, and Sphingomonas species prevailed. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.