A novel lineage of candidate pheromone receptors for sex communication in moths

Abstract

Sex pheromone receptors (PRs) are key players in chemical communication between mating partners in insects. In the highly diversified insect order Lepidoptera, male PRs tuned to female-emitted type I pheromones (which make up the vast majority of pheromones identified) form a dedicated subfamily of odorant receptors (ORs). Here, using a combination of heterologous expression and in vivo genome editing methods, we bring functional evidence that at least one moth PR does not belong to this subfamily but to a distantly related OR lineage. This PR, identified in the cotton leafworm Spodoptera littoralis, is highly expressed in male antennae and is specifically tuned to the major sex pheromone component emitted by females. Together with a comprehensive phylogenetic analysis of moth ORs, our functional data suggest two independent apparitions of PRs tuned to type I pheromones in Lepidoptera, opening up a new path for studying the evolution of moth pheromone communication.

Full text

*For correspondence:
wangguirong@caas.cn(GW);
emmanuelle.joly@inra.fr (EJ-J);
nicolas.montagne@sorbonne-
universite.fr(NM)
Present address:
†
Laboratoire
d’Ethologie Expe´ rimentale et
Compare´ e (LEEC), Universite´
Paris 13, Sorbonne Paris Cite´ ,
Villetaneuse, France
Competing interest: See
page 13
Funding: See page 14
Received: 01 July 2019
Accepted: 01 November 2019
Published: 10 December 2019
Reviewing editor: Kristin Scott,
University of California, Berkeley,
United States
Copyright Bastin-He´ line et al.
This article is distributed under
the terms of the Creative
Commons Attribution License,
which permits unrestricted use
and redistribution provided that
the original author and source are
credited.
A novel lineage of candidate pheromone
receptors for sex communication in moths
Lucie Bastin-He
´line
1
, Arthur de Fouchier
1†
, Song Cao
2
, Fotini Koutroumpa
1
,
Gabriela Caballero-Vidal
1
, Stefania Robakiewicz
1
, Christelle Monsempes
1
,
Marie-Christine Franc¸ois
1
, Tatiana Ribeyre
1
, Annick Maria
1
, Thomas Chertemps
1
,
Anne de Cian
3
, William B Walker III
4
, Guirong Wang
2
*,
Emmanuelle Jacquin-Joly
1
*, Nicolas Montagne
´
1
*
1
Sorbonne Universite´ , Inra, CNRS, IRD, UPEC, Universite´ Paris Diderot, Institute of
Ecology and Environmental Sciences of Paris, Paris and Versailles, France;
2
State
Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant
Protection, Chinese Academy of Agricultural Sciences, Beijing, China;
3
CNRS UMR
7196, INSERM U1154, Museum National d’Histoire Naturelle, Paris, France;
4
Department of Plant Protection Biology, Swedish University of Agricultural
Sciences, Alnarp, Sweden
Abstract Sex pheromone receptors (PRs) are key players in chemical communication between
mating partners in insects. In the highly diversified insect order Lepidoptera, male PRs tuned to
female-emitted type I pheromones (which make up the vast majority of pheromones identified)
form a dedicated subfamily of odorant receptors (ORs). Here, using a combination of heterologous
expression and in vivo genome editing methods, we bring functional evidence that at least one
moth PR does not belong to this subfamily but to a distantly related OR lineage. This PR, identified
in the cotton leafworm Spodoptera littoralis, is highly expressed in male antennae and is specifically
tuned to the major sex pheromone component emitted by females. Together with a comprehensive
phylogenetic analysis of moth ORs, our functional data suggest two independent apparitions of
PRs tuned to type I pheromones in Lepidoptera, opening up a new path for studying the evolution
of moth pheromone communication.
Introduction
The use of pheromone signals for mate recognition is widespread in animals, and changes in sex
pheromone communication are expected to play a major role in the rise of reproductive barriers and
the emergence of new species (Smadja and Butlin, 2009). Since the first chemical identification of
such a pheromone in Bombyx mori (Butenandt et al., 1959), moths (Insecta, Lepidoptera) have
been a preferred taxon for pheromone research (Carde
´and Haynes, 2004;Kaissling, 2014). The
diversification of pheromone signals has likely played a prominent role in the extensive radiation
observed in Lepidoptera, which represents almost 10% of the total described species of living organ-
isms (Stork, 2018).
Female moths generally release a species-specific blend of volatile molecules, which attract males
over a long distance (Carde
´and Haynes, 2004). Four types of sex pheromones have been described
in moths (types 0, I, II and III), with distinct chemical structures and biosynthetic pathways
(Lo
¨fstedt et al., 2016). 75% of all known moth sex pheromone compounds belong to type I and are
straight-chain acetates, alcohols or aldehydes with 10 to 18 carbon atoms (Ando et al., 2004). Type
I pheromones have been found in most moth families investigated, whereas the other types are
restricted to only a few families (Lo
¨fstedt et al., 2016).
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 1 of 17
RESEARCH ARTICLE

In moth male antennae, pheromone compounds are detected by dedicated populations of olfac-
tory sensory neurons (OSNs). Each type of OSN usually expresses one pheromone receptor (PR)
responsible for signal transduction. PRs are 7-transmembrane domain proteins belonging to the
odorant receptor (OR) family and, as ORs, are co-expressed in OSNs together with the conserved
co-receptor Orco (Chertemps, 2017;Fleischer and Krieger, 2018).
Since the first discovery of moth PRs (Krieger et al., 2004;Sakurai et al., 2004), numerous pher-
omone receptors tuned to type I pheromone compounds have been characterized through different
hererologous expression systems, and most appeared to be specific to only one compound
(Zhang and Lo
¨fstedt, 2015). More recently, a few receptors tuned to type 0 and type II pheromones
have also been characterized (Zhang et al., 2016;Yuvaraj et al., 2017). Type I PRs belong to a ded-
icated monophyletic subfamily of ORs, the so-called ‘PR clade’, suggesting a unique emergence
early in the evolution of Lepidoptera (Yuvaraj et al., 2018). Another hallmark of type I PRs is their
male-biased expression (Koenig et al., 2015). The phylogenetic position and the expression pattern
have thus been the main criteria used to select candidate PRs for functional studies.
Likewise, we selected PRs from the male transcriptome of the cotton leafworm Spodoptera littor-
alis (Legeai et al., 2011), a polyphagous crop pest that uses type I sex pheromone compounds
(Mun
˜oz et al., 2008) and that has been established as a model in insect chemical ecology
(Ljungberg et al., 1993;Binyameen et al., 2012;Saveer et al., 2012;Poivet et al., 2012;
de Fouchier et al., 2017). Through heterologous expression, we characterized two PRs tuned to
minor components of the S. littoralis pheromone blend (Montagne
´et al., 2012;de Fouchier et al.,
2015), but none of the tested candidate PRs detected the major pheromone component (Z,E)-9,11-
eLife digest Many animals make use of chemical signals to communicate with other members of
their species. Such chemical signals, called pheromones, often allow males and females of the same
species to recognize each other before mating. Since the discovery of the very first pheromone in
the silkworm moth Bombyx mori at the end of the 1950s, moths have been a model for pheromone
research. The sex pheromone communication system in these insects has thus been well described:
females emit a mixture of volatile chemicals, which can be detected by the antennae of males up to
several hundred meters away. This detection is achieved through neurons with specialized proteins
known as pheromone receptors that bind to the chemical signals produced by the females.
Recognizing mates by detecting a very specific pheromone signature prevents moths from
interbreeding with other species. The evolution of pheromone signals and their corresponding
receptors can therefore lead to the rise of new reproductive barriers between populations, and
eventually to the emergence of new species. The rate at which sex pheromones have diversified is
likely one reason for the existence of over 160,000 species of moths. But how did moths’ sex
pheromone receptors evolve in the first place?
Previous studies suggested that moth pheromone receptors had appeared just once during
evolution. Specifically, they revealed that these receptors belong to the same branch or lineage in
the ‘family tree’ of all receptors that detect chemical compounds in moths. This meant that when
researchers looked for pheromone receptors in a new species of moth, they always focused on this
lineage. But Bastin-He´ line et al. have now found that one pheromone receptor from a pest moth
called Spodoptera littoralis does not belong to this established group.
First, Bastin-He´ line et al. inserted this receptor into animal cells grown in the laboratory to
confirm that it responds to a specific pheromone produced by S. littoralis. Next, they genetically
modified moths of this species and showed that males need this receptor in order to mate. An
evolutionary analysis showed that the receptor belongs to a different lineage than all the other
known pheromone receptors. Together these results indicate the receptors for sex pheromones
must have evolved multiple times independently in moths.
These results will open new avenues for deciphering pheromone communication in moths, and
lead to further research into this newly discovered lineage of candidate pheromone receptors. Such
studies may foster the development of new strategies to control agricultural pests, given that some
species of moths can have devastating effects on the yields of certain crops.
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 2 of 17
Research article Evolutionary Biology Neuroscience

tetradecadienyl acetate (hereafter referred as (Z,E)-9,11-14:OAc), which is necessary and sufficient to
elicit all steps of the male mate-seeking behavioral sequence (Quero et al., 1996).
In order to identify new type I PR candidates, we focused on male-biased ORs, whether they
belong to the PR clade or not. Notably, a preliminary analysis of S. littoralis OR expression patterns
led to the identification of such a receptor, SlitOR5, which was highly expressed in male antennae
but did not belong to the PR clade (Legeai et al., 2011). Furthermore, a recent RNAseq analysis
showed that SlitOR5 was the most abundant OR in S. littoralis male antennae (Walker et al., 2019).
Here, we demonstrate that SlitOR5 is the receptor for (Z,E)-9,11-14:OAc using a combination of het-
erologous expression and in vivo genome editing methods. Based on a comprehensive phylogenetic
analysis of lepidopteran ORs, we show that SlitOR5 belongs to an OR subfamily that is distantly
related to the PR clade but harbors numerous sex-biased ORs from distinct moth families. Alto-
gether, these results suggest that PRs detecting type I pheromones evolved at least twice in Lepi-
doptera, which offers a more detailed and complex panorama on moth PR evolution.
Results
SlitOr5 is highly expressed in males but does not belong to the type I
pheromone receptor clade
We first used quantitative real-time PCR to compare the relative expression levels of the SlitOr5
gene in S. littoralis male and female adult antennae. We found SlitOr5 expressed with a more than
0
0.005
male
antennae
female
antennae
SlitOr5 expression level
(relative to SlitRpl13)
A B
type I pheromone
receptor clade
SlitOR5
0.004
0.003
0.002
0.001
type II pheromone
receptor
type 0 pheromone
receptors
Figure 1. SlitOr5 is highly expressed in males but does not belong to the pheromone receptor clade. (A) Expression levels of SlitOr5 in adult male and
female antennae of S. littoralis, as measured by real-time qPCR. Expression levels have been normalized to the expression of SlitRpl13. Plotted values
represent the mean normalized expression values ±SEM (n= 3). Raw results are available in Figure 1—source data 1. (B) Unrooted maximum
likelihood phylogeny of lepidopteran ORs, based on 506 amino acid sequences from nine species, each belonging to a different superfamily. The
position of SlitOR5 and of receptors for type 0, type I and type II pheromone compounds is highlighted. Circles on the nodes indicate the distinct
paralogous OR lineages, supported by a transfer bootstrap expectation (TBE) >0.9. All the PR-containing lineages grouped within a large clade
(highlighted in grey) also supported by the bootstrap analysis. The sequence alignment file is available in Figure 1—source data 2.
The online version of this article includes the following source data for figure 1:
Source data 1. Mean normalized expression values of SlitOr5 measured in the three biological replicates.
Source data 2. Alignment of amino acid sequences used to build the phylogeny (FASTA format).
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 3 of 17
Research article Evolutionary Biology Neuroscience

50-fold enrichment in the male antennae (Figure 1A), thus confirming previous observations
(Legeai et al., 2011;Walker et al., 2019).
We reconstructed a maximum likelihood phylogeny of lepidopteran ORs, based on entire OR rep-
ertoires from nine different species. Among the 20 paralogous lineages identified (each having
evolved in principle from an ancestral OR present in the last common ancestor of Lepidoptera), Sli-
tOR5 belonged to a lineage distantly related to the type I PR clade, as well as to the lineages con-
taining type 0 and type II PRs (Figure 1B). These four paralogous lineages grouped within a larger
clade highly supported by the bootstrap analysis (highlighted in grey in Figure 1B). This clade has
been previously shown to contain ORs tuned to terpenes and aliphatic molecules – including sex
pheromones – and exhibits higher evolutionary rates compared to more ancient clades that contain
many receptors for aromatics (de Fouchier et al., 2017).
SlitOR5 binds (Z,E)-9,11-14:OAc with high specificity and sensitivity
We next used two complementary heterologous systems to characterize the function of SlitOR5 and
assess whether it is the receptor to (Z,E)-9,11-14:OAc, the major component of the S. littoralis sex
pheromone blend. First, we expressed SlitOR5 in Drosophila melanogaster OSNs housed in at1 tri-
choid sensilla, in place of the endogenous PR DmelOR67d (Kurtovic et al., 2007). Single-sensillum
recordings were performed to measure the response of at1 OSNs to 26 type I pheromone com-
pounds (Supplementary file 1), including all the components identified in the pheromones of Spo-
doptera species (El-Sayed, 2018). SlitOR5-expressing OSNs strongly responded to (Z,E)-9,11-14:
OAc (65 ±15 spikes.s
1
), whereas there was no significant response to any other compound
(Figure 2A).
Then, we co-expressed SlitOR5 with its co-receptor SlitOrco in Xenopus oocytes and recorded
the responses to the same panel of pheromone compounds using two-electrode voltage-clamp. A
strong current was induced in SlitOR5-expressing oocytes when stimulated with (Z,E)-9,11-14:OAc
(3.9 ±0.3 mA), whereas only minor currents were recorded in response to (Z,E)-9,12-14:OAc and (Z)
9-12:OAc (Figure 2B). SlitOR5 sensitivity was assessed with a dose-response experiment that
showed a low detection threshold (10
8
M) and an EC
50
of 1.707 10
7
M (Figure 2D–E).
We compared the response spectra of heterologously expressed SlitOR5 with that of S. littoralis
male OSNs housed in type one long trichoid sensilla (LT1A OSNs, Figure 2C), known to detect (Z,E)-
9,11-14:OAc (Ljungberg et al., 1993;Quero et al., 1996). When stimulated with the 26 pheromone
compounds, LT1A OSNs significantly responded to (Z,E)-9,11-14:OAc (55 ±4 spikes.s
1
) and to a
lesser extent to its stereoisomer (Z,Z)-9,11-14:OAc, which is absent from any Spodoptera phero-
mone. This mirrored the response spectra of heterologously expressed SlitOR5, especially the one
observed in Drosophila OSNs (Figure 2A).
In vivo response to (Z,E)-9,11-14:OAc is abolished in SlitOr5 mutant
males
To confirm in vivo that SlitOR5 is the receptor for the major sex pheromone component of S. littora-
lis, we carried out a loss-of-function study by generating mutant insects for the gene SlitOr5. The
CRISPR/Cas9 genome editing system was used to create a mutation in the first exon of SlitOr5 with
the aim of disrupting the open-reading frame. Guide RNAs were injected along with the Cas9 pro-
tein in more than one thousand eggs. We genotyped 66 G0 hatched larvae and found seven individ-
uals carrying at least one mutation in SlitOr5. These 7 G0 individuals were back-crossed with wild-
type individuals to create 7 G1 heterozygous mutant lines. We selected a line carrying a single muta-
tion that consisted of a 10 bp deletion at the expected location, introducing a premature STOP
codon within the SlitOr5 transcript after 247 codons (Figure 3A).
We next generated G2 homozygous mutant males (SlitOr5
-/-
) and compared their ability to detect
(Z,E)-9,11-14:OAc to that of wild-type and heterozygous (SlitOr5
+/-
) males, using electroantenno-
gram (EAG) recordings (Figure 3B). When stimulated with (Z,E)-9,11-14:OAc, wild-type and
SlitOr5
+/-
antennae exhibited similar EAG amplitudes (0.89 mV and 1.16 mV, respectively), whereas
the response was completely abolished in SlitOr5
-/-
antennae (0.02 mV). Control experiments using a
S. littoralis minor pheromone component and plant volatiles known to induce EAG responses in S.
littoralis (Saveer et al., 2012;Lo
´pez et al., 2017) showed that antennal responses were not
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 4 of 17
Research article Evolutionary Biology Neuroscience

***
*
SlitOR5 in Drosophila OSNs
0 25 50 75 100
SlitOR5 in Xenopus oocytes
Current (µA)
0 1 2 3 4 5
(Z)5-10:OAc
12:OAc
(E)7-12:OAc
(Z)7-12:OAc
(Z)7-12:OH
(Z)9-12:OAc
(Z,E)-7,9-12:OAc
∆11-12:OAc
14:OAc
(Z)9-14:OAc
(Z)9-14:OH
(Z)9-14:Al
(E)11-14:OAc
(Z,E)-9,11-14:OAc
(Z,E)-9,11-14:OH
(Z)11-14:OAc
(Z,Z)-9,11-14:OAc
(E,E)-9,12-14:OAc
(Z,E)-9,12-14:OAc
(Z,E)-9,12-14:OH
(E,E)-10,12-14:OAc
(Z,Z)-9,12-14:OAc
(Z)9-16:Al
(Z)11-16:OAc
(Z)11-16:OH
(Z)11-16:Al
solvent
******
Response (spikes.s )
0 25 50 75 100
S. littoralis LT1A OSNs
-1
A
D E
Response (spikes.s )
-1
Current (µA)
0
1
2
3
4
5
10 10 10 10 10
Concentration of
(Z,E)-9,11-14:OAc
(M)
-9 -8 -7 -6 -5
500 nA
2 min
10 3 10 10 10 10
-9 -8 -7 -6 -5
10-8
BC
***
**
+
Figure 2. SlitOR5 is the receptor for the major component of the S. littoralis pheromone blend. (A) Action potential frequency of Drosophila at1 OSNs
expressing SlitOR5 (n= 8) after stimulation with 26 type I pheromone compounds (10 mg loaded in the stimulus cartridge). ***p<0.001, significantly
different from the response to solvent (one-way ANOVA followed by a Tukey’s post hoc test). (B) Inward current measured in Xenopus oocytes co-
expressing SlitOR5 and SlitOrco (n= 13–16) after stimulation with the same panel of pheromone compounds (10
4
M solution). ***p<0.001, **p<0.01,
significantly different from 0 (Wilcoxon signed rank test). (C) Action potential frequency of LT1A OSNs from S. littoralis male antennae (n= 8–16) after
stimulation with pheromone compounds (1 mg loaded in the stimulus cartridge). ***p<0.001, *p<0.1, significantly different from the response to solvent
(one-way ANOVA followed by a Tukey’s post hoc test). (D) Representative trace showing the response of a Xenopus oocyte co-expressing SlitOR5 and
SlitOrco after stimulation with a range of (Z,E)-9,11-14:OAc doses from 10
9
M to 10
5
M. (E) Dose-response curve of SlitOR5/Orco Xenopus oocytes
Figure 2 continued on next page
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 5 of 17
Research article Evolutionary Biology Neuroscience

impaired in SlitOr5
-/-
mutants, as these odorants elicited similar responses in wild-type, heterozygous
and homozygous moths (Figure 3B).
Then, we analyzed the courtship behavior of SlitOr5
-/-
and wild-type males in the presence of (Z,
E)-9,11-14:OAc, and found a strong behavioral defect in mutants. Whereas more than 80% of wild-
type males initiated a movement toward the pheromone source in the first 8 min, only a minority of
SlitOr5 mutants initiated such a movement (even after 30 min of test), a response similar to that of
control wild-type males not stimulated with the pheromone (Figure 3C). All the steps of the court-
ship behavior were similarly affected (Figure 3—figure supplement 1). We also verified whether Sli-
tOr5 knock-out would result in mating inability. When paired with a wild-type virgin female, only 1
out of the 13 SlitOr5
-/-
males tested was able to mate, compared to ~75% for wild-type males
(Figure 3D). This behavioral defect was further confirmed by analyzing the number of eggs laid by
the females and the number of offspring (Figure 3E). Overall, these results confirm that SlitOR5 is
the receptor responsible for the detection of the major component of the S. littoralis female phero-
mone blend.
A novel lineage of candidate moth pheromone receptors
In view of these results and the unexpected phylogenetic position of SlitOR5, we rebuilt the phylog-
eny of the lepidopteran OR clade containing SlitOR5 and the known receptors for type 0, type I and
type II pheromones (highlighted in grey in Figure 1B), adding all ORs showing a strong sex-biased
expression (at least 10-fold in one sex compared to the other) and ORs whose ligands were known
as of September 2018 (Supplementary file 2). ORs grouped within eight different paralogous line-
ages, four of which including PRs (Figure 4). One was the so-called PR clade that, as previously
observed, contained all type I PRs characterized so far (except SlitOR5) as well as two type II PRs
(Zhang et al., 2016). The other three lineages harboring PRs consisted of one containing SlitOR5,
one containing EgriOR31 (a type II PR from the geometrid Ectropis grisescens;Li et al., 2017) and
one containing EsemOR3 and 5 (type 0 PRs from the non-dytrisian moth Eriocrania semipurpurella;
Yuvaraj et al., 2017). Interestingly, most sex-biased lepidopteran ORs identified to date clustered
within the PR clade and the lineage containing SlitOR5. While sex-biased ORs within the PR clade
were mainly male-biased, the SlitOR5 lineage contained an equal proportion of male and female-
biased receptors, identified from species belonging to different families of Lepidoptera. Deep nodes
within the phylogeny were highly supported by the bootstrap analysis, enabling us to state that
these two PR-containing clades were more closely related to clades harboring receptors for plant
volatiles than to each other. This suggests that receptors tuned to type I pheromone compounds
emerged twice independently during the evolution of Lepidoptera, and that the clade containing Sli-
tOR5 may constitute a novel lineage of candidate PRs.
Discussion
While moth sex pheromone receptors have been the most investigated ORs in Lepidoptera, with
more than 60 being functionally characterized (Zhang and Lo
¨fstedt, 2015), it remains unclear how
and when these specialized receptors arose. Type I PRs have been proposed to form a monophy-
letic, specialized clade of ORs, the so-called ‘PR clade’, which emerged early in the evolution of Lep-
idoptera (Yuvaraj et al., 2017;Yuvaraj et al., 2018). Here, we bring functional and phylogenetic
evidence that type I PRs are not restricted to this clade and likely appeared twice independently in
Lepidoptera. We focused on an atypical OR, SlitOR5, which exhibited a strong male-biased expres-
sion in antennae of the noctuid moth S. littoralis but did not group with the PR clade. We demon-
strated, using a combination of heterologous expression and loss-of-function studies, that this OR is
responsible for the detection of (Z,E)-9,11-14:OAc, the major component of the S. littoralis sex pher-
omone blend. Due to the unexpected phylogenetic position of SlitOR5 outside of the previously
Figure 2 continued
(n= 9) stimulated with (Z,E)-9,11-14:OAc (EC
50
= 1.707 10
7
M). Plotted values in (A–C and E) are mean responses ±SEM. Raw results for all
experiments are available in Figure 2—source data 1.
The online version of this article includes the following source data for figure 2:
Source data 1. Raw results of electrophysiology experiments.
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 6 of 17
Research article Evolutionary Biology Neuroscience

wild-type
SlitOr5
SlitOr5
A B
_
+/
/
_
_
5' TACGTGCCACTGGGTCCAGTATTTATGCTGCATGC 3'
5' TACGT----------CCAGTATTTATGCTGCATGC 3'
SlitOr5 gene
wild-type
mutant
target sequence for gRNAPAM
0 0.2 0.4 0.6 0.8 1 1.2 1.4
EAG amplitude (mV)
(Z,E)-9,11-14:OAc
(Z,E)-9,12-14:OAc
(±)-linalool
benzyl alcohol
wild-type mRNA
mutant mRNA
ATG
ATG
STOP
frameshift
SlitOr5 ORF
SlitOr5 ORF
STOP
***
n.s.
n.s.
n.s.
n.s.
D
SlitOr5
1000 50
wild-type
25 75
_/_
mating rate (%)
0 100 200 300
number of offspring
0 100 200 300
number of eggs
C
wild-type
wild-type + solvent
SlitOr5
_/_
movement toward the source
0 500 1000 1500 2000
0
20
40
60
80
100
time (s)
cumulative occurence (%)
***
n.s.
+ (Z,E)-9,11-14:OAc
}
*** ***
E
SlitOr5
wild-type
_/_
Figure 3. Response to the major pheromone component is abolished in SlitOr5 mutants. (A) Location of the 10 bp deletion induced in the first exon of
the SlitOr5 gene by the CRISPR/Cas9 system. The sequence complementary to the RNA guide is indicated in blue, and the protospacer adjacent motif
(PAM) in red. The frameshift created in the SlitOr5 open-reading frame (ORF) induced a premature stop codon. (B) Electroantennogram (EAG)
amplitude measured in S. littoralis male antennae isolated from wild-type animals (light grey, n= 14), heterozygous SlitOr5 mutants (dark grey, n= 18)
and homozygous SlitOr5 mutants (purple, n= 8) after stimulation with pheromone compounds (1 mg in the stimulus cartridge) and plant volatiles (10 mg
in the stimulus cartridge). Plotted values represent the normalized mean response ±SEM (response to the solvent was subtracted). ***p<0.001,
significantly different from the response of the other genotypes; n.s.: not significantly different (one-way ANOVA, followed by a Tukey’s post hoc test).
Raw results for the EAG experiment are available in Figure 3—source data 1. (C) Cumulative proportion of S. littoralis males initiating a movement
toward the odor source in homozygous SlitOr5 mutants (purple, n= 14) stimulated with the major pheromone component (100 ng in the stimulus
Figure 3 continued on next page
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 7 of 17
Research article Evolutionary Biology Neuroscience

defined PR clade, the question arose whether SlitOR5 is an exception or belongs to a previously
unknown clade of moth PRs. This latter hypothesis is supported by the observation that the paralo-
gous lineage containing SlitOR5 harbored many other sex-biased ORs, identified in species from six
distinct lepidopteran families. Notably, male-biased ORs have been found in Lasiocampidae, Sphin-
gidae, Noctuidae and Tortricidae. Among these, two ORs from Ctenopseustis obliquana and C. her-
ana (Tortricidae) have been functionally studied by heterologous expression in cell cultures, but no
ligand could be identified (Steinwender et al., 2015). In the Lasiocampidae species Dendrolimus
punctatus, these male-biased ORs have been referred to as ‘Dendrolimus-specific odorant recep-
tors’, with the suspicion that they would represent good PR candidates since in Dendrolimus species,
there is no OR clustering in the PR clade (Zhang et al., 2014;Zhang et al., 2017). No functional
data yet confirmed this suspicion.
Conversely, within the SlitOR5 lineage, almost half of the sex-biased ORs were female-biased (13
out of 28, compared to 4 out of 63 in the classical PR clade). Female-biased ORs have been gener-
ally proposed to be involved in the detection of plant-emitted oviposition cues, as demonstrated in
Bombyx mori (Anderson et al., 2009). However, another interesting hypothesis is that they could be
tuned to male sex pheromones. In moths, little attention has been put on male pheromones, which
are known to be involved in various mating behaviors such as female attraction, female acceptance,
aggregation of males to form leks, mate assessment or inhibition of other males (reviewed in
Conner and Iyengar, 2016). The use of male pheromone systems has been selected multiple times
in distinct moth families, as reflected by the chemical diversity of male pheromone compounds and
of the disseminating structures (Birch et al., 1990;Phelan, 1997;Conner and Iyengar, 2016). It is
thus expected that this polyphyletic nature of male pheromones would result in a large diversity of
female PR types. Accordingly, female-biased ORs were found in different clades within the phylog-
eny. However, most remain orphan ORs, including BmorOR30 that does belong to the SlitOR5 line-
age but for which no ligand could be identified (Anderson et al., 2009). Although the most
common male-emitted volatiles are plant-derived pheromones (Conner and Iyengar, 2016), some
male courtship pheromones are long-chained hydrocarbons related to type I female pheromone
compounds (Hillier and Vickers, 2004) that could be detected by female-biased type I PRs such as
those identified within the SlitOR5 lineage.
The ancestral protein from which the so-called ‘PR clade’ would have arisen is thought to be an
OR tuned to plant-emitted volatiles (Yuvaraj et al., 2017;Yuvaraj et al., 2018). Here, we evidence
that SlitOR5 is a new type I PR that belongs to a distinct early diverging lineage for which a role in
pheromone detection had never been demonstrated. Together with the findings that PRs for Type 0
(Yuvaraj et al., 2017) and one PR for type II pheromones (Li et al., 2017) group in distinct paralo-
gous lineages also unrelated to the PR clade, our data suggest that lepidopteran PRs have evolved
four times in four paralogous lineages. Whether the SlitOR5 lineage has evolved from ORs that
detected structurally related plant volatiles - as has been proposed for type 0 (Yuvaraj et al., 2017)
and classical type I PRs - remains elusive. Yet, no OR tuned to plant volatiles has been identified in
closely related lineages. More functional data on SlitOR5 paralogs and orthologs in different moth
species, possibly revealing more type I PRs, will help in understanding evolutionary history of this
lineage, as to when and how these receptors have evolved, and confirm that we are facing a novel
type I PR clade.
Figure 3 continued
cartridge) and in wild-type animals stimulated with the pheromone (blue, n= 36) or with solvent alone (light grey, n= 44). ***p<0.001, significantly
different from the other distributions; n.s.: not significantly different (log-rank test). Results obtained for other behavioral items are presented in
Figure 3—figure supplement 1. (D) Proportion of wild-type S. littoralis males (light grey, n= 49) and homozygous SlitOr5 mutants (purple, n= 13) that
mated with a wild-type female during a period of 6 hr in the scotophase. *p<0.05, significant difference between the two genotypes (Fisher’s exact
test). (E) Number of eggs laid (left panel) and of offspring (right panel) obtained per female after the mating experiment. Plotted values represent the
mean ±SEM. ***p<0.001, **p<0.005, significant difference between the two genotypes (Mann-Whitney Utest). Raw results for all the behavioral
experiments are available in Figure 3—source data 2.
The online version of this article includes the following source data and figure supplement(s) for figure 3:
Source data 1. Raw results of the EAG experiment.
Source data 2. Raw results of behavioral experiments.
Figure supplement 1. Behavioral response of wild-type and homozygous SlitOr5 mutants to the major pheromone component.
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 8 of 17
Research article Evolutionary Biology Neuroscience

1
0.99
1
1
0.98
0.93
0.90
1
0.97
0.96
0.98
0.92
0.97
0.99
0.89
type I pheromone receptors
type II pheromone receptors
type 0 pheromone receptors
plant volatile receptors
female-biased receptor
male-biased receptor
pheromone receptor clade
novel lineage of candidate
pheromone receptors
4
Figure 4. SlitOR5 may define a novel lineage of candidate pheromone receptors in Lepidoptera. Maximum likelihood phylogeny of the lepidopteran
OR clade that includes all the paralogous lineages containing pheromone receptors. 360 sequences from 34 lepidopteran species were included.
Functional and expression data shown on the figure have been compiled from the literature (Supplementary file 2). Branch colors indicate OR
function, when characterized: PRs for type I pheromones are depicted in red, those for type II pheromones in blue and those for type 0 pheromones in
Figure 4 continued on next page
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 9 of 17
Research article Evolutionary Biology Neuroscience

Materials and methods
Key resources table
Reagent type
(species) or resource Designation Source or reference Identifiers
Additional
information
Gene
(Spodoptera littoralis)
SlitOr5 GenBank GB:MK614705
Gene
(Spodoptera littoralis)
SlitOrco Malpel et al. (2008);
PMID:18828844;
GenBank
GB:EF395366
Genetic
reagent
(Drosophila
melanogaster)
Or67d
GAL4
Kurtovic et al. (2007);
PMID: 17392786
FLYB:FBal0210948 kindly provided
by B. Dickson
Genetic
reagent
(Drosophila
melanogaster)
y
1
M{vas-int.Dm}ZH-
2A w*; M{3xP3-
RFP.attP}ZH-51C
Bischof et al. (2007);
PMID: 17360644;
Bloomington
Drosophila
Stock Center
BDSC:24482
Genetic
reagent
(Drosophila
melanogaster)
UAS-SlitOr5 This study See Materials
and methods
Recombinant
DNA reagent
pUAST.attB
(plasmid)
Bischof et al. (2007);
PMID: 17360644;
GenBank
GB:EF362409 kindly provided
by J. Bischof
Recombinant
DNA reagent
pUAST.attB-
SlitOr5 (plasmid)
This study See Materials
and methods
Recombinant
DNA reagent
pCS2+ (plasmid) Turner and Weintraub (1994);
PMID: 7926743
kindly provided
by C. He
´ligon
Recombinant
DNA reagent
pCS2+-SlitOr5
(plasmid)
This study See Materials
and methods
Recombinant
DNA reagent
pCS2+-SlitOrco
(plasmid)
This study See Materials
and methods
Sequence-
based reagent
Or5up This study PCR primers TCGGGAGAAACTGAAGGACGTTGT
Sequence-
based reagent
Or5do This study PCR primers GCACGGAACCGCACTTATCACTAT
Sequence-
based reagent
Rpl13up This study PCR primers GTACCTGCCGCTCTCCGTGT
Sequence-
based reagent
Rpl13do This study PCR primers CTGCGGTGAATGGTGCTGTC
Sequence-
based reagent
SlitOr5 guide RNA This study gRNA AGCATAAATACTGGACCCAGTGG
Sequence-
based reagent
Or5_forward This study PCR primers CCAAAAGGACTTGGACTTTGAA
Sequence-
based reagent
Or5_reverse This study PCR primers CCCGAATCTTTTCAGGATTAGAA
Figure 4 continued
orange. ORs tuned to plant volatiles are depicted in green. Symbols at the edge indicate expression data: male-biased ORs are highlighted with black
squares and female-biased ORs with black dots. Circles on the nodes indicate the distinct paralogous OR lineages. Support values on basal nodes are
transfer bootstrap expectation (TBE) values. The tree has been rooted using an outgroup as identified in the lepidopteran OR phylogeny shown in
Figure 1. The scale bar indicates the expected number of amino acid substitutions per site. The sequence alignment file is available in Figure 4—
source data 1.
The online version of this article includes the following source data for figure 4:
Source data 1. Alignment of amino acid sequences used to build the phylogeny (FASTA format).
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 10 of 17
Research article Evolutionary Biology Neuroscience

Animal rearing and chemicals
S. littoralis were reared in the laboratory on a semi-artificial diet (Poitout and Bue
`s, 1974) at 22˚C,
60% relative humidity and under a 16 hr light:8 hr dark cycle. Males and females were sexed as
pupae and further reared separately. D. melanogaster lines were reared on standard cornmeal-
yeast-agar medium and kept in a climate- and light-controlled environment (25˚C, 12 hr light:12 hr
dark cycle). The 26 pheromone compounds used for electrophysiology experiments
(Supplementary file 1) were either synthesized in the lab or purchased from Sigma-Aldrich (St Louis,
MO) and Pherobank (Wijk bij Duurstede, The Netherlands). Paraffin oil was purchased from Sigma-
Aldrich and hexane from Carlo Erba Reagents (Val de Reuil, France).
Quantitative real-time PCR
Total RNA from three biological replicates of 15 pairs of antennae of two-day-old virgin male and
female S. littoralis was extracted using RNeasy Micro Kit (Qiagen, Hilden, Germany), which included
a DNase treatment. cDNA was synthesized from total RNA (1 mg) using Invitrogen SuperScript II
reverse transcriptase (Thermo Fisher Scientific, Waltham, MA). Gene-specific primers were designed
for SlitOr5 (Or5up: 5’-TCGGGAGAAACTGAAGGACGTTGT-3’, Or5do: 5’-GCACGGAACCGCAC
TTATCACTAT-3’) and for the reference gene SlitRpl13 (Rpl13up: 5’-GTACCTGCCGCTCTCCGTGT-
3’, Rpl13do: 5’-CTGCGGTGAATGGTGCTGTC-3’). qPCR mix was prepared in a total volume of 10
mL with 5 mL of LightCycler 480 SYBR Green I Master (Roche, Basel, Switzerland), 4 mL of diluted
cDNA (or water for the negative control) and 0.5 mM of each primer. qPCR assays were performed
using the LightCycler 480 Real-Time PCR system (Roche). All reactions were performed in triplicate
for the three biological replicates. The PCR program began with a cycle at 95˚C for 13.5 min, fol-
lowed by 50 cycles of 10 s at 95˚C, 15 s at 60˚C and 15 s at 72˚C. Dissociation curves of the amplified
products were performed by gradual heating from 55˚C to 95˚C at 0.5 ˚C.s
1
. A negative control
(mix without cDNA) and a fivefold dilution series protocol of pooled cDNAs (from all conditions)
were included. The fivefold dilution series were used to construct relative standard curves to deter-
mine the PCR efficiencies used for further quantification analyses. Data were analyzed with the Light-
Cycler 480 software (Roche). Normalized expression of the SlitOr5 gene was calculated with the
Q-Gene software (Joehanes and Nelson, 2008) using SlitRpl13 as a reference, considering it dis-
plays consistent expression as previously described in Durand et al. (2010).
Heterologous expression of SlitOR5 in Drosophila
The SlitOr5 full-length open-reading frame (1191 bp, GenBank acc. num. MK614705) was subcloned
into the pUAST.attB vector. Transformant UAS-SlitOr5 balanced fly lines were generated by Best-
Gene Inc (Chino Hills, CA), by injecting the pUAST.attB-SlitOr5 plasmid (Endofree prepared, Qiagen)
into fly embryos with the genotype y
1
M{vas-int.Dm}ZH-2A w*; M{3xP3-RFP.attP}ZH-51C
(Bischof et al., 2007), leading to a non-random insertion of the UAS-SlitOr5 construct into the locus
51C of the second chromosome. The UAS-SlitOr5 balanced line was then crossed to the Or67d
GAL4
line (Kurtovic et al., 2007) to obtain double homozygous flies (genotype w; UAS-SlitOr5,w
+
;Or67d-
GAL4
) expressing the SlitOr5 transgene in at1 OSNs instead of the endogenous Drosophila receptor
gene Or67d. The correct expression of SlitOr5 was confirmed by RT-PCR on total RNA extracted
from 100 pairs of antennae.
Single-sensillum recordings
Single-sensillum extracellular recordings on Drosophila at1 OSNs were performed as previously
described (de Fouchier et al., 2015). OSNs were stimulated during 500 ms, using stimulus car-
tridges containing 10 mg of pheromone (1 mg/ml in hexane) dropped onto a filter paper. Single-sen-
sillum recordings on S. littoralis LT1A OSNs were performed using the tip-recording technique, as
previously described (Pe
´zier et al., 2007). Briefly, the tips of a few LT1 sensilla were cut off using
sharpened forceps and a recording glass electrode filled with a saline solution (170 mM KCl, 25 mM
NaCl, 3 mM MgCl
2
, 6 mM CaCl
2
, 10 mM HEPES and 7.5 mM glucose, pH 6.5) was slipped over the
end of a cut LT1 sensillum. OSNs were stimulated with an air pulse of 200 ms (10 L.h
1
), odorized
using a stimulus cartridge containing 1 mg of pheromone (diluted at 1 mg/ml in hexane). Odorants
were considered as active if the response they elicited was statistically different from the response
elicited by the solvent alone (one-way ANOVA followed by a Tukey’s post hoc test).
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 11 of 17
Research article Evolutionary Biology Neuroscience

Heterologous expression of SlitOR5 in Xenopus oocytes and two-
electrode voltage-clamp recordings
Open-reading frames of SlitOr5 and SlitOrco (GenBank acc. num. EF395366, Malpel et al., 2008)
were subcloned into the pCS2+ vector (Turner and Weintraub, 1994). Template plasmids were fully
linearized with PteI for pCS2+-SlitOr5 and NotI for pCS2+-SlitOrco and capped cRNAs were tran-
scribed using SP6 RNA polymerase. Purified cRNAs were re-suspended in nuclease-free water at a
concentration of 2 mg/mL and stored at 80˚C. Mature healthy oocytes were treated with 2 mg/ml
collagenase type I in washing buffer (96 mM NaCl, 2 mM KCl, 5 mM MgCl
2
and 5 mM HEPES, pH
7.6) for 1–2 hr at room temperature. Oocytes were later microinjected with 27.6 ng of SlitOr5 cRNA
and 27.6 ng of SlitOrco cRNA. After 4 days of incubation at 18˚C in 1 Ringer’s solution (96 mM
NaCl, 2 mM KCl, 5 mM MgCl2, 0.8 mM CaCl2, and 5 mM HEPES, pH 7.6) supplemented with 5%
dialyzed horse serum, 50 mg/ml tetracycline, 100 mg/ml streptomycin and 550 mg/ml sodium pyru-
vate, the whole-cell currents were recorded from the injected oocytes with a two-electrode voltage
clamp. Oocytes were exposed to the 26 pheromone compounds diluted at 10
4
M in Ringer’s solu-
tion, with an interval between exposures which allowed the current to return to baseline. Data acqui-
sition and analysis were carried out with Digidata 1440A and pCLAMP10 software (Molecular
Devices, San Jose, CA). Odorants were considered as active if the mean response they elicited was
statistically different from 0 (Wilcoxon signed rank test). Dose–response experiments were per-
formed using pheromone concentrations ranging from 10
9
up to 10
5
M and data were analyzed
using GraphPad Prism 5.
SlitOr5 knock-out via CRISPR/Cas9
A guide RNA (gRNA sequence: AGCATAAATACTGGACCCAG TGG) was designed against the first
exon of the SlitOr5 gene using the CRISPOR gRNA design tool (crispor.tefor.net; Haeussler et al.,
2016) and transcribed after subcloning into the DR274 vector using the HiScribe T7 High Yield RNA
Synthesis Kit (New England Biolabs, Ipswich, MA). The Cas9 protein was produced in Escherichia coli
as previously described (Me
´noret et al., 2015). A mix of Cas9 protein and gRNA was injected in
freshly laid eggs using an Eppendorf - Transjector 5246, as previously described
(Koutroumpa et al., 2016). Individual genotyping at every generation was performed via PCR on
genomic DNA extracted from larvae pseudopods (Wizard Genomic DNA Purification Kit, Promega,
Madison, WI) using gene-specific primers (Or5_forward: 5’-CCAAAAGGACTTGGACTTTGAA-3’;
Or5_reverse: 5’-CCCGAATCTTTTCAGGATTAGAA-3’) amplifying a fragment of 728 bp encompass-
ing the target sequence. Mutagenic events were detected by sequencing the amplification products
(Biofidal, Vaulx-en-Velin, France). G0 larvae carrying a single mutagenic event were reared until
adults and crossed with wild-type individuals. Homozygous G2 individuals were obtained by crossing
G1 heterozygous males and females.
Phenotyping of CRISPR/Cas9 mutants by electroantennogram
recordings
Electroantennogram recordings were performed as previously described (Koutroumpa et al., 2016)
on isolated male antennae from wild-type animals and from heterozygous and homozygous SlitOr5
mutants. Antennae were stimulated using stimulus cartridges loaded with 10 mg of linalool or benzyl
alcohol diluted in paraffin oil, and 1 mg of (Z,E)-9,11-14:OAc or (Z,E)-9,12-14:OAc diluted in hexane.
Stimulations lasted for 500 ms (30 L/h). Negative controls consisted of paraffin oil and hexane alone.
The maximum depolarization amplitude was measured using the pCLAMP10 software. Normalized
mean responses were calculated (response to the solvent was subtracted) and data were analyzed
using a one-way ANOVA followed by a Tukey’s post hoc test.
Behavioral experiments
For courtship monitoring, 2-day-old wild-type or homozygous SlitOr5 mutant males were placed
individually in a plastic squared petri dish (size = 12 cm) before the onset of the scotophase, and
experiments started at the middle of the scotophase (22˚C, 70% relative humidity). Odorant stimula-
tion was performed using Pasteur pipettes containing a filter paper loaded with 100 ng of (Z,E)-9,11-
14:OAc (10 ng/ml in hexane), or hexane alone as control. The narrow end of the pipette was inserted
into the petri dish, and a constant stream of charcoal-filtered, humidified air (0.2 L.min
1
) passed
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 12 of 17
Research article Evolutionary Biology Neuroscience

through the pipette during all the experiment. Male courtship behavior was recorded under dim red
light during 30 min using a webcam (Logitech QuickCam Pro 9000). The latency of each of the fol-
lowing stereotyped behavioral items was individually screened: antennal flicking, movement toward
the odor source, wing fanning, abdomen curving and extrusion of genitalia. Results were presented
as cumulative occurrence of each item along the time of the experiment. Statistical analysis of the
distributions obtained for each treatment were compared using a log-rank (Mantel-Cox) test. For
mating experiments, 2-day-old wild-type or homozygous SlitOr5 mutant males were paired with a 2-
day-old wild-type virgin female in a cylindrical plastic box (diameter 8 cm, height 5 cm), the walls of
which were covered up with filter paper. Experiments started at the onset of the scotophase and
lasted over 6 hr. Copulation events were visually inspected every 20 min under dim red light. After
the end of the experiment, females were kept in the boxes for 12 hr. Then, females were discarded
and filter papers were examined for the presence of egg clutches. When present, eggs were trans-
ferred to a rearing plastic box, hatch was monitored every day during 7 days and second-instar lar-
vae were counted, if any. Statistical analysis of mating rates was done using a Fisher’s exact test, and
analyses of the number of eggs and offspring were done using a Mann-Whitney Utest.
Phylogenetic analyses
The dataset of lepidopteran amino acid OR sequences used to build the phylogeny shown in Fig-
ure 1 included entire OR repertoires from the following nine species, each belonging to a different
lepidopteran superfamily: Bombyx mori (Bombycoidea; Tanaka et al., 2009), Dendrolimus punctatus
(Lasiocampoidea; Zhang et al., 2017), Ectropis grisescens (Geometroidea; Li et al., 2017), Epiphyas
postvittana (Tortricoidea; Corcoran et al., 2015), Eriocrania semipurpurella (Eriocranioidea;
Yuvaraj et al., 2017), Heliconius melpomene (Papilionoidea; Heliconius Genome Consortium,
2012), Ostrinia furnacalis (Pyraloidea; Yang et al., 2015), Plutella xylostella (Yponomeutoidea;
Engsontia et al., 2014) and Spodoptera littoralis (Noctuoidea; Walker et al., 2019). The dataset
used to build the phylogeny shown in Figure 4 contained amino acid sequences from the same nine
species falling into that clade, plus all the sequences of ORs within that clade showing a marked sex-
biased expression (threshold of a 10-fold difference in expression rate between male and female
antennae, based on RNAseq or qPCR experiments) and/or for which ligands have been identified as
of September 2018 (Supplementary file 2). Alignments were performed using Muscle (Edgar, 2004)
as implemented in Jalview v2.10.5 (Waterhouse et al., 2009). Phylogenetic reconstruction was per-
formed using maximum likelihood. The best-fit model of protein evolution was selected by SMS
(Lefort et al., 2017) and tree reconstruction was performed using PhyML 3.0 (Guindon et al.,
2010). Node support was first assessed using 100 bootstrap iterations, then the file containing boot-
strap trees was uploaded on the Booster website (Lemoine et al., 2018) to obtain the TBE (Transfer
Bootstrap Expectation) node support estimation. Figures were created using the iTOL web server
(Letunic and Bork, 2016).
Acknowledgements
We are grateful to Lixiao Du and Franc¸ oise Bozzolan for technical assistance, Bin Yang for his help
and advice, and Pascal Roskam and Philippe Touton for insect rearing. We also thank Christophe
He´ ligon (CRB Xe´ nope, Rennes) for providing the pCS2+ plasmid. This work has been funded by the
French National Research Agency (ANR-16-CE02-0003-01 and ANR-16-CE21-0002-01 grants), the
National Natural Science Foundation of China (31725023, 31621064) and a PRC NSFC-CNRS 2019
grant. Research was conducted as part of the CAAS-INRA Associated International Laboratory in
Plant Protection.
Additional information
Competing interests
Arthur de Fouchier, Emmanuelle Jacquin-Joly, Nicolas Montagne´ : The intellectual property rights of
SlitOR5 have been licensed by Inra, Sorbonne Universite´ and CNRS for the purpose of developing
novel insect control agents. The other authors declare that no competing interests exist.
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 13 of 17
Research article Evolutionary Biology Neuroscience

Funding
Funder Grant reference number Author
Agence Nationale de la Re-
cherche
ANR-16-CE02-0003-01 Nicolas Montagne
´
Agence Nationale de la Re-
cherche
ANR-16-CE21-0002-01 Emmanuelle Jacquin-Joly
National Natural Science
Foundation of China
31725023 Guirong Wang
National Natural Science
Foundation of China
31621064 Guirong Wang
PRC NSFC-CNRS Guirong Wang
The funders had no role in study design, data collection and interpretation, or the
decision to submit the work for publication.
Author contributions
Lucie Bastin-He´ line, Data curation, Investigation, Writing—original draft; Arthur de Fouchier, William
B Walker III, Investigation, Writing—review and editing; Song Cao, Data curation, Investigation, Writ-
ing—review and editing; Fotini Koutroumpa, Gabriela Caballero-Vidal, Stefania Robakiewicz, Marie-
Christine Franc¸ois, Tatiana Ribeyre, Annick Maria, Thomas Chertemps, Investigation; Christelle Mon-
sempes, Data curation, Investigation; Anne de Cian, Resources; Guirong Wang, Conceptualization,
Funding acquisition, Writing—review and editing; Emmanuelle Jacquin-Joly, Conceptualization,
Funding acquisition, Writing—original draft; Nicolas Montagne´ , Conceptualization, Data curation,
Funding acquisition, Writing—original draft
Author ORCIDs
William B Walker III https://orcid.org/0000-0003-2798-9616
Emmanuelle Jacquin-Joly http://orcid.org/0000-0002-6904-2036
Nicolas Montagne´ https://orcid.org/0000-0001-8810-3853
Decision letter and Author response
Decision letter https://doi.org/10.7554/eLife.49826.sa1
Author response https://doi.org/10.7554/eLife.49826.sa2
Additional files
Supplementary files
.Supplementary file 1. List of synthetic compounds used for electrophysiology experiments.
.Supplementary file 2. Functional and sex-biased expression data available for lepidopteran phero-
mone receptors (as of September 2018).
.Transparent reporting form
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files.
Source data files have been provided for Figures 1, 2, 3 and 4.
References
Anderson AR, Wanner KW, Trowell SC, Warr CG, Jaquin-Joly E, Zagatti P, Robertson H, Newcomb RD. 2009.
Molecular basis of female-specific odorant responses in Bombyx mori. Insect Biochemistry and Molecular
Biology 39:189–197. DOI: https://doi.org/10.1016/j.ibmb.2008.11.002,PMID: 19100833
Ando T, Inomata S, Yamamoto M. 2004. Lepidopteran Sex Pheromones. In: Schulz S (Ed). The Chemistry of
Pheromones and Other Semiochemicals I, Topics in Current Chemistry.96 Berlin, Heidelberg: Springer-Verlag.
Binyameen M, Anderson P, Ignell R, Seada MA, Hansson BS, Schlyter F. 2012. Spatial organization of antennal
olfactory sensory neurons in the female Spodoptera littoralis moth: differences in sensitivity and temporal
characteristics. Chemical Senses 37:613–629. DOI: https://doi.org/10.1093/chemse/bjs043,PMID: 22459164
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 14 of 17
Research article Evolutionary Biology Neuroscience

Birch MC, Poppy GM, Baker TC. 1990. Scents and Eversible Scent Structures of Male Moths. Annual Review of
Entomology 35:25–54 . DOI: https://doi.org/10.1146/annurev.en.35.010190.000325
Bischof J, Maeda RK, Hediger M, Karch F, Basler K. 2007. An optimized transgenesis system for Drosophila using
germ-line-specific phiC31 integrases. PNAS 104:3312–3317. DOI: https://doi.org/10.1073/pnas.0611511104,
PMID: 17360644
Butenandt A, Beckmann R, Stamm D, Hecker E. 1959. Uber Den Sexuallockstoff Des Seidenspinners Bombyx
Mori Reindarstellung Und Konstitution.284 Zeitschrift Fu
¨r Naturforschung 14b.
Carde
´RT, Haynes KF. 2004. Structure of the pheromone communication channel in moths. In: Carde´ RT, Millar
JG (Eds). Advances in Insect Chemical Ecology. Cambridge: Cambridge University Press.
Chertemps T. 2017. Molecular Basis of Pheromone Detection in Insects. In: Reference Module in Life Sciences.
Elsevier.
Conner WE, Iyengar VK. 2016. Male Pheromones in Moths: Reproductive Isolation, Sexy Sons, and Good Genes.
In: Allison J. D, Carde´ R. T (Eds). Pheromone Communication in Moths: Evolution, Behavior and Application.
Oakland: University of California Press.
Corcoran JA, Jordan MD, Thrimawithana AH, Crowhurst RN, Newcomb RD. 2015. The peripheral olfactory
repertoire of the lightbrown apple moth, Epiphyas postvittana. PLOS ONE 10:e0128596. DOI: https://doi.org/
10.1371/journal.pone.0128596,PMID: 26017144
de Fouchier A, Sun X, Monsempes C, Mirabeau O, Jacquin-Joly E, Montagne´ N. 2015. Evolution of two
receptors detecting the same pheromone compound in crop pest moths of the genus Spodoptera. Frontiers in
Ecology and Evolution 3:95. DOI: https://doi.org/10.3389/fevo.2015.00095
de Fouchier A, Walker WB, Montagne´ N, Steiner C, Binyameen M, Schlyter F, Chertemps T, Maria A, Franc¸ois
MC, Monsempes C, Anderson P, Hansson BS, Larsson MC, Jacquin-Joly E. 2017. Functional evolution of
lepidoptera olfactory receptors revealed by deorphanization of a moth repertoire. Nature Communications 8:
15709. DOI: https://doi.org/10.1038/ncomms15709,PMID: 28580965
Durand N, Carot-Sans G, Chertemps T, Montagne´ N, Jacquin-Joly E, Debernard S, Maı
¨be` che-Coisne M. 2010. A
diversity of putative carboxylesterases are expressed in the antennae of the noctuid moth Spodoptera littoralis.
Insect Molecular Biology 19:87–97. DOI: https://doi.org/10.1111/j.1365-2583.2009.00939.x,PMID: 20002215
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids
Research 32:1792–1797. DOI: https://doi.org/10.1093/nar/gkh340,PMID: 15034147
El-Sayed AM. 2018. The pherobase: database of insect pheromones and semiochemicals. http://www.
pherobase.com/ [Accessed June 30, 2019].
Engsontia P, Sangket U, Chotigeat W, Satasook C. 2014. Molecular evolution of the odorant and gustatory
receptor genes in lepidopteran insects: implications for their adaptation and speciation. Journal of Molecular
Evolution 79:21–39. DOI: https://doi.org/10.1007/s00239-014-9633-0,PMID: 25038840
Fleischer J, Krieger J. 2018. Insect pheromone receptors - Key elements in sensing intraspecific chemical signals.
Frontiers in Cellular Neuroscience 12:425. DOI: https://doi.org/10.3389/fncel.2018.00425,PMID: 30515079
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. 2010. New algorithms and methods to
estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59:
307–321. DOI: https://doi.org/10.1093/sysbio/syq010,PMID: 20525638
Haeussler M, Scho
¨nig K, Eckert H, Eschstruth A, Mianne´ J, Renaud J-B, Schneider-Maunoury S, Shkumatava A,
Teboul L, Kent J, Joly J-S, Concordet J-P. 2016. Evaluation of off-target and on-target scoring algorithms and
integration into the guide RNA selection tool CRISPOR. Genome Biology 17:148 . DOI: https://doi.org/10.
1186/s13059-016-1012-2
Heliconius Genome Consortium. 2012. Butterfly genome reveals promiscuous exchange of mimicry adaptations
among species. Nature 487:94–98. DOI: https://doi.org/10.1038/nature11041,PMID: 22722851
Hillier NK, Vickers NJ. 2004. The role of heliothine hairpencil compounds in female Heliothis virescens
(Lepidoptera: noctuidae) behavior and mate acceptance. Chemical Senses 29:499–511. DOI: https://doi.org/10.
1093/chemse/bjh052,PMID: 15269122
Joehanes R, Nelson JC. 2008. QGene 4.0, an extensible Java QTL-analysis platform. Bioinformatics 24:2788–
2789. DOI: https://doi.org/10.1093/bioinformatics/btn523,PMID: 18940826
Kaissling K-E. 2014. Pheromone Reception in Insects: The Example of Silk Moths. In: Mucignat-Caretta C (Ed).
Neurobiology of Chemical Communication.146 Boca Raton: CRC Press.
Koenig C, Hirsh A, Bucks S, Klinner C, Vogel H, Shukla A, Mansfield JH, Morton B, Hansson BS, Grosse-Wilde E.
2015. A reference gene set for chemosensory receptor genes of Manduca sexta. Insect Biochemistry and
Molecular Biology 66:51–63. DOI: https://doi.org/10.1016/j.ibmb.2015.09.007,PMID: 26365739
Koutroumpa FA, Monsempes C, Franc¸ois M-C, de Cian A, Royer C, Concordet J-P, Jacquin-Joly E. 2016.
Heritable genome editing with CRISPR/Cas9 induces anosmia in a crop pest moth. Scientific Reports 6:29620 .
DOI: https://doi.org/10.1038/srep29620
Krieger J, Grosse-Wilde E, Gohl T, Dewer YM, Raming K, Breer H. 2004. Genes encoding candidate pheromone
receptors in a moth (Heliothis virescens). PNAS 101:11845–11850. DOI: https://doi.org/10.1073/pnas.
0403052101,PMID: 15289611
Kurtovic A, Widmer A, Dickson BJ. 2007. A single class of olfactory neurons mediates behavioural responses to a
Drosophila sex pheromone. Nature 446:542–546. DOI: https://doi.org/10.1038/nature05672,PMID: 17392786
Lefort V, Longueville JE, Gascuel O. 2017. SMS: smart model selection in PhyML. Molecular Biology and
Evolution 34:2422–2424. DOI: https://doi.org/10.1093/molbev/msx149,PMID: 28472384
Legeai F, Malpel S, Montagne´ N, Monsempes C, Cousserans F, Merlin C, Franc¸ois MC, Maı
¨be` che-Coisne´ M,
Gavory F, Poulain J, Jacquin-Joly E. 2011. An expressed sequence tag collection from the male antennae of the
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 15 of 17
Research article Evolutionary Biology Neuroscience

noctuid moth Spodoptera littoralis: a resource for olfactory and pheromone detection research. BMC
Genomics 12:86. DOI: https://doi.org/10.1186/1471-2164-12-86,PMID: 21276261
Lemoine F, Domelevo Entfellner JB, Wilkinson E, Correia D, Da´ vila Felipe M, De Oliveira T, Gascuel O. 2018.
Renewing Felsenstein’s phylogenetic bootstrap in the era of big data. Nature 556:452–456. DOI: https://doi.
org/10.1038/s41586-018-0043-0,PMID: 29670290
Letunic I, Bork P. 2016. Interactive tree of life (iTOL) v3: an online tool for the display and annotation of
phylogenetic and other trees. Nucleic Acids Research 44:W242–W245. DOI: https://doi.org/10.1093/nar/
gkw290,PMID: 27095192
Li Z-Q, Luo Z-X, Cai X-M, Bian L, Xin Z-J, Liu Y, Chu B, Chen Z-M. 2017. Chemosensory Gene Families in Ectropis
grisescens and Candidates for Detection of Type-II Sex Pheromones. Frontiers in Physiology 8:953 .
DOI: https://doi.org/10.3389/fphys.2017.00953
Ljungberg H, Anderson P, Hansson BS. 1993. Physiology and morphology of pheromone-specific sensilla on the
antennae of male and female Spodoptera littoralis (Lepidoptera: Noctuidae). Journal of Insect Physiology 39:
253–260 . DOI: https://doi.org/10.1016/0022-1910(93)90096-A
Lo
¨fstedt C, Wahlberg N, Millar JM. 2016. Evolutionary patterns of pheromone diversity in Lepidoptera, in: . In:
Allison JD, Carde´ RT (Eds). Pheromone Communication in Moths: Evolution, Behavior and Application.
Oakland: University of California Press.
Lo
´pez S, Guerrero A, Bleda MJ, Quero C. 2017. Short-term peripheral sensitization by brief exposure to
pheromone components in Spodoptera littoralis. Journal of Comparative Physiology A 203:973–982.
DOI: https://doi.org/10.1007/s00359-017-1205-5
Malpel S, Merlin C, Franc¸ ois MC, Jacquin-Joly E. 2008. Molecular identification and characterization of two new
lepidoptera chemoreceptors belonging to the Drosophila melanogaster OR83b family. Insect Molecular
Biology 17:587–596. DOI: https://doi.org/10.1111/j.1365-2583.2008.00830.x,PMID: 18828844
Me
´noret S, De Cian A, Tesson L, Remy S, Usal C, Boule´ JB, Boix C, Fontanie` re S, Cre´ ne´ guy A, Nguyen TH,
Brusselle L, Thinard R, Gauguier D, Concordet JP, Cherifi Y, Fraichard A, Giovannangeli C, Anegon I. 2015.
Homology-directed repair in rodent zygotes using Cas9 and TALEN engineered proteins. Scientific Reports 5:
14410. DOI: https://doi.org/10.1038/srep14410,PMID: 26442875
Montagne
´N, Chertemps T, Brigaud I, Franc¸ ois A, Franc¸ois M-C, de Fouchier A, Lucas P, Larsson MC, Jacquin-
Joly E. 2012. Functional characterization of a sex pheromone receptor in the pest moth Spodoptera littoralis by
heterologous expression in Drosophila: characterization of a moth sex pheromone receptor. European Journal
of Neuroscience 36:2588–2596. DOI: https://doi.org/10.1111/j.1460-9568.2012.08183.x
Mun
˜oz L, Rosell G, Quero C, Guerrero A. 2008. Biosynthetic pathways of the pheromone of the Egyptian
armyworm Spodoptera littoralis .Physiological Entomology 33:275–290. DOI: https://doi.org/10.1111/j.1365-
3032.2008.00645.x
Pe
´zier A, Acquistapace A, Renou M, Rospars JP, Lucas P. 2007. Ca2+ stabilizes the membrane potential of moth
olfactory receptor neurons at rest and is essential for their fast repolarization. Chemical Senses 32:305–317.
DOI: https://doi.org/10.1093/chemse/bjl059,PMID: 17267420
Phelan PL. 1997. Evolution of mate–signaling in moths: phylogenetic considerations and predictions from the
asymmetric tracking hypothesis. In: Choe JC, Crespi BJ (Eds). The Evolution of Mating Systems in Insects and
Arachnids. Cambridge: Cambridge University Press.
Poitout S, Bue` s R. 1974. Elevage de chenilles de vingt-huit espe` ces de le´ pidopte` res Noctuidae et de deux
espe` ces d’arctiidae sur milieu artificiel simple. Particularite´ s de l’e´ levage selon les espe` ces. Annales De
Zoologie 6: 431–441.
Poivet E, Rharrabe K, Monsempes C, Glaser N, Rochat D, Renou M, Marion-Poll F, Jacquin-Joly E. 2012. The use
of the sex pheromone as an evolutionary solution to food source selection in caterpillars. Nature
Communications 3:1047. DOI: https://doi.org/10.1038/ncomms2050,PMID: 22948829
Quero C, Lucas P, Renou M, Guerrero A. 1996. Behavioral responses ofSpodoptera littoralis males to sex
pheromone components and virgin females in wind tunnel. Journal of Chemical Ecology 22:1087–1102.
DOI: https://doi.org/10.1007/BF02027947,PMID: 24225930
Sakurai T, Nakagawa T, Mitsuno H, Mori H, Endo Y, Tanoue S, Yasukochi Y, Touhara K, Nishioka T. 2004.
Identification and functional characterization of a sex pheromone receptor in the silkmoth Bombyx mori. PNAS
101:16653–16658. DOI: https://doi.org/10.1073/pnas.0407596101,PMID: 15545611
Saveer AM, Kromann SH, Birgersson G, Bengtsson M, Lindblom T, Balkenius A, Hansson BS, Witzgall P, Becher
PG, Ignell R. 2012. Floral to green: mating switches moth olfactory coding and preference. Proceedings of the
Royal Society B: Biological Sciences 279:2314–2322. DOI: https://doi.org/10.1098/rspb.2011.2710
Smadja C, Butlin RK. 2009. On the scent of speciation: the chemosensory system and its role in premating
isolation. Heredity 102:77–97. DOI: https://doi.org/10.1038/hdy.2008.55,PMID: 18685572
Steinwender B, Thrimawithana AH, Crowhurst RN, Newcomb RD. 2015. Pheromone receptor evolution in the
cryptic leafroller species, Ctenopseustis obliquana and C. herana. Journal of Molecular Evolution 80:42–56.
DOI: https://doi.org/10.1007/s00239-014-9650-z,PMID: 25252791
Stork NE. 2018. How many species of insects and other terrestrial arthropods are there on earth? Annual Review
of Entomology 63:31–45. DOI: https://doi.org/10.1146/annurev-ento-020117-043348,PMID: 28938083
Tanaka K, Uda Y, Ono Y, Nakagawa T, Suwa M, Yamaoka R, Touhara K. 2009. Highly selective tuning of a
silkworm olfactory receptor to a key mulberry leaf volatile. Current Biology 19:881–890. DOI: https://doi.org/
10.1016/j.cub.2009.04.035,PMID: 19427209
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 16 of 17
Research article Evolutionary Biology Neuroscience

Turner DL, Weintraub H. 1994. Expression of achaete-scute homolog 3 in xenopus embryos converts ectodermal
cells to a neural fate. Genes & Development 8:1434–1447. DOI: https://doi.org/10.1101/gad.8.12.1434,
PMID: 7926743
Walker WB, Roy A, Anderson P, Schlyter F, Hansson BS, Larsson MC. 2019. Transcriptome analysis of gene
families involved in chemosensory function in Spodoptera littoralis (Lepidoptera: noctuidae). BMC Genomics
20:428. DOI: https://doi.org/10.1186/s12864-019-5815-x,PMID: 31138111
Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. 2009. Jalview version 2–a multiple sequence
alignment editor and analysis workbench. Bioinformatics 25:1189–1191. DOI: https://doi.org/10.1093/
bioinformatics/btp033,PMID: 19151095
Yang B, Ozaki K, Ishikawa Y, Matsuo T. 2015. Identification of candidate odorant receptors in asian corn borer
Ostrinia furnacalis. PLOS ONE 10:e0121261. DOI: https://doi.org/10.1371/journal.pone.0121261,PMID: 25
803580
Yuvaraj JK, Corcoran JA, Andersson MN, Newcomb RD, Anderbrant O, Lo
¨fstedt C. 2017. Characterization of
odorant receptors from a Non-ditrysian moth, Eriocrania semipurpurella sheds light on the origin of sex
pheromone receptors in lepidoptera. Molecular Biology and Evolution 34:2733–2746. DOI: https://doi.org/10.
1093/molbev/msx215,PMID: 29126322
Yuvaraj JK, Andersson MN, Corcoran JA, Anderbrant O, Lo
¨fstedt C. 2018. Functional characterization of
odorant receptors from Lampronia capitella suggests a non-ditrysian origin of the lepidopteran pheromone
receptor clade. Insect Biochemistry and Molecular Biology 100:39–47. DOI: https://doi.org/10.1016/j.ibmb.
2018.06.002,PMID: 29894821
Zhang S, Zhang Z, Wang H, Kong X. 2014. Antennal transcriptome analysis and comparison of olfactory genes in
two sympatric defoliators, Dendrolimus houi and Dendrolimus kikuchii (Lepidoptera: lasiocampidae). Insect
Biochemistry and Molecular Biology 52:69–81. DOI: https://doi.org/10.1016/j.ibmb.2014.06.006,PMID: 249983
98
Zhang DD, Wang HL, Schultze A, Froß H, Francke W, Krieger J, Lo
¨fstedt C. 2016. Receptor for detection of a
type II sex pheromone in the winter moth Operophtera brumata. Scientific Reports 6:18576. DOI: https://doi.
org/10.1038/srep18576,PMID: 26729427
Zhang SF, Zhang Z, Kong XB, Wang HB, Liu F. 2017. Dynamic changes in chemosensory gene expression during
the Dendrolimus punctatus Mating Process. Frontiers in Physiology 8:1127. DOI: https://doi.org/10.3389/fphys.
2017.01127,PMID: 29375398
Zhang D-D, Lo
¨fstedt C. 2015. Moth pheromone receptors: gene sequences, function, and evolution. Frontiers in
Ecology and Evolution 3:105. DOI: https://doi.org/10.3389/fevo.2015.00105
Bastin-He´ line et al. eLife 2019;8:e49826. DOI: https://doi.org/10.7554/eLife.49826 17 of 17
Research article Evolutionary Biology Neuroscience