ArticlePDF Available

Integrative taxonomy reveals first country record of Hyalinobatrachium mondolfii Señaris and Ayarzagüena 2001, and distribution range extensions for Cochranella nola Harvey 1996, and Rulyrana spiculata Duellman 1976 (Anura: Centrolenidae) in Peru

Authors:

Abstract and Figures

We used an integrative taxonomy approach to investigate the taxonomic identity of several populations of glassfrogs from Peru, which are notoriously challenging to identify due to their overall similarity in morphology and coloration. We relied on comparisons of morphology, bioacoustics, and partial fragments of 16S rRNA DNA sequences. We report for the first time the presence of Hyalinobatrachium mondolfii in Peru, being this the southernmost locality known for the species. Likewise, we update and extend the distribution ranges of Rulyrana spiculata and Cochranella nola in the Andes of Peru, provide a 16S sequence of a topotype of R. spiculata, and confirm its presence in Bolivia. For all three species, we increase the current knowledge on their geographic distribution and genetic and phenotypic variation.
Content may be subject to copyright.
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Accepted by S. Castroviejo-Fisher: 2 Oct. 2019; published: 4 Nov. 2019 541
Zootaxa 4691 (5): 541–560
https://www.mapress.com/j/zt/
Copyright © 2019 Magnolia Press Article
https://doi.org/10.11646/zootaxa.4691.5.7
http://zoobank.org/urn:lsid:zoobank.org:pub:42A57F4C-7F4D-45BB-B9C1-DA1E0A481907
Integrative taxonomy reveals first country record of Hyalinobatrachium
mondolfii Señaris and Ayarzagüena 2001, and distribution range extensions for
Cochranella nola Harvey 1996, and Rulyrana spiculata Duellman 1976
(Anura: Centrolenidae) in Peru
GERMÁN CHÁVEZ1,3, RENZO PRADEL1 & ALESSANDRO CATENAZZI1,2
1División de Herpetología, CORBIDI, Lima, Perú
2Department of Biological Sciences, Florida International University, Miami, FL, USA.
3Corresponding author. E-mail: vampflack@yahoo.com
Abstract
We used an integrative taxonomy approach to investigate the taxonomic identity of several populations of glassfrogs
from Peru, which are notoriously challenging to identify due to their overall similarity in morphology and coloration. We
relied on comparisons of morphology, bioacoustics, and partial fragments of 16S rRNA DNA sequences. We report for
the first time the presence of Hyalinobatrachium mondolfii in Peru, being this the southernmost locality known for the
species. Likewise, we update and extend the distribution ranges of Rulyrana spiculata and Cochranella nola in the Andes
of Peru, provide a 16S sequence of a topotype of R. spiculata, and confirm its presence in Bolivia. For all three species,
we increase the current knowledge on their geographic distribution and genetic and phenotypic variation.
Resumen
Utilizamos un enfoque de taxonomía integrativa para investigar la identidad taxonómica de varias poblaciones de ranas
de cristal de Perú, que son notóriamente difíciles de identificar debido a su similitud general en morfología y coloración.
Usamos comparaciones morfológicas, bioacústicas y de fragmentos parciales de secuencias de ADN del 16S rRNA.
Reportamos por primera vez la presencia de Hyalinobatrachium mondolfii en Perú, siendo esta la localidad más austral
conocida para la especie. Así mismo, actualizamos y extendemos la distribución de Rulyrana spiculata y Cochranella
nola en los Andes de Perú, reportamos la secuencia del 16S de un topotipo de R. spiculata y confirmamos su presencia
en Bolivia. Para las tres especies, incrementamos el actual conocimiento sobre su distribución geográfica y la variación
genética y fenotípica.
Key words: molecular analysis, bioacoustics, glassfrog, Andes, 16S rRNA, barcoding
Introduction
Some species of glassfrogs (Centrolenidae) are notoriously difficult to identify morphologically due to the overall
similarity in shapes and coloration (Castroviejo-Fisher et al. 2009, 2011a, b; Kok & Castroviejo-Fisher 2008). The
use of molecular techniques, field observations, photographs, recordings of advertisement calls, tadpole morphol-
ogy and other natural history information often are necessary to confirm identification of cryptic or previously
unreported species of glassfrogs (Cisneros-Heredia and Guayasamin 2014, Twomey et al. 2014, Rada et al. 2019).
Furthermore, the discipline of taxonomy increasingly incorporates contributions from a wide range of methodologi-
cal approaches that study evolutionary relationships among species. This integrative framework has been termed in-
tegrative taxonomy and is proving extremely helpful for the accelerating rates of species discovery and description
of amphibians common in tropical countries (Padial et al. 2009, 2010). Peru is no exception to the recent increase
in the rate of frog species discovery (Catenazzi et al. 2012, Catenazzi and von May 2014, Cisneros-Heredia and
CHÁVEZ ET AL.
542 · Zootaxa 4691 (5) © 2019 Magnolia Press
Guayasamin 2014, Twomey et al. 2014). This is also evident for glassfrogs (Twomey et al. 2014; Cisneros-Heredia
& Guayasamin 2014, Lujan et al. 2014), with several recent publications reporting new species, genetic and phe-
notypic variation, as well as range extensions. Our study of new collected material revealed relevant data regarding
species of Cochranella, Hyalinobatrachium and Rulyrana.
Among glassfrogs, Cochranella is widely distributed in the Andean and Amazonian regions, with nine species
currently recognized (Frost 2019). Four species are known to occur in Peru, but two of them lack DNA sequences
in support of their identification, C. resplendens Ruiz-Carranza and Lynch, 1991 and C. nola Harvey, 1996. Co-
chranella nola was described from Bolivia and has been reported from Madre de Dios (Lujan et al. 2014, Villacam-
pa et al. 2016), where identifications were made on the basis of the morphological description by Harvey (1996).
The genus Hyalinobatrachium is one of the most diverse glassfrog clades with 32 species (Frost 2019). Hya-
linobatrachium occurs from the western side of Central and South America along the Pacific coast to the eastern
side in the Amazon and Orinoco drainages. Hyalinobatrachium mondolfii Señaris and Ayarzagüena, 2001 has a
wide distribution, which includes localities in the Orinoco basin, such as its type locality in Venezuela (Señaris and
Ayarzagüena 2001), and localities in the Amazon basin of Bolivia (Castroviejo- Fisher et al. 2011a), Brazil (Avila-
Pires et al. 2010; Oliveira et al. 2015), and Colombia, French Guiana, Guyana, Suriname (Castroviejo-Fisher et al.
2011b; Fouquet et al. 2015). Despite the proximity of sites such as Leticia (Colombia) and Pando (Bolivia) to Peru,
this species has not been recorded in Peru. Señaris and Ayarzagüena (2001) described the advertisement call of type
specimens.
The genus Rulyrana includes six species (Frost 2019), distributed in the Amazonian foothills and montane An-
dean forests. Rulyrana spiculata Duellman, 1976 occurs in the eastern slopes of the Andes of central and southern
Peru and possibly Bolivia. Its occurrence in Bolivia was suggested on the basis of similarity in DNA sequences with
an individual of R. cf. spiculata from central Peru (Guayasamin et al. 2008). However, the absence of sequences
from the type locality of R. spiculata, Kosñipata Valley near Manu National Park, prevented confirmation of species
identity. The advertisement call of topotypic R. spiculata was described in Catenazzi et al. (2009).
Our goal is to contribute to survey efforts, which include barcode DNA sequences, photographs of live speci-
mens, call recordings, and field observations, to support range extensions and species identification for Cochranella
nola, Hyalinobatrachium mondolfii, and Rulyrana spiculata in Peru. We embrace the integrative taxonomy frame-
work and resort to previous studies, and our newly acquired data to support our conclusions. Specifically, we report
the first record of Hyalinobatrachium mondolfii in Peru, extend the distribution range of Rulyrana spiculata in
Peru and confirm its presence in Bolivia, and add a new locality and confirm the presence of Cochranella nola in
southern Peru.
Methods
We collected glassfrogs during field surveys at several localities on the eastern slopes of the Andes and Amazonian
lowland rainforest in Peru. For all three species, we took photographs of live specimens, noted GPS coordinates
(WGS84), recorded field observations, collected specimens and tissue samples, and sequenced a fragment of the mi-
tochondrial gene 16S rRNA. We deposited all specimens at the Herpetology Division of CORBIDI, Lima, Peru. We
report all continuous variables as average ± standard deviation followed by minimum–maximum values in paren-
theses. Fieldwork was carried out under the authorizations Nº 292–2014-MINAGRI-DGFFS-DGEFFS and Nº 003-
2014-SERNANP-RCS-JEF provided by Peruvian Agriculture Ministery and Environment Ministery respectively.
We follow the taxonomy of Centolenid frogs proposed by Guayasamin et al. (2009), likewise for terminology
and definitions of morphological characters we follow Señaris and Ayarzagüena (2005), Guayasamin et al. (2009),
and Castroviejo-Fisher et al. (2011b). Measurements were taken with a digital caliper to the nearest 0.1 mm. Ab-
breviations for measurements are as follow: SVL=Snout Vent Length, HL=Head Length, HW=Head Width, IOD=
Interorbital Distance, EL= Eye length (Horizontal diameter of the eye), EW= Upper Eyelid Width, ES= Eye to
Snout tip distance, FIII= Width of the terminal disc of the third finger, FEL= Femur Length, TL= Tibia Length, FL=
Foot Length.
We recorded advertisement calls using a Marantz PMD661MK2 digital recorder and a Sennheiser ME64 uni-
directional microphone. We used the software Raven Pro 1.4 (Cornell Laboratory of Ornithology, Ithaca, NY) to
analyze call variables and to generate audiospectrograms and oscillograms. We used oscillograms to measure note
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 543
duration and rate, interval between calls taking one note per call, and evaluate the presence of amplitude modula-
tion. We used spectrograms to quantify dominant frequency and evaluate the presence of frequency modulation and
harmonics.
For molecular analyses, we obtained sequences of a fragment of 16S rRNA, the most widely used DNA bar-
code for amphibians (Vences et al. 2005a,b) and the best represented marker for glassfrogs in GenBank (Appendix
I). We extracted DNA from liver tissues following protocol procedure of a commercial DNA extraction kit (Model
Number IB47222, IBI Scientific, Peosta, USA). For amplification, we used the primers 16Sar (forward) (5’-3’
sequence: CGCCTGTTTATCAAAAACAT) and 16Sbr (reverse) (5’-3’ sequence: CCGGTCTGAACTCAGAT-
CACGT) (Palumbi et al. 2002). We employed the following thermocycling conditions during the polymerase chain
reaction (PCR), with a Veriti thermal cycler (Applied Biosystems): 1 cycle of 96°C/3 min; 35 cycles of 95°C/30 s,
55°C/45 s, 72°C/1.5 min; 1 cycle 72°C/7 min. We purified the PCR products with Exosap-IT (Affymetrix, Santa
Clara, CA) and shipped the final samples to MCLAB (San Francisco, CA) for paired-end sequencing. We assem-
bled both reads in Geneious v. 11.1.4 by using the De Novo Assembly function (Biomatters, http://www.geneious.
com/). We compared the newly obtained sequences with those deposited in GenBank using the BLAST procedure
with default parameters in Geneious v. 11.1.4. We obtained sequences from one specimen of Cochranella from
Chontachaca (CORBIDI 19156), two specimens of Hyalinobatrachium (CORBIDI 18221–22) collected in LPAC,
six specimens of Rulyrana (CORBIDI 13906, 14409-10, 15431, 16572) from several localities in Huallaga river
basin, Huanuco department, and one specimen of Rulyrana spiculata from the type locality in the Kosñipata Valley
(CORBIDI 19185).
Results and discussion
Cochranella nola. On 26 January 2014, we collected three specimens of Cochranella (CORBIDI 19156–58) (Fig.
1) at Chontachaca (13°01’22.72”S, 71°29’28.89”W; 985 m a.s.l.), Paucartambo Province, Cusco Department, Peru.
The three specimens of Cochranella (Fig. 2) have an uniform green dorsum finely spiculated, no melanophores on
fingers, visceral peritoneum clear, parietal peritoneum white, dark green bones, and pale gray iris with fine reticula-
tions, which resembles Harvey’s (1996) description of the types of C. nola, as well as specimens identified as C.
nola from Madre de Dios (Lujan et al. 2014; Villacampa et al. 2016). Comparisons with 16S sequences available
in Genbank indicate that the most similar sequences—genetic distances = 1.4–1.5 % (Table 1, Appendix 1)—to our
two specimens correspond to two specimens of C. nola from Bolivia published by Guayasamin et al. (2009). Based
on these results we consider our specimens as part of C. nola.
We found the three specimens of C. nola near Manu National Park during a rainy night in a disturbed sub-
montane forest at the foothills of the Andes. We observed males perched on green leaves of vegetation alongside a
stream at night between 19:00–22:00 hrs. Cochranella nola was recorded in sympatry with the glassfrogs Hyalino-
batrachium bergeri and Rulyrana spiculata, the toad Rhinella margaritifera, and the treefrogs Boana gladiator and
Osteocephalus mimeticus.
Our new record confirms the presence of C. nola in the upper Madre de Dios River (Villacampa et al. 2016), in
the vicinity of Manu National Park. Although there are no records from within the protected area, given the occur-
rence in two regions adjacent to its limit, it is very likely the species occurs within Manu NP as well. Our record is
also the first for Department Cusco in Peru; the species is now known to occur in three Departments in southern Peru
(Cusco, Madre de Dios, and Puno). The agreement between molecular and morphological data suggest that diagnos-
tic external characters are conserved through the distribution range of C. nola in the Andean foothills from central
Bolivia to southern Peru. Therefore, researchers can use external morphological characters to identify C. nola in the
field, facilitating further work aimed at assessing the distribution and conservation status of populations of C. nola
in Peru and Bolivia. The species is currently listed as Near Threatened in the IUCN Red List (Cortez et al. 2004).
Hyalinobatrachium mondolfii. On 20 January 2017, we collected three male specimens of Hyalinobatrachium
(CORBIDI 18211, 18221–22) at Las Piedras Amazon Center (LPAC) (12°4’12”S, 69°29’37.2”W; 207 m a.s.l),
Tambopata Province, Madre de Dios department, Peru (Fig. 1). We recorded the advertisement call of one of the
males (CORBIDI 18211, n = 15 calls, Tair = 24 °C) (Fig. 4). The external appearence and coloration of specimens of
Hyalinobatrachium collected at LPAC, Madre de Dios (Table 2, Fig. 3) matched the descriptions provided by previ-
ous authors (Señaris and Ayarzagüena 2001; Castroviejo-Fisher et al. 2011a,b) for Hyalinobatrachium mondolfii.
CHÁVEZ ET AL.
544 · Zootaxa 4691 (5) © 2019 Magnolia Press
However, we also observed some differences. Our specimens have truncate snout from dorsal and lateral view (vs.
rounded in other populations, Castroviejo-Fisher et al. 2011b) and approximately 1/3 to 1/2 of the hepatic perito-
neum unpigmented (Fig. 3B,D; vs. completely white peritoneum). Additionally, we report small inter population
differences in morphometric variables of H. mondolfii (Table 1).
FIGURE 1. Map of northern South America indicating known localities of Cochranella nola (blue symbols), Hyalinobat-
rachium mondolfii (yellow symbols), and Rulyrana spiculata (red symbols). Type localities are noted with a square and new
records with a star.
Despite the considerable variation in meristic and coloration traits reported above, our specimens share a num-
ber of diagnostic traits with Hyalinobatrachium mondolfii that are sufficient to differentiate them from specimens
of similar species such as H. kawense Castroviejo-Fisher, Vilà, Ayarzagüena, Blanc, and Ernst 2011 (which has
white fingers and toes, vs. yellow in H. mondolfii) and H. yaku Guayasamin, Cisneros-Heredia, Maynard, Lynch,
Culebras, and Hamilton 2017 (which has dark green spots on dorsum and a completely exposed heart, vs. no dark
green spots on anterior half of dorsum, and a heart covered by white pericardium in H. mondolfii). However, the
morphologically similar H. carlesvilai Castroviejo-Fisher, Padial, Chaparro, Aguayo and de la Riva 2009, which
inhabits the Andean foothills of Bolivia and Peru, and H. munozorum (Lynch and Duellman, 1973) from the Ama-
zonian lowlands of Ecuador, broadly overlap with the character variation of H. mondolfii and our specimens.
Genetic and bioacoustic data support our identification of specimens from Madre de Dios as Hyalinobatrachium
mondolfii (Table 3, Fig. 4, Appendix 2). The 16S sequence of CORBIDI 18221 collected at LPAC is identical (and
CORBIDI 18222 is nearly identical) to the 16S sequence (Genbank accession code JF266569) of voucher CBF 6453
identified as H. mondolfii by Castroviejo-Fisher et al. (2011a). Other specimens identified as H. mondolfii in Gen-
Bank (including those from Delta Amacuro, Venezuela, where the type locality is located) also exhibit low genetic
distances with our specimens (≤ 1.75 %). Meanwhile, the genetic distances with type specimens of H. carlesvilai is
≥ 3.8 %. The genetic distances of our specimens with specimens of H. munozorum are modest (2.1–3.9 %) but still
larger than among specimens of H. mondolfii. Furthermore, the two species are reciprocally monophyletic (Castro-
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 545
TABLE 1. Uncorrected genetic p-distances estimated from the 16S rRNA mitochondrial fragment between Cochranella nola from Chontachaca, Peru (in boldface) and a subset
of related taxa of the genus Cochranella (see Appendix 1 for full list of specimens considered).
Cochranella nola
(MN509214)
Cochranella euknemos
(EU663008)
Cochranella mache
(EU663013)
Cochranella nola
(EU663015)
Cochranella nola
(EU663016)
Cochranella sp.
(EU663021)
Cochranella euknemos
(FJ784377)
Cochranella euknemos
(FJ784396)
Cochranella granulosa
(FJ784455)
Cochranella euknemos
(FJ784458)
Espadarana prosoble-
pon (JX564857)
Centrolene durrellorum
(KF534356)
Cochranella nola (MN509214)
Cochranella euknemos (EU663008) 4.25
Cochranella mache (EU663013) 4.30 2.77
Cochranella nola (EU663015) 1.45 4.81 4.90
Cochranella nola (EU663016) 1.45 5.18 4.89 0.36
Cochranella sp. (EU663021) 1.82 5.55 5.26 2.54 2.54
Cochranella euknemos (FJ784377) 3.90 0.19 2.53 4.94 4.94 5.31
Cochranella euknemos (FJ784396) 4.61 2.24 2.89 5.31 5.30 6.04 1.95
Cochranella granulosa (FJ784455) 4.79 3.73 3.80 4.76 5.12 5.31 3.90 4.43
Cochranella euknemos (FJ784458) 4.08 0.00 2.71 4.76 5.12 5.50 0.18 2.13 3.72
Espadarana prosoblepon (JX564857) 4.82 6.64 5.72 5.25 5.24 5.44 6.19 5.66 6.02 6.37
Centrolene durrellorum (KF534356) 4.77 5.92 5.32 5.14 5.14 6.06 5.74 5.19 5.93 5.93 3.66
Cochranella erminea (KF534360) 4.69 4.05 3.42 4.88 4.87 5.61 3.82 4.36 4.00 4.00 5.41 5.67
Cochranella sp. (KF534362) 4.86 4.42 3.93 4.88 4.87 5.97 4.06 4.59 4.06 4.24 6.07 6.58
Cochranella guayasamini (KM068259) 4.70 4.06 3.58 4.89 4.88 5.98 3.89 4.25 3.72 4.07 6.25 6.04
Cochranella guayasamini (KM068265) 4.77 4.10 3.67 4.95 4.95 6.06 3.85 4.22 3.67 4.04 6.41 6.10
Espadarana andina (KP149354) 4.91 6.90 6.15 5.31 5.30 5.68 6.38 6.38 5.67 6.56 3.33 4.44
Cochranella euknemos (KR863135) 4.57 1.87 2.89 5.31 5.30 6.04 1.60 0.36 4.43 1.77 5.97 5.56
Cochranella euknemos (KR863136) 4.57 1.87 2.89 5.31 5.30 6.04 1.60 0.36 4.43 1.77 5.97 5.56
Cochranella euknemos (KR863137) 4.57 1.87 2.89 5.31 5.30 6.04 1.60 0.36 4.43 1.77 5.97 5.56
Cochranella euknemos (KR863138) 4.57 1.87 2.89 5.31 5.30 6.04 1.60 0.71 4.43 1.77 5.97 5.56
Cochranella euknemos (KR863139) 4.57 1.87 2.89 5.31 5.30 6.04 1.60 0.36 4.43 1.77 5.97 5.56
Cochranella euknemos (KR863140) 4.57 2.24 2.89 5.31 5.30 6.04 1.95 0.00 4.43 2.13 5.61 5.19
Cochranella euknemos (KR863141) 4.57 2.24 2.89 5.31 5.30 6.04 1.95 0.00 4.43 2.13 5.61 5.19
......continued on the next page
CHÁVEZ ET AL.
546 · Zootaxa 4691 (5) © 2019 Magnolia Press
TABLE 1. (Continued)
Cochranella erminea
(KF534360)
Cochranella sp.
(KF534362)
Cochranella guayasamini
(KM068259)
Cochranella guayasamini
(KM068265)
Espadarana andina
(KP149354)
Cochranella euknemos
(KR863135)
Cochranella euknemos
(KR863136)
Cochranella euknemos
(KR863137)
Cochranella euknemos
(KR863138)
Cochranella euknemos
(KR863139)
Cochranella euknemos
(KR863140)
Cochranella euknemos
(KR863141)
Cochranella nola (MN509214)
Cochranella euknemos (EU663008)
Cochranella mache (EU663013)
Cochranella nola (EU663015)
Cochranella nola (EU663016)
Cochranella sp. (EU663021)
Cochranella euknemos (FJ784377)
Cochranella euknemos (FJ784396)
Cochranella granulosa (FJ784455)
Cochranella euknemos (FJ784458)
Espadarana prosoblepon (JX564857)
Centrolene durrellorum (KF534356)
Cochranella erminea (KF534360)
Cochranella sp. (KF534362) 3.05
Cochranella guayasamini (KM068259) 3.96 2.08
Cochranella guayasamini (KM068265) 4.02 2.02 0.00
Espadarana andina (KP149354) 6.36 6.83 6.49 6.61
Cochranella euknemos (KR863135) 4.36 4.55 4.21 4.22 6.33
Cochranella euknemos (KR863136) 4.36 4.55 4.21 4.22 6.33 0.00
Cochranella euknemos (KR863137) 4.36 4.55 4.21 4.22 6.33 0.00 0.00
Cochranella euknemos (KR863138) 4.36 4.20 3.86 3.85 6.33 0.35 0.35 0.35
Cochranella euknemos (KR863139) 4.36 4.55 4.21 4.22 6.33 0.00 0.00 0.00 0.35
Cochranella euknemos (KR863140) 4.36 4.55 4.21 4.22 6.33 0.35 0.35 0.35 0.70 0.35
Cochranella euknemos (KR863141) 4.36 4.55 4.21 4.22 6.33 0.35 0.35 0.35 0.70 0.35 0.00
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 547
viejo-Fisher et al. 2011a). Our analysis of the advertisement call of male CORBIDI 18211 at LPAC confirms the
match with the known variation of the call of H. mondolfii. The advertisement call of CORBIDI 18211 was pulsed,
composed of a single note lacking frequency modulation, with highest amplitude at the beginning of the call (Fig.
4). The dominant frequency of all calls was 4593 Hz, with first harmonic at 9186 Hz; call duration averaged 345 ms
± 15 ms (309–512 ms), and intervals between calls 4.7 s ± 1.5 s (0.5–13.2 s). Although the dominant frequency is
slightly lower than reported previously (Señaris and Ayarzagüena 2001, Castroviejo-Fisher et al. 2011a,b; Venâncio
et al. 2014), the spectrogram is very similar to calls recorded in Acre, Brazil, Pando, Bolivia, and at the type locality
in Delta Amacuro, Venezuela. On the other hand, the call is clearly different from those of H. kawense and H. car-
lesvilai because these species have a dual structured call (pulsed+tonal) instead of a single note as in H. mondolfii.
Additionally the call in H. kawense and H. carlesvilai reaches the highest amplitude at the middle and at the second
third respectively, while the amplitude is highest at the beginning of the call in H. mondolfii. Unfortunately there
are no call records from the type locality of H. munozorum, and calls from a Bolivian population of H. munozorum
(consisting of five tonal notes) could not be assigned with certainty to collected vouchers (Castroviejo-Fisher et al.
2011a). Considering the new variation in head shape and hepatic peritoneum reported herein, as well as the results
of our genetic and acoustic data, we suggest that future records related with H. carlesvilai, H. kawense, H. mondolfii,
and H. munozorum should be supported by both genetic and acoustic data. For example, H. carlesvilai has been
reported from Mato Grosso state, Brazil (Cisneros-Heredia et al. 2010) on the basis of morphological comparisons.
Description of head shape and eyes coloration of H. carlesvilai from Mato Grosso are similar to those we observed
for H. mondolfii in Madre de Dios (i.e., having a truncate snout from lateral view). Although Cisneros-Heredia et
al. (2010) did not include ventral images of specimens of H. carlesvilai from Mato Grosso, they reported that iri-
dophores are absent on the ventral parietal peritoneum but covering all parts of the visceral peritonea. On the basis
of the new variation in snout shape reported in our specimens, the relative proximity with records of H. mondolfii
(Venâncio et al. 2014, this work), and that all other records of H. carlesvilai are restricted to the hills of the Andes,
while H. mondolfii is known from the Amazonian lowlands, we suggest that the presence of H. carlesvilai in Brazil
should be re-evaluated through acoustic and molecular analysis.
TABLE 2. Measurements of Hyalinobatrachium mondolfii specimens from Peru (deposited at CORBIDI) compared with
the variation reported by Señaris and Ayarzagüena (2001)* and Castroviejo-Fisher et al. (2011b)* for this species. n=
number of individuals.
Character H. mondolfii* (n = 13) H. mondolfii CORBIDI
18211
H. mondolfii CORBIDI
18221
H. mondolfii CORBIDI
18222
SVL 19.9–22.8 21.9 22.9 22.3
HL 6.2–8.0 6.8 7.0 7.0
HW 7.5–9.0 8.3 9.2 8.8
IOD 2.0–2.6 2.5 2.7 2.7
EL 2.4–3.1 2.2 2.4 2.2
EW 1.5–2.0 1.4 1.5 1.6
ES 2.3–3.5 2.9 3.3 3.2
FIII 0.7–1.3 0.7 1.0 0.9
FEL 10.2–12.3 12.1 12.8 12.6
TL 9.6–12.8 11.5 12.4 12.3
FL 7.8–9.8 8.9 10.1 10.2
Our specimens were found in primary tropical floodplain forest (Fig. 5). We heard calling males during only
one night out of our 10-day survey (survey effort 280 hours-person). Calling males were perched on the underside
of leaves at night between 22:00–02:00 hrs at 25–26°C. We observed several of these males under leaves of a fig
tree (Ficus sp.), at a height of 3 m above ground, at the side of a temporary pond. Two of the collected calling males
were nearby egg masses, each of which contained 23–24 eggs (Fig. 5). Hylinobatrachium mondolfii was recorded in
sympatry with the treefrogs (Hylidae) Boana aff. alfaroi and Boana punctata. We did not observe other centrolenid
frogs at this site, but we found males of Teratohyla midas at a nearby floodplain site (~1 km away).
The site where we observed and recorded Hylinobatrachium mondolfii was unexpected for a centrolenid be-
cause the temporary pond had a foul smell indicative of stagnant water with decomposing matter and low dissolved
CHÁVEZ ET AL.
548 · Zootaxa 4691 (5) © 2019 Magnolia Press
oxygen, in contrast with lotic and highly oxygenated habitats typical for glassfrogs. As previously noted (Castro-
viejo-Fisher et al. 2011b), the pink coloration of tadpoles could indicate an adaptation to life in such lentic habitats
(Figure 5), because the coloration is probably due to the high concentrations of hemoglobin in blood, which should
facilitate oxygen uptake and transport.
FIGURE 2. Dorsolateral and ventral views in life of adult males of Cochranella nola from Contachaca, near Manu National
Park, Cusco, Peru. A, B) CORBIDI 19157; C, D) CORBIDI 19158.
Our record from the Las Piedras River in the Madre de Dios basin is the first report of Hyalinobatrachium mon-
dolfii for Peru (Fig. 1), and extends the species’ known distribution range ~90 km by airline SW of the closest local-
ity in Pando, Bolivia (Castroviejo-Fisher et al. 2011a). Our new site is ~2,400 km by airline from the type locality,
the farthest and westernmost of any other known locality (Fig. 1). H. mondolfii had previously been reported from
Pará (Brazil), Guyana, southern Surinam, Caño Acoima and Caño Jotajana (Delta Amacuro, Venezuela) and along
the Río Guarapiche (Monagas, Venezuela), and the Amazonian regions of Leticia (Colombia), and Acre (Brazil).
Thus, the presence of this species in Amazonian Peru was very likely, and our report fills this gap in the known dis-
tribution range of the species. Future surveys might contribute to fill other gaps in the seemingly disjoint distribution
range of H. mondolfii throughout the Orinoco and Amazon basins.
According to the IUCN Red List, the distribution of Hyalinobatrachium mondolfii (classified as Least Concern)
is restricted to the Orinoco river Delta. As previously reported, and as confirmed by our work, this geographic range
is incorrect and should be extended to include known localities in the Guyana shield, and the Amazon rainforest in
Colombia, Brazil, Bolivia, and Peru (Avila-Pires et al. 2010, Castroviejo-Fisher et al. 2011a, 2011b; Oliveira et al
2015, this paper). Although our morphological observations, genetic data and advertisement calls of Peruvian speci-
mens show close similarity with the type series and specimens identified as H. mondolfii, we suggest future research
should investigate genetic diversity across the wide distribution range of the species. For the time being, and for
purposes such as assessing the conservation status for the IUCN Red List, we recommend all known populations in
both the Amazon and Orinoco basins be considered as H. mondolfii sensu lato.
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 549
TABLE 3. Uncorrected pairwise genetic p-distances estimated from the 16S mtDNA fragment between Hyalinobatrachium mondolfii from Las Piedras, Peru (in bold face) and
a subset of related taxa (see Appendix 2 for full list of specimens considered).
H. carlesvilai
(EU663030)
H. carlesvilai
(GQ142049)
H. carlesvilai
(GQ142050)
H. carlesvilai
(GQ142051)
H. carlesvilai
(GQ142052)
H. carlesvilai
(GQ142053)
H. carlesvilai
(GQ142054)
H. carlesvilai
(GQ142055)
H. carlesvilai
(GQ142056)
H. carlesvilai
(GQ142057)
H. carlesvilai
(KM068260)
H. carlesvilai
(KM068269)
H. carlesvilai
(KM068270)
H. carlesvilai (EU663030)
H. carlesvilai (GQ142049) 0.36
H. carlesvilai (GQ142050) 0.36 0.00
H. carlesvilai (GQ142051) 0.73 0.72 0.72
H. carlesvilai (GQ142052) 0.00 0.36 0.36 0.73
H. carlesvilai (GQ142053) 0.00 0.36 0.36 0.73 0.00
H. carlesvilai (GQ142054) 0.00 0.37 0.37 0.73 0.00 0.00
H. carlesvilai (GQ142055) 0.36 0.36 0.36 0.36 0.36 0.36 0.37
H. carlesvilai (GQ142056) 0.73 0.73 0.73 1.10 0.73 0.73 0.73 0.73
H. carlesvilai (GQ142057) 0.00 0.36 0.36 0.72 0.00 0.00 0.00 0.36 0.73
H. carlesvilai (KM068260) 0.73 0.72 0.72 1.08 0.73 0.73 0.73 0.72 0.00 0.70
H. carlesvilai (KM068269) 1.10 1.10 1.10 1.46 1.10 1.10 1.11 1.09 0.37 1.06 0.35
H. carlesvilai (KM068270) 0.73 0.73 0.73 1.10 0.73 0.73 0.74 0.72 0.00 0.70 0.00 0.35
H. kawense (EU663029) 6.40 4.92 4.92 5.10 4.55 4.55 4.56 4.74 4.38 4.55 4.37 4.79 4.42
H. kawense (JN870868) 6.34 4.92 4.92 5.10 4.55 4.55 4.56 4.74 4.38 4.55 4.37 4.79 4.42
H. kawense (JN870869) 6.01 5.00 5.00 5.19 4.61 4.61 4.61 4.81 4.42 4.61 4.42 4.86 4.47
H. mondolfii (MH766899) 4.71 4.69 4.69 4.51 4.72 4.71 4.75 4.65 4.03 4.53 3.84 3.88 3.88
H. mondolfii (MH766900) 5.06 5.36 5.36 5.17 5.07 5.06 5.11 5.31 4.39 5.30 4.62 4.67 4.67
H. mondolfii (EU663050) 5.84 4.14 4.14 3.96 4.17 4.16 4.20 4.14 3.47 4.14 3.42 3.46 3.46
H. mondolfii (GQ142046) 5.84 4.14 4.14 3.96 4.17 4.16 4.20 4.14 3.47 4.14 3.42 3.46 3.46
H. mondolfii (JF266569) 5.63 4.71 4.71 4.52 4.72 4.71 4.75 4.70 4.03 4.70 3.99 4.03 4.03
H. mondolfii (JN870870) 5.84 4.14 4.14 3.96 4.17 4.16 4.20 4.14 3.47 4.14 3.42 3.46 3.46
H. muiraquitan (KY310570) 4.20 4.57 4.57 4.57 4.21 4.20 4.24 4.19 4.05 4.19 4.00 4.38 4.00
H. muiraquitan (KY310571) 4.58 4.95 4.95 4.95 4.59 4.58 4.62 4.57 4.43 4.57 4.38 4.76 4.38
H. munozorum (EU663034) 5.72 4.14 4.14 4.14 4.17 4.16 4.20 4.11 3.47 4.11 3.41 3.80 3.44
H. munozorum (JF266570) 5.24 4.51 4.51 4.86 4.53 4.52 4.56 4.50 3.84 4.50 3.78 4.19 3.83
......continued on the next page
CHÁVEZ ET AL.
550 · Zootaxa 4691 (5) © 2019 Magnolia Press
TABLE 3. (Continued)
H. kawense
(EU663029)
H. kawense
(JN870868)
H. kawense
(JN870869)
H. mondolfii
(MH766899)
H. mondolfii
(MH766900)
H. mondolfii
(EU663050)
H. mondolfii
(GQ142046)
H. mondolfii
(JF266569)
H. mondolfii
(JN870870)
H. muiraquitan
(KY310570)
H. muiraquitan
(KY310571)
H. munozorum
(EU663034)
H. munozorum
(JF266570)
H. carlesvilai (EU663030)
H. carlesvilai (GQ142049)
H. carlesvilai (GQ142050)
H. carlesvilai (GQ142051)
H. carlesvilai (GQ142052)
H. carlesvilai (GQ142053)
H. carlesvilai (GQ142054)
H. carlesvilai (GQ142055)
H. carlesvilai (GQ142056)
H. carlesvilai (GQ142057)
H. carlesvilai (KM068260)
H. carlesvilai (KM068269)
H. carlesvilai (KM068270)
H. kawense (EU663029)
H. kawense (JN870868) 0.00
H. kawense (JN870869) 0.00 0.00
H. mondolfii (MH766899) 5.65 5.65 5.58
H. mondolfii (MH766900) 6.00 6.00 5.77 0.78
H. mondolfii (EU663050) 6.64 6.58 6.41 1.08 1.75
H. mondolfii (GQ142046) 6.64 6.58 6.41 1.08 1.75 0.00
H. mondolfii (JF266569) 6.93 6.93 6.93 0.00 0.50 1.53 1.53
H. mondolfii (JN870870) 6.64 6.58 6.41 1.08 1.75 0.00 0.00 1.53
H. muiraquitan (KY310570) 5.96 5.96 6.11 5.33 5.47 5.32 5.32 5.33 5.32
H. muiraquitan (KY310571) 6.35 6.35 6.52 5.71 5.85 5.70 5.70 5.71 5.70 0.38
H. munozorum (EU663034) 6.29 6.35 6.28 2.15 2.82 3.09 3.09 3.19 3.09 4.76 5.14
H. munozorum (JF266570) 6.28 6.28 6.26 3.24 3.91 3.56 3.56 3.58 3.56 5.32 5.70 2.42
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 551
FIGURE 3. Dorsolateral and ventral views in life of adult males of Hyalinobatrachium mondolfii from Las Piedras Amazon
Center (LPAC), Madre de Dios, Peru. A, B) CORBIDI 18221; C, D) CORBIDI 18222.
Rulyrana spiculata. On 28 November 2013, we collected a specimen of Rulyrana spiculata (CORBIDI 13906)
at Campamento Hospital, in El Sira Community Reserve (09°28’43.24”S, 74°46’41.36”W; 791 m a.s.l), Puerto Inca
Province, Huanuco Department, Peru. On 21 March 2014 we collected six more specimens (CORBIDI 14406–11)
(Figure 5A–F) at the same locality. On 6 November 2014, we collected a specimen of Rulyrana (CORBIDI 15431) at
3 de Mayo Native Community, in Tingo Maria National Park (09°25’13.06”S, 75°59’33.36”W; 948 m a.s.l), Leon-
cio Prado Province, Huanuco Department, Peru, and on 20 November 2015 two more specimens (CORBIDI 16518,
16572) were collected by Andy Barboza near to Agua Nueva Local Community (09°43’1.39”S, 75°48’58.77”W;
1186 m a.s.l), Huanuco Province, Huanuco Department, Peru.
The coloration patterns, overall appearance, and measurements (Table 4) of the specimens we collected from
El Sira, Tingo Maria National Park, and other locations in the Huanuco Department (Fig. 1) resembled those of
the type series of Rulyrana spiculata from the Kosñipata Valley of Cusco Department and of specimens that we
observed and collected at the type locality on multiple occasions (Catenazzi et al. 2011, 2013). The main source of
variation we observed was the distinctly wider dorsal color pattern range in specimens from Huanuco varying from
pale green (CORBIDI 14406, Figure 6A-B) to greenish brown (CORBIDI 14409, Figure 6C-D), in contrast to the
green or dark green coloration of type and topotype specimens (Duellman 1976; Catenazzi et al. 2011, 2013), as
well as Bolivian material (Harvey and Noonan 2005). A trait not included in the original description of R. spicu-
lata, but later reported for specimens from La Paz Department, Bolivia identified as Rulyrana spiculata (Harvey &
Noonan 2005), is the presence of a pair of enlarged round glandular tubercles below the venter. Our examination
of specimens from El Sira Community Reserve (CORBIDI 14406, 14409, Fig. 6) and of CORBIDI 19185 from the
type locality (Fig. 6 E, F) confirms the presence of these tubercles. Additionally, specimens from El Sira Community
Reserve seem to have longer heads and larger eyes (Table 4), but the small sample size prevents us from performing
statistical comparisons. Despite these variations, diagnostic characters of the species do not overlap with those of
other species of the genus, ensuring field identifications through morphological traits. However, we still compared
our morphological identifications with those provided by genetic analyses.
CHÁVEZ ET AL.
552 · Zootaxa 4691 (5) © 2019 Magnolia Press
TABLE 4. Measurements and proportions (in percentage) of specimens of Rulyrana spiculata from Peru and Bolivia.
Our newly reported specimens correspond to El Sira Community Reserve. NA = Data not available; n= number of
individuals.
Character Type series (n=2) Bolivian males (n=2) E1 Sira males (n=7)
SVL 21.4‒21.5 (21.4 ± 0.0) 22.6‒23.1 (22.8 ± 0.3) 19.8‒22.2 (20.9 ± 0.8)
HL 6.8‒7.2 (7.0 ± 0.2) 7.2–7.4 (7.3 ± 0.1) 6.6‒7.8 (7.2 ± 0.4)
HW 7.8‒8.1 (7.9 ± 0.2) 8.4 7.1‒8.2 (7.6 ± 0.4)
IOD NA NA 2.2‒2.8 (2.6 ± 0.2)
EL NA NA 2.7‒2.9 (2.8 ± 0.0)
EW NA NA 2.0‒2.1 (2.0 ± 0.0)
ES NA NA 2.4‒2.5 (2.5 ± 0.0)
FIII NA NA 1.0‒1.1 (1.1 ± 0.0)
FEL NA NA 11.1‒12.5 (11.8 ± 0.5)
TL 12.3‒12.4 (12.3 ± 0.0) 12.7‒13.5 (13.1 ± 0.5) 11.4‒12.7 (12.4 ± 0.8)
FL 9.8‒9.9 (9.8 ± 0.0) 11.1‒13.1 (12.1 ± 1.4) 8.1‒10.0 (9.5 ± 0.6)
HL/HW 86.3‒88.0 (87.1 ± 1.2) 86.2‒87.8 (87.0 ± 1.1) 92.5‒96.5 (94.9 ± 1.0)
HL/SVL 32.0‒33.6 (32.8 ± 1.1) 32.3‒32.4 (32.3 ± 0.0) 33.3‒36.1 (34.5 ± 1.0)
EL/FIII 196.1‒229.9 (213 ± 23.9) 159.2‒167.0 (163.1 ± 5.5) 238.0‒268.9 (262.0 ± 1.5)
EW/IOD 55.6‒58.8 (57.2 ± 2.2) 58.9‒76.3 (67.6 ± 12.3) 73.2‒90.9 (79.9 ± 7.0)
TL/SVL 57.70 56.6‒58.5 (57.5 ± 1.3) 57.6‒62.1 (59.5 ± 1.6)
FL/TL 79.90 87.5‒97.1 (92.3 ± 6.7) 71.5‒79.4 (76.1 ± 3.0)
FIGURE 4. Oscillogram (top) and spectrogram (bottom) of the advertisement call (n = 2; Tair = 24ºC) of a male of Hyalinobat-
rachium mondolfii (CORBIDI 18211) from Las Piedras Amazon Center (LPAC), Madre de Dios, Peru.
We obtained DNA sequences from CORBIDI 13906, 14409, 144010, 15431 and 16572 from Huanuco and from
a male (CORBIDI 19185) from the type locality. The uncorrected genetic distances for 16S between the topotype
individual and specimens from Huanuco support our identifications (Table 5). All specimens we sequenced from El
Sira (range 0.2–1.29 %), Tingo Maria National Park (1.29%), and the Agua Nueva Community (1.29%) were simi-
lar to the sequence we obtained from CORBIDI 19185. Furthermore, we confirmed the identification of MHNSM
24867 from Vista Alegre, Provincia Satipo, in the Junin Department as R. spiculata (Guayasamin et al. 2008), albeit
the sequence available (EU663022) seems to be of low quality due to the presence of indels not seen in any other
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 553
sequenced specimen of Rulyrana. We can also confirm that R. spiculata occurs in Bolivia because the 16S sequence
of specimen CBG 806 from Boquerón, La Paz Department closely matches the 16S sequence of CORBIDI 19185
from the type locality (only three nucleotide substitutions within a 550 bp sequence).
We found Rulyrana spiculata in El Sira Community Reserve (CORBIDI 13906, 14406–11) at night along
streams in the foothill primary forest. We found several males calling between 19:00–21:00 hours from leaves of
riparian vegetation at the end of the wet season. We did not find egg masses or females. The fast-flowing stream had
clear water, and the riparian vegetation consisted mainly of bushes, tall herbs, Heliconia sp., and some trees 25–30
meters high. We examined several epiphytic bromeliads, which did not contain amphibians. Sympatric amphibians
included Hyloscirtus cf. phyllognathus along the same stream, and Allobates sp., Ameerega petersii, and Pristiman-
tis iiap in the nearby forest. We also recorded species of snakes, which may prey on R. spiculata, such as Leptodeira
annulata and Chironius fuscus (Cantor and Pizzatto 2008, Muscat et al. 2017). Specimens from Tingo Maria Na-
tional Park (CORBIDI 15431) and Agua Nueva Local Community (CORBIDI 16518, 16572), both in the Huallaga
River basin, inhabited secondary montane forest. The males we found were perched on leaves at 1–2 meters above
the stream between 19:00-22:00 hours. The riparian vegetation consisted of bushes and tall herbs (Heliconia sp.),
and we also found males of Hyloscirtus cf. phyllognathus along the same stream.
FIGURE 5. A) Habitat of Hyalinobatrachium mondolfii in the floodplain Amazonian rainforest at Las Piedras Amazon Center
(LPAC), Madre de Dios. Peru; B) gelatinous mass containing undeveloped eggs in a clutch in the same locality; C) embryos of
CHÁVEZ ET AL.
554 · Zootaxa 4691 (5) © 2019 Magnolia Press
TABLE 5. Uncorrected genetic p-distances estimated from the 16S rRNA mitochondrial fragment between Rulyrana spiculata from El Sira Community Reserve, Tingo Maria
National Park, and the type locality (CORBIDI 1985), Peru (all in boldface) and a subset of related taxa of Rulyrana (see Appendix 3 for full list of specimens considered).
Rulyrana flavopunctata
(EU663009)
Rulyrana susatamai (EU663024)
Rulyrana tangarana (KF534370)
Rulyrana saxiscandens
(KM068266)
Rulyrana mcdiarmidi (KM068279)
Rulyrana saxiscandens
(KM068284)
Rulyrana tangarana (KM068290)
Rulyrana mcdiarmidi (KY611470)
Rulyrana adiazeta (KY611471)
Rulyrana sp. (KY611473)
Rulyrana flavopunctata (EU663009)
Rulyrana susatamai (EU663024) 3.77
Rulyrana tangarana (KF534370) 0.38 3.77
Rulyrana saxiscandens (KM068266) 0.56 3.95 0.19
Rulyrana mcdiarmidi (KM068279) 0.19 3.58 0.19 0.38
Rulyrana saxiscandens (KM068284) 0.56 3.96 0.19 0.38 0.38
Rulyrana tangarana (KM068290) 0.56 3.58 0.19 0.38 0.38 0.38
Rulyrana mcdiarmidi (KY611470) 0.19 3.58 0.19 0.38 0.00 0.38 0.38
Rulyrana adiazeta (KY611471) 3.58 0.19 3.58 3.76 3.39 3.77 3.39 3.39
Rulyrana sp. (KY611473) 4.71 3.20 4.71 4.89 4.52 4.90 4.52 4.52 3.01
Rulyrana sp. (KY611474) 4.71 3.20 4.71 4.89 4.52 4.90 4.52 4.52 3.01 0.00
Rulyrana cf. spiculata (EU663006) 3.58 3.20 3.20 3.38 3.39 3.39 3.01 3.39 3.01 4.33
Rulyrana spiculata (EU663022) 6.31 6.12 5.93 6.11 6.12 6.12 5.74 6.12 5.93 6.69
Rulyrana spiculata (MN509215) 3.58 3.20 3.20 3.38 3.39 3.39 3.01 3.39 3.01 3.77
Rulyrana spiculata (MN509216) 3.58 3.20 3.20 3.38 3.39 3.39 3.01 3.39 3.01 3.39
Rulyrana spiculata (MN509217) 3.39 3.01 3.01 3.19 3.20 3.20 2.83 3.20 2.83 3.58
Rulyrana spiculata (MN509218) 2.45 2.64 2.07 2.26 2.26 2.26 1.88 2.26 2.45 3.96
Rulyrana spiculata (MN509219) 2.45 2.64 2.07 2.26 2.26 2.26 1.88 2.26 2.45 3.96
Rulyrana spiculata (MN509220) 3.44 3.25 3.06 3.24 3.25 3.25 2.87 3.25 3.06 4.40
Rulyrana mcdiarmidi (KM068279) 0.19 3.58 0.19 0.38 0.00 0.38 0.38 0.00 3.39 4.52
Rulyrana saxiscandens (KF534369) 0.38 3.77 0.00 0.19 0.19 0.19 0.19 0.19 3.58 4.71
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 555
TABLE 5. (Continued)
Rulyrana sp. (KY611474)
Rulyrana cf. spiculata (EU663006)
Rulyrana spiculata (EU663022)
Rulyrana spiculata (MN509215)
Rulyrana spiculata (MN509216)
Rulyrana spiculata (MN509217)
Rulyrana spiculata (MN509218)
Rulyrana spiculata (MN509219)
Rulyrana spiculata (MN509220)
Rulyrana mcdiarmidi (KM068279)
Rulyrana saxiscandens (KF534369)
Rulyrana flavopunctata (EU663009)
Rulyrana susatamai (EU663024)
Rulyrana tangarana (KF534370)
Rulyrana saxiscandens (KM068266)
Rulyrana mcdiarmidi (KM068279)
Rulyrana saxiscandens (KM068284)
Rulyrana tangarana (KM068290)
Rulyrana mcdiarmidi (KY611470)
Rulyrana adiazeta (KY611471)
Rulyrana sp. (KY611473)
Rulyrana sp. (KY611474)
Rulyrana cf. spiculata (EU663006) 4.33
Rulyrana spiculata (EU663022) 6.69 4.24
Rulyrana spiculata (MN509215) 3.77 1.32 2.92
Rulyrana spiculata (MN509216) 3.39 1.69 3.30 0.38
Rulyrana spiculata (MN509217) 3.58 1.51 3.11 0.19 0.19
Rulyrana spiculata (MN509218) 3.96 1.69 4.43 1.51 1.51 1.32
Rulyrana spiculata (MN509219) 3.96 1.69 4.43 1.51 1.51 1.32 0.00
Rulyrana spiculata (MN509220) 4.40 0.77 3.92 0.96 1.34 1.15 1.34 1.34
Rulyrana mcdiarmidi (KM068279) 4.52 3.39 6.12 3.39 3.39 3.20 2.26 2.26 3.25
Rulyrana saxiscandens (KF534369) 4.71 3.20 5.93 3.20 3.20 3.01 2.07 2.07 3.06 0.19
CHÁVEZ ET AL.
556 · Zootaxa 4691 (5) © 2019 Magnolia Press
H. mondolfii prior to hatching, same locality as above, showing the characteristic pink coloration.
Our records extend the known distribution of Rulyrana spiculata ~195 km to the northeast (Fig. 1) and repre-
sent the farthest known populations from the type locality (~595 km by airline). The farthest Bolivian locality is
521 km by airline south of the type locality (Harvey & Noonan 2005). The type locality is in the upper Madre de
Dios watershed, whereas other Peruvian localities to the north, such as the Perené Valley (Cannatella and Duellman
1982) and El Sira Community Reserve (this study) are within the Ucayali watershed, and Bolivian localities to the
south are part of the upper Beni watershed. The occurrence of R. spiculata in three large watersheds (along >1000
km by airline from north to south) suggests the species may be widely distributed in the eastern slopes of the Andes
of Peru and northern Bolivia.
FIGURE 6. Dorsolateral and ventral views in life of adult males of Rulyrana spiculata. CORBIDI 14406 (A, B) and CORBIDI
14409 (C, D) from El Sira Community Reserve, Huanuco, Peru; CORBIDI 19185 (E, F) from Kosñipata Valley, Cusco, Peru,
the type locality.
The IUCN Red List considered R. spiculata as endemic to Peru with a distribution extended from south to
central regions of the country and also is listed as Near Threatened (Rodríguez et al. 2004). We recommend updat-
ing the distribution range to include our newly confirmed localities and to add Bolivia as a country of occurrence.
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 557
In spite of the new records which put in evidence a wider but fragmented occurrence, the species is known to have
been locally extirpated at localities where chytrid-driven declines have occurred (Catenazzi et al. 2011, 2014), thus
we recommend further revision of material deposited in collections which could reveal new localities, as well as
monitoring of existing populations to confirm species persistence, particularly at sites in the cloud forest known to
have being affected by chytrid epizootics. Therefore, we consider at the moment there is not enough data to allow
us to update its IUCN red list category.
Acknowledgements
We thank Las Piedras Amazon Center (LPAC) and Nice Trip SAC for financially supporting GC and RP fieldwork
in Las Piedras River. We also thank Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) and Servicio
Nacional de Areas Naturales Protegidas por el Estado (SERNANP) for supporting field surveys at SIRA Commu-
nity Reserve. We thank David Johnston and Tatiana Espinosa from LPAC and Asociación para la Resiliencia del
Bosque frente a la Inter-Oceanica (ARBIO) two amazing conservationist who trusted GC´s work and gave us all the
logistical support during every field trip performed at Las Piedras. GC thanks to Andy Barboza and José Malqui for
field assistance at SIRA Community Reserve and Caterina Cosmopolis for her help with the map and geographical
data. We are indebted to Alfredo Arbe-Loli, Liselot Lange, Vladimir Pisango, and Elvis Perdomo for accommoda-
tion during our stay at LPAC. Work at Manu National Park (AC) was supported by grants from the Amazon Con-
servation Association, the Eppley Foundation, the Rufford Small Grants Foundation, the Chicago Board of Trade
Endangered Species Fund, and the Amphibian Specialist Group.
References
Ávila-Pires, T.C.S., Hoogmoed, M.S. & da Rocha, W.A. (2010) Notes on thevertebrates of northern Pará, Brazil: A forgotten
part of the Guianan region, I. Herpetofauna. Boletim do Museu Paraense Emílio Goeldi, 5, 13–112. Avaliable from: http://
scielo.iec.pa.gov.br/pdf/bmpegcn/v5n1/v5n1a02.pdf (Accessed 1 Nov. 2019)
Cannatella, D.C. & Duellman, W.E. (1982) Two new species of Centrolenella, with a brief review of the genus in Peru and
Bolivia. Herpetologica, 38 (3), 380–388.
Cantor, M. & Pizzatto, L. (2008) Leptodeira annulata (Band cat eye snake) diet. Herpetological Review, 39 (4), 470–471.
Castroviejo-Fisher, S.J.M., Guayasamin, J.M. & Kok, P.J.R. (2009) Species status of Centrolene lema Duellman and Señaris,
2003 (Amphibia: Centrolenidae) revealed by integrative taxonomy. Zootaxa, 1980 (1), 16–28.
https://doi.org/10.11646/zootaxa.1980.1.2
Castroviejo-Fisher, S., Moravec, J., Aparicio, J., Guerrero-Reinhard, M. & Calderon, G. (2011a) DNA taxonomy reveals two
new species records of Hyalinobatrachium (Anura: Centrolenidae) for Bolivia. Zootaxa, 2798 (1), 64–68.
https://doi.org/10.11646/zootaxa.2798.1.6
Castroviejo-Fisher, S., Vilà, C., Ayarzagüena, J., Blanc, M. & Ernst, R. (2011b) Species diversity of Hyalinobatrachium glass
frogs (Amphibia: Centrolenidae) from the Guiana Shield, with the description of two new species. Zootaxa, 3132 (1),
1–55.
https://doi.org/10.11646/zootaxa.3132.1.1
Catenazzi, A., Rodriguez, L.O. & Donnelly, M.A. (2009) The advertisement call of four species of glass frogs from southeastern
Peru. Studies on Neotropical Fauna and the Environment, 44, 83–91.
https://doi.org/10.1080/01650520903036653
Catenazzi, A., Lehr, E., Rodriguez, L.O. & Vredenburg, V.T. (2011) Batrachochytrium dendrobatidis and the collapse of anuran
species richness and abundance in the upper Manu National Park, Peru. Conservation Biology, 25, 382–391.
https://doi.org/10.1111/j.1523-1739.2010.01604.x
Catenazzi A., von May, R., Gagliardi-Urrutia, G., Lehr, E. & Guayasamin, J.M. (2012) A new, high elevation glassfrog (Anura:
Centrolenidae) from Manu National Park, southern Peru. Zootaxa, 3388 (1), 56–68.
https://doi.org/10.11646/zootaxa.3388.1.5
Catenazzi, A., Lehr, E. & von May, R. (2013) The amphibians and reptiles of Manu National Park and its buffer zone, Amazon
basin and eastern slopes of the Andes, Peru. Biota Neotropica, 13, 269–283.
https://doi.org/10.1590/S1676-06032013000400024
Catenazzi, A., Lehr, E. & Vredenburg, V.T. (2014) Thermal physiology, disease and amphibian declines in the eastern slopes of
the Andes. Conservation Biology, 28, 509–517.
https://doi.org/10.1111/cobi.12194
Catenazzi, A. & von May, R. (2014) Conservation status of amphibians in Peru. Herpetological Monographs, 28, 1–23.
CHÁVEZ ET AL.
558 · Zootaxa 4691 (5) © 2019 Magnolia Press
https://doi.org/10.1655/HERPMONOGRAPHS-D-13-00003
Cisneros-Heredia, D., Strüssmann, C., Avila, R.W. & Kawashita-Rivero, R. (2010) Amphibia, Anura, Centrolenidae, Hyalino-
batrachium carlesvilai Castroviejo-Fisher, Padial, Chaparro, Aguayo and de la Riva, 2009: First country record, Brazil.
CheckList, 6 (2), 225–226.
https://doi.org/10.15560/6.2.225
Cisneros-Heredia, D. & Guayasamin, J.M. (2014) Notes on the taxonomy of some Glassfrogs from the Andes of Peru and Ec-
uador (Amphibia: Centrolenidae). Papéis Avulsos de Zoologia, 54 (12), 161–168.
https://doi.org/10.1590/0031-1049.2014.54.12
Cortez, C., Reichle, S., De la Riva, I. & Köhler, J. (2004) Cochranella nola. The IUCN Red List of Threatened Species, 2004,
e.T54973A11220213.
https://doi.org/10.2305/IUCN.UK.2004.RLTS.T54973A11220213.en
Duellman, W.E. (1976) Centrolenid frogs from Peru. Ocassional Papers of the Museum of Natural History University of Kan-
sas, 52, 1–11.
https://doi.org/10.5962/bhl.part.15140
Fouquet, A., Vacher, J.P., Kadosoe, V., Jairam, R. & Ouboter, P.E. (2015) Checklist of the amphibians of the Sipaliwini area,
Suriname. Herpetology Notes, 8, 63–68.
Frost, D.R. (2019) Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History,
New York. Electronic Database. Available from: http://research.amnh.org/herpetology/amphibia/index.html (Accessed 1
Nov. 2019)
Guayasamin, J.M., Castroviejo-Fisher, S., Ayarzagüena, J., Trueb, L. & Vilà, C. (2008) Phylogenetic relationships of glass-frogs
(Centrolenidae) based on mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution, 48, 574–595.
https://doi.org/10.1016/j.ympev.2008.04.012
Guayasamin, J. M., Castroviejo-Fisher, S, Trueb, L., Rada, M. & Vilà, C. (2009) Phylogenetic systematics of Glassfrogs (Am-
phibia: Centrolenidae) and their sister taxon Allophryne ruthveni. Zootaxa, 2100 (1), 1–97.
https://doi.org/10.11646/zootaxa.2100.1.1
Guayasamin, J.M., Cisneros-Heredia, D.F., Maynard, R.J., Lynch, R.L., Culebras, J. & Hamilton, P.S. (2017) A marvelous new
glassfrog (Centrolenidae, Hyalinobatrachium) from Amazonian Ecuador. Zookeys, 673, 1–20.
https://doi.org/10.3897/zookeys.673.12108
Harvey, M.B. (1996) A new species of glass frog (Anura: Centrolenidae: Cochranella) from Bolivia, and the taxonomic status
of Cochranella flavidigitata. Herpetologica, 52, 427–435.
Harvey, M.B. & Noonan, B.P. (2005) Bolivian glass frogs (Anura: Centrolenidae) with a description of a new species from
Amazonia. Proceedings of the Biological Society of Washington, 118 (2), 428–441.
https://doi.org/10.2988/0006-324X(2005)118[428:BGFACW]2.0.CO;2
Kok, P.J.R. & Castroviejo-Fisher, S. (2008) Glassfrogs (Anura: Centrolenidae) of Kaieteur National Park, Guyana, with notes on
the distribution and taxonomy of some species of the family in the Guiana Shield. Zootaxa, 1680 (1), 25–53.
https://doi.org/10.11646/zootaxa.1680.1.2
Lujan, L., Venegas, P.J. & Echevarría, L.Y. (2014) Cochranella nola Harvey, 1996 (Amphibia, Anura, Centrolenidae): First
country record from Peru. Herpetology Notes, 7, 607–608.
Muscat, E., Abegg, A.D. & Entiauspe-Neto, O.M. (2017) Chironius fuscus (Serpentes. Colubridae) predation over anurans in
explosive reproduction. Neotropical Biology and Conservation, 12 (1), 68–70.
https://doi.org/10.4013/nbc.2017.121.08
Oliveira de, E.A., Hernández-Ruiz, E.J. & Carvalho de, J.C. (2015) Geographic distribution: Hyalinobatrachium mondolfii.
Herpetological Review, 46, 377–378.
Padial J.M., Castroviejo-Fisher, S., Köhler, J., Vilà, C., Chaparro, J.C. & De la Riva, I. (2009) Deciphering the products of evo-
lution at the species level: the need for an integrative taxonomy. Zoologica Scripta, 38, 431–447.
https://doi.org/10.1111/j.1463-6409.2008.00381.x
Padial J.M., Miralles, A., De la Riva, I. & Vences, M. (2010) The integrative future of taxonomy. Frontiers in Zoology, 7, 16.
https://doi.org/10.1186/1742-9994-7-16
Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L. & Grabawski, G. (2002) The Simple Fool’s Guide to PCR.
Version 2.0. Privately published, compiled by S. Palumbi. University of Hawaii, Honolulu, 45 pp.
Rada, M., Dias, P.H.D.S., Pérez-Gonzalez, J.L., Anganoy-Criollo, M., Rueda-Solano, L.A., Pinto-E, M.A., Mejía Quintero
L., Vargas-Salinas, F. & Grant, T. (2019) The poverty of adult morphology: Bioacoustics, genetics, and internal tadpole
morphology reveal a new species of glassfrog (Anura: Centrolenidae: Ikakogi) from the Sierra Nevada de Santa Marta,
Colombia. PloS one, 14 (5), e0215349
https://doi.org/10.1371/journal.pone.0215349
Rodríguez, L., Martinez, J.L. & Arizabal, W. (2004) Rulyrana spiculata. The IUCN Red List of Threatened Species, 2004,
e.T54994A11227150.
https://doi.org/10.2305/IUCN.UK.2004.RLTS.T54994A11227150.en
Señaris, J.C. & Ayarzagüena, J. (2001) Una nueva especie de rana de cristal del género Hyalinobatrachium (Anura: Centroleni-
dae) del delta del Río Orinoco, Venezuela. Revista de Biología Tropical, San José, 49, 1083–1093.
Señaris, J.C. & Ayarzagüena, J. (2005) Revisión Taxonómica de la Familia Centrolenidae (Amphibia, Anura) en Venezuela.
Publicaciones del Comité Español del Progrma MaB y de la Red IberoMab de la UNESCO. Number 6. Comité español del
NEW RECORDS OF GLASSFROGS FROM PERU Zootaxa 4691 (5) © 2019 Magnolia Press · 559
programa MAB de la UNESCO, Sevilla, 337 pp.
Twomey, E., Delia, J. & Castroviejo-Fisher, S. (2014) A review of northern Peruvian Glassfrogs, with the description of four
new remarkable species. Zootaxa, 3851 (1), 001–087.
https://doi.org/10.11646/zootaxa.3851.1.1
Venâncio, N.M., Souza de, M.B. & Kokubum de, C. (2014) Hyalinobatrachium mondolfii Senaris & Ayarzagüena, 2001 (An-
ura: Centrolenidae): First record for the state of Acre, Brazil. Check List. A Journal of Species Lists and Distribution, 10,
1184–1186.
https://doi.org/10.15560/10.5.1184
Villacampa, J., Serrano-Rojas, S. & Whitworth, A. (2016) Amphibians of the Manu Learnig Center and others areas of the
Manu Region. The Cress Foundation, Cusco, 283 pp. Available from: https://view.joomag.com/field-guide-amphibians-of-
manu/0741739001481300238?short (accessed 11 December 2018)
Vences, M., Thomas, M., Bonett, R.M. & Vieites, D.R. (2005a) Deciphering amphibian diversity through DNA barcoding:
chances and challenges. Philosophical Transactions of the Royal Society of London, B, 360, 1859–1868.
https://doi.org/10.1098/rstb.2005.1717
Vences, M., Thomas, M., van der Meijden, A., Chiari, Y. & Vieites, D.R. (2005b) Comparative performance of the 16S rRNA
gene in DNA barcoding of amphibians. Frontiers in Zoology, 2, 5.
https://doi.org/10.1186/1742-9994-2-5
APPENDIX I. GenBank accession codes of the sequences of Centrolene, Cochranella, and Espadarana included in the
study. GenBank codes in bold indicate new sequences produced for this work.
Species Museum 16S
Cochranella nola CORBIDI 19156 MN509214
Cochranella nola CBG 814 EU663016
Cochranella nola CBG 1094 EU663015
Cochranella sp. CBG 1096 EU663021
Cochranella euknemos Field# KRL 0803 FJ784377
Cochranella euknemos Field# KRL 1054 FJ784458
Cochranella euknemos CH 5109 EU663008
Cochranella mache QCAZ 27747 EU663013
Cochranella euknemos CH 6696 KR863141
Cochranella euknemos CH 6864 KR863140
Cochranella euknemos CH 6440 KR863139
Cochranella euknemos AJC 1687 KR863138
Cochranella euknemos AJC 1688 KR863137
Cochranella euknemos CH 6423 KR863136
Cochranella euknemos AJC 1850 KR863135
Cochranella euknemos Field# KRL 0841 FJ784396
Centrolene litorale QCAZ 27693 EU662990
Cochranella erminea MHNC7247 KF534360
Cochranella guayasamini MHNC 13930 KM068259
Cochranella guayasamini CORBIDI 8956 KM068265
Centrolene durrellorum QCAZ47909 KF534356
Cochranella granulosa Field# KRL 1011 FJ784455
Espadarana prosoblepon NA JX564857
Centrolene andinum JMG 366 EU662976
APPENDIX 2. GenBank accession codes of the sequences of Hyalinobatrachium included in the study. GenBank codes
in bold indicate new sequences produced for this work.
Species Museum 16S
H. carlesvilai CBG 1099 EU663030
H. carlesvilai MNCN 43692 GQ142049
......continued on the next page
CHÁVEZ ET AL.
560 · Zootaxa 4691 (5) © 2019 Magnolia Press
APPENDIX 2. (Continued)
Species Museum 16S
H. carlesvilai MNCN 43691 GQ142050
H. carlesvilai MNCN 43690 GQ142051
H. carlesvilai CBG 1140 GQ142052
H. carlesvilai CBG 1139 GQ142053
H. carlesvilai CET GQ142054
H. carlesvilai MNCN 44213 GQ142055
H. carlesvilai MHNCP 5434 GQ142056
H. carlesvilai ZFMK 75238 GQ142057
H. carlesvilai MHNC 13958 KM068260
H. carlesvilai CORBIDI-HE-2010-8959 KM068269
H. carlesvilai ET-10-117 KM068270
H. kawense MB254 EU663029
H. kawense MNCN 44825 JN870868
H. kawense MNHN 2011.0118 JN870869
H. mondolfii MHNLS 17119 EU663050
H. mondolfii MHNLS 17121 GQ142046
H. mondolfii CBF 6453 JF266569
H. mondolfii SMNS 12255 JN870870
H. mondolfii CORBIDI 18221 MH766899
H. mondolfii CORBIDI 18222 MH766900
H. muiraquitan LZA 844 KY310570
H. muiraquitan LZA 841 KY310571
H. munozorum QCAZ 31056 EU663034
H. munozorum NMP6V 74059 JF266570
APPENDIX 3. GenBank accession codes of the sequences of Rulyrana included in the study. GenBank codes in bold
indicate new sequences produced for this work.
Species Musem 16S
Rulyrana adiazeta MAR 483 KY611471
Rulyrana cf. spiculata CBG 806 EU663006
Rulyrana flavopunctata QCAZ 32265 EU663009
Rulyrana mcdiarmidi CORBIDI 6848 KM068279
Rulyrana mcdiarmidi MHNC14015 KY611470
Rulyrana mcdiarmidi CORBIDI 6848 KM068279
Rulyrana saxiscandens ET10121 KF534369
Rulyrana saxiscandens ET-10-124 KM068284
Rulyrana saxiscandens CORBIDI 14150 KM068266
Rulyrana spiculata CORBIDI 16572 MN509219
Rulyrana spiculata CORBIDI 15431 MN509218
Rulyrana spiculata CORBIDI 14410 MN509217
Rulyrana spiculata CORBIDI 14409 MN509216
Rulyrana spiculata CORBIDI 13906 MN509215
Rulyrana spiculata CORBIDI 19185 MN509220
Rulyrana spiculata MHNSM 24867 EU663022
Rulyrana sp. MUJ 6583 KY611474
Rulyrana sp. MUJ 6584 KY611473
Rulyrana susatamai MAR 337 EU663024
... However, species identification within Hyalinobatrachium is often problematic due to subtle morphological differences among taxa. This situation is evidenced by the confusing taxonomic status of several species (see Castroviejo-Fisher et al. 2008, 2011a, 2011bGuayasamin et al. 2008Guayasamin et al. , 2017Guayasamin et al. , 2019Kok & Castroviejo-Fisher 2008;Chávez et al. 2019;Mendoza-Henao et al. 2020). Difficulties in identifying species of Hyalinobathrachium are compounded by the modification of key taxonomic characteristics as an artifact of preservation (e.g. ...
... Species identification within Hyalinobathrachium can be problematic due to a conservative morphology, i.e. most species are very similar in external traits such as dorsal and visceral coloration, webbing extension, and snout shape, which makes their taxonomy a difficult task (Kok & Castroviejo-Fisher 2008;Castroviejo-Fisher et al. 2009, 2011a, 2011bChávez et al. 2019;Mendoza-Henao et al. 2019). Thus, analyses of molecular data and comparisons of coloration in life help elucidate intricate species identities and evolutionary relationships (Castroviejo-Fisher et al. 2011a;Guayasamin et al. 2017 -89, 15992, 15994-98, 16000-01, 19686, 19688, 19564-65, 19561-63;Barrera-Rodríguez 2000'1999, and individuals of H. pellucidum can be confused with H. munozorum and H. esmeralda (Marco Rada, pers. ...
... Hyalinobatrachium mondolfii is a widely distributed species in Guyana, Bolivia, Colombia, Venezuela, and Peru (Castroviejo-Fisher et al. 2011b;Chávez et al. 2019;Frost 2020; this work). Guayasamin et al. (2009) andCastroviejo-Fisher et al. (2011a) found a close relationship between H. mondolfii and H. munozorum. ...
Article
Full-text available
The Neotropical amphibian family Centrolenidae currently includes 156 named species of nocturnal anurans commonly known as glassfrogs. With 79 species, Colombia is the country with the highest diversity of centrolenids. However, the number of species known to occur in the country remains uncertain because research often results in names being resurrected or placed in synonymy, the description of new taxa, and range extensions of species, including new country records. Based on field trips and assess of additional specimens, herein we report new distribution data for centrolenids species in Colombia. These data include six new distribution records for: (Cochranella granulosa, Nymphargus balionotus, N. chami, N. grandisonae, Hyalinobatrachium mondolfii, and H. pellucidum). Records of C. granulosa and H. pellucidum are the first records of these species from Colombia. Thus, our study increases to 81 the numbers of glassfrogs for this country. Because most Hyalinobatrachium have a conservative morphology, making species identification problematic when only based on external traits, we sequenced a fragment of the mitochondrial gene 16S to confirm species identities within a phylogenetic context. We discuss the taxonomic implications of our results for the recognition of species and populations that are morphologically similar to H. talamancae.
Article
Full-text available
Conservation initiatives are particularly important in light of the high proportion of species threatened with extinction worldwide. Advertisement calls are a valuable resource for conservation given their importance for studies on amphibian taxonomy, systematics, evolutionary biology, ecology, and monitoring strategies. However, advertisement calls are still unknown for many species. Here, advertisement call descriptions are provided for six glassfrog species (Centrolene huilensis, Centrolene hybrida, Nymphargus orenonympha, Rulyrana flavopunctata, Rulyrana susatamai, and Sachatamia punctulata) from six localities in four municipalities in the Andes of Colombia. Based on our current knowledge of the acoustics, distribution ranges, presence in protected areas, and IUCN Red List threat status, some species of glassfrogs are identified as priorities for future studies. The overall parameters measured for the advertisement calls of the species described here fall within those known for other species from the same genus, but the species studied here are differentiated from their congenerics by the pulse rate, number of notes, and/or dominant frequency. To date, advertisement calls are known for approximately 60% of glassfrog species and we identified 23 priority species with unknown calls which should be the focus of future research efforts.
Article
Full-text available
Vocalizations are one of the most important communication modalities in amphibian biology, and advertisement call is the type of vocalization mostly emitted by anurans (frogs and toads). In the present study, we carried out a scientometric analysis of the advertisement call in species of anurans in Colombia to determine the state of knowledge of this science in the country. We recorded the number of call descriptions and its trend throughout more than 60 years; in addition, we identified how many species there are with the call described per taxonomic family, geographic units and threat status. According to our review, between 1958 and June 30 of 2021, at least 296 studies have been published that describe the advertisement call of 307 species (of 785 in the country); only 130 descriptions come from recordings to individuals in Colombian populations. Leptodactylidae and Hylidae are the families with the highest percentage of species whose call has been described (84.6% and 68.4%, respectively). On the contrary, Bufonidae (19.5%) and Craugastoridae (12.9%) exhibit a low percentage of described calls. The Central and Eastern cordilleras were the regions with the best knowledge of advertisement calls, while the least known were the Caribbean – interAndean valleys, Orinoquía, and Sierra Nevada de Santa Marta. In terms of the threat status, the species with the least concern (LC) were the ones that presented the highest number of species with the call described. Despite an increase in the most recent two decades, our findings still reveal notable gaps in knowledge of the advertisement calls in Colombian anurans, which constitutes an incentive to develop future research on this subject. Finally, based on this meta-analysis, we highlight some recommendations that we hope that we hope stimulate new studies in ecoacoustics, using anurans in Colombia as a study model.
Article
Full-text available
Anurans compose an important part of the diet of several species of Neotropical snakes. Here we report a predator-prey interaction involving Chironius fuscus and Ololygon ar-gyreornata. A young individual of C. fuscus preyed three specimens of O. argyreornata, in soil, while occurred explosive reproduction of frogs. This contribution reinforces ecological data that C. fuscus forages mainly on the ground. We believe that this interaction can occur with relative frequency and that eventually arboreal frogs can compose important sample in C. fuscus' diet, which is based on terrestrial amphibians. Resumo Os anuros compõem uma parcela importante da dieta de diversas espécies de serpen-tes neotropicais. Neste trabalho, relatamos uma interação de predador-presa envolvendo Chironius fuscus e Ololygon argyreornata. Um indivíduo jovem de C. fuscus apresou três espécimes de O. argyreornata, no solo, enquanto ocorria reprodução explosiva dos anu-ros. Essa contribuição reforça os dados ecológicos de que C. fuscus forrageia, principal-mente, no chão. Acreditamos que essa interação possa ocorrer com relativa frequência e que, eventualmente, os anuros arborícolas possam compor importante amostra na dieta de C. fuscus, a qual é baseada em anfíbios terrestres. Palavras-chave: anurofagia, Colubrinae, dieta, hábitos alimentares. Chironius fuscus (Serpentes: Colubridae): Predation over anurans in explosive reproduction Chironius fuscus (Serpentes: Colubridae): predação sobre anuros em reprodução explosiva 1 Projeto Dacnis. Estrada do Rio Escuro 4754, 11680-000,
Article
Full-text available
Ikakogi is a behaviorally and morphologically intriguing genus of glassfrog. Using tadpole morphology, vocalizations, and DNA, a new species is described from the Sierra Nevada de Santa Marta (SNSM), an isolated mountain range in northern Colombia. The new taxon is the second known species of the genus Ikakogi and is morphologically identical to I. tayrona (except for some larval characters) but differs by its genetic distance (14.8% in mitochondrial encoded cytochrome b MT-CYB; ca. 371 bp) and by the dominant frequency of its advertisement call (2928–3273 Hz in contrast to 2650–2870 Hz in I. tayrona). They also differ in the number of lateral buccal floor papillae, and the position of the buccal roof arena papillae. Additionally, the new species is differentiated from all other species of Centrolenidae by the following traits: tympanum visible, vomerine teeth absent, humeral spines present in adult males, bones in life white with pale green in epiphyses, minute punctuations present on green skin dorsum, and flanks with lateral row of small, enameled dots that extend from below eye to just posterior to arm insertion. We describe the external and internal larval morphology of the new species and we redescribe the larval morphology of Ikakogi tayrona on the basis of field collected specimens representing several stages of development from early to late metamorphosis. We discuss the relevance of larval morphology for the taxonomy and systematics of Ikakogi and other centrolenid genera. Finally, we document intraspecific larval variation in meristic characters and ontogenetic changes in eye size, coloration, and labial tooth-rows formulas, and compare tadpoles of related species. Ikakogi tayrona has been proposed as the sister taxon of all other Centrolenidae; our observations and new species description offers insights about the ancestral character-states of adults, egg clutches, and larval features in this lineage of frogs.
Article
Full-text available
Hyalinobatrachium is a behaviorally and morphologically conserved genus of Neotropical anurans, with several pending taxonomic problems. Using morphology, vocalizations, and DNA, a new species from the Amazonian lowlands of Ecuador is described and illustrated. The new species, Hyalinobatrachium yaku sp. n., is differentiated from all other congenerics by having small, middorsal, dark green spots on the head and dorsum, a transparent pericardium, and a tonal call that lasts 0.27–0.4 s, with a dominant frequency of 5219.3–5329.6 Hz. Also, a mitochondrial phylogeny for the genus is presented that contains the new species, which is inferred as sister to H. pellucidum. Conservation threats to H. yaku sp. n. include habitat destruction and/or pollution mainly because of oil and mining activities.
Article
Full-text available
We compile a list of all amphibians and reptiles known to occur within Manu National Park, Peru and its buffer zone, located in one of the world's biodiversity hotspots. Covering approximately 0.01% of the planet's terrestrial surface, this protected area preserves 155 species of amphibians and 132 species of reptiles, corresponding to 2.2% and 1.5% respectively of the known diversity for these groups. Moreover, Manu National Park preserves natural habitats and populations of one critically endangered (Atelopus erythropus), three endangered (Bryophryne cophites, Pristimantis cosnipatae and Psychrophrynella usurpator), three vulnerable amphibians (Atelopus tricolor, Gastrotheca excubitor, Rhinella manu) and two vulnerable reptiles (Chelonoidis denticulata, Podocnemis unifilis), according to the threat categories of the IUCN Red List.
Article
Full-text available
Hyalinobatrachium mondolfii Senari & Ayarzagüena, 2001 was described in the state of Monagas, Venezuela (Señaris and Ayarzagüena 2001) and its distribution has been widely extended to include Bolivia (Castroviejo-Fisher et al. 2011a), Brazil, Colombia, French Guiana, Guyana, Suriname (Castroviejo-Fisher et al. 2011b). The species has been found exclusively associated with riverbank vegetation. The following unique combination of characters differentiates Hyalinobatrachium mondolfii from all other species in the genus: snout rounded in dorsal and lateral view, tympanic membrane not visible in life, pericardium white with minute melanophores, dorsal color green in life with small yellow dots and minute melanophores (Figure 1); when in preservative, dorsal color pale cream, dotted with minute melanophores and yellow dots (can be lost in some specimens); color of iris reticulated by dark spots in life, bones white, hands and feet yellow in life (Castroviejo-Fisher et al. 2011b). During a herpetofaunistic inventory carried out on 30 January 2010 in the municipality of Feijó, state of Acre, Brazil, on the left bank of the Jurupari River (08°09' S & 70°21' W), we found seven individuals of H. mondolfii calling on the riverbank vegetation, at heights ranging from 3–5 m from the water surface. All individuals were collected and housed in the herpetological collection of Universidade Federal do Acre – ChUFAC, with the following voucher numbers: 4486, 4566, 4567, 4568, 4569, 4570, 4571 and 4572. One individual (4486) was recorded calling in 5 m from the water surface at 23:00 (27°C and 89% RH) using digital recorder (Sony ® ICD-CX50), with directional microphone (shotgun) Yoga 380-A. Abstract: In this work, we record the first occurrence of Hyalinobatrachium mondolfii from the state of Acre. It is the second record from Brazil.
Article
Full-text available
We present new information on several species of centrolenid frogs from Ecuador and Peru that justify the placement of Centrolene fernandoi Duellman and Schulte as a junior synonym of Centrolenella audax Lynch and Duellman; Centrolenella puyoensis Flores & McDiarmid as a synonym of Centrolenella mariae Duellman & Toft; and Cochranella tangarana Du-ellman & Schulte as a synonym of Cochranella saxiscandens Duellman & Schulte.
Article
We evaluate the hypothesis of Centrolene lema as a species distinct from C. gorzulae using morphological, bioacoustic and genetic comparisons. Our results show that there are no consistent differences in any of these three areas; hence, we present C. lema as a synonym of C. gorzulae. Additionally we provide new data on the distribution and ecology of the species.
Article
We collected two specimens of the genus Hyalinobatrachium during fieldwork expeditions to the Departamento Pando—the northernmost region of Bolivia situated in the south-western Amazonian basin, within the zone of tall evergreen lowland rainforest. The specimens are deposited in the Colección Boliviana de Fauna, La Paz (CBF 6453) and in the National Museum, Prague (NMP6V 74059). Because species identification within Hyalinobatrachium based only on morphological characters is in many cases problematic (Kok & Castroviejo-Fisher 2008; Castroviejo-Fisher et al. 2009), we took advantage of published sequences of Hyalinobatrachium to identify our samples. Our results show that each specimen belongs to a different species (H. mondolfii and H. munozorum), none of them previously known to occur in Bolivia. The taxonomic implications of our discovery are briefly discussed.
Article
I describe a new species of Cochranella from semi-deciduous forests near Samaipata, Santa Cruz, Bolivia. It is the most southern, Andean member of the genus Cochranella. The new species is most similar to C. spiculata and C. tangarana, from which it differs in color, distribution of melanophores, spiculation, and prominence of the tympanum. Large series of males and females of Cochranella bejaranoi are reported from two localities near the border of Santa Cruz and Cochabamba, Bolivia. Reported differences between the holotypes of C. flavidigitata and C. bejaranoi are found to be the result of sexual dimorphism and individual variation. Cochranella flavidigitata is synonymized with C. bejaranoi.