Necrotic and Cytolytic Activity on Grapevine Leaves Produced by Nep1-Like Proteins of Diplodia seriata

Abstract

Many phytopathogenic fungi produce necrosis and ethylene inducing peptide 1 (Nep1-like proteins or NLP) that trigger leaf necrosis and the activation of defense mechanisms. These proteins have been widely studied in plant pathogens as Moniliophthora perniciosa or Botrytis cinerea between others, but little is known about their biological roles in grapevine trunk pathogens. Advances in the sequencing of genomes of several fungi involved in grapevine trunk diseases have revealed that these proteins are present in several copies in their genomes. The aim of this project was to analyze the presence of genes encoding NLP proteins in the Diplodia seriata genome and to characterize their putative role as virulence factors associated to grapevine trunk diseases. In this study, we characterized four NLPs from Diplodia seriata. All proteins showed highly similar amino acid sequences and contained the characteristic peptide motifs of NLPs. DserNEPs slightly reduced the viability of Vitis vinifera L. cell cultures. The cytolytic activity from DserNEP1 was stronger than that from DserNEP2, even at low concentrations. Purified DserNEPs also produced necrosis in leaves when they were inoculated into micropropagules of V. vinifera L. This is the first record of Nep1-like proteins from a fungus associated with grapevine trunk diseases and also from a member of the Botryosphaeriaceae family.

Full text

1October 2019 | Volume 10 | Article 1282
ORIGINAL RESEARCH
doi: 10.3389/fpls.2019.01282
published: 17 October 2019
Frontiers in Plant Science | www.frontiersin.org
Edited by:
Dario Cantu,
University of California,
Davis, United States
Reviewed by:
Florence Fontaine,
Université de Reims
Champagne-Ardenne, France
Elodie Vandelle,
University of Verona, Italy
*Correspondence:
Rebeca Cobos
rcobr@unileon.es
Juan José Rubio Coque
jjrubc@unileon.es
Specialty section:
This article was submitted to
Plant Microbe Interactions,
a section of the journal
Frontiers in Plant Science
Received: 05 June 2019
Accepted: 13 September 2019
Published: 17 October 2019
Citation:
CobosR, Calvo-PeñaC,
Álvarez-PérezJM, IbáñezA,
Diez-GalánA, González-GarcíaS,
García-AnguloP, AcebesJL and
CoqueJJR (2019)Necrotic and Cytolytic
ActivityonGrapevineLeavesProduced
byNep1-Like Proteins of Diplodia seriata.
Front. Plant Sci. 10:1282.
doi: 10.3389/fpls.2019.01282
Necrotic and Cytolytic Activity on
Grapevine Leaves Produced by
Nep1-Like Proteins of Diplodia
seriata
Rebeca Cobos 1,2*, Carla Calvo-Peña 1, José Manuel Álvarez-Pérez 1, Ana Ibáñez 1,
Alba Diez-Galán 2,Sandra González-García 1, Penélope García-Angulo 1, Jose Luis Acebes 1
and Juan José R. Coque 1,2*
1 Instituto de Investigación de la Viña y el Vino, Universidad de León, León, Spain, 2 RGA-bioinvestigación S.L., León, Spain
Many phytopathogenic fungi produce necrosis and ethylene inducing peptide 1 (Nep1-
like proteins or NLP) that trigger leaf necrosis and the activation of defense mechanisms.
These proteins have been widely studied in plant pathogens as Moniliophthora perniciosa
or Botr ytis cinerea between others, but little is known about their biological roles in grapevine
trunk pathogens. Advances in the sequencing of genomes of several fungi involved in
grapevine trunk diseases have revealed that these proteins are present in several copies
in their genomes. The aim of this project was to analyze the presence of genes encoding
NLP proteins in the Diplodia seriata genome and to characterize their putative role as
virulence factors associated to grapevine trunk diseases. In this study, we characterized
four NLPs from Diplodia seriata. All proteins showed highly similar amino acid sequences
and contained the characteristic peptide motifs of NLPs. DserNEPs slightly reduced the
viability of Vitis vinifera L. cell cultures. The cytolytic activity from DserNEP1 was stronger
than that from DserNEP2, even at low concentrations. Purified DserNEPs also produced
necrosis in leaves when they were inoculated into micropropagules of V. vinifera L. This
is the first record of Nep1-like proteins from a fungus associated with grapevine trunk
diseases and also from a member of the Botryosphaeriaceae family.
Keywords: Botryosphaeriaceae, NLP, RT-qPCR, grapevine trunk diseases, phytotoxicity, Vitis vinifera
INTRODUCTION
Grapevines are one of the most important economic crops worldwide. Grapevine trunk diseases
(GTDs) are a major threat for the wine sector, causing serious economic losses to the wine
industry (Siebert, 2001; Gubler et al., 2005). is term encompasses dierent fungal pathologies
such as Botryosphaeria dieback, Esca, Eutypa dieback, Petri disease, or Black foot, to cite the most
relevant. e incidence of GTD have increased over the last decades, mainly due to the lack of
eective strategies to ght these diseases (Chiarappa, 2000; Graniti et al., 2000; Spagnolo et al.,
2017; Mondello et al., 2018). Botryosphaeria dieback has been reported since the 1970s as one
of the main GTD. It is caused by several xylem-inhabiting fungi (Bertsch et al., 2013) which are
primarily members of the Botryosphaeriaceae family such as Diplodia seriata De Not. (anamorph
of Botryosphaeria obtusa, Shoemaker, 1964; Phillips et al., 2007), Diplodia mutila (anamorph of

NLPs from Diplodia seriataCobos et al.
2October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
Botryosphaeria stevensii, Shoemaker, 1964), and Neofusicoccum
parvum (anamorph of Botryosphaeria parva, Crous et al., 2006).
D. seriata is one of the pathogens most frequently isolated
from symptomatic grapevines in Spanish vineyards (Martín
and Cobos, 2007) as well as French vineyards (Kuntzmann
etal., 2010). It has been isolated from at least 34 dierent hosts
(Punithalingam and Waller, 1976), mostly fruit trees, but also
from other woody plants. D. seriata has been recognized as
a wound pathogen and is associated with dieback symptoms
and cankers (Larignon et al., 2001; Phillips, 2002; Van Niekerk
et al., 2004). ese pathogens attack the perennial organs of
grapevines, although they have never been isolated from leaves
(Larignon and Dubos, 1997). erefore, it is supposed that
symptoms observed in the berries and leaves might be caused
by extracellular compounds produced by the fungi in colorless
woody tissues of the trunk, which are then translocated to leaves
through the transpiration system (Mugnai et al., 1999).
e toxicity of some extracellular metabolites produced by
members of Botryosphaeriaceae family has been proven (Martos
et al., 2008; Andol et al., 2011; Ramírez-Suero et al., 2014), and
several phytotoxic metabolites have been identied (Bénard-
Gellon et al., 2014; Abou-Mansour et al., 2015). However, little is
known about putative proteins secreted by these fungi that could
have any role in pathogenesis. Bénard-Gellon et al. (2014) detected
some toxicity in an extracellular protein extract from D. seriata
and N. parvum. However, to date no protein has been identied
yet as a virulence factor in D. seriata, although in a previous work
Nep1-like proteins were detected as putative virulence factors in
the secretome of this fungus (Cobos et al., 2010). Among the host
cell-death-inducing secreted proteins of plant pathogens are the
necrosis and ethylene-inducing peptide 1 (Nep1)-like proteins
(NLPs) that were rst detected in culture ltrates of Fusarium
oxysporum (Bailey, 1995). NLPs constitute a superfamily of
proteins that are produced by phytopathogenic bacteria, fungi,
and oomycetes (Pemberton and Salmond, 2004; Gijzen and
Nurnberger, 2006), which have been recognized as virulence
factors in several phytopathogenic fungi such as F. oxysporium
(Bailey, 1995; Bae et al., 2006), Botrytis spp. (Staats et al.,
2007a; Staats et al., 2007b; Schouten et al., 2008), Phytophthora
megakarya (Bae et al., 2005), Moniliophthora perniciosa (García
et al., 2007; Zaparoli et al., 2009), Mycosphaerella graminicola
(Motteram et al., 2009), or Verticillium dahliae (Zhou et al., 2012)
among others.
NLPs have been proposed to have dual functions in plant–
pathogen interactions, acting both as triggers of immune responses
and also as toxin-like virulence factors (Qutob et al., 2006). NLPs
are relatively small proteins of about 24 kDa that exhibit a high
degree of similarity at amino acid sequence level, including the
presence of two highly conserved cysteine residues that form
an intramolecular disulde bridge essential for NLP activities
(Fellbrich et al., 2002; Qutob et al., 2006; Ottmann et al., 2009),
and also a central hepta-peptide motif “GHRHDWE” that is part
of the negatively charged cavity exposed at the protein surface.
Both are necessary for plasma membrane permeabilization and
cytolysis in plant cells (Ottmann et al., 2009). NLPs have been
classied into type I and type II classes, depending on whether
they contain two or four cysteine residues present at conserved
positions, respectively (Gijzen and Nurnberger, 2006). A third
type of NLP was described by Oome and Van Den Ackerveken
(2014), but this type III only shares a central 50 amino acids with
types I and II including the highly conserved heptapeptide motif.
e present study aims to analyze the presence of genes
encoding NLP proteins in the D. seriata genome and to
characterize their structure and their putative role as virulence
factors associated to GTDs.
MATERIALS AND METHODS
DNA Isolation
e D. seriata strain used in this work was derived from a
monosporic culture of D. seriata VS1 (Cobos et al., 2010). e
strain was routinely maintained on potato dextrose agar (PDA;
Scharlau Chemie S.A.). Genomic DNA was isolated from fresh
mycelia following an adaptation of the method described by
Möller et al. (1992). Briey, 16 g of fresh mycelia was ground to
a ne powder in liquid nitrogen, transferred to Falcon® tubes,
and mixed with TES solution (100 mM Tris, pH 8.0, 10 mM
EDTA, 2% SDS); 120 µg/mL of Proteinase K was added and
tubes were incubated for 1 h at 65°C with occasional gentle
mixing. e salt solution was adjusted to 1.4 M with 5 M NaCl,
and 1/10 volume 10% CTAB was added before incubating for
10 min at 65°C. e tubes were centrifuged at 10,000 rpm for
10 min. RNase (20 µg/mL) was added to the supernatant and
incubated at 37°C for 1 h. e aqueous phase was extracted with
1 volume of phenol–CIA solution (phenol/chloroform/isoamyl
alcohol; 25:24:1 v/v) mixed by inversion and placed on ice for
30 min. Aer centrifugation for 10 min at 8,000 rpm, and an
additional extraction with 1 volume of CIA (chloroform:isoamyl
alcohol; 24:1 v/v), the supernatant was mixed with 1/3 volume
of 5 M NH4Ac, mixed gently, and placed on ice for 30 min.
Aer centrifugation for 10 min at 8,000 rpm, the nucleic acids
were precipitated with 1 volume of cold isopropanol. DNA was
recovered by centrifugation and the pellet washed with 70%
ethanol. DNA was dissolved in 500 µl of TE buer and stored
at −20°C. DNA concentration was estimated with a NanoDrop
2000 Spectrophotometer (ermo Scientic).
Genomic Library Construction and
Screening
Genomic DNA from D. seriata (12 µg) was partially digested
with Sau3AI. DNA fragments (17–23 kb) were puried
by ultracentrifugation in a sucrose gradient and ligated to
Lambda DASH II BamHI Vector Kit (Stratagene), followed
by in vitro packaging. Degenerate primers NepFdeg (5′
GTRAATGGRTGCGTRCCATTCCC 3′) and NepRdeg (5′
CCTTCCCARTCGTGRCGGTGRCC 3′) were designed against
conserved regions present in Nep1-like proteins (identied by in
silico analysis of proteins deposited in GenBank database) that
included the peptides previously identied by MASCOT from
D. seriata NLPs (Cobos et al., 2010). ese primers amplied a
partial DserNEP sequence that was labeled with the DIG DNA
labeling kit (Roche) and used as a hybridization probe to screen
recombinant bacteriophage plaques of the genomic library.

NLPs from Diplodia seriataCobos et al.
3October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
PCR Amplification and Sequencing of
DserNEP Genes
Primer pairs were designed to amplify the entire sequence of
DserNEP genes from DNA and cDNA (Table 1 ). DserNEP genes
were amplied by PCR. Each reaction contained 1× Kapa Hi
(KAPA BIOSYSTEMS), 300 µM of each dNTP, 0.3 µM of each
primer, 0.5 U of Kapa Hi polymerase, and 1 µl of template DNA.
PCR amplications were performed on a Mastercycler gradient
(Eppendorf). e program consisted of an initial step of 2 min
at 95°C, followed by 35 cycles of denaturation at 95°C for 20 s,
annealing at 60°C for 15 s, and elongation at 72°C for 30 s. A nal
extension was performed at 72°C for 3 min. DNA was sequenced
by the dideoxynucleotide chain termination method using a
BigDye Terminator cycle sequencing kit (Applied Biosystems).
Signal peptide regions were predicted by using the Signal P3
program (Bendtsen et al., 2004).
Amino Acid Sequence Analysis
Sequences from GTD pathogens with signicant similarity (value
1e−4) to DserNEP proteins were retrieved from the NCBI database
and identied using BlastP (Altschul et al., 1990). Sequences in
Table 2 were aligned by ClustalW (Larkin et al., 2007) and then
analyzed using the MEGA 5 phylogenetic package (Tamura
etal., 2011). e phylogenetic tree was obtained using Neighbor
analysis with 1,000 bootstrap replications.
Analysis of DserNLP Expression
A plug of mycelium of D. seriata VS1c grown on PDA was
inoculated in Erlenmeyer asks containing Czapeck liquid
medium (control conditions) (Cobos et al., 2010) or Czapeck
liquid medium supplemented with chips of grapevine wood as
described by Paolinelli-Alfonso et al. (2016). Each condition was
assayed in triplicate. Aer inoculation, asks were incubated
in an orbital shaker at 25°C and 100 rpm in darkness. Fungal
mycelia were collected from each 24 hours during 6 days. All
collected samples were immediately frozen in liquid nitrogen
and stored at −70°C for RNA isolation. Total RNA was isolated
with 1 mL of TRIzol reagent (Invitrogen) according to the
manufacturer’s instructions. RNA was cleaned up with the
RNeasy Plant Mini Kit (Qiagen) including the on-column
DNase enzymatic treatment. RNA concentration and purity were
measured with NanoDrop 2000 Spectrophotometer (ermo
Scientic). cDNA was synthesized from RNA with PrimeScript
RT Master Mix (Takara). Transcript levels of NLPs were
determined by quantitative real-time PCR (qRT-PCR, TB Green
Premix Ex Taq; Takara). qRT-PCR reactions were carried out
in triplicate in 96-well plates in a 20-µl nal volume containing
1× TB Green Premix Ex Taq (Takara), and 400 nM forward and
reverse primers (Tab le 1). Cycling parameters were 2 min of Taq
polymerase activation at 95°C, followed by 40 two-step cycles
composed of 20 s of denaturation at 95°C, and 20 s of annealing
and elongation at 58°C. Melting curve assays were performed
from 55 to 95°C, and melting peaks were visualized to check
the specicity of amplication. e results obtained for each
gene of interest were normalized to the expression of β-tubulin
gene. ree biological with three technical replicates were used.
Relative gene expression was determined with the formula fold
induction: 2−ΔΔCt, where ΔΔCt = [Ct TG (US) – Ct RG (US)] – [Ct
TG (RS) – Ct RG (RS)]. Ct (cycle threshold) value is based on the
threshold crossing point of individual uorescence traces of each
sample, TG is target gene, RG is reference gene, US is unknown
sample, and RS is reference sample. e genes analyzed were
considered signicantly up- or downregulated when changes in
their expression were >2-fold or <0.5-fold, respectively.
Heterologous Expression in
Escherichia coli
e cDNAs encoding for DserNEP1 and DserNEP2 proteins
(without their putative signal peptides) were amplied and cloned
into pET SUMO vectors and transformed into competent E. coli
One shot Mach1-T1 cells. Recombinant clones were selected and
sequenced to ensure that no erroneous nucleotide changes had
resulted from PCR amplication. Expression of recombinant
proteins in E. coli BL21 (DE3) strain was carried out by using the
Champion pET SUMO Protein Expression System (Invitrogen)
according to the manufacturer’s instructions. Purication of His-
tag fusion proteins from E. coli cell-free extracts was achieved by
anity purication with a Ni-nitrilotriacetic acid resin (Ni-NTA;
Qiagen) balanced with buer A (50 mM NaH2PO4; 300 mM
NaCl; 20 mM imidazole; pH 8.0). Aer extensive washing,
bound proteins were eluted with buer B (50 mM NaH2PO4; 300
mM NaCl; 250 mM imidazole; pH8.0). Upon visual inspection
in a SDS gel, DserNEP-containing fractions were pooled and
dialyzed against a phosphate-buered saline (PBS) solution
(pH 7.4) at 4°C with a Slide-A-lyzer Mini Dialysis Float system
(Pierce). e purity of the recombinant proteins (higher that
98%) was conrmed by SDS PAGE and quantied using the
Bradford method (Bradford, 1976).
Grapevine In Vitro Cultures and Cellular
Callus Production
For the development of in vitro cultures, grapevine shoots
of Tempranillo cultivar, with three to four buds each, were
treated with 16% (w/v) copper oxychloride fungicide (Cobre
TABLE 1 | Oligonucleotides used in this study.
Primer name Primer sequence (5′–3′)
NepFdeg GTRAATGGRTGCGTRCCATTCCC
NepRdeg CCTTCCCARTCGTGRCGGTGRCC
DserNEP1F ATGCTGTCCTCATCACTCTTCTGGCC
DserNEP1R TCACAACGCAGCCTCAGCGAGGTT
DserNEP2F ATGCCGCTCTCCATCCGCTAC
DserNEP2R TCACAACGCCGCCTTGGCCAG
DserNEP3F GCCCCCTTCACCCAGCAGCTGCACG
DserNEP3R TCAAACCCACGCCTTATCCAAATTCCCC
DserNEP4F GCCCCGGCAGCTGCCCCTGAGAG
DserNEP4R TCAAAGGCAGGCCTTGTTAAGGTTG
qDsernep1F ACGCTTTCGCCATCATGTAC
qDsernep1R ACAATGCTCTCCCAGTCGTG
qDsernep2F TACAACGTCTACCCCGTCAAC
qDsernep2R TCTTTGAACGGCACATTGGC
qDsernep3F GGTATGCGTTGCTGGATTGGGATGT
qDsernep4F CGAGCTGCAGTTCAAGACCAGC
qtubulin Dser F GAACGTCTACTTCAACGAGGT
qtubulin Dser R GAGGACAGCACGAGGAACGT

NLPs from Diplodia seriataCobos et al.
4October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
Key-S; Químicas KEY S.A.). Buds were stimulated to sprout
under culture room conditions maintained at 25 ± 2°C with a
16/8-hour light/dark cycle for 2 months. Two kinds of explants
were used: double-node stem segments for in vitro plants and
young leaves for calluses. Explants were surface sterilized by
immersion in 70% (v/v) ethanol for 1 min, and 0.4% (v/v) sodium
hypochlorite solution with four drops of Tween 20 for 2 min, and
then rinsed four to ve times in sterilized water.
In vitro plants were obtained according to Sevillano et al. (2014).
Double-node stem segment explants were cultured on Murashige
and Skoog media (Murashige and Skoog, 1962) supplemented
with 20 g/L sucrose, 1 mg/L benzyl adenine (BA), and 8 g/L agar,
pH 5.8. Stems developed from nodal segments were multiplied
through micro-cutting in order to obtain in vitro plants. All plant
material was grown at 25 ± 2°C under 16/8-hour light/dark cycle
and transferred to fresh medium every 2 months.
For callus induction, young sterilized grape leaves from
Tempranillo cultivar were cultured on GB5 media (Gamborg
et al., 1968) supplemented with 20 g/L sucrose, 1 mg/L
2,4-dichlophenoxyacetic acid (2,4-D), 0.1 mg/L BA, 0.5% (w/v)
charcoal, and 8 g/L agar, pH 5.8. Calluses were maintained at
25 ± 2°C in darkness and transferred to fresh medium monthly.
For establishment of liquid cell suspensions, 1 g of callus pieces
was transferred into 150 mL asks containing 50 mL liquid GB5
media supplemented with 20 g/L sucrose, 0.5 mg/L 2,4-D pH 5.8,
placed in a rotary shaker (120 rpm) under 16/8-hour light/dark
cycle, and routinely subcultured every 15 days. Manipulation of
plant material was always performed on a clean bench and all
instruments and growth media used were sterilized using dry
heat or in autoclave.
In order to test the cultivar susceptibility, 1-year-old plants
of four dierent cultivars (Chardonnay, Cabernet Sauvignon,
Tempranillo, and Sauvignon Blanc) were potted in plastic pots
and regularly irrigated by drip.
Necrosis Activity Assay
In vitro micropropagated V. vinifera plants from Tempranillo
cultivar were inoculated with puried DserNEP1, DserNEP2, or
PBS buer (pH 7.4). We tested dierent protein concentrations
ranging between 0 and 0.5 mg/mL. Protein application was made by
dipping freshly cut micropropagules into DserNEP protein solution
(100 µl), and the propagules were immediately transferred to fresh
medium. Each concentration was assayed in three replicates and the
experiment was repeated at least three times.
Application to potted plants was carried out by leaf inltration
of 20 µl of DserNEP1 and DserNEP2 proteins at 0.15 and
0.30mg/mL, or PBS buer (as negative control). ree plants for
each cultivar and three leaves from each plant were assayed.
Necrosis quantification was carried out by performing an
electrolyte leakage assay, as described previously (Sevillano
et al., 2014), by using 50 mg of leaves that were removed
and washed in 2 mL distilled water 4 days after propagule
inoculation. After 5 min, the water was transferred to other
tubes and electrolyte leakage was measured with a conductivity
meter (Crison 522).
Fluorescein Diacetate Assay (FDA)
FDA assay was used to check cell viability. FDA is converted
by non-specic esterases of vital cells to uorescein, which
produces a bright green uorescence for at least 15 min.
e polar uorescein is trapped in cells with intact plasma
membranes (Widholm, 1972). Cell suspensions were exposed
to puried DserNEP1 (0.15 mg/mL) and DserNEP2 (0.60 mg/mL).
Each concentration was assayed in triplicate. Cell viability
was measured by staining with FDA [1:1 (v/v) dilution of
0.1 mg/mL FDA] 5 days aer inoculation. Aer 2 min in darkness,
cells were observed under a Nikon microscope equipped with
epiuorescence irradiation. Cell viability was expressed as the
TABLE 2 | Nep 1-like proteins used in the phylogenetical analysis.
Organism Accession number Plant pathogenicity of host Reference
Diplodia seriata KKY26562 Botryosphaeria dieback Morales-Cruz et al., 2015
Diplodia seriata KKY20654 Botryosphaeria dieback Morales-Cruz et al., 2015
Diplodia seriata KKY13781 Botryosphaeria dieback Morales-Cruz et al., 2015
Diplodia seriata KKY20647 Botryosphaeria dieback Morales-Cruz et al., 2015
Diplodia seriata AKQ49205 Botryosphaeria dieback This study
Diplodia seriata AKQ49206 Botryosphaeria dieback This study
Diplodia seriata MK978328 Botryosphaeria dieback This study
Diplodia seriata MK978329 Botryosphaeria dieback This study
Neofusicoccum parvum EOD44475 Botryosphaeria dieback Blanco-Ulate et al., 2013b
Neofusicoccum parvum EOD47698 Botryosphaeria dieback Blanco-Ulate et al., 2013b
Neofusicoccum parvum EOD48844 Botryosphaeria dieback Blanco-Ulate et al., 2013b
Neofusicoccum parvum EOD52252 Botryosphaeria dieback Blanco-Ulate et al., 2013b
Neofusicoccum parvum EOD44269 Botryosphaeria dieback Blanco-Ulate et al., 2013b
Phaeoacremonium minimum XP007911059 Esca disease Blanco-Ulate et al., 2013c
Eutypa lata EMR66076 Eutypa dieback Blanco-Ulate et al., 2013a
Eutypa lata EMR63075 Eutypa dieback Blanco-Ulate et al., 2013a
Eutypa lata EMR70921 Eutypa dieback Blanco-Ulate et al., 2013a
Diaporthe ampelina KKY35834 Phomopsis dieback Morales-Cruz et al., 2015
Diaporthe ampelina KKY36076 Phomopsis dieback Morales-Cruz et al., 2015
Diaporthe ampelina KKY37779 Phomopsis dieback Morales-Cruz et al., 2015
Diaporthe ampelina KKY30513 Phomopsis dieback Morales-Cruz et al., 2015

NLPs from Diplodia seriataCobos et al.
5October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
percentage of uorescent cells with respect the total number of
cells checked. e experiment was repeated three times.
Statistical Data Analysis
Conductivity and cell viability data were analyzed using a
weighted least-square ANOVA test to determine if there
were signicant dierences. When F ratios were statistically
signicant, post hoc tests (Tukey’s honestly signicant dierence
test) were performed to establish where the dierences between
groups were. Statistical analyses were performed using R Core
Team 3.0.1 (2014) soware (http://www.R-project.org). Error
bars in graphs indicate SDs. Bars marked with the same letter do
not dier at P = 0.05.
RESULTS
Cloning and Sequence Analysis of
DserNEP Genes
Degenerate primers NEPdF and NEPdR were designed in order
to amplify an internal fragment of DserNEP genes. ese primers
amplied a partial DserNEP sequence of 325 bp that was used as a
probe to screen a D. seriata genomic library. Four bacteriophages
containing the whole sequence of four dierent DserNEP genes
were selected: phage λDASH-DsF1 contained a DserNEP1
gene (NCBI GenBank database accession number AKQ49205),
λDASH-DsF2 phage contained a DserNEP2 gene (AKQ49206),
whereas λDASH-DsF3 phage contained a DserNEP3 gene
(MK978328), and λDASH-DsF4 phage contained a DserNEP4
gene (MK978329).
All the DserNEP genes were amplied by using specic
primers (Table 1). DserNEP1 gene consisted of an open reading
frame (ORF) of 877 bp. DserNEP2 gene consisted of an 858 bp
ORF, whereas DserNEP3 and DserNEP4 ORFs had a size of
897 and 812 bp, respectively. Total RNA isolated from D. seriata
was subjected to RT-PCR to obtain cDNAs of DserNEP genes.
e resulting fragments were cloned and sequenced. Sequence
analysis revealed that the DserNEP1 gene contained a 142 bp
intron to yield a cDNA of 729 bp encoding a 242 amino acid
protein. e DserNEP2 gene contained a 126 bp intron to
generate a 735 bp cDNA encoding a 243 amino acid protein.
e DserNEP3 gene contained a 162 bp intron to generate a
735 bp cDNA encoding a 243 amino acid protein, whereas the
DserNEP4 gene contained a 59 bp intron to generate a 753 bp
cDNA encoding a 250 amino acid protein. Signal peptides were
predicted by using Signal P3 soware (Bendtsen et al., 2004).
is analysis suggested that DserNEP genes contain a typical
signal peptide ranging from 18 to 22 amino acids (Figure 1).
Analysis of Amino Acid Sequences of
DserNEP Proteins
According to sequence analysis, the DserNEP1 protein has an
estimated isoelectric point (Ip) of 4.30 and a molecular mass of
25,384.99 Da; DserNEP2 has an estimated isoelectric point of
4.83 and a molecular mass of 25,647.41 Da; DserNEP3 protein
has an estimated isoelectric point (Ip) of 5.59 and a molecular
mass of 26,434.14 Da whereas DserNEP4 protein has an
estimated isoelectric point (Ip) of 7.12 and a molecular mass of
27,482.45 Da.
D. seriata NEP proteins contain two conserved cysteine
residues at positions 69 and 96 in DserNEP1, positions 64 and 90
in DserNEP2, positions 66 and 92 in DserNEP3, and positions 70
and 97 in DserNEP4. All of them also possessed the characteristic
GHRHDWE central hepta-peptide motif starting at amino acid
positions 132, 129, 130, and 136, respectively (Figure 1).
e publication of the Diaporthe ampelina, D. seriata, and
Phaeomoniella chlamydospora genomes (Morales-Cruz et al.,
2015), and the dra sequenced from Eutypa lata (Blanco-Ulate
et al., 2013a), N. parvum (Blanco-Ulate et al., 2013b), and
Phaeoacremonium minimum (Blanco-Ulate et al., 2013c) as
well as the availability of the sequences posted at Joint Genome
Institute (https://jgi.doe.gov/) revealed that there are no NLPs
homologous in P. chlamydospora genome. P. minimum has two
NLPs homologous (ID 1413 and 3642). N. parvum genome
contains six NLPs homologous (ID 727, 928, 2549, 6217, 6314,
and 7612). E. lata genome contains four NLPs homologous
(ID 1995, 4041, 5290, and 8324) and D. ampelina has ve NLPs
homologous (ID 1057, 1426, 6910, 7604, and 9588), although
some of them are truncated proteins.
A comparison of the amino acid sequences from NLPs
of GTD pathogens was carried out (Figure 2). is analysis
revealed that DserNEP1 exhibited a 100% sequence identity with
a putative NPP1-domain type protein of D. seriata (KKY26562),
90.95% with a necrosis inducing protein from Diplodia corticola
(XP_020133422), and 79.54% with a putative NPP1-domain
type protein from N. parvum (EOD44475). DserNEP2 exhibited
a sequence identity of 99.59% with a putative NPP1-domain type
protein of D. seriata (KKY20654), 79.15% with a npp1 domain
FIGURE 1 | Diagram shows the overall organization of DserNEP genes. The E1–E2 exons are represented in dark gray boxes. Both are separated by an intron
(single line). The position (relative to the initial methionine residue) of the two conserved cysteine residues typical of type I NLP proteins is indicated. Signal peptides
are indicated by black boxes. The relative location of the central hepta-peptide motif typical of NLP proteins in E2 is indicated (italics).

NLPs from Diplodia seriataCobos et al.
6October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
protein (XP_020127860), and 76.13% with a hypothetical protein
MPH_06630 from Macrophomina phaseolina (EKG16193.1),
another Botryosphaeriaceae fungus, and 61.45% with a putative
NPP1-domain type protein from N. parvum (EOD44475).
DserNEP3 exhibited a sequence identity of 100% with
the hypothetical protein BK809_0004431 from D. seriata
(OMP83050), 77.93% with a putative necrosis and ethylene
inducing protein 1 precursor protein from N. parvum
(EOD52252), and 75.00% with a necrosis and ethylene inducing
peptide 1 from D. corticola (XP_020125686).
DserNEP4 exhibited a sequence identity of 100% with
putative npp1 domain protein from D. seriata (KKY20647),
78.09% with a putative necrosis and ethylene inducing peptide
1 precursor protein from N. parvum (EOD44269), and 61.68%
with necrosis and ethylene inducing peptide from D. corticola
(XP_020125686).
Analysis of DserNLP Expression
Expression levels of genes encoding DserNEPs in D. seriata VS1
strain were analyzed in Czapeck liquid medium and compared
to the expression levels observed in the same medium
supplemented with chips of grapevine wood from Tempranillo
cultivar to mimic a putative inductor eect carried out by
some component present in the wood of grapevine plants. e
obtained results showed that only DserNEP1 and DserNEP3
genes were upregulated in the assayed conditions DserNEP1 was
induced at 48 and 72 hours post inoculation, whereas DserNEP3
gene was induced at 72 hours post inoculation. On the contrary,
DserNEP2 and DserNEP4 genes were downregulated in the
assay conditions (Figure 3).
Cytotoxic and Necrotic Activity of D.
seriata NLPs
DserNEP1 and DserNEP2 were selected for further studies
based on the fact that they had been the only two NEP proteins
detected in the secretome of D. seriata in a previous work
(Cobos et al., 2010). Genes encoding DserNEP1 and DserNEP2
proteins were cloned into the pETSUMO expression vector
and expressed in E. coli BL21(DE3). Purified protein yields
were 100 µg/mL for DserNEP1 and 500µg/mL for DserNEP2
FIGURE 2 | Phylogenetic tree of D. seriata NEP proteins with necrosis and ethylene inducing peptide 1-like proteins from GTD-related fungi. The figure shows the
result of a Neighbor analysis performed using the MEGA 5.0 package (Tamura et al., 2011). Percent bootstrap values (1,000 replicates) are shown above the forks.
The scale bar represents 10% weighted sequence divergence.

NLPs from Diplodia seriataCobos et al.
7October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
under the tested assay conditions. The putative phytotoxicity
of NEP proteins was first determined by dipping in vitro
micropropagated V. vinifera plants into NEP suspensions.
We tested different protein concentrations between 0 and
0.5 mg/mL. Necrosis symptoms were clearly visible 3 days
after inoculation at 0.25 and 0.5 mg/mL (Figure 4). At
lower concentrations (0.05 and 0.1 mg/mL), only the plants
inoculated with DserNEP1 showed some symptoms of
necrosis. The effect caused by DserNEP2 was less than that
produced by DserNEP1. In fact, a DserNEP2 concentration
of at least five times higher was required for detecting some
necrotic activity as compared to the effect produced by
DserNEP1. The necrotic symptoms first appeared on the
leaf margin and then progressed through the center of the
leaves. No symptoms were evident at either the lowest protein
concentration tested or in the controls.
e quantication of the necrotic activity was carried out
by inltration of NEP proteins into in vitro micropropagated V.
vinifera plants, followed by a typical electrolyte leakage assay. We
tested the same protein concentrations that we had previously
used in the immersion experiments (Figure 5A). e conductivity
data obtained for inoculated leaves was indicative of some degree
of cell permeability. DserNEP1 cytolytic activity was stronger
than that detected for DserNEP2; this was also the case at lower
concentrations. Cell viability was tested using the FDA assay. V.
vinifera cell suspensions were exposed to puried DserNEP1 (0.15
mg/mL) and DserNEP2 (0.60 mg/mL) proteins. Five days aer
inoculation, nearly all cells in the control suspensions were alive
whereas cell numbers in suspensions treated with the DserNEP1
protein were slightly reduced. Up to four times higher DserNEP2
concentrations were needed for a similar response to be observed, as
compared with DserNEP1 (Figure 5B).
In order to test the eect of these proteins on adult plants,
leaves of 1-year-old Chardonnay V. vinifera plants were
inoculated with 0.15 and 0.30 mg/mL of DserNEP1 and
DserNEP2 proteins by leaf inltration. e necrotic symptoms
were clearly observed aer 2 days of inltration (Figure 6A). e
necrotic symptoms produced by DserNEP1 were quite similar at
both concentrations, and the eect was greater than the eect
produced by DserNEP2 at 0.15 mg/mL (Figure 6B). e highest
necrotic eect was produced by DserNEP2 at 0.30 mg/mL and
both proteins produced larger lesions than the control (wound
inoculated with buer). Although visually the necrotic activity of
DserNEP1 seemed to be slightly higher, no signicant dierences
between the two proteins were detected by performing an
electrolyte leakage assay (Figure 6B).
Four different grapevine cultivars were assayed in order
to test their susceptibility: Chardonnay, Cabernet Sauvignon,
FIGURE 3 | Relative transcript levels of DserNEPs. The relative transcript levels of four DserNEP genes were determined by q-RTPCR using β-tubulin as reference
gene. Samples were recovered at 48, 72, 96, 120, and 144 hours post inoculation. Data shown represent the mean ± SD from three independent experiments.
The genes analyzed were considered significantly up- or downregulated when changes in their expression were > 2-fold or < 0.5-fold, respectively. Bars marked
with the same letter do not differ at P = 0.05

NLPs from Diplodia seriataCobos et al.
8October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
Tempranillo, and Sauvignon Blanc. Three plants from each
cultivar and three leaves from each plant were infiltrated with
DserNEP1 at 0.15 and 0.30 mg/mL, and the conductivity of
the necrotic tissues was measured 4 days after infiltration
(Figure 7). As expected, the effect caused by DserNEP1 was
different depending on the cultivar tested. The largest damage
was produced by DserNEP1 at 0.30 mg/mL in Cabernet
Sauvignon cultivar while the smallest was achieved in the
Chardonnay cultivar. Again no significant differences were
found in the susceptibility of this cultivar to the two protein
concentrations tested.
DISCUSSION
In a previous work, we had detected three hypothetical proteins
in the D. seriata secretome with signicant similarity to necrosis
and ethylene inducing proteins from Nectria haematococca
and Sclerotinia sclerotiorum (Cobos et al., 2010). Peptides were
identied by Mascot and used to design degenerated primers
in order to amplify an internal fragment of DserNEP genes.
Two dierent genes were amplied from D. seriata encoding
proteins with high sequence similarity to NLPs, DserNEP1, and
DserNEP2. e progression of the D. seriata genome sequencing
suggests the putative existence of a small family of related genes
in the genome of D. seriata since four homologous sequences
could be detected (GenBank accession numbers KKY26562,
KKY20654, KKY13781, and KKY20647). Similar results had
been reported for other phytopathogenic fungi such as Botrytis
species, which have two NLPs (Staats et al., 2007b; Schouten
etal., 2008); Moniliophthora perniciosa with three NLPs (García
et al., 2007), or Verticillium dahliae with up to nine NLP genes
(Zhou et al., 2012).
e presence of a signal peptide in their sequences is in
accordance with the extracellular location of the mature proteins
FIGURE 4 | Foliar symptoms caused by DserNEP proteins. Micropropagules of V. vinifera were inoculated by dipping into 100 µl of different concentrations of
DserNEP1 (A), DserNEP2 (B), or buffer (C) as negative control. Pictures were taken 4 days after inoculations. The experiment was repeated three times, always
using three independent samples for each treatment and three negative controls (dipped into buffer). The scale bar represents 1 cm.

NLPs from Diplodia seriataCobos et al.
9October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
previously reported (Cobos et al., 2010). e conserved NPP1
domain is typical for NLP proteins (PFAM domain PF05630)
(Fellbrich et al., 2002). NLPs are classied into two groups,
type I and type II, depending on the presence of two or four
cysteine residues at conserved positions, respectively (Gijzen
and Nurnberger, 2006). Accordingly, DserNEP proteins would
belong to the type I group. DserNEP proteins also possessed
the characteristic GHRHDWE central hepta-peptide motif
(Pemberton and Salmond, 2004). is motif is part of a negatively
charged cavity exposed at the protein surface that is supposed
to be important for the biological activity of NEP proteins
(Ottmann et al., 2009).
e publication of the Diaporthe ampelina, D. seriata, and
Phaeomoniella chlamydospora genomes (Morales-Cruz et al.,
2015), and the dra sequenced from Eutypa lata (Blanco-
Ulate et al., 2013a), N. parvum (Blanco-Ulate et al., 2013b),
FIGURE 5 | Quantification of necrotic activity by electrolyte leakage assay induced by DserNEP proteins in micropropagated plants (A), and viability of V. vinifera
cell cultures treated with DserNEP proteins determined 5 days after protein exposition by staining with FDA (B). DserNEP1 was assayed at 0.05 and 0.1 mg/mL,
DserNEP2 at 0.25 and 0.5 mg/mL, and control leaves were inoculated with water. Data shown represent the mean ± SD from three independent experiments. Bars
marked with the same letter do not differ at P = 0.05.
FIGURE 6 | Plant necrosis promoting activity of DserNEP proteins after infiltration of leaves of 1-year-old plants. Lesion formation 4 days after infiltration is shown (A).
Quantification of the necrotic activity by an electrolyte leakage assay induced by DserNEP proteins. Data shown represent the mean ± SD from three independent
experiments. Bars marked with the same letter do not differ at P = 0.05. Control leaves were inoculated with water. Non-inoculated leaves are marked as NI (B).

NLPs from Diplodia seriataCobos et al.
10 October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
and Phaeoacremonium minimum (Blanco-Ulate et al., 2013c)
have revealed that there are several NLP homologues in each
fungal species, except in case of P. chlamydospora. Some of the
detected sequences have an incomplete conserved hepta-peptide
GHRHDWE motif, and sometimes they lack the upstream
amino acid sequence, including the conserved cysteines, and the
occurrence of premature stop codons suggests that some of these
sequences could be pseudogenes (Gijzen and Nurnberger, 2006;
Staats et al., 2007b).
e analysis of the amino acid sequence of DserNEPs
allowed their location into two dierent branches of a putative
phylogenetic tree, corresponding to type I (two conserved
cysteines) and type II NLPs (four conserved cysteines). NLPs
from GTDs pathogens belong mainly to type I group since solely
E. lata contains NLPs from type I and type II groups. However, this
analysis did not reect the phylogenetic relationship among the
fungal species checked, as it was unable to discriminate between
dierent fungal classes. is could be an indication of an intense
horizontal gene transfer between species as has been suggested
by other authors (Gijzen and Nurnberger, 2006; Zaparoli et al.,
2009). is hypothesis could explain the dierences in G+C
content observed between genes encoding DserNEP proteins
and the D. seriata genome. While the D. seriata genome has a
G+C content of 56.7%, this percentage is increased up to 60%
in DserNEP1, 63% in DserNEP2, 64% in DserNEP3, and 60% in
DserNEP4 genes, suggesting that these sequences could have been
recently acquired by this microorganism and their maintenance
could confer some evolutionary advantage (Pemberton and
Salmond, 2004; García et al., 2007).
Little is known about how NLPs cause necrosis in plant cells,
but several authors indicate that they may play as elicitors by
manipulating cell death programs of the host (Fellbrich et al.,
2002; Zhou et al., 2012) or acting like phytotoxins (Dong et al.,
2012). e detection of DserNEPs during the fungal growth, as
well as the overexpression of DserNEP1 and DserNEP3 in the
presence of the wood chips, suggests a putative role of DserNEPs
as virulence factors. Interestingly, in a previous work Cobos and
colleagues (2010) detected that DserNEP1 and DserNEP2 proteins
were upregulated in the presence of carboxymethylcellulose.
ese dierences in the expression pattern of D. seriata NEP
proteins could be due to the dierent experimental strategy used.
Composition of trunk chips is much more complex than pure
carboxymethylcellulose. We can speculate with the presence in
trunk chips of compounds with an inducing eect on NEP gene
expression, but we cannot rule out the presence of compounds
with the opposite eect. e upregulation of NLP gene expression
during infection has been described in many other plant pathogens
like Botrytis cinerea (Arenas et al., 2010), Magnaporthe oryzae
(Fang et al., 2017), or Verticillium dahliae (Zhou et al., 2012).
e necrotic activity of DserNEP1 and DserNEP2 proteins
has been demonstrated. However, the dierences in their toxicity
could indicate dierences in their mechanism of action. Both
proteins can produce leaf injuries in both in vitro propagated and
adult plants, although the eect of DserNEP1 was stronger than
FIGURE 7 | Grapevine cultivar susceptibility was tested by leaf infiltration with DserNEP1 protein. Grapevine leaves from four different cultivars (Chardonnay,
Cabernet Sauvignon, Tempranillo, and Sauvignon Blanc) were inoculated with DserNEP1 at 0.15 or 0.30 mg/mL. Control leaves were inoculated with water.
Electrolyte leakage was measured for 4 days after infiltration. Data shown represent the mean ± SD from three independent experiments. Bars marked with the
same letter do not differ at P = 0.05.

NLPs from Diplodia seriataCobos et al.
11 October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
that detected for DserNEP2. ese results are in concordance
with the data of NEP activity reported by Staats et al. (2007a)
in Botrytis elliptica. e observed dierences in the results
obtained from in vitro plants of Tempranillo cultivar and those
from Chardonnay 1-year-old potted plants suggest dierences
in cultivar susceptibility. ese dierent susceptibilities could be
related to the specic morphological characteristics or defense
mechanisms of each cultivar. Moreover, the progress of foliar
symptoms was quite similar to that observed in grapevines under
eld conditions. is fact deserves to be highlighted.
Taken together, these results suggest a putative role of DserNEPs
in pathogenesis, especially in development of the leaf symptoms
observed in D. seriata infected grapevines. Both proteins exhibited
necrotic activity although DserNEP1 produced larger lesions
than DserNEP2. However, little is known about the molecular
mechanisms which produce the injuries detected. D. seriata is a
vascular pathogen, but to our knowledge it has never been isolated
from grapevine leaves, suggesting that DserNEP proteins may be
able to reach leaves by some unknown mechanism. e increase
of conductivity detected in inltrated leaves suggests that NLPs
induce plasma membrane disruption in the host. is could drive
the release of host-derived molecules that would trigger damage via
pathogen associated molecular patterns. Other authors suggest that
NLPs could interact with targets in the plasma membrane. Indeed,
Schouten et al. (2008) demonstrated that NLPs are associated
with membranes and are accumulated in the cytosol, nuclear
membrane, and the nucleolus. ey proposed that NLPs might
bind to, or associate with, specic plant lectins resulting in a loss of
membrane integrity, possibly through the pore-forming activity of
NLPs. Intracellular accumulation of NLPs could explain the high
toxicity of these proteins which act as toxins, blocking transcription,
interfering with chloroplast function, or inducing programmed cell
death (Bae et al., 2006).
is is the rst record of Nep1-like proteins from a
fungus associated with GTDs and also from a member of the
Botryosphaeriaceae family. Advances made in sequencing
genomes of fungi associated with GTDs have revealed the
presence of NLPs in most of them. Accordingly, it might be
necessary to assay the role of these proteins in the development of
GTDs, and particularly in the development of foliar symptoms.
Further studies of all the DserNEPs present in the D. seriata
genome and gene replacement assays might help to elucidate their
mode of action and their role in plant–pathogen interactions.
Unfortunately, the diculty in developing an ecient method for
genetic transformation of D. seriata is hampering these studies.
DATA AVAILABILITY STATEMENT
e datasets generated for this study can be found in the
Genbank: AKQ49205, AKQ49206, MK978328, MK978329.
AUTHOR CONTRIBUTIONS
RC and JC analyzed the data, interpreted the results, conceived
and designed the experiments, and contributed materials,
equipment, and analysis tools. PG-A and RC developed the
grapevine in vitro cultures and cellular callus production. RC,
CC, JÁ-P, AD-G, AI, and SG-G conducted the experiments.
RC, JC, and JA wrote the manuscript. All authors reviewed the
manuscript and approved the nal version.
FUNDING
is work was supported by Bodegas Vega Sicilia S.A. (Valbuena
de Duero, Valladolid, Spain).
REFERENCES
Abou-Mansour, E., Débieux, J. L., Ramírez-Suero, M., Bénard-Gellon, M.,
Magnin-Robert, M., Spagnolo, A., et al. (2015). Phytotoxic metabolites from
Neofusicoccum parvum, a pathogen of Botryosphaeria dieback of grapevine.
Phytochemistry 115, 207–215. doi: 10.1016/j.phytochem.2015.01.012
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990).
Basic local alignment search tool. J. Mol. Biol. 215, 403–410. doi: 10.1016/
S0022-2836(05)80360-2
Andol, A., Mugnai, L., Luque, J., Surico, G., Cimmino, A., and Evidente, A.
(2011). Phytotoxins produced by fungi associated with grapevine trunk
diseases. Toxins 3, 1569–1605. doi: 10.3390/toxins3121569
Arenas, Y. C., Kalkman, E. R. I. C., Schouten, A., Dieho, M., Vredenbregt, P.,
Uwumukiza, B. et al. (2010). Functional analysis and mode of action of
phytotoxic Nep1-like proteins of Botrytis cinerea. Physiol. Mol. Plant Pathol.
74, 376–386. doi: 10.1016/j.pmpp.2010.06.003
Bae, H., Bowers, J. H., Tooley, P. W., and Bailey, B. A. (2005). NEP1 orthologs
encoding necrosis and ethylene inducing proteins exist as a multigene family
in Phytophthora megakarya, causal agent of black pod disease on cacao.
Mycological Res. 109, 1373–1385. doi: 10.1017/S0953756205003941
Bae, H., Kim, M. S., Sicher, R. C., Bae, H. J., and Bailey, B. A. (2006). Necrosis-
and Ethylene-Inducing Peptide from Fusarium oxysporum Induces a
Complex Cascade of Transcripts Associated with Signal Transduction and
Cell Death in Arabidopsis. Plant Physiol. 141, 1056–1067. doi: 10.1104/
pp.106.076869
Bailey, B. A. (1995). Purication of a protein from culture ltrates of Fusarium
oxysporum that induces ethylene and necrosis in leaves of Erythroxylum coca.
Phytopathology 85, 1250–1255. doi: 10.1094/Phyto-85-1250
Bénard-Gellon, M., Farine, S., Goddard, M., Schmitt, M., Stempien, E., Pensec,F.,
et al. (2014). Toxicity of extracellular proteins from Diplodia seriata and
Neofusicoccum parvum involved in grapevine Botryosphaeria dieback.
Protoplasma 252, 679–687. doi: 10.1371/journal.pone.0188766
Bendtsen, J. D., Nielsen, H., von Heijne, G., and Brunak, S. (2004). Improved
prediction of signal peptides: signalp 3.0. J. Mol. Biol. 340, 783–795. doi:
10.1016/j.jmb.2004.05.028
Bertsch, C., Ramírez-Suero, M., Magnin-Robert, M., Larignon, P.,
Chong, J., Abou-Mansour, E., et al. (2013). Grapevine trunk diseases:
complex and still poorly understood. Plant Pathol. 62, 243–265. doi:
10.1111/j.1365-3059.2012.02674.x
Blanco-Ulate, B., Rolshausen, P. E., and Cantu, D. (2013a). Dra genome sequence
of the grapevine dieback fungus Eutypa lata UCR-EL1. Genome Announc. 1
(3), e00228–e00213. doi: 10.1128/genomeA.00228-13
Blanco-Ulate, B., Rolshausen, P. E., and Cantu, D. (2013b). Dra genome sequence
of Neofusicoccum parvum isolate UCR-NP2, a fungal vascular pathogen
associated with grapevine cankers. Genome Announc. 1 (3), e00339–e00313.
doi: 10.1128/genomeA.00339-13
Blanco-Ulate, B., Rolshausen, P. E., and Cantu, D. (2013c). Dra genome sequence
of the ascomycete Phaeoacremonium aleophilum strain UCR-PA7, a causal
agent of the esca disease complex in grapevines. Genome Announc. 1 (3),
e00390–e00313. doi: 10.1128/genomeA.00390-13

NLPs from Diplodia seriataCobos et al.
12 October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
Bradford, M. M. A. (1976). Rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem. 72, 248–254. doi: 10.1016/0003-2697(76)90527-3
Chiarappa, L. (2000). Esca (black measles) of grapevine. An overview. Phytopathol.
Mediterr. 39, 11–15. doi: 10.14601/Phytopathol_Mediterr-1537
Cobos, R., Barreiro, C., Mateos, R. M., and Coque, J. J. R. (2010). Cytoplasmic- and
extracellular-proteome analysis of Diplodia seriata: a phytopathogenic fungus
involved in grapevine decline. Proteome Sci. 8, 46. doi: 10.1186/1477-5956-8-46
Crous, P. W., Slippers, B., Wingeld, M. J., Rheeder, J., Marasas, W. F. O.,
Philips, A.J. L., et al. (2006). Phylogenetic lineages in the Botryosphaeriaceae.
Stud. Mycol. 55, 235–253. doi: 10.3114/sim.55.1.235
Dong, S., Kong, G., Qutob, D., Yu, X., Tang, J., Kang, J., et al. (2012). e NLP
Toxin Family in Phytophthora sojae Includes Rapidly Evolving Groups at
Lack Necrosis-Inducing Activity. Mol. Plant Microbe Interact. 25, 896–909. doi:
10.1094/MPMI-01-12-0023-R
Fang, Y. L., Peng, Y. L., and Fan, J. (2017). e Nep1-like protein family of
Magnaporthe oryzae is dispensable for the infection of rice plants. Sci. Rep. 7,
1–10. doi: 10.1038/s41598-017-04430-0
Fellbrich, G., Romanski, A., Varet, A., Blume, B., Brunner, F.,
Engelhardt, S., et al. (2002). NPP1, a Phytophthora-associated trigger
of plant defense in parsley and Arabidopsis. Plant J. 32, 375–390. doi:
10.1046/j.1365-313X.2002.01454.x
Gamborg, O. L., Miller, R. A., and Ojima, K. (1968). Nutrient requirements of
suspension cultures of soybean root cells. Exp. Cell Res. 50, 151–158. doi:
10.1016/0014-4827(68)90403-5
García, O., Macedo, J. A., Tiburcio, R., Zaparoli, G., Rincones, J., Bittencourt, L.M.,
et al. (2007). Characterization of necrosis and ethylene inducing proteins (NEP)
in the basidiomycete Moniliophthora perniciosa, the causal agent of witches’
broom in eobroma cacao. Mycological Res. 111, 443–455. doi: 10.1016/j.
mycres.2007.01.017
Gijzen, M., and Nurnberger, T. (2006). Nep1-like proteins from plant pathogens:
recruitment and diversication of the NPP1 domain across taxa. Phytochemistry
67, 1800–1807. doi: 10.1016/j.phytochem.2005.12.008
Graniti, A., Surico, G., and Mugnai, L. (2000). Esca of grapevine: a disease complex
or a complex of diseases? Phytopathol. Mediterr. 39, 16–20. doi: 10.14601/
Phytopathol_Mediterr-1539
Gubler, W. D., Rolshausen, P. E., Trouillas, F. P., Urbez, J. R., Voegel, T.,
Leavitt,G.M., et al. (2005). Grapevine trunk diseases in California. Pract.
Winery Vineyard Mag. 27, 6–25.
Kuntzmann, P., Vuillaumé, S., Larignon, P., and Bertsch, C. (2010). Esca, BDA
and Eutypiosis: foliar symptoms, trunk lesions and fungi observed in diseased
vinestocks in two vineyards in Alsace. Vitis 49, 71–76.
Larignon, P., and Dubos, B. (1997). Fungi associated with esca disease in grapevine.
Eur. J. Plant Pathol. 103, 147–157. doi: 10.1023/A:1008638409410
Larignon, P., Fulchic, R., Cere, L., and Dubos, B. (2001). Observation on black
dead arm in French vineyards. Phytopathol. Mediterr. 40S, 336–342. doi:
10.14601/Phytopathol_Mediterr-1629
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A.,
McWilliam, H., et al. (2007). Clustal W and Clustal X version 2.0. Bioinformatics
23, 2947–2948. doi: 10.1093/bioinformatics/btm404
Martín, M. T., and Cobos, R. (2007). Identication of fungi associated with
grapevine decline in Castilla y León (Spain). Phytopathol. Mediterr. 46, 18–25.
doi: 10.14601/Phytopathol_Mediterr-1854
Martos, S., Andol, A., Luque, J., Mugnai, L., Surico, G., and Evidente, A. (2008).
Production of phytotoxic metabolites by ve species of Botryosphaeriaceae
causing decline on grapevines, with special interest in the species Neofusicoccum
luteum and N. parvum. Eur. J. Plant Pathol. 121, 451–461. doi: 10.1007/
s10658-007-9263-0
Möller, E. M., Bahnweg, G., Sandermann, H., and Geiger, H. H. (1992). A simple
and ecient protocol for isolation of high molecular weight DNA from
lamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Res. 20,
6115–6116. doi: 10.1093/nar/20.22.6115
Mondello, V., Songy, A., Battiston, E., Pinto, C., Coppin, C., Trotel-Aziz, P., et al.
(2018). Grapevine Trunk Diseases: a review of een years of trials for their
control with chemicals and biocontrol agents. Plant Dis. 102, 1189–1217. doi:
10.1094/PDIS-08-17-1181-FE
Morales-Cruz, A., Amrine, K. C. H., Blanco-Ulate, B., Lawrence, D. P.,
Travadon,R., Rolshausen, P. E., et al. (2015). Distinctive expansion of gene
families associated with plant cell wall degradation, secondary metabolism,
and nutrient uptake in the genomes of grapevine trunk pathogens. BMC
Genomics 16, 469. doi: 10.1186/s12864-015-1624-z
Motteram, J., Kufner, I., Deller, S., Brunner, F., Hammond-Kosack, K. E.,
Nurnberger, T., et al. (2009). Molecular characterization and functional
analysis of MgNLP, the sole NPP1 domain-containing protein, from the fungal
wheat leaf pathogen Mycosphaerella graminicola. Mol. Plant-Microbe Interact.
22, 790–799. doi: 10.1094/MPMI-22-7-0790
Mugnai, L., Graniti, A., and Surico, G. (1999). Esca (black measles) and brown
wood streaking: two old and elusive diseases of grapevines. Plant Dis. 83, 404–
417. doi: 10.1094/PDIS.1999.83.5.404
Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473–479. doi:
10.1111/j.1399-3054.1962.tb08052.x
Oome, S., and Van Den Ackerveken, G. (2014). Comparative and Functional
Analysis of the Widely Occurring Family of Nep1-Like Proteins. Mol. Plant-
Microbe Interact. 27, 1081–1094. doi: 10.1094/MPMI-04-14-0118-R
Ottmann, C., Luberacki, B., Kufner, I., Koch, W., Brunner, F., Weyand, M.,
et al. (2009). A common toxin fold mediates microbial attack and plant
defense. Proc. Natl. Acad. Sci. U.S.A. 106, 10359–10364. doi: 10.1073/
pnas.0902362106
Paolinelli-Alfonso, M., Villalobos-Escobedo, J. M., Rolshausen, P., Herrera-
Estrella, A., Galindo-Sánchez, C., López-Hernández, J. F., et al. (2016). Global
transcriptional analysis suggests Lasiodiplodia theobromae pathogenicity
factors involved in modulation of grapevine defensive response. BMC Genomics
17, 615. doi: 10.1186/s12864-016-2952-3
Pemberton, C. L., and Salmond, G. P. (2004). e Nep1-like proteins—a growing
family of microbial elicitors of plant necrosis. Mol. Plant Pathol. 5, 353–359.
doi: 10.1111/j.1364-3703.2004.00235.x
Phillips, A. J. L. (2002). Botryosphaeria species associated with diseases of
grapevines in Portugal. Phytopathol. Mediterr. 41, 3–18. doi: 10.14601/
Phytopathol_Mediterr-1655
Phillips, A. J. L., Crous, P. W., and Alves, A. (2007). Diplodia seriata, the anamorph
of “Botryosphaeria obtusa“. Fungal Divers. 25, 141–155.
Punithalingam, E., and Waller, J. M. (1976). Botryosphaeria obtusa. Description
of Pathogenic Fungi and Bacteria 394. Kew, Surrey, England: Commonwealth
Mycological Institute.
Qutob, D., Kemmerling, B., Brunner, F., Kufner, I., Engelhardt, S., Gust, A. A.,
etal. (2006). Phytotoxicity and innate immune responses induced by Nep1-like
proteins. Plant Cell 18, 3721–3744. doi: 10.1105/tpc.106.044180
R Core Team, (2014). R: A language and environment for statistical computing.
Vienna, Austria: R Foundation for Statistical Computing.
Ramírez-Suero, M., Bénard-Gellon, M., Chong, J., Laloue, H., Stempien, E.,
Abou-Mansour, E., et al. (2014). Extracellular compounds produced by
fungi associated with Botryosphaeria dieback induce dierential defence
gene expression patterns and necrosis in Vitis vinifera cv. Chardonnay cells.
Protoplasma 251, 1417–1426. doi: 10.1007/s00709-014-0643-y
Schouten, A., van Baarlen, P., and van Kan, J. A. (2008). Phytotoxic Nep1-
like proteins from the necrotrophic fungus Botrytis cinerea associate with
membranes and the nucleus of plant cells. New Phytol. 177, 493–505. doi:
10.1111/j.1469-8137.2007.02274.x
Sevillano, S., Cobos, R., García-Angulo, P., Alonso-Monroy, A., Álvarez-
Rodriguez, M. L., Álvarez-Pérez, J. M., et al. (2014). Manganese transporter
protein MntH is required for virulence of Xylophilus ampelinus, the causal
agent of bacterial necrosis in grapevine. Aust. J. Grape Wine Res. 20, 442–450.
doi: 10.1111/ajgw.12090
Shoemaker, R. A. (1964). Conidial states of some Botryosphaeria species on Vitis
and Quercus. Can. J. Bot. 42, 1297–1301. doi: 10.1139/b64-122
Siebert, J. B. (2001). Eutypa: the economic toll in vineyards. Wines Vines 82, 50–56.
Spagnolo, A., Mondello, V., Larignon, P., Villaume, S., Rabenoelina, F.,
Clément, C., et al. (2017). Defense Responses in Grapevine (cv.
Mourvèdre) after Inoculation with the Botryosphaeria Dieback Pathogens
Neofusicoccum parvum and Diplodia seriata and Their Relationship with
Flowering. Int. J. Mol. Sci. 18, 393. doi: 10.3390/ijms18020393

NLPs from Diplodia seriataCobos et al.
13 October 2019 | Volume 10 | Article 1282Frontiers in Plant Science | www.frontiersin.org
Staats, M., van Baarlen, P., Schouten, A., and van Kan, J. A. L. (2007a). Functional
analysis of NLP genes from Botrytis elliptica. Mol. Plant Pathol. 8, 209–214. doi:
10.1111/j.1364-3703.2007.00382.x
Staats, M., van Baarlen, P., Schouten, A., van Kan, J. A. L., and Bakker, F. T. (2007b).
Positive selection in phytotoxic protein-encoding genes of Botrytis species.
Fungal Genet. Biol. 44, 52–63. doi: 10.1016/j.fgb.2006.07.003
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011).
MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,
2731–2739. doi: 10.1093/molbev/msr121
Van Niekerk, J. M., Crous, P. W., Fourie, P. H., and Hallen, F. (2004). DNA
phylogeny, morphology and pathogenicity of Botryosphaeria species on
grapevines. Mycologia 96, 781–798. doi: 10.1080/15572536.2005.11832926
Widholm, J. M. (1972). e use of uorescein diacetate and phenosafranine for
determining viability of cultured plant cells. Stain Technol. 47, 189–194. doi:
10.3109/10520297209116483
Zaparoli, G., Cabrera, O. G., Medrano, F. J., Tiburcio, R., Lacerda, G.,
and Pereira, G. G. (2009). Identication of a second family of genes in
Moniliophthora perniciosa, the causal agent of witches’ broom disease in
cacao, encoding necrosis-inducing proteins similar to cerato-platanins. Mycol.
Res. 113, 61–72. doi: 10.1016/j.mycres.2008.08.004
Zhou, B.-J., Jia, P.-S., Gao, F., and Guo, H.-S. (2012). Molecular Characterization
and Functional Analysis of a Necrosis-and Ethylene-Inducing, Protein-
Encoding Gene Family from Verticillium dahliae. Mol. Plant Microbe Interact.
25, 964–975. doi: 10.1094/MPMI-12-11-0319
Conict of Interest: e authors declare that the research was conducted in the
absence of any commercial or nancial relationships that could be construed as a
potential conict of interest.
Copyright © 2019 Cobos, Calvo-Peña, Álvarez-Pérez, Ibáñez, Diez-Galán,
González-García, García-Angulo, Acebes and Coque. This is an open-access
article distributed under the terms of the Creative Commons Attribution License
(CC BY). The use, distribution or reproduction in other forums is permitted,
provided the original author(s) and the copyright owner(s) are credited and
that the original publication in this journal is cited, in accordance with accepted
academic practice. No use, distribution or reproduction is permitted which does
not comply with these terms.