Content uploaded by Muqdad Ali
Author content
All content in this area was uploaded by Muqdad Ali on Jun 15, 2021
Content may be subject to copyright.
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7439 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
MORPHOLOGICAL AND MOLECULAR IDENTIFICATION OF
CAPOETA TRUTTA (CYPRINIDAE) AND PLANILIZA ABU
(MUGILIDAE) FRESHWATER FISH IN SULAIMANI
GOVERNORATE, IRAQ
ALI, M. K.1* – ABDULLAH, S. M. A.2
1Department of Animal Science, College of Agricultural Science, University of Sulaimani,
Sulaimani, Iraq
2Department of Fish and Aquatic Resource, College of Agriculture, University of Salahaddin,
Erbil, Iraq
(phone: +964-770-365-5545)
*Corresponding author
e-mail: muqdad.ali@univsul.edu.iq
(Received 3rd Mar 2019; accepted 1st May 2019)
Abstract. The morphological similarities of species of Capoeta and Planiliza genera make the
identification difficult in some cases. Thus, this classification should be confirmed by molecular
examination. In this study, 150 specimens of Capoeta trutta (Cyprinidae) were collected from Dukan
Lake and 120 specimens of Planiliza abu (Mugilidae) from Sirwan River in northwestern and
southeastern Sulaimani Governorate, respectively. The two fish species recorded were native species. The
DNA sequences of both species of fish (C. trutta and P. abu) were mitochondrial DNA cytochrome c
oxidase subunit I (mtDNA COI) locus 617 bp with 61 cytochrome b (cytb) gene, partial cds;
mitochondrial, 446 bp respectively. Following analysis the sequences were compared with sequences of
other genera and fish species stored in GenBank. DNA sequencing results showed that studied species
belong to Capoeta trutta and Planiliza abu. We conclude, in the view of the results of the present study,
that DNA sequence analysis revealed and confirmed the validity of these two species.
Keywords: fishes, morphometric measure and meristic, molecular examination, DNA sequencing, Iraq
Introduction
Among the several families of freshwater fishes in the world the most diverse one is
Cyprinidae having 220 genera including 2420 species, which belong to Cypriniformes
order (Nelson, 2006). Most of Iraqi fish belong to Cyprinidae family, which involving
16 genera with 32 cyprinid species (Coad, 1998; Coad and Hussein, 2007). The
distribution area of cyprinid genus Capoeta includes Western to Central Asia, such as
Armenia, Azerbaijan, Afghanistan, Israel, Anatolia, Iraq, Uzbekistan, Georgia, and Iran
(Banarescu, 1991). Genus Capoeta includes almost 10 species, 4 out of these occur in
Iraq (Coad, 2010). The species commonly appear in streams and lakes, thus in both fast
and slow flowing waters (Geldiay and Balik, 1996). Capoeta trutta (Heckel, 1843) is a
fish species having economic importance with wide distribution in Turkey, Iran, Iraq
and Syria (Gunduz et al., 2014), which is dominantly thriving in both the Euphrates and
Tigris river systems (Geldiay and Balik, 2007).
The grey mullets or mullets were discovered world-wide in temperate to tropical
coastal waters directly entering in estuaries and they are also resident in freshwaters.
There are around 75 species and 20 genera in world (Nelson et al., 2016). In Iraq only
four species are exist (Coad, 2010). Planiliza abu is a mugilid species discovered in
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7440 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
channels, drains, lakes, reservoirs ponds, canals, rivers, and streams on fish farms with
entering estuaries. Ozdilek (2003) and Kuru (1979) state that in Syria, Iraq, Pakistan,
Turkey and Iran, mullet often occurs in inhabited places or schools. Liza abu, mugilid
fish (Heckel, 1843), locally known as khisni, is distributed in all part of mid and south
inland waters of Iraq (Al-Daham, 1984).
Fishes in the genera Chelon, Ellochelon and Planiliza were previously in the genus
Liza (Jordan and Swain, 1884). Molecular data has caused a re-assessment that can be
found in the literature (Durand et al., 2012; Nematzadeh et al., 2013; Xia et al., 2016).
Various authors have or have not accepted, these generic replacements but the review of
these opinions is beyond the scope of this paper. Most of the literature cited below
refers to the species discussed under the genus Liza (except for Mugil cephalus) but the
genus name has been changed in this text for consistency.
Nowadays via using characteristics other than morphological traits mullet species
phylogenic relationships were determined based on molecular genetics and advanced
techniques have been developed for studying DNAs in diverse populations and also for
identifying fish species via using nuclear (nDNA) and mitochondrial (mtDNA)
genomes (Semina et al., 2007; Avis, 1991; Papasotiropoulos et al., 2007). For the study
of phylogenetic relationships and molecular systematic in population genetics the
mtDNA is an efficient genetic marker due to maternal inheritance, and lesser mean rate
of recombination, of replacement and exchange in mtDNA nucleotides than those in
nDNA (Ghorashi et al., 2008; Asensio, 2007).
The morphological similarities of species of Capoeta and Planiliza genera make the
identification difficult in some cases. Thus, the aim of this study is to confirm this
classification by molecular examination.
Materials and methods
Description of study area
Dukan Lake is situated in north western Sulaimani City, Kurdistan Region, in the
north of Iraq. It is approximately 76 km far from the city center (Shaban, 1980).
According to Toma (2000) the lake has unregulated spillway at 515 m above sea level
and full-pool operating altitude of 511 m, its boundaries extend between 34°17’N –
36°33’N latitude with 43°17’E – 46°24’E longitude (Fig. 1).
Sirwan River is situated in south eastern Sulaimani City. It is called Diyala in Arabic
and Sirwan in Kurdish. It flows in western Iran from its headwaters in Zagros
Mountains to south of Baghdad to its ultimate confluence with the Tigris River. The
latitude of Sirwan River is 33° 13’ 14.88” N and its longitude is 44° 30’ 23.04” E
(Fig. 1).
Sample collection
A total of 150 Capoeta trutta specimens have been collected from Dukan Lake in
north western Sulaimani governorate and 120 individual of Planiliza abu were collected
from Sirwan River in the Sulaimani governorate by fishermen using gill nets, during the
period from November, 2017 until May 2018. Fish were transported with local river
water in a cool box to laboratory.
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7441 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
Figure 1. Map of Iraq showing Dukan Lake and Sirwan River
Morphometric measure and meristic study
The specimens were brought out of the cool box and the body length was measured
using a one-meter measuring board graduated in millimetres (mm). The morphometric
parameters were measured from left side of each specimen. According to Beckman
(1962) and Coad (2010, 2017), morphometric characters and meristic were studied as
shown in Table 1.
Extraction of DNA
Samples were taken from the liver of two fish species their identification by
morphological characters only. Samples (20 mg) collected from the liver tissue samples
were digested and homogenized, and stored in liquid nitrogen. According the protocol
of AccuPrep® Genomic DNA extraction Kit (Bioneer Corporation Cat. No.: K-3032
Korea), genomic DNA was extracted.
Agarose gel (1%) electrophoresis used to assess and identify the quality of the
extracted DNA.
PCR amplification
In Capoeta trutta to amplify mtDNA COI locus by Darabi (2014) viz., the following
primer was used COI-625F: 5’-TCAACCAACCACAAAGACATTGGCAC-3’ and
COI-625 R: 5’-GACTTCTGGGTGGCCAAA-GAATCA-3’ have been used in this
study. Amplifications of DNA were performed using a thermal cycler (MultiGene
OptiMax Thermal Cycler TC9610 /TC9610-230, Applied Bio systems, USA) with the
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7442 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
final reaction volume of 25 μl. Each reaction contained prime taq premix (2X) Genet
Bio PCR master mix (Taq DNA Polymerase 1 unit/10 μl, 20 mM Tris-HCl, 80 mM
KCl, 4 mM MgCl2, enzyme stabilizer, sediment, loading dye, pH 9.0, 0.5 mM of each
dATP, dCTP, dGTP, dTTP), primers (10 pmoles/μl), DNA template (40 ng) and water
free DNase. Initial denaturation was carried out for 3 min at 95 °C, followed by 35
cycles of denaturation at 95 °C for 30 s; annealing at 62 °C for 30 s and extension at
72 °C for 45 s followed by a final extension at 72 °C for 10 min (Parmaksiz and Eksi,
2017).
Table 1. Morphological characters and meristic abbreviations and description
Abbreviations Description
TL
Total length
SL
Standard length
HL
Head length
BD
Body depth
ED
Eye diameter
SnL
Snout length
Pre
-
O
Pre orbital dista
nce
PrD
Pre dorsal fin distance
LD
Length of the dorsal
-
fin ray
Pre
-
Pectoral
Pre pectoral fin distance
Pre
-
Pelv
Pre pelvic fin distance
Pre
-
ans
Pre
–
anal distance
LA
Length of the anal
-
fin ray
ALL
Above lateral line scales
BLL
Below lateral line s
cales
PrD1
First pre dorsal fin distance
PrD2
Second pre dorsal fin distance
Primers have been used to amplify 61 cytochrome b (cytb) gene, partial cds;
mitochondrial, primers designed from cytochrome b (cytb) gene GenBank:
(JQ060190.1), F: CTGCATTCGTAGGCTATGTC and R:
GTGCTAGAACCCCTCCTAGC for Planiliza abu fish. PCR was performed with a
profile of initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation
at 95 °C for 30 s, annealing at 61 °C for 30 s, extension at 72 °C for 30 s and final
extension at 72 °C for10 min.
Agarose gel electrophoresis separation
A volume of 10 μl PCR product on 2% agarose gel was electrophoresed. Ethidium
bromide was used to stain bands, which were visualized on a gel documentation
(ENDURO™ GDS Touch Gel Documentation System) by using 100 bp DNA ladder
(gene direx). The ladder was supplied in a ready for using format having fluorescent
tracking dyes and DNA stain. The expected size of the PCR amplicon was 625 bp for
Capoeta trutta and 521 bp for Planiliza abu.
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7443 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
DNA sequencing
A mitochondrial DNA cytochrome c oxidase subunit I (mtDNA COI) locus and
cytochrome b (cytb) gene were amplified by PCR. In the present study, Genetic
analyzer 3500, Applied Bio systems (USA) was used to find the nucleotides order of
mtDNA COI and cytb for C. trutta and P. abu fish samples, respectively. The PCR
product of the fish samples were used for sequence specific PCR amplification and sent
to the Macrogen Company in South Korea for nucleotide sequence analyses.
Results
A total of 150 Capoeta trutta specimens were collected from Dukan Lake in north
western Sulaimani governorate and 120 specimens of the Planiliza abu were collected
from Sirwan River in south eastern Sulaimani governorate.
Morphology
The morphological characters and meristic of Capoeta trutta and Planiliza abu are
indicated in Table 2. Figures 2 and 3 show the general morphology of Capoeta trutta
and Planiliza abu, respectively.
Table 2. The results of morphological characters and meristic for Capoeta trutta (Heckel,
1843) and Planiliza abu (Heckel, 1843)
Abbreviations Range Capoeta trutta Range Planiliza abu
TL
18
-
32 (25) cm.
14
-
21 (17.5) cm.
SL
15
-
27.5 (21.25) cm.
12
-
18 (15) cm.
HL
4
-
5 (4.5) cm
3
–
3.5 (3.25) cm
BD
4.5
-
7 (5.75) cm
4
–
5.5 (4.75) cm
ED
0.7
–
1.3(1) cm
0.8
–
0.9 (0.85) cm
SnL
0.9
–
1.5 (1.2) cm
1 cm
Pre
-
O
1.5
-
2 (1.7
5) cm
1
–
1.5 (1.25) cm
PrD
8
–
12.5 (10.25)
-
LD
3.2
–
5.5 (4.35) cm
2.5
–
3.5 (3) cm
Pre
-
Pectoral
4
–
5.5 (4.75) cm
4
–
4.5 (4.25) cm
Pre
-
Pelv
9.5
–
13 (11.25) cm
6
–
7 (6.5) cm
Pre
-
ans
14
–
20 (17) cm
11.5
–
13 (12.25) cm
LA
3
-
5 (4) cm
2
–
3 (2.5) c
m
ALL
14
-
17
7
BLL
11
-
14
6
Number of barbels
One pair barbels on the upper jaw
No barbels
The pectoral fin ray length
3
–
3.8 (3.4) cm
2
–
2.8 (2.4) cm
PrD1
-
7
–
8 (7.5) cm
PrD2
-
11.5
–
13 (12.25)
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7444 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
Figure 2. Capoeta trutta
Figure 3. Planiliza abu
DNA sequence
DNA extraction performed on 150 and 120 specimens for Capoeta trutta and
Planiliza abu, respectively were successfully generated product containing DNA.
The result of the present study of sequencing DNA of two species of fish, were
mtDNA COI locus in Capoeta trutta about 617 bp and cytochrome b (cytb) gene, partial
cds; mitochondrial in Planiliza abu about 446 bp put to BLAST then compared with
sequences of other genera and fish species stored in GenBank. The molecular study
showed the presence of two species belonging to Capoeta trutta and Planiliza abu.
BLAST results are indicated in Table 3.
Table 3. The BLAST results of fish species
No. Samples Genus and species Molecular based homology (%)
1
Capoeta trutta
100%
identified homology
2
Planiliza abu
100%
identified homology
Partial cds, Cytochrome oxidase subunit I (COI) gene mitochondrial and partial cds
61 cytochrome b (cytb) gene mitochondrial are compatible with the same sequence
fragment marker, which is available at the GeneBank in the National Center for
Biotechnology Information (NCBI). Figures 4a, b and 5a, b showed pair wise analysis
and partial sequence of the two fish specimens.
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7445 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
Figure 4a. The partial sequencing result of partial cds, Cytochrome oxidase subunit I (COI)
gene; of Capoeta trutta
Figure 4b. Pair wise alignment partial cds, Cytochrome oxidase subunit I (COI) gene of
Capoeta trutta. Query is the study or sample sequence and Subject is the GenBank sequence
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7446 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
Figure 5a. The partial sequencing result of Cytochrome oxidase subunit I (COI) gene, of
Planiliza abu
Figure 5b. Pair wise alignment of partial cds, Cytochrome oxidase subunit I (COI) gene of
Planiliza abu. Query is the study or sample sequence and subject is the GenBank sequence
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7447 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
Discussion
Traditionally, in the freshwaters of Iraq, four species (Capoeta aculeata, Capoeta
barroisi, Capoeta damascina and Capoeta trutta) represent the genus Capoeta and four
species (Liza abu, Liza klunzingeri, Liza oligolepis and Liza subviridis) represent the
genus Liza (Coad, 2010).
The presences of two species of fish in this study are showed belonging to the family
of Cyprinidae and Mugilidae. The description and measurement of present samples of
two fish species in this study are similar to those received from Beckman (1962) and
Coad (2010).
As a comparison between some characteristics of Capoeta trutta in this study such as
standard length, total length, body depth, head length, eye diameter, length of the
dorsal-fin ray, snout length, length of the anal-fin ray, above lateral line scales and
below lateral line scales are 25, 21.25, 4.5, 5.75, 1, 1.2, 4.35, 4, (14-17) and (11-14),
respectively are in agreement with the results of Agha (2017), which are 28.18, 23.74,
4.86, 5.7, 0.76, 1.5, 4.98, 3.6, (15-16) and (10-11).
Standard length, total length, body depth, head length, eye diameter, length of the
dorsal-fin ray, snout length, length of the anal-fin ray, above lateral line scales and
below lateral line scales of Planiliza abu in this study are 17.5, 15, 3.25, 4.75, 0.85, 1, 7
and 6, respectively are in agreement with the results of Agha (2017), which are 18.38,
16, 3.53, 4.45, 0.75, 1, 7, 6.
The morphological results of Planiliza abu in this study are similar to the results of
Khayyami et al. (2014) on morphological variability of Liza abu and Mohamed et al.
(2016) on comparative taxonomical for (Planiliza subviridis, P. klunzingeri, P. carinata
and Osteomugil speigleri). Standard length of Planiliza abu in this study is in agreement
with the results of Mohamed et al. (2018).
In Iraq, there has not been any molecular research on Capoeta trutta and Planiliza
abu, but Cyprinidae and Mugilidae families have been examined. The results of
Capoeta trutta in family Cyprinidae in this study are in agreement with the results of
Faddagh et al. (2012a) who identified eight cyprinid fish species, and discovered high
similarity between Barbus species, from 84.4% between B. Kersin and B. xanthopterus
to 52% between B. sharpeyi and B. barbulus to 86.9% between A. vorax and B. grypus.
Faddagh et al. (2012b) also used the mitochondrial 16S rRNA gene fragment as a
molecular marker to study taxonomical status of seven cyprinin fish species in Iraqi
inland waters: Barbus kersin, B. xanthopterus, B. barbulus, B. sharpeyi, B. grypus,
Cyprinus carpio and C. luteus, the results assured that the six Barbus species genetically
belong to sub-family Cyprininae which belong to family Cyprinidae. Aziz (2015)
examined nine species of Cyprinidae family, the result of DNA sequencing showed that
all species belong to family Cyprinidae the phylogenetic relationship degree with this
family for C. luteus was a BP of 87%, for C. regium, C. carpio and C. Carassius was a
BP of 75%, for C. macrostomum, L. esocinus, C. trutta and L. xanthopterusa was a BP
of 90% and for Barbus grypus was a BP of 76%.
In this study the results are in agreement with Parmaksiz and Eksi (2017) who used
mtDNA COI 625 locus to study the genetic diversity of populations from 47 samples of
Capoeta trutta. The result of sequence analysis showed six polymorphic sites and seven
haplotypes on that locus, which is also in agreement with Turan (2008) determination of
subspecies of Capoeta corresponding to taxonomic entities and defined species using
traditional gene sequencing of mitochondrial 16S rDNA. The database included 124
variable sites, parsimony informative was 103 sites. The results in this study are similar
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7448 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
to the results of Zareian et al. (2016) who used mitochondrial cytochrome b gene
sequences for phylogenetic relationship of Capoeta species, and it was found that three
major groups were detected: Clade I: Capoeta trutta group which is the Mesopotamian
Capoeta group having very close related taxa (barroisi, trutta and turani). Clade II:
Capoeta damascina complex group (capoeta group small scale) including the
Anatolian-Iranian groups such us (buhsei, saadii, banarescui and damascina) and
widespread highly diversified groups. Clade III comprises closely related taxa; Capoeta
capoeta complex group (the Aralo-Caspian group, large scale capoeta group).
The results in this study are in agreement with Nematzadeh et al. (2013) using PCR-
sequencing method to establish phylogenetic relationships among six mugilidae species
(M. capito, Valamugil buchanani, Mugil cephalus, Liza subviridis, L. saliens and L.
aurata) and genetic differences were determined. The results demonstrate that in the
mitochondrial 16s rRNA genome number of bases was approximated 600 base pairs.
Also (Lai et al., 2011) (80) random primers for random amplified polymorphic DNA
(RAPD) were used for the examination of 15 fish families. Results clarify that in the
Mugilidae family a novel specific PCR product was found, OPAV04 primer was
employed also in the Liza genus, by using OPAV10 primer other novel specific PCR
product was found.
The results of the present study are not in agreement with Faddagh et al. (2012b the
Liza abu and Liza klunzingeri did not respond to the modified primer in mitochondrial
16S rRNA gene but in this study Planiliza abu responded to the cytochrome b (cytb)
gene, partial cds; mitochondrial.
This taxonomic position has changed and most researchers in the field now agree that
DNA coding is a useful tool in the process of identifying and indexing species. There
are still researchers who doubt that one can distinguish the gene of all species and refers
to the fact that taxonomists who evaluate their findings on morphological basis have a
range of many different characters, not one, to help them identify, for this the present
study used a molecular tool for identification. Molecular techniques such as PCR and
DNA sequencing were proven to be very specific and highly sensitive to detect species
of fish. However, using them in diagnostic laboratories are very rare.. Moreover, DNA
amplification is not cheap and it is tedious, also samples can face cross contamination
which is dangerous, fortunately nowadays by developed methods these issues are
decreased (Agha, 2017).
In the present study, 617 and 446 bp were aligned for Capoeta trutta and Planiliza
abu respectively; the two specimens were morphologically identified by using Coad
keys. The sequences compared with sequences of other genera and fish species stored in
Gen Bank. The results showed that the morphometric data and molecular methods were
successful in identifying of C. trutta and P. abu.
Samples of Capoeta trutta and Planiliza abu have been morphologically identified.
DNA sequencing results showed that the studied two fish species belong to Capoeta
trutta and Planiliza abu. Gen Bank analysis indicated that the two sequenced species
were correctly identified.
Conclusions
In the view of the results of the present study, Capoeta trutta and Planiliza abu were
morphologically identified. The results of DNA sequencing revealed and confirmed the
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7449 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
validity of the two fish species and indicated that the two sequenced species were
correctly identified by using COI and cytochrom b gene.
Acknowledgements. A special thanks to Asst. Prof. Dr. Bahzad Hama Salih Mustafa the Head of Animal
Science Department for his continuous help during the study.
REFERENCES
[1] Agha, G. F. (2017): Morphological and molecular identification of some inhabitant fishes
in greater Zab River/Aski-Kalak in Kurdistan Region, Iraq. – M.Sc. Thesis, College of
Agriculture, University of Salahaddin, Arbil, Iraq.
[2] AL-Daham, N. K. (1984): Fishes of Iraq and the Arab Gulf, Vol. 3, Perciformes
(Mugiloidei) to Tetraodontiformes. – Basrah University Press, Basrah (in Arabic).
[3] Asensio, L. G. (2007): PCR-based methods for fish and fishery products authentication. –
Food Science &Technology Journal 18: 558-568.
[4] Avis, J. C. (1991): Molecular Markers, Natural History and Evolution. – Chapman and
Hall, New York.
[5] Aziz, D. M. A. (2015): Comparative hemato-biochemical profiles and phylogenetic study
of some Cyprinids in Dukan Lake, Kurdistan. – Master of Science Thesis, College of
Science, University of Salahaddin, Arbil.
[6] Banarescu, P. (1991): Zoogeography of Fresh Waters. Distribution and Dispersal of
Freshwater Animals in North America and Eurasia. Vol. 2. – Aula-Verlag, Wiesbaden.
[7] Beckman, W. C. (1962): The Freshwater Fishes of Syria and Their General Biology and
Management. – Fisheries Biology Branch Technical Paper. FAO, Rome.
[8] Coad, B. W. (1998): Systematic biodiversity in the freshwater fishes of Iran. – Ital. J.
Zool. 65: 101-108.
[9] Coad, B. W., Hussain, N. A. (2007): First record of the exotic species Hemiculter
leucisculus (Actinopterygii: Cy-prinidae) in Iraq. – Zoology in the Middle East 40: 107-
109.
[10] Coad, B. W. (2010): Freshwater Fishes of Iraq. – Pensoft Series Faunistica, 93. Pensoft,
Moscow.
[11] Coad, B. W. (2017): Freshwater Fishes of Iran. – www.braincoad.com.
[12] Darabi, A. R., Kashan, N., Fayazi, J., Aminafshar, M., Chamani, M. (2014): Investigation
of phylogenetic relationship among two Barbus species (Cyprinidae) populations with
mitochondrial DNA using PCR sequencing. – IJBPAS 4(2): 302-311. DOI:
10.12692/ijb/5.2. 41-46.
[13] Durand, J –D., Shen, K-N., Chen, W.-J., Jamandre, B. W., Biel, H., Diop, K., Nirchio,
M., Garciade león, F. J., Whitfield, A. K., Chang, C.-W., Borsa, P. (2012): Systematics of
the grey mullets (Teleostei: Mugiliformes: Mugilidae): Molecular phylogenetic evidence
challenges two centuries of morphology based taxonomy. – Molecular Phylogenetics and
Evolution 64(1): 63-92.
[14] Faddagh, M. S., Hussain, N. A., AL-Badran, A. I. (2012a): DNA fingerprinting of eight
cyprinid fish species of Iraqi inland waters using RAPD-PCR technique. – Advances in
Life Sciences 2(2): 9-16.
[15] Faddagh, M. S., Hussain, N. A., AL-Badran, A. I. (2012b): Usage mitochondrial 16S
rRNA gene as molecular marker in taxonomy of Cyprinin fish species (Cyprinidae:
Teleostei). – JKAU: Mar. Sci. 23(1): 39-49.
[16] Geldiay, R., Balik, S. (1996): Turkiye Tatlısu Balıkları. – Ege Unv. Fen Fak. Kitaplar
Serisi No: 46, Ege Universitesi Basımevi, İzmir, 532.
[17] Geldiay, R., Balik, S. (2007): Turkiye Tatlisu Balıkları. – Ders Kitabı, Ege Universitesi
BasımEvi. 97: 250.
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7450 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
[18] Ghorashi, S. A., Fatemi, S. M., Amini, F., Houshmand, M., Salehitabar, R, Hazaie, K.
(2008): Phylogenetic analysis of anemone fishes of the Persian Gulf using mtDNA
sequences. – African Journal of Biotechnology 7(12): 2074-2080.
[19] Gunduz, F., Coban, M. Z., Yuksel, F., Demirol, F., Kurtoglu, M., Yildiz, N. (2014):
Uzuncayır Baraj Golu’ndeki (Tunceli) Capoeta trutta (Heckel, 1843) ‘nınBazı
Populasyon Parametreleri. – Yunus Araştırma Bülteni 2: 3-14. DOI: 10.1
7693/yunusae.vi.235393.
[20] Heckel, J. J. (1843): Abbildungen und Beschreibungen der Fische Syriens nebst einer
neuen Classification und Characteristiks sämmtlicher Gattungen der Cyprinen
Süsswasser-Fische Syriens. – Schweizerbart, Stuttgart.
[21] Jordan, D. S., Swain, J. (1884): A review of the American species of marine Mugilidae. –
Proceedings of the United States National Museum 7(434): 261-275.
[22] Khayyami, H., Movahedinia, A., Zolgharnein, H., Salamat, N. (2014): Morphological
variability of Liza abu (Heckel, 1843) from Northwestern part of the Persian Gulf. –
World Journal of Fish and Marine Sciences 6(5): 386-394.
[23] Kuru, M. (1979): The Freshwater fish of South-Eastern Turkey-2 (Euphrates-Tigris
System). – Hacettepe Bulletin of Natural Sciences and Engineering 7: 105-114.
[24] Lai, S., Wang, Y., Yang, K., Chen, C., Huang, M. (2011): Novel family- an genus
specific DNA markers in Mugilidae. – African Journal of Biotechnology 10(59): 12722-
12728.
[25] Mohamed, A. M., Abood, A. N., Hussein, S. A. (2016): Comparative taxonomical study
of four mullet species (Mugiliformes: Mugilidae) from Iraqi marine waters, Arabian Gulf.
– Basrah J. Agric. Sci. 29 (2): 11-20.
[26] Mohamed, A. M., Abood, A. N., Hussein, S. A. (2018): Taxonomical study of Planiliza
abu in Qarmat Ali River, Iraq. – Scientific Journal of King Faisal University, Basic and
Applied Sciences 19(1).
[27] Nelson, J. S. (2006): Fishes of the World. – John Wiley & Sons, Inc, Hoboken.
http://en.wikipedia.org/wiki /Cyprinid.
[28] Nelson, J. S., Grande, T. C., Wilson, M. V. H. (2016): Fishes of the World. Fifth Ed. –
John Wiley & Sons, Hoboken.
[29] Nematzadeh, M., Rezvani, S., Khalesi, M. K., Laloei, F., Fahim, A. A. (2013): Phylogeny
analysis on six mullet species (Teleosti: Mugillidae) using PCR-sequencing method. –
Iranian Journal of Fisheries Sciences 12(3): 669-679.
[30] Özdilek, Ş. Y. (2003): Occurrence of the Abu mullet, Liza abu (Heckel, 1843) (Pisces,
Mugilidae), in the Orontes River. – Zoology in the Middle East 30: 111-113.
[31] Papasotiropoulos, V., Klossa-Kilia, E., Alahiotis, S., Kilias, G. (2007): Molecular
phylogeny o Grey Mullets (Teleostei: Mugilidae) in Greece: evidence from sequence
analysis of mtDNA segments. – Biochem. Genet. 45: 623-636.
[32] Parmaksiz, A., Eksi, E. (2017): Genetic diversity of the cyprinid fish Capoeta trutta
(Heckel, 1843) populations from Euphrates and Tigris rivers in Turkey based on mtDNA
COI sequences. – Indian J. Fish 64(1): 18-22.
[33] Semina, A. V., Polyakova, N. E., Barykov, V. A. (2007): Analysis of mitochondrial
DNA: taxonomic and phylogenic relationships in two fish taxa (pisces: Mugilidae and
Cyprinidae). – www.ncbi.nlm.nih.gov/pubmed/18205618.
[34] Shaban, A. A. G. (1980): An ecological study on phytoplankton in Dokan Lake. – M.Sc.
Thesis. University of Salahaddin, Arbil, Iraq.
[35] Toma, J. J. (2000): Limnological study of Dokan Lake, Kurdistan region of Iraq. – M.Sc.
Thesis. University of Salahaddin, Arbil, Iraq.
[36] Turan, C. (2008): Molecular systematic of the Capoeta (Cypriniformes: Cyprinidae)
species complex inferred from mitochondrial 16S rDNA sequence data. – Acta Zoologica
Acracoviensia 51A (1-2): 1 14.
Ali – Abdullah: Morphological and molecular identification of Capoeta trutta (Cyprinidae) and Planiliza abu (Mugilidae)
freshwater fish in Sulaimani Governorate, Iraq
- 7451 -
APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 17(4): 7439-7451.
http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online)
DOI: http://dx.doi.org/10.15666/aeer/1704_74397451
2019, ALÖKI Kft., Budapest, Hungary
[37] Xia, R., Durand, J-D., Fu, C. (2016): Multi locus resolution of Mugilidae phylogeny
(Teleostei: Mugiliformes): implications for the family’s taxonomy. – Molecular
Phylogenetics and Evolution 96: 161 177.
[38] Zareian, H., Esmaeili, H., Heidari, A., Khoshkholgh, M., Mousavi-Sabet, H. (2016):
Contribution to the molecular systematic of the genus Capoeta from the south Caspian
Sea basin using mitochondrial cytochrome b sequences (Teleosstei: Cyprinidae). –
Molecular Biology Research Communications 5(2): 65-75.
