Available via license: CC BY
Content may be subject to copyright.
Submitted 14 May 2019
Accepted 6 August 2019
Published 5 September 2019
Corresponding author
Jia-Yong Zhang,
zhangjiayong@zjnu.cn
Academic editor
Ilaria Negri
Additional Information and
Declarations can be found on
page 14
DOI 10.7717/peerj.7633
Copyright
2019 Wang et al.
Distributed under
Creative Commons CC-BY 4.0
OPEN ACCESS
The complete mitochondrial genomes
of five longicorn beetles (Coleoptera:
Cerambycidae) and phylogenetic
relationships within Cerambycidae
Jun Wang1, Xin-Yi Dai1, Xiao-Dong Xu1, Zi-Yi Zhang1, Dan-Na Yu1,2,
Kenneth B. Storey3and Jia-Yong Zhang1,2
1College of Chemistry and Life Science, Zhejiang Normal University, Jinhua, Zhejiang, China
2Key lab of wildlife biotechnology, Conservation and Utilization of Zhejiang Province, Zhejiang Normal
University, Jinhua, Zhejiang, China
3Department of Biology, Carleton University, Ottawa, Ontario, Canada
ABSTRACT
Cerambycidae is one of the most diversified groups within Coleoptera and includes
nearly 35,000 known species. The relationships at the subfamily level within Cer-
ambycidae have not been convincingly demonstrated and the gene rearrangement of
mitochondrial genomes in Cerambycidae remains unclear due to the low numbers of se-
quenced mitogenomes. In the present study, we determined five complete mitogenomes
of Cerambycidae and investigated the phylogenetic relationship among the subfamilies
of Cerambycidae based on mitogenomes. The mitogenomic arrangement of all five
species was identical to the ancestral Cerambycidae type without gene rearrangement.
Remarkably, however, two large intergenic spacers were detected in the mitogenome of
Pterolophia sp. ZJY-2019. The origins of these intergenic spacers could be explained by
the slipped-strand mispairing and duplication/random loss models. A conserved motif
was found between trnS2 and nad1 gene, which was proposed to be a binding site of a
transcription termination peptide. Also, tandem repeat units were identified in the A +
T-rich region of all five mitogenomes. The monophyly of Lamiinae and Prioninae was
strongly supported by both MrBayes and RAxML analyses based on nucleotide datasets,
whereas the Cerambycinae and Lepturinae were recovered as non-monophyletic.
Subjects Bioinformatics, Entomology, Evolutionary Studies, Genomics, Zoology
Keywords Mitochondrial genome, Cerambycidae, Intergenic spacer, Phylogenetic relationship
INTRODUCTION
Coleoptera (Hexapoda: Insecta) are a highly diverse group of insects consisting of about
360,000 known species of beetles that account for almost 40% of all described insect species
(Lawrence & Newton, 1982;Hunt et al., 2007). Cerambycidae (longicorn beetles) is one
of the species-rich families of Coleoptera and is a group of phytophagous insects with
over 4,000 genera and 35,000 species in the world (Monné, Monné & Mermudes, 2009;
Sama et al., 2010). Longicorn beetles are morphologically and ecologically diverse, and
have significant effects on almost all terrestrial ecosystems (Ponomarenko & Prokin, 2015).
Nevertheless, owing to their remarkable species richness, variable morphological features
How to cite this article Wang J, Dai X-Y, Xu X-D, Zhang Z-Y, Yu D-N, Storey KB, Zhang J-Y. 2019. The complete mitochondrial
genomes of five longicorn beetles (Coleoptera: Cerambycidae) and phylogenetic relationships within Cerambycidae. PeerJ 7:e7633
http://doi.org/10.7717/peerj.7633
and sparse gene data, the resolution of the phylogeny of longicorn beetles has turned
out to be a difficult challenge (Bologna et al., 2008;Zhang et al., 2018a;Zhang et al., 2018b;
Zhang et al., 2018c). Cerambycidae s. s. (sensu stricto) has usually been divided into eight
subfamilies: Lamiinae, Cerambycinae, Lepturinae, Prioninae, Dorcasominae, Parandrinae,
Spondylidinae and Necydalinae (Svacha, Wang & Chen, 1997) whereas Cerambycidae s. l.
(sensu lato) was considered to consist of Cerambycidae s. s., Disteniidae, Oxypeltidae and
Vesperidae (Napp, 1994;Reid, 1995;Svacha, Wang & Chen, 1997). Even if the number and
definition of Cerambycidae gradually stabilizes, the relationships at the subfamily level
remained unclear.
The mitochondrial genome is widely considered to be an informative molecular marker
for species identification, molecular evolution, and comparative genomic research (Moritz,
Dowling & Brown, 1987;Boore, 1999) due to its maternal inheritance and high evolutionary
rate properties (Avise et al., 1987). In the last few years, studies of animal mitogenomes
have grown rapidly in number and approximately 40,000 mitogenome sequences have now
been published in the NCBI database (Tan et al., 2017). By contrast, a mere 18 sequenced
mitogenomes of Cerambycidae have been reported, among them being eight mitogenomes
belonging to the subfamily Lamiinae, four mitogenomes of the subfamily Cerambycinae,
three mitogenomes of the subfamily Prioninae, and three mitogenomes of the subfamily
Lepturinae (Kim et al., 2009;Chiu et al., 2016;Fang et al., 2016;Guo et al., 2016;Li et al.,
2016a;Li et al., 2016b;Wang et al., 2016;Lim et al., 2017;Liu et al., 2017;Song et al., 2017;
Liu et al., 2018;Que et al., 2019;Wang et al., 2019). These few mitogenomes seriously
restrict the capacity for phylogenetic analyses and phylogeography of the Cerambycidae.
The gene organization of the known mitogenomes of Coleoptera, especially the
arrangements of protein-coding genes, are mostly in accordance with those of ancestral
insects (Timmermans & Vogler, 2012). Nevertheless, recent evidence suggested that gene
rearrangements had occurred in the tRNA of Mordella atrata (Coleoptera: Mordellidae) and
Naupactus xanthographus (Coleoptera: Curculionidae) (Song et al., 2010). In addition to
these, recombination in the control region was observed in Phrixtothrix hirtus (Coleoptera:
Phengodidae) and Teslasena femoralis (Coleoptera: Elateridae) (Amaral et al., 2016). The
mitogenome structure was originally found with no introns, sparse intergenic spacers and
no overlapping genes (Ojala, Montoya & Attardi, 1981). Nevertheless, large non-coding
regions (except the A +T-rich region) in mitogenomes have been observed within
beetles, including a 1724-bp long intergenic spacer region in Pyrocoelia rufa (Coleoptera:
Lampyridae), a 494-bp region in Hycleus chodschenticus (Coleoptera: Meloidae) and two
large intergenic spacers of more than 30 bp in Hycleus species (Bae et al., 2004;Yuan et
al., 2016;Haddad et al., 2018). Previously reported tandem repeat units or an additional
origin of replication were identified among large intergenic regions (Dotson & Beard, 2001;
Rodovalho et al., 2014).
The phylogenetic relationships within Cerambycidae have yet to be fully resolved due to
a lack of adequately convincing taxon sampling, and the monophyly of subfamilies within
Cerambycidae need further discussion (Haddad et al., 2018;Kim et al., 2018). With the aim
to discuss the monophyly of subfamilies of Cerambycidae and gene arrangements of the
mitogenome, complete mitogenomes of the five longicorn beetle species were determined.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 2/23
We also described the structural and compositional features of the newly sequenced
mitogenomes and analyzed the intergenic spacers to explain the possible evolutionary
mechanisms.
MATERIALS AND METHODS
Sampling collection and DNA extraction
Five longicorn beetle specimens (Oberea yaoshana,Thermistis croccocincta,Blepephaeus
succinctor,Nortia carinicollis,Pterolophia sp. ZJY-2019) were captured from Jinxiu, Guangxi
Zhuang Autonomous Region, China and were stored at −40 ◦C in the lab of JY Zhang
(College of Chemistry and Life Science, Zhejiang Normal University). The specimens were
identified by Dr. JY Zhang based on morphology. Total genomic DNA was extracted from
the thorax muscle using Ezup Column Animal Genomic DNA Purification Kit (Sangon
Biotech Company, Shanghai, China).
PCR amplification and sequencing
In order to obtain the entire mitogenome of samples, we used eleven universal primer
pairs to amplify eleven adjacent and overlapping fragments (Simon et al., 2006;Zhang et al.,
2008;Zhang et al., 2018a;Zhang et al., 2018b). Then specific primers were designed from
the initial overlapping fragments using Primer Premier 5.0 (Premier Biosoft International,
Palo Alto, CA). A total of 45 pairs of primers were used in the present study to amplify and
sequence the remaining gaps (Table S1). The cycling conditions and reaction volume of
PCR amplifications were as in Cheng et al. (2016) and Gao et al. (2018). All PCR products
were sequenced by Sangon Biotech Company (Shanghai, China).
Mitogenome annotation and sequence analyses
Manual proofreading and assembling of contiguous and overlapping sequences used
DNASTAR Package v.6.0 (Burland, 2000). We annotated the tRNA genes by MITOS (freely
available at http://mitos.bioinf.uni-leipzig.de/index.py) (Bernt et al., 2013). Two rRNA
genes and the A +T-rich region were identified using the Clustal W in Mega 7.0 (Kumar,
Stecher & Tamura, 2016) based on alignments of homologous sequences from other species
of Cerambycidae available in GenBank (Kim et al., 2009;Fang et al., 2016;Lim et al., 2017).
The nucleotide sequences of the 13 protein-coding genes (PCGs) were translated into
amino acids based on the invertebrate mitogenome genetic code (Cameron, 2014). We
used Mega 7.0 (Kumar, Stecher & Tamura, 2016) to find the open reading frames of the
13 PCGs and calculate AT content along with codon usage for the five newly sequenced
mitogenomes. Circular mitogenome maps were generated by CG View server V 1.0 (Grant
& Stothard, 2008). Composition skew analysis was calculated on the basis of the formula
AT-skew =(A −T)/(A +T) and GC-skew =(G −C)/(G +C) (Perna & Kocher, 1995).
Tandem Repeat Finder V 4.07 (http://tandem.bu.edu/trf/trf.html) (Benson, 1999) was used
to find tandem repetitive sequences.
Phylogenetic analyses
For the purpose of reconstructing the phylogenetic relationships of Cerambycidae, a
nucleotide dataset (13P26) of the 13 protein-coding genes of 26 complete mitogenomes
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 3/23
was used (Table 1) according to the methods of Zhang et al. (2019), this included the 5
newly determined sequences and 18 published complete mitogenomes of Cerambycidae
(Kim et al., 2009;Chiu et al., 2016;Fang et al., 2016;Guo et al., 2016;Li et al., 2016a;Li
et al., 2016b;Wang et al., 2016;Lim et al., 2017;Liu et al., 2017;Song et al., 2017;Liu et
al., 2018;Que et al., 2019;Wang et al., 2019). Three species of Galerucinae, Paleosepharia
posticata,Diabrotica barberi and Diabrotica virgifera served as the outgroups (Coates, 2014;
Wang & Tang, 2017). To verify whether the lack of samples affects the relationships among
the Cerambycidae, we reconstructed Cerambycidae phylogeny based on the nucleotide
data (12P38) of 12 PCGs (omitting the nad2 gene) from 38 complete or nearly complete
mitogenomes (Table 1). These include all species of the 13P26 dataset, 8 directly submitted
partial mitogenomes of Cerambycidae, one mitogenome of Necydalinae, two mitogenomes
of Vesperidae and one mitogenome of Disteniidae (Nie et al., 2017). Each of the 13 protein-
coding genes in 13P26 dataset or 12 protein-coding genes in 12P38 dataset was aligned using
Clustal W in the program Mega 7.0 (Kumar, Stecher & Tamura, 2016). Conserved regions
were identified by the program Gblock 0.91b (Castresana, 2000). Protein-coding genes
were partitioned a priori by codon position. Accodrding to the analyses methods of Zhang
et al. (2008),Ma et al. (2015a),Ma et al. (2015b) and Cheng et al. (2016), we excluded the
third codon positions because of the saturated third codon positions and obtained a 12P38
dataset with 5584 nucleotide sites and 13P26 dataset with 6960 nucleotide sites. So 12P38
dataset with 24 partitions and 13P26 dataset with 26 partitions were used. The optimal
partitioning scheme and best-fitting models were selected by the program PartitionFinder
1.1.1 (Lanfear et al., 2012) based on the Bayesian information criterion (BIC) (Tables 2
and 3). Bayesian Inference (BI) and Maximum likelihood (ML) methods were used for
phylogenetic analyses. BI analyses were carried out in MrBayes 3.2 (Ronquist et al., 2012)
with the model of GTR +I+G. The runs were set for 10 million generations with sampling
every 1,000 generations. The first 25% of generations were removed as burn-in and the
average standard deviation of split frequencies in Bayesian was below 0.01. ML analyses
were performed by RAxML 8.2.0 with the best-fitting model of GTRGAMMAI. Branch
support values were inferred from a rapid bootstrap method applied with 1,000 replications
(Stamatakis, 2014).
RESULTS AND DISCUSSION
Mitogenome organization and composition
In this study, the complete mitogenomes of five species of the subfamilies Cerambycinae
and Lamiinae (O. yaoshana, T. croccocincta, B. succinctor, N. carinicollis, Pterolophia sp.
ZJY-2019) were determined. Structures of the five newly sequenced entire mitogenomes are
shown in Figs. S1–S5. The lengths of the five mitogenomes were basically within the range
of the published Cerambycidae species in the GenBank database, covering sizes between
15,503 bp in T. croccocincta to 16,063 bp in Pterolophia sp. ZJY-2019. Every mitogenome
of the five species possessed similar compositional profiles and featured the typical gene
arrangement and orientation that have been hypothesized for most coleopteran insects
(Wolstenholme, 1992;Boore, Lavrov & Brown, 1998), with the trnW -trnC-trnY triplet
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 4/23
Table 1 Species used to construct the phylogenetic relationships along with GenBank accession numbers.
Order Family Species GenBank No. References
Cerambycidae Lamiinae Anoplophora glabripennis DQ768215 Fang et al. (2016)
Psacothea hilaris FJ424074 Kim et al. (2009)
Thyestilla gebleri KY292221 Yang et al. (2017)
Monochamus alternatus KJ809086 Li et al. (2016a)
Anoplophora chinensis KT726932 Li et al. (2016b)
Apriona swainsoni NC_033872 Que et al. (2019)
Batocera lineolata MF521888 Liu et al. (2017)
Oberea yaoshana MK863509 This study
Thermistis croccocincta MK863511 This study
Blepephaeus succinctor MK863507 This study
Pterolophia sp.ZJY-2019 MK863510 This study
Olenecamptus subobliteratus*KY796054 Directly submitted
Eutetrapha metallescens*KY796053 Directly submitted
Cerambycinae Xylotrechus grayii NC_030782 Guo et al. (2016)
Xystrocera globosa MK570750 Wang et al. (2019)
Nortia carinicollis MK863508 This study
Massicus raddei KC751569 Wang et al. (2016)
Aeolesthes oenochrous AB703463 Chiu et al. (2016)
Obrium sp. NS-2015 KT945156 Song et al. (2017)
Pyrrhidium sanguineum*KX087339 Directly submitted
Chlorophorus simillimus*KY796055 Directly submitted
Prioninae Callipogon relictus MF521835 Lim et al. (2017)
Dorysthenes paradoxus MG460483 Liu et al. (2018)
Aegosoma sinicum NC_038089 Directly submitted
Lepturinae Leptura arcuata*KY796051 Directly submitted
Stictoleptura succedanea*KY796052 Directly submitted
Rhagium mordax*JX412743 Directly submitted
Stenurella nigra*KX087348 Directly submitted
Cortodera humeralis KX087264 Directly submitted
Anastrangalia sequensi KY773687 Directly submitted
Brachyta interrogationis KX087246 Directly submitted
Necydalinae Necydalis ulmi*JX220989 Directly submitted
Disteniidae Disteniinae Disteniinae sp. BMNH 899837 KX035158 Directly submitted
Vesperidae Philinae Spiniphilus spinicornis KT781589 Nie et al. (2017)
Vesperinae Vesperus conicicollis*JX220996 Directly submitted
Chrysomelidae Galerucinae Paleosepharia posticata KY195975 Wang & Tang (2017)
Diabrotica barberi KF669870 Coates (2014)
Diabrotica virgifera KF658070 Coates (2014)
Notes.
*Partial genome.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 5/23
Table 2 The partition schemes and best-fitting models selected of 13 protein-coding genes in 13P26
data.
Nucleotide sequence alignments
Subset Subset partitions Best model
Partition 1 atp6_pos1, cox1 pos 1, cox2_pos1, cox3_pos1, cytb_pos1 GTR +I+G
Partition 2 atp6_pos2, cox1_pos2, cox2_pos2, cox3_pos2, cytb_pos2,
nd3_pos2
TVM +I+G
Partition 3 atp8_pos1, atp8_pos2, nd2_pos2, nd3_pos3, nd6_pos2 GTR +I+G
Partition 4 nd1_pos1, nd4l_pos1, nd4_pos1, nd5 pos1 GTR +I+G
Partition 5 nd1_pos2, nd4_pos2, nd4l_pos2, nd5_pos2 GTR +I+G
Partition 6 nd2_pos2, nd3_pos2, nd6_pos2 TVM +I+G
Table 3 The partition schemes and best-fitting models selected of 12 protein-coding genes in 12P38
data.
Nucleotide sequence alignments
Subset Subset partitions Best model
Partition 1 atp6_pos1, cox2_pos1, cox3_pos1, cytb_pos1 GTR +I+G
Partition 2 atp6_pos2, cox2_pos2, cox3_pos2, cytb_pos2, nd3_pos2 TVM +I+G
Partition 3 atp8_pos1, atp8_pos2, nd6_pos2 HKY +G
Partition 4 cox1 pos 1 SYM +G
Partition 5 cox1_pos2 F81 +G
Partition 6 nd1_pos1, nd4l_pos1, nd4_pos1, nd5 pos1 GTR +I+G
Partition 7 nd1_pos2, nd4_pos2, nd4l_pos2, nd5_pos2, GTR +I+G
Partition 8 nd3_pos1, nd6_pos1 GTR +I+G
(Tables S2–S6). Twenty-three genes were coded on the majority strand (J-strand), with
the remaining fourteen genes coded on the minority strand (N-strand) (Figs. S1–S5).
The nucleotide composition of the five longicorn beetle mitogenomes was strongly biased
towards A and T, which made up 73.2% (N. carinicollis) to 79.1% (O. yaoshana) of the base
pairs. A comparison of AT-skew and GC-skew showed that the AT skew of all mitogenomes
was positive and the GC-skew was negative (Table 4).
Protein-coding genes and codon usages
The orientations of the 13 the PCGs of the five longicorn beetles were identical to most
coleopteran species (Tables S2–S6). Conventional initiation codons were assigned to the
majority of the PCGs, except for nad1, which started with TTG in all five beetles. Most
putative protein sequences showed typical stop codons (TAA/TAG), but the nad4 and
nad5 genes of O. yaoshana,T. croccocincta,B. succinctor used a single T residue as the
terminal codon. The cox1 and cox2 genes of O. yaoshana,T. croccocincta and Pterolophia
sp. ZJY-2019 also used a single T residue as the terminal codon. Functional terminal
codons can be produced by partial terminal codons in polycistronic transcription cleavage
and polyadenylation processes (Anderson et al., 1981;Ojala, Montoya & Attardi, 1981;Du
et al., 2016). The relative synonymous codon usage (RSCU) of the five Cerambycidae
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 6/23
Table 4 Base composition of Cerambycidae mitochondrial genomes.
Species A +T(%) AT-skew GC-skew
Mito PCGs rRNAs AT-richregion Mito PCGs rRNAs AT-richregion Mito PCGs rRNAs AT-richregion
O. yaoshana 79.1 77.8 81.1 87.1 0.03 0.14 0.04 0.04 0.20 0.01 0.38 0.24
T. croccocincta 76.4 76.4 78.6 87.4 0.15 0.15 0.04 0.04 0.13 0.01 0.49 0.45
B. succinctor 75.3 73.2 78.6 86.2 0.023 0.17 0.06 0.02 0.26 0.02 0.39 0.32
N. carinicollis 73.2 71.1 75.7 80.3 0.10 0.17 0.16 0.07 0.18 0.03 0.36 0.21
Pterolophia
sp.ZJY-2019
76.7 75.1 81.7 82.8 0.02 0.18 0.02 0.04 0.22 0.04 0.36 0.18
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 7/23
0
1
2
3
4
5
6
0
1
2
3
4
5
0
1
2
3
4
5
0
1
2
3
4
5
6
0
1
2
3
4
5
6
GS1RWCEDKNQHYATPS2VMIL2L1F
UUU
UUC
UUA
UUG
CUU
CUC
CUA
CUG
AUU
AUC
AUA
AUG
GUU
GUC
GUA
GUG
UCU
UCC
UCA
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
UAU
UAC
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG
UGU
UGC
UGA
UGG
CGU
CGC
CGA
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG
UCG GCG CGG
C B. succinctor
E Pteropliini sp.
D N. carinicollis
B T. croccocincta
A O. yaoshana
Figure 1 The RSCU of five longicorn beetle mitochondrial genomes. Codon families are provided on
the x-axis along with the different combinations of synonymous codons that code for that amino acid.
RSCU (relative synonymous codon usage) is defined on the Yaxis.
Full-size DOI: 10.7717/peerj.7633/fig-1
mitochondrial genomes was calculated (Fig. 1,Table S7). The results showed an over-
utilization of A or T nucleotides in the third codon position as compared to other
synonymous codons, this is normally considered to be caused by genome bias, optimum
choice of tRNA usage or the benefit of DNA repair (Chai & Du, 2012;Ma et al., 2015a;Ma
et al., 2015b).
Comparative analyses also indicated that the major customarily utilized codons and
the codon usage patterns of the five samples were conservative. For instance, each of the
five mitogenomes possessed UUA (Leu), AUU (Ile), UUU (Phe), and AUA (Met) as the
most frequently used codons. All codons contained A or T nucleotides, indicating that the
strong AT mutation bias obviously influenced the codon usage (Powell & Moriyama, 1997;
Rao et al., 2011). Furthermore, the codons rich in AT encoded the most abundant amino
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 8/23
acids, e.g., Leu (15.6–16.4%), indicating that the AT bias also influences the amino acid
constituents of the proteins encoded by the mitochondrial genes (Foster, Jermiin & Hickey,
1997;Min & Hickey, 2007).
Ribosomal RNAs and transfer RNAs
The two expected rRNAs (16S rRNA and 12S rRNA) were found in the mitochondrial
genomes of all five longicorn beetles. The 16S rRNA gene was situated between trnL and
trnV whereas the 12S rRNA gene was between trnV and the A +T-rich region. Due to
the impossibility of faultless determination by DNA sequence alone, the terminus of the
rRNA genes in coleopteran mitogenomes has been presumed to stretch to the border of
the flanking genes (Boore, 2001). Therefore, the 16S rRNA was presumed to fill the blank
between trnL and trnV whereas the border between 12S rRNA and the putative A +T-rich
region was defined based on alignments of homologous sequences of known longicorn
beetles (Boore & Brown, 2000). The sizes of 16S rRNA in the five beetle mitogenomes varied
from 1261 bp for N. carinicollis to 1283 bp for O. yaoshana, and the sizes of 12S rRNA
ranged between 759 bp for Pterolophia sp. ZJY-2019 to 787 bp for T. croccocincta. These
fit within the lengths detected in other coleopteran mitogenomes. The A +T content of
the rRNA genes was the highest (81.7%) in the Pterolophia sp. ZJY-2019 mitogenome and
the lowest in the N. carinicollis mitogenome (75.7%). The AT-skew of 16S rRNA and 12S
rRNA showed great positivity, whereas the GC-skew was somewhat negative (Table 4),
which indicated the occurrence of less As and Cs than Ts and Gs (Eyrewaker, 1997).
The 22 typical tRNAs were detected in all five species like other published longicorn
beetles. All the anticodons were also highly conserved compared to other beetle species.
Twenty-two tRNAs excluding trnS1 displayed the classic clover-leaf secondary structure,
whereas trnS1 lacked the dihydrouridine (DHU) arm and formed a simple loop (Fig. S6).
Nevertheless, this abnormal tRNA has proven to be functional, although somewhat
less effective than conventional tRNAs (Steinberg & Cedergren, 1994;Hanada et al., 2001;
Stewart & Beckenbach, 2003). Another unusual feature was the use of TCT as the trnS1
anticodon in Cerambycidae, whereas most arthropods use a GCT anticodon in trnS1. In
many other coleopteran mitogenomes the trnS1 anticodon (TCT) can also be observed
(Friedrich & Muqim, 2003;Bae et al., 2004). Mismatched pairs also exist in stems of tRNAs.
For example, the mismatched pairs U-G existed in the DHU stem of trnY and trnQ; U-U
existed in the T 9C stem of trnC and in the anticodon stem of trnL1; G-U existed in
acceptor stem of trnC. It has been verified that mismatched pairs can be revised via editing
processes or may symbolize abnormal pairings (Negrisolo, Babbucci & Patarnello, 2011).
A+T-rich region
A large non-coding region between 12S rRNA and trnI, ranging between 861 bp for
O. yaoshana to 1137 bp for Pterolophia sp. ZJY-2019, was found in the mitogenomes of the
five beetles. Owing to the high AT content levels of the overall mitogenome, this non-coding
element was defined as the A +T-rich region. It has been verified that the A +T-rich
region harbors the origin sites and essential regulatory elements for transcription and
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 9/23
replication (Wolstenholme, 1992;Taanman, 1999;Yukuhiro et al., 2002;Saito, Tamura &
Aotsuka, 2005). The sequence of this region is relatively conserved owing to its high A
+T content, and thus it is impossible to use as a molecular marker (Zhang & Hewitt,
1997). The existence of tandem repeats in the mitochondrial A +T-rich region has been
observed in many coleopteran species. Some studies such as that conducted by Sheffield et
al. (2008) have shown that the A +T-rich region of Trachypachus holmbergi (Coleoptera:
Trachypachidae) possessed 21 similar copies of tandem repeats consisting of a 58-bp
fragment. The A +T-rich region of Priasilpha obscura (Coleoptera: Phloeostichidae) is
known to possess 6 tandem repeats of a 132-bp fragment and Psacothea hilaris (Coleoptera:
Cerambycidae) possesses 7 identical copies of a 57 bp tandem repeat (Kim et al., 2009).
In the present study, we found tandem repetitive sequences in all five newly sequenced
mitogenomes. The mitogenomes of T. croccocincta and B. succinctor contained three
copies of tandem repetitive sequences with lengths of 19 and 43 bp, respectively. Four
tandem repeats of a 19-bp fragment were found in the mitogenome of Pterolophia sp.
ZJY-2019, whereas two tandem repeats of a 25-bp fragment existed in N. carinicollis.
The tandem repeats generally exhibited high A +T contents. Moreover, two poly-T
stretches were detected in the mitogenome of N. carinicollis: one stretch was 16 bp in
length (position: 14,880–14,895) near the 12S rRNA gene and the other stretch was 17-bp
in length (position: 15,283–15,299). Previous studies have confirmed that the two poly-T
stretches were structural signals for the recognition of proteins that performed a role in
replication initiation (Andrews, Kubacka & Chinnery, 1999).
Intergenic regions
The mitogenomes of O. yaoshana,T. croccocincta, and N. carinicollis contain 6, 7, 9
non-coding intergenic spacer sequences, with total lengths of 28 bp, 28 bp, and 31 bp,
respectively, whereas B. succinctor has 8 non-coding intergenic spacer sequences of 52 bp
in total length. Unexpectedly, a total of 354-bp of intergenic spacer, whose elements ranged
from 1 to 184 bp in length was found in the mitogenome of Pterolophia sp. ZJY-2019. The
sequences are divided into 9 regions, containing two large intergenic spacers. The largest
one is 184 bp long situating between trnC and trnY, and the other is 157 bp long situated
between trnS2 and nad1 (Table S6). Consequently, the total length of the mitogenome of
Pterolophia sp. ZJY-2019 is longer than that of other longicorn beetle species. The longer
mitogenome length is due to the existence of its extended large intergenic spacers not
the A +T-rich region. Previously reported tandem repeat units or additional origins
of replication have been identified within this region (Dotson & Beard, 2001;Rodovalho
et al., 2014). Proven by the lack of introns, rare intergenic spacers, defective terminal
codons and overlapping fragments, mitogenomes characteristically show exceptional
compactness of organization (Ojala, Montoya & Attardi, 1981). Nevertheless, according
to Yuan et al. (2016) and Haddad et al. (2018), large non-coding regions (except the A +
T-rich region) in mitochondrial genomes were observed in Pyrocoelia rufa (Coleoptera:
Lampyridae) and some Hycleus species (Coleoptera: Meloidae). Coincidentally, a 5 bp
consensus motif (TACTA) exists in the intergenic regions situated between trnS2 and nad1
of all five species studied here. This pentanucleotide motif is conserved across coleopteran
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 10/23
Figure 2 Putative mechanisms for formation of the two large intergenic regions (IGRs) that exist in
Pterolophia sp. ZJY-2019. (A) The slipped-strand mispairing and random loss model to explain the 157
bp-IGR between trnS2 and nad1. The CS indicates the 18 bp conservative sequence TTACTAAATTTAAT-
TAACTAAA. (B) The duplication/random loss model to explain the 184 bp-IGR between trnC and trnY.
Full-size DOI: 10.7717/peerj.7633/fig-2
lineages (Kim et al., 2009;Liu et al., 2018), similar to the findings that Evania appendigaster
(Hymenoptera: Evaniidae) possessed a 6 bp motif ‘THACWW’ and Chilo suppressalis
(Lepidoptera: Pyralidae) possessed a 7 bp motif ‘ATACTAA’, respectively (Wei et al., 2010;
Gong et al., 2018).
In the mitogenome of Pterolophia sp. ZJY-2019, the large intergenic region was situated
between trnS2 and nad1, which included two copies of a 22 bp long consensus sequence
(TTACTAAATTTAATTAACTAAA) in both ends of the intergenic region. The formation
of an intergenic region may be explained by slipped-strand mispairing (Levinson & Gutman,
1987;Du et al., 2017). Based on this theory, mispairing occurred during replication of DNA
strands, and what followed next was misaligned reassociation and then replication or repair
was caused by insertions of several repeat units. The resulting tandem repeat underwent
random loss and/or point mutation, with only the repeat units in both extremities remaining
(Fig. 2A). However, a tandem repeat was not found in the intergenic region located
between trnC and trnY of Pterolophia sp. ZJY-2019. We conjectured that some errors
in DNA replication can lead to tandem duplication in tRNA clusters of trnW-trnC-trnY,
followed by the random loss of partial duplicated genes, and leading to the large intergenic
region formed by the residues (Fig. 2B). In addition, Hua et al. (2008) suggested that
the duplication-random loss model caused the rearrangements in Hemiptera. Du et al.
(2017) also suggested that the duplication-random loss model was an evolutionary ancient
mechanism in Coleoptera, which led to the random loss of nucleotides.
Consequently, compared to the original tRNAs, the residual intergenic region was not
conserved. According to Du et al. (2017), four species of Hycleus genera harbored similar
location and sequence of non-coding regions, which indicated that the region may serve as
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 11/23
Cerambycinae
Lepturinae
Prioninae
Outgroup
BI
0.2
ML
0.2
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
0.98
0.97
0.98
0.76
0.57
1
0.73
100
100
100
100
100
100 100
100
100
100
98
27
69
96
39 57
37
85
93
94
95
83
54
90
Diabrotica barberi KF669870
Paleosepharia posticataKY195975
Diabrotica virgifera virgifera KF658070
Diabrotica barberi KF669870
Paleosepharia posticataKY195975
Diabrotica virgifera virgifera KF658070
Cortodera humeralis KX087264 Cortodera humeralis KX087264
Anastrangalia sequensi KY773687 Anastrangalia sequensi KY773687
Brachyta interrogationis KX087246 Brachyta interrogationis KX087246
Dorysthenes paradoxus MG460483
Callipogon relictus MF521835
Aegosoma sinicum NC_038089
Dorysthenes paradoxus MG460483
Callipogon relictus MF521835
Aegosoma sinicum NC_038089
Xystrocera globosa MK570750 Xystrocera globosa MK570750
Obrium sp.NS-2015 KT945156
Xylotrechus grayii NC_030782 Xylotrechus grayii NC_030782
Massicus raddei KC751569
Aeolesthes oenochrous AB703463
Massicus raddei KC751569
Aeolesthes oenochrous AB703463
Batocera lineolata MF521888
Anoplophora glabripennis DQ768215
Apriona swainsoni NC_033872
Thyestilla gebleri KY292221
Psacothea hilaris FJ424074
Anoplophora chinensis KT726932
Monochamus alternatus KJ809086
Lamiinae
Batocera lineolata MF521888
Apriona swainsoni NC_033872
Thyestilla gebleri KY292221
Anoplophora glabripennis DQ768215
Psacothea hilaris FJ424074
Anoplophora chinensis KT726932
Monochamus alternatus KJ809086
Nortia carinicollis MK863508 Nortia carinicollis MK863508
Pteropliini sp.ZJY-2019 MK863510 Pteropliini sp.ZJY-2019 MK863510
Oberea yaoshana MK863509 Oberea yaoshana MK863509
Thermistis croccocincta MK863511 Thermistis croccocincta MK863511
Blepephaeus succinctor MK863507 Blepephaeus succinctor MK863507
A: BI B: ML
Figure 3 Phylogenetic relationships of Cerambycidae in BI and ML analyses. The data includes 23
species of Cerambycidae as the ingroup and three species of Chrysomelidae as the outgroup. The GenBank
accession numbers of all species are also shown.
Full-size DOI: 10.7717/peerj.7633/fig-3
a latent symbol to distinguish Hycleus from the other genera. Thus, we speculated the large
intergenic region of Pterolophia sp. ZJY-2019 may be a molecular feature in Pterolophia,
though we were unable to adequately confirm it owing to the lack of enough samples.
Phylogenetic analyses
The phylogenetic relationships were reconstructed based on the nucleotide data (13P26)
with BI and ML methods (Fig. 3). BI and ML phylogenetic analyses yielded a similar
topology except for the position of Lepturinae, which was in the sister group of
(Cerambycinae +Prioninae) with high values in BI, but supported as the basal group
of Cerambycidae in ML analyses. The BI tree indicated that Cerambycidae split into 2
major groups (0.73): a clade of (Lepturinae +(Cerambycinae +Prioninae)) and a clade of
Lamiinae. The monophyly of Lamiinae, Lepturinae and Prioninae was supported by both BI
and ML analyses, whereas the monophyly of Cerambycinae was not recovered. Within the
subfamily Lamiinae, the clade of (Lamiinae +(Batocera lineolata +Thyestilla gebleri)) was
supported. However, Liu et al. (2018) favoured T. gebleri as the basal position of Lamiinae
with a high value, and B. lineolata and Apriona swainsoni were reliably recovered as a sister
group. Our results concurred with the suggestion that B. lineolata was closely related to
A. swainsoni, rather than T. gebleri. The results also placed Pterolophia sp. ZJY-2019 as a
sister group of all remaining Lamiinae. Moreover, our results suggested that O. yaoshana
clustered with Trachypachus holmbergi, as a sister group of T. gebleri. For the relationship
within Cerambycinae, M. raddei,A. oenochrous and Obrium sp. NS-2015 were gathered into
one clade and most closely related to the subfamily Prioninae rather than the remaining
Cerambycinae, consistent with the morphological and molecular analyses in previous
reports (Liu et al., 2018).
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 12/23
Chlorophorus simillimus KY796055
Anastrangalia sequensi KY773687
Olenecamptus subobliteratus KY796054
Xystrocera globosa MK570750
Necydalis ulmi JX220989
Leptura arcuata KY796051
Batocera lineolata MF521888
Anoplophora glabripennis DQ768215
Stenurella nigra KX087348
Blepephaeus succinctor MK863507
Pyrrhidium sanguineum KX087339
Apriona swainsoni NC_033872
Brachyta interrogationis KX087246
Xylotrechus grayii NC_030782
Diabrotica barberi KF669870
Massicus raddei KC751569
Stictoleptura succedanea KY796052
Thyestilla gebleri KY292221
Paleosepharia posticataKY195975
Psacothea hilaris FJ424074
Pteropliini sp.ZJY-2019 MK863510
Nortia carinicollis MK863508
Diabrotica virgifera virgifera KF658070
Aeolesthes oenochrous AB703463
Anoplophora chinensis KT726932
Obrium sp.NS-2015 KT945156
Vesperus conicicollis JX220996
Cortodera humeralis KX087264
Spiniphilus spinicornis KT781589
Monochamus alternatus KJ809086
Disteniidae sp.BMNH-899837 KX035158
Eutetrapha metallescens KY796053
Thermistis croccocincta MK863511
Dorysthenes paradoxus MG460483
Rhagium mordax JX412743
Callipogon relictus MF521835
Aegosoma sinicum NC_038089
Oberea yaoshana MK863509
Cerambycinae
Lamiinae
Lepturinae
Prioninae
Outgroup
BI
0.2
ML
0.2
1
1
1
1
1
1
1
1
1
1
1
11
1
1
1
1
1
1
1
1
1
1
0.99
0.99
0.95
0.51
0.51
0.85
0.55
0.76
0.93
100
100
100
100 100
100
100
100
100
100
100
100
100
0.65
1
1
Necydalinae
Vesperidae
Disteniidae
45
97
67
91
60
56
100
72
91
53
94
24
55
98
53
93
91
71
54
92 64
61
82
Paleosepharia posticataKY195975
Diabrotica barberi KF669870
Diabrotica virgifera virgifera KF658070
Brachyta interrogationis KX087246
Rhagium mordax JX412743
Cortodera humeralis KX087264
Stenurella nigra KX087348
Leptura arcuata KY796051
Anastrangalia sequensi KY773687
Stictoleptura succedanea KY796052
Xystrocera globosa MK570750
Callipogon relictus MF521835
Aegosoma sinicum NC_038089
Dorysthenes paradoxus MG460483
Aeolesthes oenochrous AB703463
Massicus raddei KC751569
Pyrrhidium sanguineum KX087339
Chlorophorus simillimus KY796055
Xylotrechus grayii NC_030782
Necydalis ulmi JX220989
Disteniidae sp.BMNH-899837 KX035158
Vesperus conicicollis JX220996
Spiniphilus spinicornis KT781589
Olenecamptus subobliteratus KY796054
Apriona swainsoni NC_033872
Batocera lineolata MF521888
Thyestilla gebleri KY292221
Eutetrapha metallescens KY796053
Monochamus alternatus KJ809086
Anoplophora glabripennis DQ768215
Anoplophora chinensis KT726932
Psacothea hilaris FJ424074
Nortia carinicollis MK863508
Oberea yaoshana MK863509
Thermistis croccocincta MK863511
Blepephaeus succinctor MK863507
Pteropliini sp.ZJY-2019 MK863510
A: BI B: ML
Figure 4 Phylogenetic relationships of Cerambycidae in BI and ML analyses. The data includes 35
species of Cerambycidae as the ingroup and three species of Chrysomelidae as the outgroup. The GenBank
accession numbers of all species are also shown.
Full-size DOI: 10.7717/peerj.7633/fig-4
The results from the BI trees of the nucleotide dataset showed that Lepturinae cluster
with the clade (Cerambycinae +Prioninae) with a high support value (Fig. 3). However,
in the ML tree, a close relationship between Lamiinae and (Cerambycinae +Prioninae)
was supported with 100% posterior probabilities (Fig. 3). The relationship between
Cerambycinae and Prioninae is not currently understood in great detail. Prioninae were
traditionally considered basal in Cerambycidae by morphology (Hatch, 1958;Svacha,
Wang & Chen, 1997;Farrell, 1998). In addition, Hunt et al. (2007) and Haddad et al. (2018)
pointed out that Prioninae could be placed at the basal position of Cerambycidae based
on molecular phylogenetic studies. However, in BI and ML analyses of the 13P26 dataset
Prioninae clustered into Cerambycinae, which was consistent with the phylogenetic
position of Prioninae recovered by Raje, Ferris & Holland (2016).
The most controversial point in our results was in Cerambycinae (Fig. 3), which was
represented by five different genera and rendered non-monphyletic in Prioninae. However,
Cerambycinae was not supported as monophyletic based on molecular by Liu et al. (2018)
and Haddad et al. (2018), but was recovered in other molecular studies (Lim et al., 2017;
Liu et al., 2017).
To further discuss the monophyly of subfamilies within Cerambycidae, more samples
were needed to confirm and rebuild the phylogenetic relationship of Cerambycidae
using 12 protein-coding genes. The phylogenetic relationships were reconstructed
based on the nucleotide data (12P38) with BI and ML methods (Fig. 4). Prioninae
still clustered into Cerambycinae in BI and ML analyses of the 12P38 dataset, which
agreed with the phylogenetic position of Prioninae recovered using the 13P26 dataset.
In BI and ML analyses, all trees recovered the monophyly of Lamiinae (although the
relationships within Lamiinae were different). The Lamiinae formed a sister group to
a clade comprising Disteniidae, Prioninae, Cerambycinae and Vesperidae. The clade of
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 13/23
Lepturinae and Necydalinae was a sister to the remaining species of Cerambycidae s. l. In
addition, BI and ML analyses recovered the monophyly of Prioninae including Callipogon
relictus,Dorysthenes paradoxus and Aegosoma sinicum, as proposed by Wang et al. (2019).
However, BI and ML results did not support the monophyly of Cerambycinae with
respect to Prioninae and Spiniphilus spinicornis (Vesperidae). It has been well accepted that
Necydalinae and Lepturinae have a close relationship. The monophyly of Lepturinae was
recovered in both BI and ML analyses of the 13P26 dataset. However, BI and ML trees from
the 12P38 dataset returned a paraphyletic Lepturinae, due to a sister relationship between
Necydalis ulmi (Necydalinae) and Brachyta interrogationis (Fig. 4).
Previous studies recognized S. spinicornis as a species of Vesperinae in Cerambycidae
(Napp, 1994). Nevertheless, subsequent studies considered it to belong to the subfamily
Philinae of Vesperidae (Svacha, Wang & Chen, 1997;Lin & Bi, 2011;Nie et al., 2017).
Further phylogenetic studies put S. spinicornis in the fairly controversial placements (Bi
& Lin, 2015;Liu et al., 2018). In addition to our results, a recent molecular study also
indicated a similar relationship (Liu et al., 2018).
CONCLUSION
In this study, we present five completely sequenced mitogenomes of Cerambycidae. The
five longicorn beetle species shared similar gene organization with the insects previously
reported. The gene sequences and composition of the mitogenomes were relatively
conservative with no rearrangements, duplications or deletions. Two large intergenic
spacers existed in Pterolophia sp. ZJY-2019. The duplication/random loss model and
slipped-strand mispairing may explain the existence of these regions. The phylogenetic
results inferred from mitogenomes supported the monophyly of Lamiinae and Prioninae
in BI and ML analyses, whereas the Cerambycinae and Lepturinae were recovered as
non-monophyletic. Although data collected thus far could not resolve the phylogenetic
relationships within Cerambycidae, this study will increase the richness of the Cerambycidae
genome information and assist in phylogenetic, molecular systematics and evolutionary
studies of Cerambycidae.
ACKNOWLEDGEMENTS
We are grateful to Wen-Yong Feng for his help in sample collection.
ADDITIONAL INFORMATION AND DECLARATIONS
Funding
This research was supported by the Zhejiang provincial Natural Science Foundation
(Y18C040006), the National Natural Science Foundation of China (31370042), the College
students’ Innovation and Entrepreneurship Project in China (No. 201810345043), the
College students in Zhejiang Normal University Innovation and Entrepreneurship Plan
(2018-317) for the study design, data collection and analyses. The funders had no role
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 14/23
in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Grant Disclosures
The following grant information was disclosed by the authors:
Zhejiang provincial Natural Science Foundation: Y18C040006.
National Natural Science Foundation of China: 31370042.
Innovation and Entrepreneurship Project in China: 201810345043.
College students in Zhejiang Normal University Innovation and Entrepreneurship Plan:
2018-317.
Competing Interests
Kenneth B. Storey and Jia-Yong Zhang are Academic Editors for PeerJ.
Author Contributions
•Jun Wang and Xin-Yi Dai conceived and designed the experiments, performed the
experiments, analyzed the data, contributed reagents/materials/analysis tools, prepared
figures and/or tables, authored or reviewed drafts of the paper.
•Xiao-Dong Xu and Zi-Yi Zhang analyzed the data, prepared figures and/or tables,
authored or reviewed drafts of the paper.
•Dan-Na Yu conceived and designed the experiments, analyzed the data, contributed
reagents/materials/analysis tools, authored or reviewed drafts of the paper.
•Kenneth B. Storey authored or reviewed drafts of the paper.
•Jia-Yong Zhang conceived and designed the experiments, analyzed the data, contributed
reagents/materials/analysis tools, authored or reviewed drafts of the paper, approved the
final draft.
Data Availability
The following information was supplied regarding data availability:
Five new sequenced mitochondrial genomes are available at GenBank: MK863507–
MK863511.
Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/10.7717/
peerj.7633#supplemental-information.
REFERENCES
Amaral DT, Mitani Y, Ohmiya Y, Viviani VR. 2016. Organization and comparative
analysis of the mitochondrial genomes of Bioluminescent Elateroidea (Coleoptera:
Polyphaga). Gene 586(2):254–262 DOI 10.1016/j.gene.2016.04.009.
Anderson S, Bankier AT, Barrell BG, Bruijin MHL, Droujn ARJ, Eperon IC, Nierlich
DP, Roe BA, Sanger F, Schreier PH. 1981. Sequence and organization of the human
mitochondrial genome. Nature 290(5806):457–465 DOI 10.1038/290457a0.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 15/23
Andrews RM, Kubacka I, Chinnery PF. 1999. Reanalysis and revision of the Cambridge
reference sequence for human mitochondrial DNA. Nature Genetics 23(2):147
DOI 10.1038/13779.
Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders
NC. 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between
population genetics and systematics. Annual Review of Ecology and Systematics
18(1):489–522 DOI 10.1146/annurev.es.18.110187.002421.
Bae JS, Kim I, Sohn HD, Jin BR. 2004. The mitochondrial genome of the firefly,
Pyrocoelia rufa: complete DNA sequence, genome organization, and phylogenetic
analysis with other insects. Molecular Phylogenetics and Evolution 32(3):978–985
DOI 10.1016/j.ympev.2004.03.009.
Benson G. 1999. Tandem repeats finder: a program to analyze DNA sequences. Nucleic
Acids Research 27(2):573–580 DOI 10.1093/nar/27.2.573.
Bernt M, Donath A, Jühling F, Externbrink F, Florentz C, Fritzsch G, Pütz J, Mid-
dendorf M, Stadler PF. 2013. MITOS: improved de novo metazoan mitochon-
drial genome annotation. Molecular Phylogenetics and Evolution 69(2):313–319
DOI 10.1016/j.ympev.2012.08.023.
Bi W, Lin M. 2015. Discovery of second new species of the genus Spiniphilus Lin & Bi,
and female of Heterophilus scabricollis Pu with its biological notes (Coleoptera: Ves-
peridae: Philinae: Philini). Zootaxa 3949(4):575–583 DOI 10.11646/zootaxa.3949.4.7.
Bologna MA, Oliverio M, Pitzalis M, Mariottini P. 2008. Phylogeny and evolutionary
history of the blister beetles (Coleoptera, Meloidae). Molecular Phylogenetics and
Evolution 48(2):679–693 DOI 10.1016/j.ympev.2008.04.019.
Boore JL. 1999. Animal mitochondrial genomes. Nucleic Acids Research 27(8):1767–1780
DOI 10.1093/nar/27.8.1767.
Boore JL. 2001. Complete mitochondrial genome sequence of the polychaete an-
nelid Platynereis dumerilii.Molecular Biology and Evolution 18(7):1413–1416
DOI 10.1186/1471-2164-5-67.
Boore JL, Brown WM. 2000. Mitochondrial genomes of Galathealinum,Helobdella, and
Platynereis: sequence and gene arrangement comparisons indicate that Pogonophora
is not a Phylum and Annelida and Arthropoda are not sister taxa. Molecular Biology
and Evolution 17(1):87–106 DOI 10.1093/oxfordjournals.molbev.a026241.
Boore JL, Lavrov DV, Brown WM. 1998. Gene translocation links insects and crus-
taceans. Nature 392(6677):667–668 DOI 10.1038/33577.
Burland TG. 2000. DNASTAR’s Lasergene sequence analysis software. In: Misener S,
Krawetz SA, eds. Bioinformatics methods and protocols. Methods in molecular biology.
Totowa: Humana Press, 71–91.
Cameron SL. 2014. How to sequence and annotate insect mitochondrial genomes for sys-
tematic and comparative genomics research. Systematic Entomology 39(3):400–411
DOI 10.1111/syen.12071.
Castresana J. 2000. Selection of conserved blocks from multiple alignments for their
use in phylogenetic analysis. Molecular Biology and Evolution 17(4):540–552
DOI 10.1093/oxfordjournals.molbev.a026334.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 16/23
Chai HN, Du YZ. 2012. The complete mitochondrial genome of the pink stem borer,
Sesamia inferens, in comparison with four other noctuid moths. International Journal
of Molecular Sciences 13(8):10236–10256 DOI 10.3390/ijms130810236.
Cheng XF, Zhang LP, Yu DN, Storey KB, Zhang JY. 2016. The complete mitochondrial
genomes of four cockroaches (Insecta: Blattodea) and phylogenetic analyses within
cockroaches. Gene 586:115–122 DOI 10.1016/j.gene.2016.03.057.
Chiu WC, Yeh WB, Chen ME, Yang MM. 2016. Complete mitochondrial genome
of Aeolesthes oenochrous (Fairmaire) (Coleoptera: Cerambycidae): an endan-
gered and colorful longhorn beetle. Mitochondrial DNA Part A 27(1):686–687
DOI 10.3109/19401736.2014.913143.
Coates BS. 2014. Assembly and annotation of full mitochondrial genomes for the
corn rootworm species, Diabrotica virgifera virgifera and Diabrotica barberi (In-
secta: Coleoptera: Chrysomelidae), using next generation sequence data. Gene
542(2):190–197 DOI 10.1016/j.gene.2014.03.035.
Dotson EM, Beard CB. 2001. Sequence and organization of the mitochondrial
genome of the Chagas disease vector, Triatoma dimidiata.Insect Molecular Biology
10(3):205–215 DOI 10.1046/j.1365-2583.2001.00258.x.
Du C, He SL, Song XH, Liao Q, Zhang XY, Yue BS. 2016. The complete mitochondrial
genome of Epicauta chinensis (Coleoptera: Meloidae) and phylogenetic analysis
among coleopteran insects. Gene 578(1):274–280 DOI 10.1016/j.gene.2015.12.036.
Du C, Zhang LF, Lu T, Ma JN, Zeng CJ, Yue BS, Zhang XY. 2017. Mitochondrial
genomes of blister beetles (Coleoptera, Meloidae) and two large intergenic spacers
in Hycleus genera. BMC Genomics 18(1):698 DOI 10.1186/s12864-017-4102-y.
Eyrewaker A. 1997. Differentiating between selection and mutation bias. Genetics
147(4):1983–1987.
Fang J, Qian L, Xu M, Yang X, Wang B, An Y. 2016. The complete nucleotide sequence
of the mitochondrial genome of the Asian longhorn beetle, Anoplophora glabripen-
nis (Coleoptera: Cerambycidae). Mitochondrial DNA Part A 27(5):3299–3300
DOI 10.3109/19401736.2015.1015012.
Farrell BD. 1998. Inordinate fondness explained: why are there so many beetles? Science
281(5376):555–559 DOI 10.1126/science.281.5376.555.
Foster PG, Jermiin LS, Hickey DA. 1997. Nucleotide composition bias affects amino acid
content in proteins coded by animal mitochondria. Journal of Molecular Evolution
44(3):282–288 DOI 10.1007/pl00006145.
Friedrich M, Muqim N. 2003. Sequence and phylogenetic analysis of the complete mito-
chondrial genome of the flour beetle Tribolium castanaeum.Molecular Phylogenetics
and Evolution 26(3):502–512 DOI 10.1016/s1055-7903(02)00335-4.
Gao XY, Cai YY, Yu DN, Storey KB, Zhang JY. 2018. Characteristics of the complete
mitochondrial genome of Suhpalacsa longialata (Neuroptera, Ascalaphidae) and its
phylogenetic implications. PeerJ 6:e5914 DOI 10.7717/peerj.5914.
Gong R, Guo X, Ma J, Song X, Shen Y, Geng F, Yue B. 2018. Complete mitochon-
drial genome of Periplaneta brunnea (Blattodea: Blattidae) and phylogenetic
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 17/23
analyses within Blattodea. Journal of Asia-Pacific Entomology 21(3):885–895
DOI 10.1016/j.aspen.2018.05.006.
Grant JR, Stothard P. 2008. The CG view server: a comparative genomics tool for
circular genomes. Nucleic Acids Research 36(2):181–184 DOI 10.1093/nar/gkn179.
Guo K, Chen J, Xu CQ, Qiao HL, Xu R, Zhao XJ. 2016. The complete mitochondrial
genome of the longhorn beetle Xylotrechus grayii (Coleoptera: Cerambycidae).
Mitochondrial DNA Part A 27(3):2133–2134 DOI 10.3109/19401736.2014.982592.
Haddad S, Shin S, Lemmon AR, Lemmon EM, Svacha P, Farrell B, McKenna DD. 2018.
Anchored hybrid enrichment provides new insights into the phylogeny and evo-
lution of longhorned beetles (Cerambycidae). Systematic Entomology 43(1):68–89
DOI 10.1111/syen.12257.
Hanada T, Suzuki T, Yokogawa T, Takemoto-Hori C, Sprinzl M, Watanabe K.
2001. Translation ability of mitochondrial tRNAsSer with unusual secondary
structures in an in vitro translation system of bovine mitochondria. Genes to Cells
6(12):1019–1030 DOI 10.1046/j.1365-2443.2001.00491.x.
Hatch MH. 1958. Blind beetles in the fauna of the Pacific Northwest. In: Pro-
ceedings of the Tenth International Congress of Entomology, 1956, 1. 207–211
DOI 10.1093/aesa/49.1.102.
Hua J, Li M, Dong P, Cui Y, Xie Q, Bu W. 2008. Comparative and phylogenomic
studies on the mitochondrial genomes of Pentatomomorpha (Insecta: Hemiptera:
Heteroptera). BMC Genomics 9(1):610 DOI 10.1186/1471-2164-9-610.
Hunt T, Bergsten J, Levkanicova Z, Papadopoulou A, John OS, Wild R, Gómez-Zurita
J. 2007. A comprehensive phylogeny of beetles reveals the evolutionary origins of a
superradiation. Science 318(5858):1913–1916 DOI 10.1126/science.1146954.
Kim KG, Hong MY, Kim MJ, Im HH, Kim MI, Bae CH. 2009. Complete mitochondrial
genome sequence of the yellow-spotted long-horned beetle Psacothea hilaris
(Coleoptera: Cerambycidae) and phylogenetic analysis among coleopteran insects.
Molecules and Cells 27(4):429–441 DOI 10.1007/s10059-009-0064-5.
Kim S, De Medeiros BA, Byun BK, Lee S, Kang JH, Lee B, Farrell BD. 2018. West
meets East: how do rainforest beetles become circum-Pacific? Evolutionary
origin of Callipogon relictus and allied species (Cerambycidae: Prioninae) in
the new and old worlds. Molecular Phylogenetics and Evolution 125:163–176
DOI 10.1016/j.ympev.2018.02.019.
Kumar S, Stecher G, Tamura K. 2016. Mega 7: molecular evolutionary genetics analysis
version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7):1870–1874
DOI 10.1093/molbev/msw054.
Lanfear R, Calcott B, Ho SYW, Guindon S. 2012. PartitionFinder: combined selection of
partitioning schemes and substitution models for phylogenetic analyses. Molecular
Biology and Evolution 29(6):1695–1701 DOI 10.1093/molbev/mss020.
Lawrence JF, Newton AF. 1982. Evolution and classification of beetles. Annual Review of
Ecology and Systematics 13(1):261–290 DOI 10.1146/annurev.es.13.110182.001401.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 18/23
Levinson G, Gutman GA. 1987. Slipped-strand mispairing: a major mechanism
for DNA sequence evolution. Molecular Biology and Evolution 4(3):203–221
DOI 10.1093/oxfordjournals.molbev.a040442.
Li F, Zhang H, Wang W, Weng H, Meng Z. 2016a. Complete mitochondrial genome
of the Japanese pine sawyer, Monochamus alternatus (Coleoptera: Cerambycidae).
Mitochondrial DNA Part A 27(2):1144–1145 DOI 10.3109/19401736.2014.936321.
Li W, Yang X, Qian L, An Y, Fang J. 2016b. The complete mitochondrial genome of
the citrus long-horned beetle, Anoplophora chinensis (Coleoptera: Cerambycidae).
Mitochondrial DNA Part A 27(6):4665–4667 DOI 10.3109/19401736.2015.1106493.
Lim J, Yi DK, Kim YH, Lee W, Kim S, Kang JH. 2017. Complete mitochondrial genome
of Callipogon relictus Semenov (Coleoptera: Cerambycidae): a natural monument
and endangered species in Korea. Mitochondrial DNA Part B 2(2):629–631
DOI 10.1080/23802359.2017.1372718.
Lin M, Bi W. 2011. A new genus and species of the subfamily Philinae (Coleoptera:
Vesperidae). Zootaxa 2777(1):54–60 DOI 10.11646/zootaxa.2777.1.4.
Liu JH, Jia PF, Luo T, Wang QM. 2017. Complete mitochondrial genome of
white-striped long-horned beetle, Batocera lineolata (Coleoptera: Ceram-
bycidae) by next-generation sequencing and its phylogenetic relationship
within superfamily Chrysomeloidea. Mitochondrial DNA Part B 2(2):520–521
DOI 10.1080/23802359.2017.1361797.
Liu YQ, Chen DB, Liu HH, Hu HL, Bian HX, Zhang RS. 2018. The complete mitochon-
drial genome of the longhorn beetle Dorysthenes Paradoxus (Coleoptera: Cerambyci-
dae: Prionini) and the implication for the phylogenetic relationships of the Ceramby-
cidae species. Journal of Insect Science 18(2):Article 21 DOI 10.1093/jisesa/iey012.
Ma Y, He K, Yu PP, Cheng XF, Zhang JY. 2015a. The complete mitochondrial
genomes of three bristletails (Insecta: Archaeognatha): the paraphyly of Machil-
idae and insights into Archaeognathan phylogeny. PLOS ONE 10:e0117669
DOI 10.1371/journal.pone.0117669.
Ma ZH, Yang XF, Bercsenyi M, Wu JJ, Yu Y, Wei K, Qi XF, Yang RB. 2015b. Com-
parative mitogenomics of the genus Odontobutis (Perciformes: Gobioidei:
Odontobutidae) revealed conserved gene rearrangement and high sequence
variations. International Journal of Molecular Sciences 16(10):25031–25049
DOI 10.3390/ijms161025031.
Min XJ, Hickey DA. 2007. DNA asymmetric strand bias affects the amino acid composi-
tion of mitochondrial proteins. DNA Research 14(5):201–206
DOI 10.1093/dnares/dsm019.
Monné ML, Monné MA, Mermudes JRM. 2009. Inventário das espécies de Cerambyci-
nae (Insecta, Coleoptera, Cerambycidae) do Parque Nacional do Itatiaia, R.J. Brasil.
Biota Neotropica 12(12):40–76 DOI 10.1590/S1676-06032012000100004.
Moritz C, Dowling TE, Brown WM. 1987. Evolution of animal mitochondrial DNA:
relevance for population biology and systematics. Annual Review of Ecology and
Systematics 18(1):269–292 DOI 10.2307/2097133.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 19/23
Napp DS. 1994. Phylogenetic relationships among the subfamilies of Cerambycidae
(Coleoptera, Chrysomeloidea). Revista Brasileira de Entomologia 38(2):265–419.
Negrisolo E, Babbucci M, Patarnello T. 2011. The mitochondrial genome of
the ascalaphid owlfly Libelloides macaronius, and comparative evolution-
ary mitochondriomics of neuropterid insects. BMC Genomics 12(1):221
DOI 10.1186/1471-2164-12-221.
Nie R, Lin M, Xue H, Bai M, Yang X. 2017. Complete mitochondrial genome of
Spiniphilus spinicornis (Coleoptera: Vesperidae: Philinae) and phylogenetic
analysis among Cerambycoidea. Mitochondrial DNA Part A 28(1):145–146
DOI 10.3109/19401736.2015.1111363.
Ojala D, Montoya J, Attardi G. 1981. tRNA punctuation model of RNA processing in
human mitochondria. Nature 290(5806):470–474 DOI 10.1038/290470a0.
Perna NT, Kocher TD. 1995. Patterns of nucleotide composition at fourfold de-
generate sites of animal mitochondrial genomes. Journal of Molecular Evolution
41(3):353–358 DOI 10.1007/bf01215182.
Ponomarenko AG, Prokin AA. 2015. Review of paleontological data on the evolu-
tion of aquatic beetles (Coleoptera). Paleontological Journal 49(13):1383–1412
DOI 10.1134/S0031030115130080.
Powell JR, Moriyama EN. 1997. Evolution of codon usage bias in drosophila. Proceedings
of the National Academy of Sciences of the United States of America 94(15):7784–7790
DOI 10.2307/2097133.
Que S, Yu A, Liu P, Jin M, Xie GA. 2019. The complete mitochondrial genome of
Apriona swainsoni.Mitochondrial DNA Part B 4(1):931–932
DOI 10.1080/23802359.2019.1567284.
Raje KR, Ferris VR, Holland JD. 2016. Phylogenetic signal and potential for invasiveness.
Agricultural and Forest Entomology 18(3):260–269 DOI 10.1111/afe.12158.
Rao Y, Wu G, Wang Z, Chai X, Nie Q, Zhang X. 2011. Mutation bias is the driving
force of codon usage in the Gallus gallus genome. DNA Research 18(6):499–512
DOI 10.1093/dnares/dsr035.
Reid CAM. 1995. A cladistic analysis of subfamilial relationships in the Chrysomelidae
s. l. (Chrysomeloidea). In: Pakaluk J, Slipinski SA, eds. Biology, phylogeny and
classification of Coleoptera: papers celebrating the 80th birthday of Roy A. Crowson.
Warzawa: Muzeum i Instytut Zoologii PAN, 559–631.
Rodovalho CM, Lyra ML, Ferro M, Jr MB. 2014. The mitochondrial genome of the leaf-
cutter ant Atta laevigata: a mitogenome with a large number of intergenic spacers.
PLOS ONE 9(5):e97117 DOI 10.1371/journal.pone.0097117.
Ronquist F, Teslenko M, Mark PVD, Ayres DL, Darling A, Höhna S, Larget B, Liu
L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phyloge-
netic inference and model choice across a large model space. Systematic Biology
61(3):539–542 DOI 10.1093/sysbio/sys029.
Saito S, Tamura K, Aotsuka T. 2005. Replication origin of mitochondrial DNA in insects.
Genetics 171(4):1695–1705 DOI 10.1534/genetics.105.046243.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 20/23
Sama G, Buse J, Orbach E, Friedman A, Rittner O, Chikatunov V. 2010. A new cata-
logue of the Cerambycidae (Coleoptera) of Israel with notes on their distribution and
host plants. Munis Entomology and Zoology 5(1):1–55
DOI 10.1007/s12032-010-9513-4.
Sheffield NC, Song H, Cameron SL, Whiting MF. 2008. A comparative analysis of
mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome de-
scriptions of five new beetles. Molecular Biology and Evolution 25(11):2499–2509
DOI 10.1093/molbev/msn198.
Simon C, Buckley TR, Frati F, Stewart JB, Beckenbach AT. 2006. Incorporat-
ing molecular evolution into phylogenetic analysis, and a new compilation
of conserved polymerase chain reaction primers for animal mitochondrial
DNA. Annual Review of Ecology Evolution and Systematics 37(1):545–579
DOI 10.1146/annurev.ecolsys.37.091305.110018.
Song H, Sheffield NC, Cameron SL, Miller KB, Whiting MF. 2010. When phylogenetic
assumptions are violated: base compositional heterogeneity and among-site rate vari-
ation in beetle mitochondrial phylogenomics. Systematic Entomology 35(3):429–448
DOI 10.1111/j.1365-3113.2009.00517.x.
Song N, Zhang H, Yin X, Lin A, Zhai Q. 2017. The complete mitochondrial genome
sequence from the longicorn beetle Obrium sp. (Coleoptera: Cerambycidae).
Mitochondrial DNA Part A 28(3):326–327 DOI 10.3109/19401736.2015.1122766.
Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis
of large phylogenies. Bioinformatics 30(9):1312–1313
DOI 10.1093/bioinformatics/btu033.
Steinberg S, Cedergren R. 1994. Structural compensation in atypical mitochondrial
tRNAs. Nature Structural Biology 1(8):507–510 DOI 10.1038/nsb0894-507.
Stewart JB, Beckenbach AT. 2003. Phylogenetic and genomic analysis of the com-
plete mitochondrial DNA sequence of the spotted asparagus beetle Crioceris
duodecimpunctata.Molecular Phylogenetics and Evolution 26(3):513–526
DOI 10.1016/S1055-7903(02)00421-9.
Svacha P, Wang J, Chen S. 1997. Larval morphology and biology of Philus antennatus
and Heterophilus punctulatus, and systematic position of the Philinae (Coleoptera:
Cerambycidae: Vesperidae). Annales de la Société Entomologique de France
33:323–369.
Taanman JW. 1999. The mitochondrial genome: structure, transcription, trans-
lation and replication. Biophysica Acta (BBA)-Bioenergetics 1410(2):103–123
DOI 10.1016/S0005-2728(98)00161-3.
Tan MH, Gan HM, Lee YP, Poore GC, Austin CM. 2017. Digging deeper: new gene order
rearrangements and distinct patterns of codons usage in mitochondrial genomes
among shrimps from the Axiidea, Gebiidea and Caridea (Crustacea: Decapoda).
PeerJ 5:e2982 DOI 10.7717/peerj.2982.
Timmermans MJ, Vogler AP. 2012. Phylogenetically informative rearrangements in
mitochondrial genomes of Coleoptera, and monophyly of aquatic elateriform
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 21/23
beetles (Dryopoidea). Molecular Phylogenetics and Evolution 63(2):299–304
DOI 10.1016/j.ympev.2011.12.021.
Wang J, Lan DY, Dai XY, Yu DN, Storey KB, Zhang JY. 2019. The complete mitochon-
drial genome of Xystrocera globosa (Coleoptera: Cerambycidae) and its phylogeny.
Mitochondrial DNA Part B 4(1):1647–1649 DOI 10.1080/23802359.2019.1605852.
Wang Q, Tang G. 2017. Genomic and phylogenetic analysis of the complete mito-
chondrial DNA sequence of walnut leaf pest Paleosepharia posticata (Coleoptera:
Chrysomeloidea). Journal of Asia-Pacific Entomology 20(3):840–853
DOI 10.1016/j.aspen.2017.05.010.
Wang YT, Liu YX, Tong XL, Ren QP, Jiang GF. 2016. The complete mitochondrial
genome of the longhorn beetle, Massicus raddei.Mitochondrial DNA Part A
27(1):209–211 DOI 10.3109/19401736.2014.880892.
Wei SJ, Tang P, Zheng LH, Shi M, Chen XX. 2010. The complete mitochondrial genome
of Evania appendigaster (Hymenoptera: Evaniidae) has low A+T content and a long
intergenic spacer between atp8 and atp6. Molecular Biology Reports 37(4):1931–1942
DOI 10.1007/s11033-009-9640-1.
Wolstenholme DR. 1992. Animal mitochondrial DNA: structure and evolution.
International Review of Cytology 141:173–216 DOI 10.1016/S0074-7696(08)62066-5.
Yang J, Cao LJ, Geng YX, Wei DF, Chen M. 2017. Determination of the complete mito-
chondrial genome of Thyestilla gebleri and comparative analysis of the mitochondrial
genome in Cerambycidae. Chinese Journal of Applied Entomology 54(5):755–766 (In
Chinese) DOI 10.7679/j.issn.2095-1353.2017.092.
Yuan M, Zhang Q, Zhang L, Guo Z, Liu Y, Shen Y. 2016. High-level phylogeny of the
Coleoptera inferred with mitochondrial genome sequences. Molecular Phylogenetics
and Evolution 104:99–111 DOI 10.1016/j.ympev.2016.08.002.
Yukuhiro K, Sezutsu H, Itoh M, Shimizu K, Banno Y. 2002. Significant levels of
sequence divergence and gene rearrangements have occurred between the mito-
chondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close
relative, the domesticated silkmoth, Bombyx mori.Molecular Biology and Evolution
19(8):1385–1389 DOI 10.1093/oxfordjournals.molbev.a004200.
Zhang DX, Hewitt GM. 1997. Insect mitochondrial control region: a review of its
structure, evolution and usefulness in evolutionary studies. Biochemical Systematics
and Ecology 25(2):99–120 DOI 10.1016/s0305-1978(96)00042-7.
Zhang JY, Zhou CF, Gai YH, Song DX, Zhou KY. 2008. The complete mitochondrial
genome of Parafronurus youi (Insecta: Ephemeroptera) and phylogenetic position of
the Ephemeroptera. Gene 424(1–2):18–24 DOI 10.1016/j.gene.2008.07.037.
Zhang LP, Cai YY, Yu D.N. Storey KB, Zhang JY. 2018a. Gene characteristics of the
complete mitochondrial genomes of Paratoxodera polyacantha and Toxodera hauseri
(Mantodea: Toxoderidae). PeerJ 6:e4595 DOI 10.7717/peerj.4595.
Zhang LP, Ma Y, Yu DN, Storey KB, Zhang JY. 2019. The mitochondrial genomes of
Statilia maculata and S. nemoralis (Mantidae: Mantinae) with different duplications
of trnR genes. International Journal of Biological Macromolecules 121:839–845
DOI 10.1016/j.ijbiomac.2018.10.038.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 22/23
Zhang LP, Yu DN, Storey KB, Cheng HY, Zhang JY. 2018b. Higher tRNA gene du-
plication in mitogenomes of praying mantises (Dictyoptera, Mantodea) and the
phylogeny within Mantodea. International Journal of Biological Macromolecules
111:787–795 DOI 10.1016/j.ijbiomac.2018.01.016.
Zhang SQ, Che LH, Li Y, Liang D, Pang H, Ślipiński A, Zhang P. 2018c. Evolutionary
history of Coleoptera revealed by extensive sampling of genes and species. Nature
Communications 9(1):Article 205 DOI 10.1038/s41467-017-02644-4.
Wang et al. (2019), PeerJ, DOI 10.7717/peerj.7633 23/23
