A preview of this full-text is provided by Pensoft Publishers.
Content available from Journal of Hymenoptera Research
This content is subject to copyright. Terms and conditions apply.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)1
Phylogeny of the subfamilies of Ichneumonidae
(Hymenoptera)
Andrew M.R. Bennett1, Sophie Cardinal1, Ian D. Gauld2,†, David B. Wahl3
1 Agriculture and Agri-Food Canada, Canadian National Collection of Insects, Arachnids and Nematodes,
960 Carling Avenue, Ottawa, Ontario, K1A 0C6, Canada 2 Natural History Museum, Cromwell Road,
London, SW7 5BD, UK 3 Department of Biology, Utah State University, Logan, UT, 84322-5305, USA
Corresponding author: Andrew M.R. Bennett (andrew.bennett@canada.ca)
Academic editor: Gavin Broad|Received 13 December 2018|Accepted 13 June 2019|Published 30 August2019
http://zoobank.org/4D498F4D-0CBE-47C4-852C-9AB3108E9154
Citation: Bennett AMR, Cardinal S, Gauld ID, Wahl DB (2019) Phylogeny of the subfamilies of Ichneumonidae
(Hymenoptera). Journal of Hymenoptera Research 71: 1–156. https://doi.org/10.3897/jhr.71.32375
Abstract
A combined morphological and molecular phylogenetic analysis was performed to evaluate the subfamily
relationships of the parasitoid wasp family Ichneumonidae (Hymenoptera). Data were obtained by coding
135 morphological and 6 biological characters for 131 exemplar species of ichneumonids and 3 species
of Braconidae (the latter as outgroups). e species of ichneumonids represent all of the 42 currently
recognized subfamilies. In addition, molecular sequence data (cytochrome oxidase I “DNA barcoding”
region, the D2 region of 28S rDNA and part of the F2 copy of elongation factor 1-alpha) were obtained
from specimens of the same species that were coded for morphology (1309 base pairs total). e data were
analyzed using parsimony and Bayesian analyses. e parsimony analysis using all data recovered previ-
ously recognized informal subfamily groupings (Pimpliformes, Ophioniformes, Ichneumoniformes), al-
though the relationships of these three groups to each other diered from previous studies and some of the
subfamily relationships within these groupings had not previously been suggested. Specically, Ophioni-
formes was the sister group to (Ichneumoniformes + Pimplformes), and Labeninae was placed near Ich-
neumoniformes, not as sister group to all Ichneumonidae except Xoridinae. e parsimony analysis using
only morphological characters was poorly resolved and did not recover any of the three informal subfamily
groupings and very few of the relationships were similar to the total-evidence parsimony analysis. e mo-
lecular-only parsimony analysis and both Bayesian analyses (total-evidence and molecular-only) recovered
Pimpliformes, a restricted Ichneumoniformes grouping and many of the subfamily groupings recovered in
† Deceased.
JHR 71: 1–156 (2019)
doi: 10.3897/jhr.71.32375
http://jhr.pensoft.net
Copyright Her Majesty the Queen in Right of Canada, as represented by the Minister of Agriculture and Agri-Food Canada et al. This is an open access
article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original author and source are credited.
RESEARCH ARTICLE
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
2
the total-evidence parsimony analysis. A comparison and discussion of the results obtained by each phylo-
genetic method and dierent data sets is provided. It is concluded that the molecular characters produced
results that were relatively consistent with traditional, non-phylogenetic concepts of relationships between
the ichneumonid subfamilies, whereas the morphological characters did not (at least not by themselves).
e inclusion of both molecular and morphological characters using parsimony produced a topology that
was the closest to the traditional subfamily relationships. e method of analysis did not greatly aect the
overall topology for the molecular-only analyses, but there were dierences between Bayesian and parsi-
mony results for the total-evidence analyses (especially near the root of the tree). e Bayesian results did
not seem to be altered very much by the inclusion of morphological characters, unlike in the parsimony
analysis. In summary, the following groups were supported in multiple analyses regardless of the characters
used or method of tree-building: Pimpliformes, higher Ophioniformes, higher Pimpliformes, (Claseinae +
Pedunculinae), (Banchinae + Stilbopinae), Campopleginae, Cremastinae, Diplazontinae, Ichneumoninae
(including Alomya), Labeninae, Ophioninae, Poemeniinae, Rhyssinae, and Tersilochinae sensu stricto.
Conversely, Ctenopelmatinae and Tryphoninae were never recovered without inclusion of other taxa.
Based on the hypothesis of relationships obtained by the total-evidence parsimony analysis, the following
formal taxonomic changes are proposed: Alomyinae Förster (= Alomya Panzer and Megalomya Uchida) is
once again synonymized with Ichneumoninae and is now considered a tribe (Alomyini rev. stat.); and
Notostilbops Townes is transferred from Stilbopinae to Banchinae, tribe Atrophini.
Keywords
Ichneumonidae, phylogeny, parsimony, Bayesian, classication, taxonomy
Table of contents
Introduction ............................................................................................................. 3
Methods ................................................................................................................... 7
Outgroups .............................................................................................................. 7
Ingroup .................................................................................................................. 7
Morphological character coding ............................................................................. 8
Morphological terms, measurements and photography ........................................... 8
Molecular protocols .............................................................................................. 11
Sequence alignment.............................................................................................. 15
Phylogenetic analyses ........................................................................................... 15
Results and discussion ............................................................................................ 16
Morphological characters (see Table 2 for matrix) ................................................. 16
Phylogenetics ....................................................................................................... 24
Parsimony analysis ........................................................................................... 24
Bayesian analysis .............................................................................................. 60
Support/relationships of taxa ................................................................................ 66
Ichneumonidae ................................................................................................ 66
Sister group to all other Ichneumonidae ........................................................... 66
Subfamily groupings ........................................................................................ 72
Relationship of Ophioniformes, Pimpliformes and Ichneumoniformes ............ 79
Support/ relationships of subfamilies ................................................................ 80
Biological transitions .......................................................................................... 123
Timing of larval maturation ........................................................................... 124
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)3
Location of larval maturation ......................................................................... 125
Host/ source of larval nutrition ...................................................................... 128
Conclusions ......................................................................................................... 131
Acknowledgements ............................................................................................... 132
References ............................................................................................................ 133
Appendix 1 ........................................................................................................... 145
Appendix 2 ........................................................................................................... 149
Supplementary material 1 ..................................................................................... 154
Supplementary material 2 ..................................................................................... 154
Supplementary material 3 ..................................................................................... 154
Supplementary material 4 ..................................................................................... 155
Supplementary material 5 ..................................................................................... 155
Supplementary material 6 ..................................................................................... 155
Supplementary material 7 ..................................................................................... 156
Supplementary material 8 ..................................................................................... 156
Supplementary material 9 ..................................................................................... 156
Introduction
e catalogue of Yu et al. (2016) listed 25,285 described species of ichneumonids in 1601
genera. In terms of the subfamily classication within Ichneumonidae, there is general
consensus for the taxonomic limits of most subfamilies; however, some authors disagree
on a small minority (see Table 1). Townes (1969) established the modern subfamily clas-
sication recognizing 25 subfamilies. Morphological studies by several authors between
1969 and 2002 increased this number gradually to 37 (Wahl 1990, 1993; Gauld 1991;
Porter 1998; Gauld et al. 2002a). e latter study recognized 37 subfamilies including
the Pedunculinae, but not the Claseinae (both proposed by Porter 1998). us the total
number recognized by morphology-based studies alone is 38 (see column 1 of Table 1).
From 1998–2009, several studies used single gene molecular evidence (the D2–D3
region of 28S ribosomal DNA) to examine ichneumonid subfamily relationships, either
combined with morphological characters (Quicke et al. 2005; Quicke et al. 2009) or using
molecular characters alone (Belshaw et al. 1998; Laurenne et al. 2006). It was not until
Quicke et al. (2005) that formal changes to the subfamily classication were proposed
based on studies using molecular data. is study proposed two additional subfamilies:
Nesomesochorinae and Nonninae for three genera previously included in Campopleginae.
Further, Laurenne et al. (2006) proposed the resurrection of Alomyinae (included in Ich-
neumoninae in previous classications) (Wahl and Mason 1995). Subsequently, Quicke et
al. (2009) evaluated sequences of 28S D2–D3 ribosomal DNA from 1001 species of Ich-
neumonidae and proposed the resurrection of one subfamily and the synonymy of three
others (see column 2 of Table 1) (for a total of 39 subfamilies). e state of knowledge
in ichneumonid systematics was summarized by Quicke (2015) and Broad et al. (2018).
More recently, Broad (2016) reversed one of the synonymies proposed by Quicke
et al. (2009) by once again recognizing Neorhacodinae. Santos (2017), using both
morphology and multi-gene sequence data, studied the relationships within Cryptinae
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
4
Table 1. Comparison of extant subfamilies of Ichneumonidae recognized by recent studies. Column 1:
subfamilies recognized by morphological studies alone (up to 2002). Column 2: most recent analysis of all
subfamily relationships using both morphological and molecular data. Column 3: subfamilies recognized
following current study. *Brachyscleromatinae is now known as Sisyrostolinae (Bennett et al. 2013). Ne-
orhacodinae was resurrected by Broad (2016) (considered part of Tersilochinae by Quicke et al. 2009). At-
eleutinae and Phygadeuontinae were raised to subfamily status from within Cryptinae by Santos (2017).
Gauld et al. (2002a) + Porter (1998) Quicke et al. (2009) Current study (after formal changes)
Acaenitinae Acaenitinae Acaenitinae
Adelognathinae Adelognathinae Adelognathinae
Agriotypinae Agriotypinae Agriotypinae
Alomyinae (previously part of
Ichneumoninae)
Anomaloninae Anomaloninae Anomaloninae
Ateleutinae (previously part of Cryptinae)
Banchinae Banchinae Banchinae (including Notostilbops)
Brachycyrtinae Brachycyrtinae Brachycyrtinae
Brachyscleromatinae* (previously
part of Phrudinae)
Campopleginae Campopleginae Campopleginae
Claseinae Claseinae Claseinae
Collyriinae Collyriinae Collyriinae
Cremastinae Cremastinae Cremastinae
Cryptinae Cryptinae Cryptinae
Ctenopelmatinae Ctenopelmatinae Ctenopelmatinae
Cylloceriinae Cylloceriinae Cylloceriinae
Diacritinae Diacritinae Diacritinae
Diplazontinae Diplazontinae Diplazontinae
Eucerotinae Eucerotinae Eucerotinae
Hybrizontinae (previously
Paxylommatinae)
Hybrizontinae (previously
Paxylommatinae)
Hybrizontinae
Ichneumoninae Ichneumoninae Ichneumoninae (including Alomyini)
Labeninae Labeninae Labeninae
Lycorininae Lycorininae Lycorininae
Mesochorinae Mesochorinae Mesochorinae
Metopiinae Metopiinae Metopiinae
Microleptinae Microleptinae Microleptinae
Neorhacodinae Neorhacodinae
Nesomesochorinae (including
Nonninae of Quicke et al. (2005)
Nesomesochorinae
Ophioninae Ophioninae Ophioninae
Orthocentrinae Orthocentrinae Orthocentrinae
Orthopelmatinae Orthopelmatinae Orthopelmatinae
Oxytorinae Oxytorinae Oxytorinae
Pedunculinae Pedunculinae Pedunculinae
Phrudinae
Phygadeuontinae (previously part of Cryptinae)
Pimplinae Pimplinae Pimplinae
Poemeniinae Poemeniinae Poemeniinae
Rhyssinae Rhyssinae Rhyssinae
Sisyrostolinae*
Stilbopinae Stilbopinae Stilbopinae (excluding Notostilbops)
Tatogastrinae Tatogastrinae Tatogastrinae
Tersilochinae Tersilochinae (including
Neorhacodinae + part of
Phrudinae)
Tersilochinae
Tryphoninae Tryphoninae Tryphoninae
Xoridinae Xoridinae Xoridinae
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)5
and raised Phygadeuontinae (from the tribe Phygadeuontini) and Ateleutinae (from
the tribe Cryptini, subtribe Ateleutina). In summary, 42 ichneumonid subfamilies
were recognized prior to this study. Since Santos (2017), two other studies have been
published which discuss ichneumonid subfamily relationships but neither of these pro
-
posed changes to the subfamily classication. Broad et al. (2018) provided an updated
handbook to the ichneumonids of Britain and Ireland including discussion of all sub
-
families, and Klopfstein et al. (2019) used transcriptomes and target DNA enrichment
to examine the relationships of Pimplinae and related subfamilies.
In terms of the relationships of the subfamilies, prior to about 1990, relationships
could only be inferred by the their relative arrangement in Henry Townes’s Genera of
Ichneumonidae (Townes 1969, 1970a, 1970b, 1971), a classication that was largely
based on the supporting evidence (especially larval) in the character outline of Townes
(1969) (pp. 29–35). As Townes (1969) wrote (p. 29): “Examination of the larval
characters gave nal proof of the basic faults in the old system and helped in the for
-
mulation of a new one”. Since 1990, phylogenetic hypotheses have been proposed for
several groupings of subfamilies within Ichneumonidae. e informal name Pimpli
-
formes was proposed for ve subfamilies putatively related to Pimplinae (Wahl, 1990),
and this group was further divided into eight subfamilies by Gauld (1991) through
establishment of Diacritinae, Poemeniinae and Rhyssinae. Further, Wahl (1991) pro
-
posed the name Ophioniformes for eight subfamilies and Wahl (1993a) hypothesized
that the two large subfamilies Cryptinae and Ichneumoninae were related and pro
-
posed the informal name Ichneumoniformes to comprise these two subfamilies along
with Brachycyrtinae. e studies by Quicke and colleagues have for the most part,
upheld these three groupings. eir studies also suggested placement for other sub
-
families, for example, Quicke et al. (2009) placed an additional 8 subfamilies within
the Ophioniformes (for a total of 16), 3 additional subfamilies in Ichneumoniformes
(for a total of 5), and 1 additional subfamily (Collyriinae) in Pimpliformes (for a to
-
tal of 9). Still, the study of Quicke et al. (2009) had two subfamilies with uncertain
anity (Eucerotinae and Microleptinae). eir study included the most comprehen
-
sive taxon sampling of any phylogenetic study of Ichneumonidae, including species
from all subfamilies, but the analysis included only one gene and morphology was
coded mostly at the subfamily and tribal levels (88 terminal taxa). More recent studies
(Santos 2017 which sampled heavily within Ichneumoniformes and Klopfstein et al.
2019 that focused on Pimpliformes) included much more molecular data, but with
a more limited taxonomic scope. e overall purpose of this study is to examine the
relationships of the subfamilies of Ichneumonidae based on phylogenetic analyses us
-
ing both morphological and molecular sequence data. e study is of interest because
it includes the largest morphological data set for Ichneumonidae that has been coded
for individual exemplar species. Novel morphological characters are introduced, espe
-
cially for larvae, and the nuclear gene elongation factor 1-alpha is sequenced across the
entire family for the rst time. e results will be compared to previous hypotheses
of relationships (e.g., Wahl and Gauld 1998, Quicke et al. 2009, Santos 2017, Klopf
-
stein et al. 2019) and will provide another hypothesis of relationships against which
future studies can be compared.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
6
For the purposes of this study, the following denitions for the subfamily group-
ings are used:
1) Ophioniformes includes the following 18 subfamilies: Anomaloninae, Banchinae,
Campopleginae, Cremastinae, Ctenopelmatinae, Hybrizontinae, Lycorininae, Mes-
ochorinae, Metopiinae, Oxytorinae, Neorhacodinae, Nesomesochorinae, Ophioni-
nae, Sisyrostolinae, Stilbopinae, Tatogastrinae, Tersilochinae and Tryphoninae. is
concept is the same as that of Quicke et al. (2009)–the 16 subfamilies listed under
Ophioniformes in their table 4 plus Neorhacodinae resurrected by Broad (2016)
and Tatogastrinae which was presumably accidentally omitted from their table. Note
that this group includes the eight subfamilies included by Wahl (1991) when the
name was proposed. Gauld et al. (1997) included nine subfamilies: the eight of
Wahl (1991) and Tersilochinae. Gauld et al. (1997) also coined the name Tryphoni-
formes to comprise Adelognathinae, Eucerotinae, Tryphoninae and Townesioninae
(the latter now synonymized with Banchinae). Adelognathinae and Eucerotinae are
now believed more closely related to Ichneumoniformes (Quicke et al. 2009, San-
tos 2017) and Tryphoninae is thought to belong to Ophioniformes (Quicke et al.
2009), as sister group to all other subfamilies, therefore we do not use the term
Tryphoniformes. Within Ophioniformes is a group of closely related subfamilies
that Quicke et al. (2009) called the “higher Ophioniformes” which we dene as
Anomaloninae, Campopleginae, Cremastinae, Nesomesochorinae and Ophioninae.
2) Pimpliformes includes the following nine subfamilies: Acaenitinae, Cylloceriinae,
Diacritinae, Diplazontinae, Orthocentrinae, Pimplinae, Poemeniinae, Rhyssinae
and in addition, Collyriinae. is denition corresponds to the concept of Quicke
et al. (2009), which was the same as Wahl and Gauld (1998), except for the inclu-
sion of Collyriinae in Quicke et al. (2009). e higher Pimpliformes is comprised
of Pimplinae, Poemeniinae and Rhyssinae (Quicke et al. 2009). Note that the
term “higher Pimpliformes” was used previously by Gauld (1991) for a group
comprised of Diplazontinae, Orthocentrinae and Microleptinae, but this is not
the denition used in the current study. Gauld (1991) believed that Rhyssinae was
sister subfamily to all others in Pimpliformes, followed by a polytomy of Pimpli-
nae, Poemeniinae and Acaenitinae leading to the koinobiont, endoparasitoid y
parasitoids (Cylloceriinae and his “higher Pimpliformes”). e sister group rela-
tionship of Rhyssinae to the rest of Pimpliformes was not upheld by the studies of
Wahl and Gauld (1998) and Quicke et al. (2009), but the grouping of Rhyssinae,
Poemeniinae and Pimplinae was strongly supported in both studies.
3) Ichneumoniformes is considered in two senses: a) in the strict sense (Ichneu-
moniformes sensu stricto) as originally proposed by Wahl (1993a) and including
only Brachycyrtinae, Cryptinae (including Ateleutinae and Phygadeuontinae)
and Ichneumoninae (including Alomyinae), and b) in the broad sense (Ichneu-
moniformes sensu lato) comprised of Ichneumoniformes s.s. plus seven related
subfamilies which will be further described and discussed in the Results and
discussion section.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)7
In addition, Quicke et al. (2009) dened the following higher groups:
4) Xoridiformes comprised of Xoridinae
5) Labeniformes comprised of Labeninae
6) Orthopelmatiformes comprised of Orthopelmatinae
7) Brachycyrtiformes comprised of Brachycyrtinae, Claseinae and Pedunculinae.
See the Results section on Support/ relationships of subfamilies (below) for discus-
sion on the support/ placement of these groups in the current study.
Methods
Outgroups
ere is very strong evidence that Braconidae is the sister group of Ichneumonidae
based on morphology (Rasnitsyn 1988; Sharkey and Wahl 1992) as well as combined
morphological and molecular evidence (Heraty et al. 2011; Sharkey et al. 2012; Pe-
ters et al. 2017; Branstetter et al. 2017). e three exemplar species (from three sub-
families) chosen for this study were species used in the studies of Heraty et al. (2011)
and Sharkey et al. (2012) which was done to aid comparison between these studies
and to ensure inclusion of a range of life strategies in our outgroups: Doryctes eryth-
romelas (Brullé) (Doryctinae) (idiobiont ectoparasitoid); Aleiodes terminalis Cresson
(Rogadinae) (koinobiont endoparasitoid) and Rhysipolis sp. (Rhysipolinae) (koinobi-
ont ectoparasitoid).
Ingroup
Ingroup taxa were chosen in order to provide complete coverage of all currently rec-
ognized subfamilies based on the most recent study of ichneumonid relationships
(Quicke et al. 2009) as well as to try to include the widest range of morphological
variation among the species in each subfamily. In addition, some equivocally placed
taxa were deliberately included (see Results and Discussion). Apart from taxonomic
coverage and choosing species to maximize morphological divergence within subfami-
lies, the following additional criteria were used for choosing ingroup exemplar taxa
(in order of importance): a) availability of fresh specimens from which all three DNA
regions could be obtained; b) knowledge of the larva; c) knowledge of biological (life-
history) traits; d) knowledge of the egg. All taxa used in this study are listed in the mor-
phological character matrix (Table 2) as well as the list of taxa examined (Appendix 2).
Voucher specimens and larval slides are deposited at the Australian National Insect
Collection, Canberra, Australia (ANIC) (J. Rodriguez), the Canadian National Collec-
tion of Insects, Arachnids and Nematodes, Ottawa, Canada (CNC) (A. Bennett), the
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
8
Entomology collection, Department of Biology, Utah State University, Logan, Utah,
USA (EMUS) (D. Wahl), the Smithsonian Institute, Washington, DC (NMNH) (R.
Kula) and the University of Kentucky, Lexington, Kentucky, USA (UKY) (E. Chapman).
Morphological character coding
We used a species exemplar approach in this study, rather than coding morphological
characters at the tribal or subfamily level as has been done in other studies on family
and subfamily relationships within Hymenoptera (Brothers and Carpenter 1993 for
Aculeata; Quicke and van Achterberg 1990 for Braconidae; Quicke et al. 2009 for
Ichneumonidae). Whereas the species exemplar approach is very time-consuming for
large datasets, it is preferable (if possible) in order to make the character coding as
objective and reproducible as possible. It also permits testing of the monophyly of the
subfamilies and tribes (evidence of monophyly is provided when all constituent taxa
cluster together). For a comparison of the exemplar and generic abstraction approach-
es, see Gauld et al. (2002b), which included both types of coding for Pimplinae. In
all cases, coding of adult morphology was done with reference to the actual specimen
from which DNA was obtained, as well as other authoritatively identied, conspecic
specimens used to ensure that the DNA voucher was representative of the species.
Larval characters were coded directly from conspecic larval slides of our exemplar
species (when known), or if the larva of our exemplar species was not known, coding
was done with reference to slides and or literature gures of species within the same
genus. In cases in which there was no larval knowledge of any species within the genus,
the larval characters were coded as missing. e same strategy was used for the egg and
biological characters.
Morphological terms, measurements and photography
All terms of ichneumonid morphology follow Townes (1969) with the following
modications: hypostomal carina (Fig. 1, structure #18) for ‘oral carina’, supra-an-
tennal area (Fig. 1, structure #2) for ‘frons’, supraclypeal area (Fig. 1, structure #3)
for ‘face’, gena (Fig. 1, structure #19) for ‘temple’, occiput (Fig. 1, structure #14) for
‘postocciput’, malar space (Fig. 1, structure #4) for ‘cheek’, epicnemial carina (Fig. 2C)
for ‘prepectal carina’, laterotergites (Fig. 79) for ‘epipleura’, gonoforceps (Fig. 92) for
‘claspers’, and hypopygium (Fig. 86) for ‘subgenital plate’. e term ‘mesosoma’ is used
for the body region that includes the thorax and rst abdominal segment (the propo-
deum). e term ‘metasoma’ is used for the apparent abdomen, with MS1, MS2, etc.
referring to metasomal segments 1, 2, etc., T1, T2, etc. referring to the corresponding
tergites; L1 and L2, etc. referring to the laterotergites and S1, S2, etc. referring to the
sternites. e term T2+ refers to tergite 2 and all tergites posterior to T2. Terms of
relative position of the body follow Goulet and Huber (1993). Wing venation terms
follow the Comstock-Needham system as updated by Ross (1936) and incorporate
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)9
the recommendations of Goulet and Huber (1993) except for naming of the vein that
forms the distal edge of fore wing cell 1+2Rs (the ‘areolet’ of Townes 1969). is vein
is of uncertain origin and is here referred to as ‘vein 3rs-m’ (Fig. 4A) in conformity
with Wahl and Gauld (1998) (= 3r-m vein of Sharkey and Wahl 1992). e following
terms for specialized structures are dened: epomia (Fig. 2b): a raised ridge (carina)
on the pronotum (Figs 30–31); glymma (Fig. 5, structure #11): the lateral depression
Figure 1. Head of an ichneumonid. A anterior view B posterior view (modied from Townes 1969).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
10
Figure 2. Mesosoma of an ichneumonid, lateral view (modied from Townes 1969).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)11
sub-basally on T1; notaulus (Fig. 3A): a longitudinal groove sublaterally on the mes-
oscutum; sternaulus (Fig. 2F): a longitudinal groove subventrally on the mesopleuron
(not to be confused with the mesopleural groove which is more dorsal (see Fig. 30).
e carinae on the propodeum (see Figs 3, 4) can present diculties for scoring
of their presence and absence, depending on interpretation of their homology. For
example, if only one transverse carina is present near the longitudinal middle of the
propodeum, there is ambiguity with respect to whether this should be considered the
anterior or posterior transverse carina. To help make scoring of the propodeal carinae
more objective, the following conventions were used:
1) In cases in which there is ambiguity between the anterior and posterior transverse
carinae, the posterior transverse carina was given precedence.
2) In cases in which there is ambiguity between the medial and lateral longitudinal
carinae, the medial longitudinal carinae were given precedence.
3) In cases in which longitudinal and transverse carinae run obliquely together across the
propodeum, the transverse carina was given precedence over the longitudinal carinae.
4) In cases in which an abscissa of a carina is incomplete (e.g., the costula of many
specimens of Campopleginae), the abscissa was considered present if it extended
half the way across the area in which it is located or greater, or if this could not be
determined (e.g., no other carinae are present on the propodeum), one sixth of the
length (for longitudinal carinae) or width (for tranverse carinae) of the propodeum.
Digital photos at the CNC were taken using a Leica MZ16 stereomicroscope with
motorized focus drive attached to a Leica DFC420 digital camera. Photos were com-
bined and edited using Leica Application Suites Montage Multifocus software V3.8,
Auto-Montage Pro 5.01 and Adobe Photoshop CS4. Photos taken at EMUS were
taken with an EntoVision micro-imaging system. is system consists of a Leica M16
zoom lens attached to a JVC KY-75U 3-CCD digital video camera that feeds image
data to a desktop computer. e program Archimed 5.3.1 was used to merge an image
series (representing typically 15–30 focal planes) into a single in-focus image. Lighting
was provided by an EntoVision dome light.
Molecular protocols
Most sequences in this study were obtained by sequencing specimens at the Canadian
National Collection of Insects, Arachnids and Nematodes (CNCI), except as noted in
Appendix 2 (11 sequences downloaded from Genbank: the nine outgroup sequences
and 28s DS for Poecilocryptus nigromaculatus Cameron and Hellwigia obscura Graven-
horst). GenBank accession numbers are listed in Appendix 2. All sequences, including
those downloaded from GenBank, were compared to published sequences of putative-
ly related taxa to verify sequence veracity using the nucleotide BLAST tool (Altschul
etal. 1990) through GenBank (Benson et al. 2017).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
12
Figure 3. Mesosoma of an ichneumonid, dorsal view (modied from Townes 1969).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)13
Figure 4. Fore and hind wings of an ichneumonid (Ross system). A wing veins B wing cells (modied
from Townes 1969).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
14
Figure 5. First and second metasomal tergites of an ichneumonid, lateral view (modied from Townes 1969).
Molecular extracts were obtained using standard protocols outlined in DNeasy
Blood and Tissue extraction kit instructions (Qiagen, Gaithersburg, MD, USA). A
single mid leg was macerated except for small specimens in which a hind and mid
leg were used. PCRs were carried out using 50 μl reactions containing 4 μl DNA
extract, 1μl of each primer, 5 μl PCR buer, 1 μl DNTPs, 1 μl MgCl2, 0.25 μl Taq
and 36.75 μl RNase-free water. Primers were as follows: Cytochrome oxidase I (COI)
(F) (LCO1490): GGTCAACAAATCATAA AGATATTGG; (R) (HCO2198):
TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al. 1994); 28S (F) (3665):
AGAGAGAGT TCAAGAGTACGTG; (R) (4068): TTGGTCCGTGTT TCAA-
GACGGG (Belshaw et al. 1998); F2 copy of elongation factor 1-alpha (EF1a) (F):
AGATGGGYAAR GGTTCCTTCAA; (R): AACATGTTGTCDCCGTGCCATCC
(Belshaw and Quicke 1997). Verication that only the F2 copy was present was done
by comparing our sequences to published F1 and F2 sequences from Klopfstein and
Ronquist (2013). PCR protocols followed the studies listed above for each molecule.
e PCR products were puried using the QIAquick PCR Purication Kit Protocol
(Qiagen). Problems with PCR amplication of EF1a resulting from multiple gene
copies were resolved through gel-cutting. All centrifugation steps were performed for
60 s and samples were left to incubate for two minutes in Buer PE (to reduce salt
concentration), and ve minutes in Buer EB. Sequencing reactions were performed
in a total reaction volume of 10μl, with 1 μl ddH2O, 3μl of sequencing buer, 1μl
of primer with concentrations ranging from 51.8 to 69.9 nmol, 1 μl of BigDye Ter-
minator (PE Applied Biosystems, Foster City, CA, USA), and 4 μl of puried PCR
product. Sequencing was performed in both directions at the Agriculture & Agri-
Food Canada, Eastern Cereal and Oilseed Research Centre Core Sequencing Facility
(Ottawa, ON, Canada) on an Applied Biosystems Incorporated PRISM 3100-Avant
Genetic Analyzer.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)15
Sequence alignment
Preliminary alignment of coding genes (COI and EF1-a) was done using ClustalW
(ompson et al. 1994) followed by alignment with reference to amino acid coding
using MacClade 4.0 (Maddison and Maddison 2001) and Mesquite 2.75 (Maddison
and Maddison 2011). For COI, third codon positions were excluded from analysis be-
cause of saturation. Alignment of 28S used the secondary structure model for Ichneu-
monoidea (Gillespie et al. 2005). e following invariant or unalignable regions were
excluded from analyses: NHR(1), REC(1’), RAA(2), RAA(3), NHR(2), REC(2’),
RAA(7), REC(3’), RAA(8), REC(4), REC(5), REC(6), RAA(10), REC(5’), RAA(15).
e number of aligned bases were as follows: COI: 441; 28s D2: 448; EF1a: 417.
Aligned sequences are available in Suppl. materials 1–4 and by request from the
corresponding author.
Phylogenetic analyses
Parsimony analysis was performed using TNT v. 1.1 (Golobo et al. 2003). All charac-
ters were treated as unordered and equally weighted in order to avoid placing subjective,
pre-conceived notions on the direction and relative importance of particular transitions.
e optimal score was found 20 times using the default settings of “xmult” plus 10
cycles of tree-drifting. Optimal trees found were then imported into Winclada 1.00.08
(Nixon 2002) for tree-viewing and were then exported to NONA 2.0 (Golobo 1999)
for additional branch-swapping using the command “max” to nd the complete set
of equally parsimonious cladograms for the starting cladograms. NONA did nd ad-
ditional trees and this step is highly recommended when doing parsimony searches
with TNT. Strict consensus cladograms were produced using WinClada. e taxonomy
depicted in all cladograms (Figs 117–124) represents classication prior to this study.
Taxa for which formal nomenclatural changes are made are indicated with an asterisk
(see text of respective taxa for details). Cladograms showing optimization of individual
characters (Figs 122–124) were produced using MacClade 4.03 (Maddison and Mad-
dison 2001) and Mesquite 2.75 (Maddison and Maddison 2011). Nodal support on
parsimony cladograms is shown by optimization of morphological characters using
ACCTRAN which favours reversals over parallelisms as well as by decay index values
(Bremer 1994) calculated using TNT (shown as a boxed number under each node
or taxon) (see Fig. 117). Parsimony analyses were run for the total-evidence data set
(Fig.117), morphological characters only (Fig. 118) and sequence data only (Fig. 119).
Bayesian analyses were conducted using MrBayes 3.1.2 (Ronquist and Huelsen-
beck 2003). Model testing was done in JModelTest 0.1.1 (Posada 2008) with the best-
tting models for each partition as follows: COI (TIM+I+G); 28S (GTR+F); EF1a
(K80+I+T), morphology (discrete model with gamma). Bayesian analysis was run
with all parameters unlinked across partitions. In addition for 28S, secondary struc-
ture stems versus loops were analyzed using separate models. Eight independent runs
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
16
of 4 chains each were run for 10 million generations, with trees sampled every 1000
generations. Chains were run until the average standard deviation of split frequencies
went below 0.01. For each analysis, the trees in a burn-in period were excluded, and
the remaining post-burn-in trees were used to construct a maximum clade credibility
tree. Nodal support is indicated using Bayesian Posterior Probabilities (BPP) shown
to the right of each node. Bayesian analyses were run for the total-evidence data set
(Fig.120) and sequence data only (Fig. 121). Trees from Bayesian analyses were made
using FigTree 1.4.3 (Rambaut 2016).
Results and discussion
Morphological characters (see Table 2 for matrix)
In total, 141 morphological and biological characters were included in the analyses:
104 adult, 28 larval, 3 egg and 5 biological.
1. Clypeus: 0) comprised of one part (Fig. 1); 1) dierentiated into basal and api-
cal parts (Fig. 8).
2. Clypeus and supraclypeal area: 0) separated by groove or indentation (Fig. 1); 1)
without any impression separating them – more or less at or uniformly convex
(Fig. 9).
3. Clypeal margin in anterior view: 0) simple, truncate to slightly convex or slight-
ly concave (Fig. 12); 1) medially with apical denticle or denticles (not bilobed)
(Fig. 10); 2) apically bilobed (strongly concave medially) (median denticle may
be present or absent) (Fig. 11).
4. Clypeal margin vestiture: 0) with small scattered setae or lacking setae; 1) with
regularly spaced strong setae (Fig. 12).
5. Mandibles: 0) bidentate, gradually to strongly tapering (Fig. 1); 1) unidentate,
chisel shaped (Fig. 13); 2) unidentate, wide apically and twisted (Fig. 14); 3)
reduced to ap (Fig. 15); 4) tridentate (dorsal tooth divided in two) (Fig. 16).
6. Subocular sulcus: 0) absent to indistinct (Fig. 12); 1) present (Fig. 17).
7. Apical agellomere of female: 0) simple; 1) with projections arising at out-
growth from surface (see Wahl and Gauld 1998: Fig. 2); 2) attened apically
and without setae (Fig. 18)
8. Antennal color of female: 0) more or less unicolorous; 1) with distinct light
coloured median band.
9. Flagellum of male: 0) central agellomeres lacking tyloids; 1) central agellom-
eres with elliptical (Fig. 19) or raised, longitudinal ridge-like tyloids on ventral
surface (Fig. 20).
10. Inner margin of eye: 0) not or only weakly emarginate (Figs 10, 12); 1) strongly
emarginate near antennae.
11. Lateral ocellus: 0) small, separated from eye by 0.5× its diameter or greater; 1)
enlarged, touching, or almost touching eye.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)17
12. Gena: 0) simple; 1) denticulate (Fig. 21).
13. Occiput with medial notch near foramen magnum: 0) absent; 1) present (see
Wahl and Gauld 1998: Figs 8–9).
14. Occipital carina: (0) joining hypostomal carina at a distance from mandible
that is less than basal width of mandible (Fig. 1); 1) joins hypostomal carina at
a distance from mandible greater than basal width of mandible; 2) runs directly
to mandibular base.
15. Foramen magnum: 0) simple (Fig. 1); 1) laterally expanded (see Wahl and
Gauld 1998: Fig. 11).
16. Maxillary palpus: 0) 5-segmented; 1) 4-segmented; 2) 3-segmented.
17. Maxillary palpus: 0) normal; 1) elongate, reaching to or beyond middle coxa.
18. Labial palpus: 0) 4-segmented; 1) 3-segmented.
19. Propleuron: 0) without lateroventral posteriorly-projecting lobe (Fig. 2); 1) with
lateroventral posteriorly-projecting lobe (Fig. 22).
20. Epomia: 0) present as ridge ventro-anteriorly that crosses furrow dorsally
(Fig.2); 1) reduced to short central ridge across furrow (Fig. 23); 2) absent.
21. Mesoscutum: 0) smooth (Fig. 2); 1) with transverse rugae (Fig. 24).
22. Notaulus: 0) shallow or vestigial; 1) deeply impressed anteriorly (Fig. 2A);
2)absent.
23. Notaulus: 0) extending to 0.5× length of mesoscutum or less; 1) extending pos-
teriorly past centre of mesoscutum but not joining other notaulus; 2) extending
posteriorly past centre and joining either other notaulus or rugose medial area
(Fig. 25); 3) absent.
24. Notaular crest or carina anterolateral to notaulus: 0) absent; 1) present (arrow in
Fig. 26).
25. Epicnemial carina: 0) not curving anteriorly, vertical to around middle of pro-
notum; 1) curving to anterior of mesopleuron, around middle of pronotum (ar-
row in Fig. 27); 2) extending all the way to subtegular ridge (Fig. 2C); 3) present
ventrally only (not extending dorsally to ventral edge of pronotum); 4) absent.
26. Sternaulus length: 0) present, less than 0.7× length of mesopleuron; 1) pre-
sent, greater than or equal to 0.7× length of mesopleuron (Figs 2F, 28); 2)
entirely absent.
27. Sternaulus curvature: 0) short, not reaching posterior end of mesopleuron (pos-
terior curvature not scoreable); 1) posterior end ending dorsal to posterolateral
corner of mesopleuron (Fig. 2F); 2) posterior end ending anterior to posterolat-
eral corner of mesopleuron (arrow in Fig. 28).
28. Foveate groove of mesopleuron: 0) absent; 1) present (arrow in Fig. 29).
29. Mesopleural groove: 0) absent to incomplete; 1) complete to posterior margin
of mesopleuron (“mg” in Fig. 30).
30. Posterior transverse carina of mesothoracic venter: 0) absent; 1) interrupted near
anterior of middle coxa (gap indicated by arrow in Fig. 31); 2) complete (arrow
in Fig. 32).
31. Metapostnotum: 0) posterolateral triangles present (Figs 3, 33); 1) posterolat-
eral triangles absent.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
18
32. Propodeum base: 0) without median tubercle; 1) with small, median tubercle
(arrow in Fig. 34).
33. Propodeal spiracles: 0) separated from pleural carina by about minimum diam-
eter of spiracle or more (Fig. 2); 1) separated from pleural carina by less than
minimum diameter.
34. Propodeal spiracles: 0) round to sub-circular (less than 1.5× as long as high)
(Figs 34, 35); 1) ovoid to elongate (1.5× as high as long or more) (Figs 2, 36).
35. Lateral prole of propodeum: 0) angulate with separate dorsal and posterior
faces (Fig. 2); 1) rounded to attened, without separate dorsal and posterior
faces (Fig. 35).
36. Anterior transverse carina of propodeum: 0) complete (medially and sublater-
ally) (Fig. 3); 1) medial abscissa present, sublateral abscissae (= costulae) ab-
sent (Fig. 36); 2) median abscissa absent, sublateral abscissae present (Fig. 37);
3) completely absent (Fig. 40). Note: condition of the lateral abscissa was not
coded because the presence of the spiracle makes scoring the condition in this
region problematical.
37. Anterior transverse carina of propodeum: 0) medially angled (Fig. 3); 1) form-
ing more or less smooth arc (Fig. 38). Note: if carina absent or incomplete so
that angulation/curvature could not be scored, character is coded as “?”
38. Posterior transverse carina of propodeum: 0) complete (medially and sublaterally)
(Figs 3, 36–38, 40); 1) medial abscissa present, sublateral abscissae absent; 2)
median abscissa absent, sublateral abscissae present (areolar area conuent with
petiolar area) (Fig. 39); 3) completely absent/ indistinguishable.
39. Posterior transverse carina of propodeum: 0) as strongly developed as other cari-
nae; 1) conspicuously stronger than other carinae (Fig. 33). Note, if carina ab-
sent, coded as “?”
40. Posterior transverse carina: 0) angled (Fig. 3); 1) more or less continuous arc
(Fig. 40). Note: if carina absent or angulation uncertain, coded as “?”
41. Anterior abscissa of medial longitudinal carina: 0) present, not fused (Fig. 3); 1)
present, fused for entire length (arrow in Fig. 41); 2) absent (Fig. 40).
42. Median abscissa of medial longitudinal carina: 0) present, not fused (Fig. 3); 1)
present, fused for entire length; 2) absent (Fig. 40).
43. Posterior abscissa of medial longitudinal carina: 0) present, not fused (Fig. 3); 1)
present, fused for entire length; 2) absent (Fig. 40).
44. Anterior abscissa of lateral longitudinal carina: 0) present (Fig. 3); 1) absent
(Fig. 38).
45. Median abscissa of lateral longitudinal carina: 0) present (Fig. 3); 1) absent
(Fig.40).
46. Posterior abscissa of lateral longitudinal carina: 0) present (Fig. 3); 1) absent
(Fig. 37).
47. Propodeal surface reticulation: 0) smooth, without reticulation (Fig. 3); 1)
mostly covered by reticulation that obscures carinae (Fig. 42).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)19
48. Submetapleural carina: 0) complete, anterior section unmodied to slightly
broadened (arrow in Fig. 43); 1) complete, anterior section abruptly broadened
into a lobe (arrow in Fig. 44); 2) anteriorly present, not lobe-like (arrow in Fig.
45), posteriorly absent; 3) completely absent.
49. Height of ventral edge of metasomal foramen (“mf” in Figs 46, 47): 0) ventral
in relation to dorsal edge of hind coxal foramen (“cf” in Fig. 46): 1) dorsal in
relation to dorsal edge of hind coxal foramen (“cf” in Fig. 47).
50. Metacoxal cavity posteromedially: 0) separated from metasomal insertion by
sclerotized bridge (Fig. 46); 1) conuent with metasomal insertion (arrow in
Fig. 48 points to unsclerotized region joining metasomal and coxal foramina).
51. Fore wing vein 2m-cu: 0) present (Fig. 4); 1) absent (Fig. 49).
52. Fore wing vein 2m-cu posteriorly: 0) vertical (joining vein Cu at right angle) to
slightly reclivous (Fig. 4); 1) inclivous (joining Cu at acute angle) (Fig. 50).
53. Fore wing vein 2m-cu: 0) with two discrete bullae separated by small length of
tubular vein (arrows in Fig. 50); 1) with single bulla (Figs 52–54).
54. Fore wing cell 1+2Rs (areolet): 0) obliquely rhombic to subtriangular (Fig. 51);
1) rhombic to subrhombic (Fig. 52); 2) with vein Rs absent so only cross vein is
distad 2m-cu (Fig. 53); 3) with 3rs-m absent so only cross vein is basad 2m-cu
(Fig. 50); 4) obliterated (vein Rs touching vein M so that veins Rs and 3rs-m can-
not be scored (Fig. 55); 5) symmetrically pentagonal (Fig. 4A) (vein 3rs-m may
be present or absent, but if absent, pentagonal nature of cell is evident) (e.g.,
Fig. 50); 6) large, roughly square, distal edge as high as proximal edge (Fig. 56);
7) irregularly pentagonal (Fig. 57).
55. Fore wing cell 1+2Rs (areolet) veins: 0) smilar thickness to other fore wing veins
(Fig. 4); 1) abscissae of vein Rs and vein M that comprise areolet thickened rela-
tive to other fore wing veins (Fig. 58).
56. Fore wing cell 1+2Rs (areolet): 0) sessile anteriorly (Figs 4A, 56–57); 1) petiolate
anteriorly (Figs 51–52).
57. Antero-medial fore wing exion line basally: 0) splitting anterior to M and an-
terior fold running anterior to M (forming bulla indicated by arrow) (Fig. 49);
1) anterior fold running posterior to M (creating bulla(e) in vein 2m-cu) (Figs
50–57). Note: In ichneumonids (state 1), the exion line never creates a bulla
in the basal cross-vein of the areolet (whether open, closed or as in Ophioninae);
whereas in braconids (state 0), this bulla is generally present (unlabelled arrow
in Fig. 49).
58. Fore wing cell 2R1 (radial cell) posterior angle: 0) greater than 100 degrees
(Fig.4); 1) 90 degrees or less (Fig. 58).
59. Fore wing cell 1M+1R1: 0) uniformly hirsute; 1) with small to large glabrous
area that may have free sclerites (Fig. 59).
60. Fore wing vein Rs+M (ramellus): 0) complete (extending across all of cell 1M +
1R1) (Fig. 49); 1) incomplete (present only as short vein or stub) (Fig. 53); 2)
completely absent (Fig. 4).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
20
61. Fore wing vein 1cu-a: 0) opposite, slightly proximal or slightly distad vein M
(Fig. 4); 1) distad vein M by 0.5× length of 1cu-a or greater (Fig. 58); 2) proxi-
mal to vein M by 0.3 length of 1cu-a or greater (Fig. 60).
62. Hind wing vein 1rs-m: 0) basal to separation of veins R1 and Rs (Fig. 49); 1)
opposite or apical to separation of veins R1 and Rs (Fig. 4).
63. Hind wing vein 2/Cu: 0) equidistant between A and M, closer to A or slightly
closer to M (Fig. 4); 1) much closer to M than A (Fig. 61) or appearing to origi-
nate from M; 2) absent (Fig. 49).
64. Hind wing vein M+Cu: 0) complete (Fig. 62); 1) basal 0.6 spectral (Fig. 58).
65. Hind wing vein M+Cu: 0) straight to weakly arched (Fig. 61); 1) strongly arched
(Fig. 62).
66. Hind wing basal hamuli: 0) distant from wing base on membrane or spectral
vein; 1) close to wing base on spur of tubular vein; 2) absent.
67. Hind wing distal hamuli: 0) 1–3; 1) 4 or greater.
68. Apex of fore tibia: 0) without tooth; 1) with distinct tooth on dorsal margin
(Fig. 63).
69. Fore tibia dorsal surface: 0) covered with uniform thickness of setae; 1) with
uniform setae and sparse, much stouter spines (Fig. 64).
70. Middle tibial spurs: 0) two; 1) one.
71. Apex of middle and hind tibiae: 0) with common area of insertion for spurs and
basitarsus; 1) with sclerotized bridge separating insertion areas (Fig. 65).
72. Female hind coxa: 0) simple, without furrow; 1) with inner surface near base
with vertical basal furrow (Fig. 66).
73. Hind tibia: 0) covered with uniform thickness of setae; 1) with uniform setae
and sparse, much stouter spines (Fig. 67).
74. Hind tibia: 0) with posterior face simple (not smooth and shining) and with
moderately sparse fringe of setae (Fig. 68); 1) with posterior face smooth and
shining and thick fringe of setae (Fig. 69).
75. Hind tibial spurs: 0) present; 1) absent.
76. T1 petiolar cross-section (measured at petiolar midpoint): 0) not petiolate or
if petiolate not wider than high (height/ width = 1–1.2×); 1) wider than high
(height/ width = 0.6–0.7×).
77. T1 spiracle location: 0) at or anterior to 0.6× length of segment; 1) posterior to
0.6× length of segment.
78. T1 glymma: 0) present and shallow (Fig. 70); 1) relatively deep, almost meeting
at midline (Fig. 71); 2) absent.
79. First metasomal segment shape: 0) non-petiolate: more or less evenly broadened
from near base to posterior end or, if more or less parallel-sided throughout,
then clearly depressed and less than 2.0× as long as posteriorly wide (Fig. 72); 1)
petiolate: anteriorly more or less parallel-sided and broadened posterior to spira-
cles or, if parallel-sided throughout, then more or less cylindrical and greater
than 2.0× as posteriorly wide. (Fig. 73).
80. S1 length: 0) 0.6× length of T1 or less; 1) longer than 0.6× length of T1.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)21
81. S1 fusion apically: 0) not fused to T1 (Fig. 74); 1) fused, but suture visible
(Fig.75); 2) fused, suture not visible.
82. yridium shape: 0) present, ovoid (Fig. 76); 1) present, linear (“th” in Fig. 77);
2) absent.
83. yridium location: 0) less than one length or diameter distant from anterior
edge of T1 (Fig. 77); 1) greater than or equal to one length, width or diameter
distant from anterior edge of T1 (Fig. 76).
84. Gastrocoelus: 0) absent; 1) present (“gs” in Fig. 77).
85. Pseudothyridium of T2: 0) present (“ps” in Fig. 78); 1) absent.
86. T2 sculpture: 0) smooth to granulate; 1) with clearly dened longitudinal rugu-
lae.
87. T2 and T3 fusion: 0) separate, with exion line allowing movement (Fig. 2); 1)
fused, without a exion line.
88. MS2 laterotergites: 0) creased and curved mesad under metasoma (“L2” in
Fig.79); 1) not separated by a crease (Fig. 80).
89. MS3 laterotergite: 0) separated by crease, often partially turned under (“L3” in
Fig. 79, arrow points to crease); 1) not separated by crease (Fig. 80).
90. MS4 laterotergite: 0) separated by crease (at least basally), often turned under;
1) not separated by crease (Fig. 80).
91. T2–T4 sculpture: 0) each tergite uniformly sculptured; 1) posterior 0.2 of each
tergite sculptured dierently than anterior 0.8 (arrows in Fig. 81).
92. Apical segment of female metasoma: 0) short; 1) elongate with horn or boss (“h”
in Fig. 82); 2) elongate without horn or boss (arrow in Fig. 83).
93. Posterior sternites of female: 0) without ovipositor guides; 1) with tuberculate
ovipositor guides (arrows in Fig. 84).
94. Female hypopygium in lateral prole: 0) inconspicuous and uniformly scle-
rotized; 1) moderate length, regularly triangular in prole, uniformly sclerotized
(Fig. 85); 2) moderate length, regularly triangular in prole, medially mem-
branous (Fig. 86, arrow points to medial, membranous region); 3) extending
far beyond apex of posterior tergites, strongly triangular in prole, uniformly
sclerotized (Fig. 87).
95. Hind margin of female hypopygium: 0) simple; 1) with median apical notch
(arrow in Fig. 88).
96. Ovipositor length: 0) longer than apical height of metasoma but shorter than
metasoma; 1) shorter than or equal to apical height of metasoma; 2) longer than
length of metasoma.
97. Ovipositor ventral valve: 0) with teeth apically (Fig. 89); 1) without teeth apically.
98. Ovipositor ventral valve: 0) not enclosing dorsal valve; 1) enclosing dorsal valve.
99. Ovipositor dorsal valve, apically: 0) simply tapered (Fig. 2); 1) with dorsal, sub-
apical notch (arrow in Fig. 90); 2) slender and needle-like (Fig. 85); 3) simple
with nodus (Fig. 91, arrow points to nodus); 4) weakly sclerotized.
100. T8 or T8+9 of male: 0) medially longitudinally divided (Fig. 92, arrow points
to line of longitudinal division); 1) not medially, longitudinally divided.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
22
101. Hypopygium of male: 0) short and apically truncate; 1) elongate and scoop-like
(Fig. 93).
102. Gonoforceps: 0) simple (“gon” in Fig. 92; 1) apically long and rod-like (Fig. 94).
103. Apical 0.5 of aedeagus: 0) subcylindrical and slightly to strongly clubbed (Fig.
95); 1) strongly attened (Fig. 96).
104. Ovaries: 0) bohrertypus of Pampel (1913) (i.e., relatively low number of ovari-
oles and short lateral oviducts); 1) Ophion-typus of Pampel (large number of
ovarioles and lateral oviducts 1–2 times as long as ovaries) (see Wahl 1991:
Fig.2).
105. Larval epistomal suture: 0) unsclerotized (Fig. 97); 1) partially sclerotized, me-
dially incomplete (Fig. 6r); 2) completely sclerotized forming epistomal band
(Figs 99, 101).
106. Larval hypostoma and pleurostoma: 0) not laterally expanded (Fig. 6a, b); 1)
laterally expanded (Fig. 99).
107. Larval pleurostoma location: 0) inferior mandibular process dorsad or opposite
to dorsal margin of labial sclerite (Fig. 6a, b); 1) shifted ventrally inferior to
mandibular process opposite labial palpus (Fig. 100).
108. Larval labral sclerite: 0) present (Figs 6f, 7f); 1) absent (Fig. 97).
109. Larval mandible shape: 0) triangular, auxiliary tooth present or absent (Figs 6m,
7m); 1) cone shaped and with small apical tooth (Fig. 111, mandible in upper
left); 2) bidentate, teeth subequal (Fig. 101); 3) reduced so that only apex of
blade is present (Fig. 100); 4) absent.
110. Larval mandible with accessory teeth: 0) absent (Fig. 97); 1) present (Fig. 6m).
111. Larval mandible sclerotization: 0) uniformly sclerotized (Fig. 6m); 1) blade
weakly sclerotized (base only or all except apex) (“m” in Fig. 100).
112. Larval mandibular blade denticles: 0) present on entire dorsal and ventral mar-
gins (Fig. 102); 1) present only on entire dorsal margin (Fig. 98); 2) absent on
both dorsal and ventral margins (Fig. 97); 3) restricted to apex of dorsal and
ventral margins; 4) mandible completely absent (Fig. 106).
113. Larval mandible, spines at base of blades: 0) juncture of base and blade without
long, horizontal spines (Figs 97, 98); 1) juncture of base and blade with long (>
2× blade length) horizontal spines (Fig. 6m).
114. Larval posterior struts of inferior mandibular processes: 0) short (as long as dor-
sal struts) and not connected by band (Fig. 6k); 1) long (> 2× length of anterior
struts) and connected by band (the latter indicated by an arrow in Fig. 103).
115. Larval hypostoma length: 0) long (>2 × as long as hypostomal spur) (Fig. 6b
relative to 6c); 1) reduced (1–1.5 × as long as hypostomal spur); 2) absent or
present only as a rudimentary stub (Fig. 103).
116. Larval hypostoma, lateral end: 0) simple/ undivided (Fig. 6b) divided as two
bands, or with one upcurved extension; 1) divided into two bands, ventral band
long, robust, downcurved (arrow in Fig. 104).
117. Larval hypostomal spur: 0) normal, about 2× as long as basal width or longer
(Fig. 6c); 1) reduced, about as long as basal width (Fig. 97); 2) absent or only a
rudimentary stub (Figs 99, 100).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)23
118. Larval hypostomal spur meeting stipital sclerite: 0) near middle to lateral end of
stipital sclerite (Fig. 6c, 6d); 1) near median end of stipital sclerite (Fig. 102);
2) fused and forming hypostomal-stipital plate (Fig. 105); 3) hypostomal-stip-
ital plate reduced to narrow strip (Fig. 106); 4) fused in L-shaped structure
(Fig.107); 5) absent (Fig. 112).
119. Larval stipital sclerite orientation: 0) oriented so that lateral end at about right
angle to labial sclerite (Figs 97, 98); 1) dorso-ventrally angled, lateral end near
or on hypostoma (Fig. 99); 2) absent.
120. Larval stipital sclerite lateral end: 0) unmodied (Fig. 6d); 1) with plate-like
expansion (Fig. 108).
121. Larval cardo: 0) unsclerotized (Fig. 6j); 1) present as lightly sclerotized oval (Fig. 104).
122. Larval maxillary apex: 0) unsclerotized (Fig. 6p); 1) sclerotized.
123. Larval maxillary and labial palpi sensilla: 0) maxillary bearing one to two, labial
bearing one to three (Fig. 6i, 6h); 1) each bearing three (Fig. 103); 2) each bear-
ing four to ve (Fig. 109).
124. Larval labial sclerite shape: 0) quadrate (Fig. 6e); 1) circular (Fig. 104) to elon-
gate-ovoid (Fig. 97); 2) absent (Fig. 109).
125. Larval labial sclerite dimensions: 0) about as long as wide, length of ventral
portion/ total length = 0.2–0.3 (Fig. 98); 1) 1.4–1.7× as long as wide, length of
ventral portion/ total length = 0.4–0.7× (Fig. 97).
126. Larval labial sclerite ventral margin: 0) relatively unmodied (may be lobes,
minor scalloping, etc.) (Fig. 6e); 1) produced as spine (Fig. 100).
127. Larval prelabial sclerite: 0) absent (Fig. 6); 1) present as transverse band (arrow
in Fig. 110); 2) present as triangular to Y-shaped structure (“ps” in Fig. 97).
128. Larval prelabium, number of sensilla: 0) 6 (Fig. 108); 1) 8 or more (Fig. 104).
129. Larval sclerotized plate ventral to labial sclerite: 0) absent (Fig. 6); 1) present
(“sp” in Fig. 98).
130. Larval clypeolabral plate location: 0) absent (Fig. 6); 1) present, not contacting
pleurostoma (“cl” in Fig. 100); 2) touching pleurostoma (Fig. 109).
131. Larval antenna: 0) present and with central papillus present (Figs 6n, 102); 1)
present and lacking central papillus (Figs 104, 108); 2) absent.
132. Larval spiracles: 0) present, closing apparatus separated from atrium by section
of trachea (Fig. 103b); 1) present, closing apparatus adjacent to atrium (Fig.
109); 2) present, closing apparatus absent; 3) completely absent.
133. Larval salivary orice: 0) transverse or ovoid (Figs 105, 107); 1) u-shaped
(Figs6g, 97).
134. Egg: 0) without stalk; 1) with chorionic stalk (Fig. 113); 2) egg with a wide,
pedunculate, ventral protrusion and an apical, sinuous stalk (Fig. 114); 3) stalk
formed from hardened secretion from female (Figs 115, 116).
135. Egg stalk anchor: 0) anchor absent or entire stalk absent; 1) with tryphonine-
like anchor (Fig. 113); 2) with eucerotine disk-like anchor (Fig. 116).
136. Exit of egg from body: 0) egg travels down lumen of ovipositor; 1) egg exits
from hole ventral to ovipositor, stalk goes down ovipositor; 2) entire egg exits
from hole ventral to ovipositor.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
24
137. Biological mode (timing of larval maturation): 0) idiobiont; 1) koinobiont.
138. Biological mode (location of development): 0) ectoparasitoid; 1) endoparasi-
toid; 2) inside hind gut with nal ectoparasitoid phase AND pupate inside host
cocoon.
139. Host/ source of larval nutrition: 0) phytophagous (at least facultatively after
consuming insect host); 1) Hymenoptera; 2) Lepidoptera; 3) Coleoptera; 4)
Diptera; 5) Araeneae; 6) Trichoptera; 7) Neuroptera; 8) egg predators.
140. Oviposition location: 0) through lignied plant tissue; 1) through non-ligni-
ed plant or gall tissue; 2) in leaf rolls, cases and other plant tissues held by silk;
3) in silken bags or sacs; 4) into or onto exposed larval/ pupal hosts; 5) into
ground nests; 6) into trichopteran tubes; 7) into exposed eggs; 8) on to leaf; 9)
into host in host.
141. Oviposition/emergence stages: 0) eggs (predators); 1) larval-larval (not last in-
star); 2) pupa-pupa; 3) egg-larval; 4) immature spider - adult spider; 5) larval-
larval (last instar); 6) larval-pupal; 7) egg-pupal; 8) leaf-pupa.
Phylogenetics
Parsimony analysis
Total-evidence
e total-evidence parsimony analysis found 1728 equally parsimonious trees of
length 9917 (C.I. = 0.15, R.I. = 0.44). In the strict consensus tree (Fig. 117), 14
nodes collapsed. Table 3 (column “Pars. (all)”) provides a summary of the taxa that
were recovered as unequivocally monophyletic. In summary, of the 29 groupings
included in Table 3, 15 were monophyletic and a further 8 groupings would be
monophyletic with inclusion or exclusion of one or more problematical/ equivocally
classied taxa as described in footnotes. Aplomerus (Xoridinae) was sister group to all
other Ichneumonidae, (Odontocolon + Xorides) was sister group to all except for Aplo-
merus, and Orthopelmatinae (Orthopelma mediator unberg) was sister group to all
taxa except the three Xoridinae. e remainder of the subfamilies were arranged in
three groupings. e sister group to the other two was the Ophioniformes of Quicke
et al. (2009) comprised of 17 subfamilies. e second group was equivalent to the
Pimpliformes of Quicke et al. (2009). e third group was the Ichneumoniformes
s.l., which was comprised of Ichneumoniformes s.s. of Wahl (1993a) i.e., Brachycyr-
tinae + Cryptinae (including Ateleutinae and Phygadeuontinae) + Ichneumoninae
(including Alomya), as well as Adelognathinae, Agriotypinae, Claseinae, Euceroti-
nae, Labeninae, Microleptinae and Pedunculinae. Placement and relationships of
subfamilies within these three groupings will be discussed in the section Support/
relationships of taxa (below). e average consistency indices for the dierent char-
acter types were as follows: adult (0.24), larval (0.41), egg (0.80), biological (0.22)
and molecular (0.04).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)25
Table 2. Data matrix for morphological character states of Ichneumonidae and outgroup taxa. Key to the letters in matrix below: a=0/1; b=0/2; c=0/3; d=1/2; e=1/3;
f=1/4; g=1/5; h=2/3; k=2/4; m=2/6; n=3/4; p=3/7; q=5/6; r=6/7; s=0/1/3; t=1/5/6; u=2/6/7; v=5/6/7; w=2/5/6/7; x=3/5/6/7.
Taxon 1 2 3 4 5 6 7
1234567890123456789012345678901234567890123456789012345678901234567890123456789
Doryctes erythromelas 000000000000020000020120000000001013?3??10000010011??60000001020011010000000000
Rhysipolis sp. 000001000000020000020120000000101013?00010000000011??60000001020010000000000000
Aleiodes terminalis 000000000100020000020020100000101013?3??11111110011??60000001020010000000000000
Spilopteron occiputale 00000101000010000001012000000100110001000020000000000h0?1002b100011100000000020
Coleocentrus rufus 001000000000100000010120300000001103?101002100000000000110020110011000000000000
Adelognathus sp. 000000001000020000020000100000000013?3??222110000000130?10020100101000000000020
Agriotypus armatus 0000000000000?0000010120000011000013?3??000000000000130?11010100011000000000021
Anomalon picticorne 0000000100000000011001201000020000100000222111100000120?10020120111001000000121
erion texanum 0000000000000?0000100000100001100113?3??222111110000130?10020100011100000000121
Lissonota scutellaris 000000000000000000020230020001101003?001222110010000100110020100001000000000000
Exetastes bioculatus 00000001000000000002023000000110?003?001222110010000100110020110001000000000020
Apophua simplicipes 000000000000020000000230020001000002?001002001010000030?10020100001000000000000
Sphelodon phoxopteridis 0000000100000000000000000000000000100011020010010000130?10020100001000000000000
Brachycyrtus wardae 000001000100000000100001000001000110020?100000000000030?10011100001000000000121
Bathyplectes infernalis 010000000000000000120230100002000000020?000001000000100110020100101100000000120
Campoletis sonorensis 0110000000000?0000110230100002001000020?000001000000110110020100101000000000100
Campoplex sp. 010000000000020000120020100002000010020?0000110000001c0110020100101000000000121
Casinaria grandis 01000000010002000010000010001210?11103??002111100000100110020100021000000000121
Dusona egregia 010000000100000000100230100002000110020?022111000000100110020100101000000000121
Hyposoter sp. 010000000000000000120230100002100000020?000001000000100110010100121000000000100
Olesicampe sp. 010000000000000000120230100002000000020?000001000000100110020100121000000000100
Rhimphoctona macrocephala 0110000000000000001200001200020000000200000101000000100110020100101100000000100
Clasis sp. nov. 0000010000000000000002300000000000120010222111000000050010020100101000000000121
Collyria catoptron 001000000000000000020120d20000100113?3??000000020000030?10020110001000000000020
Eiphosoma pyralidis 0000000000000200001001001000020001100000000000000000100110020100101000100000121
Xiphosomella setoni 0000000000000000001200001000020011100000000000000000100110020120101000100000120
Agonocryptus chichimecus 00000021000000000001011001200110?010120?222111000000150010022100101000000000021
Ateleute sp. nov. 000000010000020101010100410002100013?1??22011100000116001002012010a000000000020
Baryceros texanus 00000021100000000000000001200110011003??022111000000150010020100101000000000121
Diapetimorpha brunnea 000000011000000000000110012001100010020?222111000000150010022100121000000000121
Echthrus reluctator 001000201000000000000120012001000103?011002000000000150010012100021000000000020
Lymeon orbus 00000001100000000002011021200110001003??022111000000150010020100101000000001120
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
26
Taxon 1 2 3 4 5 6 7
1234567890123456789012345678901234567890123456789012345678901234567890123456789
Polytribax contiguus 00000000100000000000010001200100110a0011000000000000150010020100101000000000120
Rhytura pendens 00000001100000000000010021200100000h?b10000000000000150010020100101000000001120
Acrolyta sp. 0000000010000000000001002110010000000000020101000001050010020100101000000001120
Endasys patulus 0000000010000200000101002000010001000000000000000001050010020100101000000001120
Mastrus sp. 0010000010000000000001002110010000000000000000000000050010020100101000000001120
Ctenopelma sanguineum 00000000000002000000000002000000001s0000000001000000000110020100001100000000010
Xenoschesis limata 000000000000000000010000020000001013?3??222110000000000110020100101100000000020
Euryproctus sentinis 000000010000000000010000020000001013?000000001000000130?10020100101100001001020
Mesoleptidea decens 000000000000000000000000120000001013?3??000110000000030?10020100101100000000020
Barytarbes honestus 000000010000000000020000120000000013?3??222110000000100110021100101100000000000
Himerta luteofacia 000000010000000000010000100000000013?3??2bd111000000130?10011100001100000000000
Lathrolestes asperatus 0000000000000200000200000200010000100000000a01000000100110020100101100000000010
Perilissus concolor 000000000000000000010000100000000010000000b000000000100110020110101100000000010
Rhorus bartelti 0000000000000000000100001000000000120000000001000000100110020100121100000000000
Sympherta fucata 000000000000000000000000000000000013?000001000000000130?10020100101100000000020
Seleucus cuneiformis 0000000000000000000000001200010000100000000001000000100010020100101100000000021
Onarion sp. 0010000000000?000001023002000010?013?3??222111000000130?10020100101100000000000
Westwoodia sp. 000000000000000000010110020000000013?3??220111020000100110021100101100000000000
Ctenopelmatinae Genus NZ 000000000000000001020110000001000013?000220111000000130?11020100100000000100001
Cylloceria melancholica 000001000000100000000120100000000013?00?00d000000000030?10020100100000000000020
Diacritus incompletus 000000000000000000010121100001000003?000002000000000000110020100101000000000021
Diplazon laetatorius 000040000000000000010100100000100013?200000000000100130?10010100101000000000000
Woldstedtius avolineatus 000040000000000000020230120000100013?3??222111000100130?10010100001000000000000
Euceros sp. nov. 000000000000020000010110020000101003?010002110000000130?10010100001000000000000
Hybrizon rileyi 0000300000000?0201010230320000100113?3??22111003101??30?10021121?21000000000021
Alomya debellator 000000001000000000020000200000001003?001222aa0020100050010020100021010000000021
Centeterus euryptychiae 0000000110000000000000002000020100000000000000000000150010020100001000000000121
Phaeogenes hebrus 000000011000000000000230d000010100000000000000000000050010020100011000000000121
Stenodontus sp. nov. 000010001000020000000100d000010100130000000000000000050010020100121000000000121
Coelichneumon eximius 010000011000000000000100d0000100111b0000000000000001050010010100001000000000121
Protichneumon grandis 01000001100000000000010022000100111e0000000aa0000000050010010100001010001000121
Barichneumon neosorex 0100000110000000000001001000010101000000000000000000050010010100001000000000121
Cratichneumon w-album 0100000110000000000001001000010001000000000000000000050010020100001010000000121
Orgichneumon calcatorius 010000011000020000000100120001001100000000b000000000050010010100001000000000121
Patrocloides montanus 0100000110000000000000001200010001010000000000000000050010010100001000000000121
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)27
Taxon 1 2 3 4 5 6 7
1234567890123456789012345678901234567890123456789012345678901234567890123456789
Plagiotrypes concinnus 0100000110000200000101001000010001000000000001000001050010010100001000000000121
Dilopharius otomitus 0100000100000200000000001000010001000000000000000000050010020100001000000000121
Cyclolabus impressus 01000001100002000001010020000100000a0000000000000000050010010100001000000001121
Linycus exhortator 0100000110000000000101002000010000000000000000000000050010010100001000000001121
Grotea anguina 000000000100010000120230120000001113?000002000000000070010020100011000000000021
Labium sp. 01000000000002000010000110001000011b0001000000000000170010020100011010000000121
Apechoneura sp. 100000000000000000001230020001000113?000002000001000000110020100011100010000020
Labena grallator 1000002001000100000100011200101001100a00002000001000070110020100011100010000020
Poecilocryptus nigromaculatus 000000000000000000020111000010100100020?000100000001170010020120111000000000021
Lycorina glaucomata 00000100000000000000023010000010?013?c01222111010000130?10020120101000000000000
Astiphromma sp. nov. 01000000000000000000000000000000101h?00000000a000100110110021100101100000000010
Chineater masneri 01000000?0000000000200001000000000100200002000010001110110020100101100000000001
Cidaphus paniscoides 0100000001100000000000000000110011000000002000000100000110022100101100000000011
Lepidura collaris 010000000000000000000000000000000013?000220111000001110110020100101100000000111
Mesochorus sp. 0100010000000000000000000000000000100000000001000000110110020120101100000000011
Exochus semirufus 0100000000000?00000000002200010011000000002000000000130?10020100001000000000000
Metopius pollinctorius 010000000000010000000230d11001101113?200000000000000170010020110021101000000000
Scolomus sp. 010000000000010000020230020000001000010?020011000000100110020120101000000000010
Seticornuta terminalis 0100000000000?0000020230220001100103?001000100000000100110021100121000000000000
Microleptes sp. 000001000000000000020000d00001000003?000000001000000130?10020100101100000100020
Neorhacodes enslini 000000000000000101020230000000100003?00000200000000??4???0021100100000000000000
Chriodes sp. 0000000100000001011100001000021011100000002001010000130?10020100101000000000121
Nonnus sp. 000000010000020101020000000002101113?011222111000000170010021100001000000000121
Enicospilus avostigma 00000000011000000002000002000210011013??202111000000120?10120100011010000000121
Hellwigia obscura 10000000?10001010012023000000210?113?3??222111000000120?10022110011010001000121
Ophion sp. 000000000000000000020100120000100110120?201110000000120?10110100011000000000121
Skiapus sp. 0000210001000100001202301200021001101001222110000001120?10021110011010001000121
yreodon sp. 000000000000000000020100120001101113?3??222111100000120?10021110021000000000121
Megastylus sp. nov. 000001000000000000020000100000000013?000222110000001031?10020100101000000000020
Orthocentrus sp. 0100010000000?0000020001120000001003?010002000000001130?10020100101000000000000
Proclitus speciosus 000001000000000000020001000001000003?0100020000000000n0?10020100101000000000020
Orthopelma mediator 0000010000000000000100010201000000120000000001000001030?11020120101000000000020
Oxytorus albopleuralis 0000000100000000100000001000010011100000000001000000100110020100101000000000021
Pedunculus sp. nov. 0000000000000000000001010000010000010000000001000001050010020120101000000100021
Perithous divinator 000000000000100000010000020000000003?011222110000001000110010110111000000000000
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
28
Taxon 1 2 3 4 5 6 7
1234567890123456789012345678901234567890123456789012345678901234567890123456789
Acrotaphus wiltii 00000000001011000002011002000010?013?3??222110030001030?10010100001000000000000
Clistopyga recurva 000001000000100000010110020000101013?3??222110000000030?10010100111000000000000
Dolichomitus irritator 002000000000100000010101020000001113?3??bb2110020000000110020110011000000000000
Zaglyptus pictilis 000000000000100000010100020000101003?3??222110020000030?10020100101000000000000
Pimpla annulipes 000001100000000000000000020000101013?3??222110000000000110020110111000000000000
eronia bicincta 000000000000000000000101000000000113?000002110000000000110020110111000000000000
Neoxorides caryae 000010000001001000020120420000101013?00?222110000000030?10010110011010000000020
Poemenia albipes 000000000000101000010120420000100013?3??222110020000a00110010110111010000000020
Megarhyssa greenei 002000000000000000001100020000101113?3??222111000000000110011110011000000000020
Rhyssa crevieri 001000000000000000001100020000000113?3??222111030000000110010110011000000000020
Rhyssella nitida 002000000000000000001100020000000113?3??222110000000000110011110011000000000020
Brachyscleroma sp. 0010010000000000001100000001010000100000000001000000a00110020100101000000000101
Erythrodolius calamitosus 0010000100000000001201300000010001000000000001000000130?10020100001100000000010
Notostilbops sp. nov. 0000000000000000000001000000000000120000000000010000100010021100101000000000000
Stilbops vetulus 0000000000000000000000000000000000100000000000010000000a10021100101000000000000
Tatogaster nigra 001000000000000000000000000000000010020??00001000000100110022100101100000000021
Allophrys sp. 000100000000000101020001000100100013?000000111000100131?11021121120000000000121
Peucobius fulvus 0000000000000000000200000000001010100000000001000000130?1002a100101100000000010
Phrudus sp. 0000000000000000000200010200001000100000000001000000100011020121101000000000021
Stethantyx nearctica 000100000000000101020000220100001003?000000111000100130?1002112110a000000000101
Tersilochus sp. 000100000000000101020000120100001003?000000111000100131?1102112112a000000000101
Eclytus sp. 000100000000000000000110000001000013?000201000000100030?10020100101000000000000
Idiogramma longicauda 00010?000000020000020000000000000011?3??000000000001000010020100101100000000000
Zagryphus nasutus 0000000100000000000001200000010001100000000001010000030?10020100101000000000010
Netelia sp. 000100000110000000020110000000001113?3??222111000100000110021100011010001000010
Phytodietus vulgaris 0001000000000000000201000b000000?013?3??222111000000000110010100001010001000000
Cteniscus sp. 0001000000000000000001000000000000100000002000000101000110020100101001000010000
Cycasis rubiginosa 0001000000000000000000200000010000120000000001000100000110020100101001000010000
Polyblastus sp. 000100000000000000000100000000000002?000000001000101000110020100101000000000000
Aplomerus sp. 001001000000000000020120220000000011?000002000000000030?10022100011010000000020
Odontocolon albotibiale 000000000000000000020120000001000003?000000001000000030?10012100111010000000020
Xorides stigmapterus 1000110100000100000001202200000001000000001000000000030?10010100011010000000020
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)29
Table 2. Continued. Data matrix for morphological character states of Ichneumonidae and outgroup taxa. Key to the letters in matrix below: a=0/1; b=0/2; c=0/3;
d=1/2; e=1/3; f=1/4; g=1/5; h=2/3; k=2/4; m=2/6; n=3/4; p=3/7; q=5/6; r=6/7; s=0/1/3; t=1/5/6; u=2/6/7; v=5/6/7; w=2/5/6/7; x=3/5/6/7.
Taxon 1 1 1 1 1
8 9 0 1 2 3 4
01234567890123456789012345678901234567890123456789012345678901
Doryctes erythromelas 012?00110010201020001001?2001000100000000100000000000000000301
Rhysipolis sp. 002?00010000001001031001???????????????????????0??????00010215
Aleiodes terminalis 002?00010000000011001001?000100020000000000010000001?000011245
Spilopteron occiputale 010000000000003020001001000010002000002100000000?00??000???30?
Coleocentrus rufus 000000000000203020001001000000002000002100001000?0011000???30?
Adelognathus sp. 010100000010000011000000?00010001001000000000002000000002001k1
Agriotypus armatus 122?0001111000001000000100000000200001000000000000003000000662
Anomalon picticorne 122?01000110000001011000120010001000020100001000000111??011hk6
erion texanum 122?0100011000001101100012101000200002010000100000011120011246
Lissonota scutellaris 00000100001000110101000010001000201200000001100100011100011225
Exetastes bioculatus 000001000010001111010000120010002010000000111001100111000112k5
Apophua simplicipes 00000100000000112101000010001000201000000000100100011100011225
Sphelodon phoxopteridis 000001000000001121010000????????????????????????????????011225
Brachycyrtus wardae 120101000000000000001010?00000001001000000001000000?01????07? w
Bathyplectes infernalis 010001000010000011010000?000100020000100100010020001110001134q
Campoletis sonorensis 01000100001000000101000010001000200001001000100200011100011241
Campoplex sp. 1101010000100000010100001000100020000100100010020001110001122g
Casinaria grandis 11010100001000001101000010001000200001001000100200011100011241
Dusona egregia 1201010000100000110100001000100020000100100011020001110001124q
Hyposoter sp. 01000100001000001101000010001000200001001000100200011100011241
Olesicampe sp. 0100010000100000110100001000100020000100100010020001110001114q
Rhimphoctona macrocephala 010101000010000001010000?00010002000010010001002000111??01130 g
Clasis sp. nov. 110101000010000001030000????????????????????????????????????? ?
Collyria catoptron 002?01000010000001000000000010004000?2520?0???00?0021?0001111 3
Eiphosoma pyralidis 122?01001110000001011000?000100020000000010010000001110001122 5
Xiphosomella setoni 01010110011000000101?000?00010002000000001001002000111?????22?
Agonocryptus chichimecus 110001000000000000100000????????????????????????????????0??3a?
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
30
Taxon 1 1 1 1 1
8 9 0 1 2 3 4
01234567890123456789012345678901234567890123456789012345678901
Ateleute sp. nov. 010000000010000001000000??????????????????????????????????022 ?
Baryceros texanus 120101000000000000000000???????????????????????????????????24?
Diapetimorpha brunnea 110101000000000000030000?????????????????????????????????0?242
Echthrus reluctator 0101000000002000201000000000000000000000000000000000010000?30?
Lymeon orbus 010101000000000000030000?10000001000000000000000000001?????d??
Polytribax contiguus 010101000000000000030000000000000000000000000000000001000?02?m
Rhytura pendens 010101000000000000030000????????????????????????????????????? ?
Acrolyta sp. 010101000000000000030000?00000000?00?000000?0?00000001??000142
Endasys patulus 01010100000000000003000000000000000000000000000000000100000142
Mastrus sp. 01010000000000000003000000000000000000000000000000000100000df 2
Ctenopelma sanguineum 002?01000010000011010000100010003000000000001000000111000111hp
Xenoschesis limata 0110000000100000110100001100100020000000000110000001110001113t
Euryproctus sentinis 0110010000100000110100001100000020000000100110000001110001114?
Mesoleptidea decens 010001000010000011010000?11010002000000000011000000111???1114?
Barytarbes honestus 000001000010000011011000??????????????????????????????000??14?
Himerta luteofacia 000001000010000011010000?100100020000000000010000001110001114?
Lathrolestes asperatus 002?01000010000011010000?1000000200000001000100000011100011d1q
Perilissus concolor 002?010000100000110100001210000020000000100010000001110001114 ?
Rhorus bartelti 001001000010000011020000?1100000200000000000100100011100011146
Sympherta fucata 1110010000100000110200001010000020000000100010000001110001114?
Seleucus cuneiformis 012?01001110000011010000???????????????????????????????????12?
Onarion sp. 002?01000010000011010000??????????????????????????????????????
Westwoodia sp. 001001001110000011010000??????????????????????????????000?114 t
Ctenopelmatinae Genus NZ 000000000000001011020000??????????????????????????????00??12? u
Cylloceria melancholica 000000100010000021001000?00000002000002100001000000110????14??
Diacritus incompletus 110000100000000000001001??????????????????????????????????????
Diplazon laetatorius 00100100000000001101100110011301200202?2000000100012000001144 7
Woldstedtius avolineatus 000001100000000011011001?0011001200202?2000100100012???????44 ?
Euceros sp. nov. 00100100000000001104000001001000200000000001000100000132011188
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)31
Taxon 1 1 1 1 1
8 9 0 1 2 3 4
01234567890123456789012345678901234567890123456789012345678901
Hybrizon rileyi 110001000010000011021000??????????????????????????????????114q
Alomya debellator 012?01000000000011000000?2001000200002?200021000000?01??01124 5
Centeterus euryptychiae 112?00000000000001000000?20010002000?2?200022??0002?11????12? ?
Phaeogenes hebrus 111110000000000010030000020010002000?2?200022??0002111000?12ku
Stenodontus sp. nov. 111110000000000011000000???????????????????????????????????2? ?
Coelichneumon eximius 111110100000000010030100021010002000?2?200022??0101111000?124 u
Protichneumon grandis 111110100000000010000000021010002000?2?200022??0101111000?124 u
Barichneumon neosorex 111110000000000010000000?20010002000?2?200022??0001111000?124u
Cratichneumon w-album 111110000000000010030100020010002000?2?200022??0001?1100001242
Orgichneumon calcatorius 111110100000000010030100?20010002000?2?200022??0?01?11??01124r
Patrocloides montanus 111110000000000011000100?21010002000?2?200022??0?01?11??01124r
Plagiotrypes concinnus 111110000000000010000000????????????????????????????????????? ?
Dilopharius otomitus 11111000000000001103?000????????????????????????????????????? ?
Cyclolabus impressus 111110000000000011000000?10010002000?2?200022??0001?1100011?4 6
Linycus exhortator 111110000000000011000000?10010002000?2?200022??0001?11??0?124?
Grotea anguina 120001000000000000100000?0100000100000001010000000010000000110
Labium sp. 010000000000000010100000?00000002000004000120000000100????015?
Apechoneura sp. 020000000000200020101000????????????????????????????????0???0?
Labena grallator 011000000000000020101000?11000001000000010000000000000000??30 1
Poecilocryptus nigromaculatus 011000000000000020101000?20002000000000000001000000?10???0001?
Lycorina glaucomata 002?010000000020200310001000100010000000000000000001211101224 6
Astiphromma sp. nov. 010001000110001001020010?00010012000000010001000000?11??01119v
Chineater masneri 012?0100001000100102????????????????????????????????????????? ?
Cidaphus paniscoides 010101000000001001020010?00010002000000010001000000111??01119 v
Lepidura collaris 110101000110001011020010??????????????????????????????????????
Mesochorus sp. 01000100001000100102001010001001200202001000100000011100011195
Exochus semirufus 002?01000000000011020000?2101000200002?100001000000111000112k6
Metopius pollinctorius 002?0100000000001102100012101000200002?1000010000001110001124 6
Scolomus sp. 012?01000000001011021000??????????????????????????????????????
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
32
Taxon 1 1 1 1 1
8 9 0 1 2 3 4
01234567890123456789012345678901234567890123456789012345678901
Seticornuta terminalis 000001000000000000001000?21010002000020100001000000111??01122u
Microleptes sp. 110001000010001011001000?000100020000100000010000001?1????14??
Neorhacodes enslini 00000100000000000101?00??00010002000010000000002000001????11? ?
Chriodes sp. 11010100001000000101000???????????????????????????????????????
Nonnus sp. 110101000010000021010000????????????????????????????????????? ?
Enicospilus avostigma 1201010001100000110110001010100020001000010011021001110001124q
Hellwigia obscura 12000100011000001101110????????????????????????????????????2? ?
Ophion sp. 12000100011000001101100010101000200000000100110210011100011h4q
Skiapus sp. 122?010000100010110010001?????????????????????????????????????
yreodon sp. 120101001110000011011000000010002000000001001102100111000112n5
Megastylus sp. nov. 010001000010000011010001?00014??4?010032?0000000000110??0114fx
Orthocentrus sp. 000000000010000011011001?000110120020032?00?10?0?00?00????14??
Proclitus speciosus 010001000010000021011001???????????????????????????????????4? ?
Orthopelma mediator 112?01000000000001010000?00010102000?2?2?00?20000001?0??0?111?
Oxytorus albopleuralis 110001001110000011011000????????????????????????????????????? ?
Pedunculus sp. nov. 120001010110000011030000??????????????????????????????????????
Perithous divinator 00100000000000002000010101000010000000100001000000000000000112
Acrotaphus wiltii 001000000001000000000001?00000001000001000000000000000???10544
Clistopyga recurva 001000000000000001000001?00000000000001000000000000000???00830
Dolichomitus irritator 001000000001000020000001?100000000000010000000000000000000030 1
Zaglyptus pictilis 001000000001000000030001?00000001000001000000000000000??000830
Pimpla annulipes 0010000000010000000001010200100020020010000001000001100000124 2
eronia bicincta 0010000000000000000000010000001000000010000000000000100000124 2
Neoxorides caryae 010000000000200020101001?10000000000004000000000000000??000e01
Poemenia albipes 010000000000000020101001100000002001001000000000000010??0001a1
Megarhyssa greenei 01010000000011002000000100000010000000100002110000001000000101
Rhyssa crevieri 00000000000011002000000100000010000000100000100000001000000101
Rhyssella nitida 010001000000110020000001?000001000000010000011000000?00000010 1
Brachyscleroma sp. 012?01000110000021000000???????????????????????????????????32?
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)33
Taxon 1 1 1 1 1
8 9 0 1 2 3 4
01234567890123456789012345678901234567890123456789012345678901
Erythrodolius calamitosus 010001000110000020030000????????????????????????????????????? ?
Notostilbops sp. nov. 001001000010001021010000??????????????????????????????????????
Stilbops vetulus 000001000010001001000000?00010001000000000001002000101??011227
Tatogaster nigra 112?01001110000011011000??????????????????????????????????????
Allophrys divaricata 110101001110000001010000???????????????????????????????????31 ?
Peucobius fulvus 00000100011000002100?000??????????????????????????????????????
Phrudus sp. 112?01000110000001000000???0?10020?000000?00100000???1?????3? ?
Stethantyx nearctica 010101001110000021010000?00011002000000000000000000?11??01131 6
Tersilochus sp. 010001001110000021010000?0001100200000000000000000011100011h1 6
Eclytus sp. 000001000010001011001000?2000000100000000001000000000111110146
Idiogramma longicauda 000001001110001020030000?00000002000000000000000000?0111110116
Zagryphus nasutus 000001000010001001001000??????????????????????????????1?1???? ?
Netelia sp. 00000100001000100100100000000000100000000001000001001110110246
Phytodietus vulgaris 00100100001000102003000001000000100000000001000001000110110226
Cteniscus sp. 001001000000001011001000?2000000200000000000000000010111110146
Cycasis rubiginosa 001001000010001011001000??????????????????????????????111??14?
Polyblastus sp. 00000100000000100100000002000000200000000001000000010111110146
Aplomerus sp. 002?000000000000200010000?????????????????????????????????????
Odontocolon albotibiale 112?000000002000200010000100000011000000000011000000010000030 1
Xorides stigmapterus 012?0100000020002000100001000010110000000000000000000100000301
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
34
Figure 6. Cephalic sclerites of nal larval instar, Xorides sp. Scale bars: 1mm.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)35
Figure 7. Final larval instar, anterior of whole larva, Xorides sp. A anterolateral view B lateral view.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
36
Figures 8–13. Head. 8 Xorides stigmapterus, anterior view. Arrow indicates division of clypeus into basal
and apical parts 9 Hyposoter sp., anterolateral view 10–13 Anterior view 10 Echthrus reluctator 11 Doli-
chomitus irritator 12 Hercus fontinalis 13 Neoxorides caryae.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)37
Figures 14–20. 14–15 Head, anterior view 14 Skiapus sp 15 Hybrizon rileyi Arrow indicates reduced
mandible 16–17 Head, lateral view 16 Diplazon laetatorius 17 Orthocentrus sp. Arrow indicates subocular
groove 18–20 Antennae 18 Labena grallator, apical agellomere 19–20 Flagellum, lateral view, arrows
indicate longitudinal tyloids 19 Protichneumon grandis 20 Lymeon orbus (Say).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
38
Figures 21–26. 21 Podoschistus vittifrons (Cresson), head, lateral view 22 Venturia sokanakiakorum
(Viereck), head and mesosoma, lateral view, showing ventral lobe of propleuron 23 Labena grallator,
pronotum, lateral view. Arrow indicates epomia 24 Rhyssella perfulva Porter, head and mesosoma, lateral
view 25–26 Diacritus incompletus 25 Mesosoma, dorsal view 26 Mesosoma, lateral view. Arrow indicates
notaular crest.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)39
Figures 27–32. 27–30 Mesosoma, lateral view 27 Rhimphoctona macrocephala. ec = epicnemial carina
28 Diapetimorpha brunnea Townes. Arrow indicates sternaulus curving ventrally anterior to posterolateral
corner 29 Stethantyx nearctica. Arrow indicates foveate groove 30 Agriotypus armatus. mg = mesopleural
groove, st = sternaulus 31–32 Mesosternum, ventral view 31 erion longipes (Provancher). Arrow indi-
cates incomplete posterior transverse carina 32 Dusona egregia. Arrow indicates complete posterior trans-
verse carina.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
40
Figures 33–38. Propodeum. 33 Polytribax contiguous (Cresson), dorsolateral view. Arrow indicates
posterolateral triangle of metanotum 34 Centeterus euryptychiae, dorsal view. Arrow indicates median tu-
bercle at base of propodeum 35 Sphelodon phoxopteridis, lateral view 36–38 Dorsal view (re-drawn after
Townes 1969, 1970a, 1971) 36 Aplomerus tibialis (Provancher) 37 Ateleute tsiriria (Seyrig) 38Ophion
avidus Brullé.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)41
Figures 39–44. 39–42 Propodeum, dorsal view 39 Pyracmon hyalinus (re-drawn after Townes 1970b)
40 Lissonota lineolaris (Gmelin) (re-drawn after Townes 1970b) 41 Brachycyrtus wardae. Arrow indicates
fused anterior abscissa of medial longitudinal carina 42 erion longipes (Provancher) 43–44 Metapleu-
ron, lateral view 43 Pimpla aequalis Provancher. Arrow indicates submetapleural carina 44 Exetastes forni-
cator (Fabricius). Arrow indicates anterior lobe of submetapleural carina.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
42
Figures 45–49. 45 Dolichomitus irritator, mesopleuron and metapleuron, lateral view. Arrow indicates
submetapleural carina 46–48 Mesosoma and metasoma, ventroposterior view. Line above cf = dorsal edge
of coxal foramen, line below mf = ventral edge of metasomal foramen 46 Lissonota scutellaris 47Apecho-
neura sp. 48 Polyblastus pedalis (Cresson). Arrow in 48 indicates unsclerotized region joining metasomal
and coxal foramina 49 Wings, Helcon sp. (Braconidae) (modied from Goulet and Huber 1993). Unla-
beled arrow indicates antero-medial exion line.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)43
Figures 50–57. Fore wing (modied from Townes 1969, 1970a, 1970b, 1971) 50 Mastrus acitulatus.
Arrows indicate bullae in vein 2m-cu 51 Phytodietus gelitorius (unberg) 52 Mesochorus sp. 53 Ophion
avidus 54 Glypta erratica Cresson 55 Proclitus sp. 56 Ateleute tsiriria 57 Labena grallator.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
44
Figures 58–61. Wings. 58 Allophrys oculata (Ashmead), fore and hind wings 59 Enicospilus purgatus
(Say), fore wing showing sclerites in cell 1M + 1R1 60 Aplomerus tibialis, fore wing 61 Exetastes fornicator,
hind wing.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)45
Figures 62–67. 62 Ateleute tsiriria, hind wing. 63–64 Fore tibia, lateral view 63 Euryproctus sentinis Davis
(apex with distinct tooth) 64 Phytodietus vulgaris. Arrows indicate sparse, stout spines 65 Eiphosoma pyralid-
is, hind tibia, apical view. Arrow indicates sclerotized bridge between insertion points of spurs and basitarsus
66 Labena grallator, inner surface of hind coxa of female, lateral view. Arrow indicates furrow for bracing
ovipositor during oviposition 67 Phytodietus vulgaris, lateral view. Arrows indicate sparse, stout spines.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
46
Figures 68–73. 68–69 Hind tibial apex, apical view. sp = spur, tar = tarsus, tib apex = tibial apex 68Poly-
blastus pedalis (simple apex with sparse fringe of stout setae) 69 Pedunculus sp. (apex with apical face smooth
and enlarged with thick fringe of ne setae) 70–71 Tergite 1 of metasoma, lateral view 70Phytodietus
vulgaris Arrow points to glymma 71 Netelia sp. Arrow points to deep glymma (sides of glymma separated
medially by only a thin, translucent sclerite) 72–73 Tergite 1, dorsal view 72 Pimpla aequalis 73 Campoletis
sonorensis (Cameron).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)47
Figures 74–79. 74–75 Metasomal segment 1, ventral view. S1 = sternite 1, T1 = tergite 1 74 Rhyssa line-
olata (Kirby) 75 Megarhyssa macrura (Linnaeus). Arrow indicates S1 fused to T1 posteriorly 76–79Anterior
tergites of metasoma 76 Lateral view, Olesicampe sp. Arrow points to thyridium 77 Dorsal view, Patrocloides
montanus (Cresson). gs = gastrocoelus (delineated by dotted line), th = thyridium (linear, posterior part of gas-
trocoelus), ps = pseudothyridium, T2 = tergite 2 78–79 Lateral view 78 Patrocloides montanus. sp = spiracle.
T3 = tergite 3 79 Netelia sp. Arrow indicates crease separating tergite 3 and laterotergite 3. L2 = laterotergite
2, L3 = laterotergite 3.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
48
Figures 80–85. Metasoma. 80 Lateral view, Allophrys divaricata MS2, etc. = metasomal segment 2, etc.
81 Tergites 2 to 4, dorsal view, Pimpla aequalis. Arrows indicate dierent sculpture on posterior 0.2 of
tergites 82–83 Posterior segments of female, lateral view 82 Megarhyssa greenei. c = cercus , h = horn, o =
ovipositor 83 Odontocolon albotibiale. Arrow indicates lack of horn 84 Sternites of female, ventral view,
Rhyssa lineolata. Arrows indicate tuberculate ovipositor guides 85 Posterior segments of female, lateral
view, Astiphromma splenium.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)49
Figures 86–91. Posterior of female metasoma 86 Ventroposterior view, Lycorina albomarginata (Cres-
son). Arrow indicates medial, membranous area of hypopygium 87 Lateral view, Coleocentrus occiden-
talis Cresson 88 Ventral view, Lissonota scutellaris. Arrow indicates medial apical notch of hypopygium
89–91Ovipositor, lateral view: 89 Pimpla aquilonia Cresson 90 Exetastes sp. nov. Arrow indicates dorsal,
subapical notch 91 Phytodietus burgessi (Cresson). Arrow indicates dorsal, subapical nodus.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
50
Figures 92–96. Posterior of male metasoma. 92 Dorsal view, Phytodietus vulgaris. Arrow showing longi-
tudinal division of tergite 8. T7 = tergite 7,
T8 = tergite 8, gon = gonoforceps 93 Ventrolateral view, Pim-
pla sp. 94 Ventrolateral view, Mesochorus sp. 95–96 Gonoforceps and aedeagus, lateral view 95 yreodon
sp. 96 Rhyssa crevieri.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)51
Figures 97–98. Cephalic sclerites of nal larval instar 97 Dusona sp. (copied from Wahl 1990) ps =pre-labial
sclerite 98 Phytodietus polyzonias Förster (copied from Short 1978) ep = epistomal band, sp = sclerotized plate
ventral to labial sclerite.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
52
Figures 99–100. Cephalic sclerites of nal larval instar 99 Exochus albifrons Cresson (copied from Short
1978) 100 Diplazon laetatorius (copied from Wahl 1990) cl = clypeolabral plates, m = mandible.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)53
Figures 101–102. Cephalic sclerites of nal larval instar 101 Poecilocryptus nigromaculatus (copied from
Short 1978) 102 Dolichomitus irritator (copied from Short 1978).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
54
Figures 103–104. Cephalic sclerites of nal larval instar 103 Lissonota occidentalis (Cresson) (copied
from Wahl 1988). Arrow points to lateral edge of lightly sclerotized band connecting posterior struts of
inferior mandibular processes 104 Enicospilus biharensis Townes, Townes & Gupta (copied from Short
1978). Arrow points to ventral end of hypostoma.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)55
Figures 105–106. Cephalic sclerites of nal larval instar 105 Spilopteron sp. (modied from Wahl 1990)
106 Megastylus sp. (modied from Wahl 1990).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
56
Figures 107–108. Cephalic sclerites of nal larval instar 107 Neoxorides borealis (copied from Short
1978) 108 Rhimphoctona aldrichi (Davis) (copied from Short 1978).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)57
Figures 109–110. Cephalic sclerites of nal larval instar 109 Phaeogenes hebrus (copied from Short
1978) 110 Euceros serricornis (Haliday) (copied from Short 1978). Arrow points to prelabial sclerite.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
58
Figures 111–112. 111 Cephalic sclerites of nal larval instar, Phrudus sp. Figures in upper left corner
is whole mandible (upper) and close-up of apex of mandible (lower). Scale bar: 0.1 mm. Mandible and
spiracle not same scale as main gure (spiracle is 27 μm in length) 112 Final larval instar, anterior of whole
larva, Collyria catoptron, lateroventral view of head and thorax (stained with acid fuschin).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)59
Figures 113–116. 113 Mature egg of Ctenochira sanguinatoria (Ratzeburg) (re-drawn after Kasparyan
1973) 114 Ovarian egg of erion sp. egg (re-drawn after Iwata 1960) 115 Mature ovarian egg of Euceros
frigidus Cresson (copied from Tripp 1961) 116 Egg of Euceros frigidus following oviposition (copied from
Tripp 1961).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
60
Morphological and biological characters only
e parsimony analysis using only the 141 morphological and biological characters
produced 3872 equally parsimonious trees of 1527 steps (C.I. = 0.15, R.I. = 0.60). e
strict consensus had 75 nodes collapsed (Fig. 118). Despite the lack of resolution in
the “middle” of the tree, 14 of the 29 groupings considered in Table 3 were recovered
as monophyletic in this analysis. is number did not include any of the three major
subfamily groupings, which illustrates that our morphological data set was not good
at resolving old divergences, but was relatively successful at supporting the monophyly
of subfamilies. Agriotypinae (Agriotypus armatus Curtis) was always the sister group
of all other Ichneumonidae. is analysis provided support for six subfamilies that
were not monophyletic in the parsimony analysis with all characters (i.e., Acaenitinae,
Banchinae, Mesochorinae, Metopiinae, Orthocentrinae and Xoridinae), but overall, it
was much less well-resolved than the total-evidence parsimony analysis.
Molecular characters only
e parsimony analysis with molecular characters found 104 trees of 8126 steps (C.I.
= 0.16, R.I. of 0.42). Ten nodes collapsed in the strict consensus cladogram (Fig. 119).
Lycorininae (Lycorina glaucomata (Cushman)) was sister to all other Ichneumonidae,
followed by Neorhacodes enslini (Ruschka) (Neorhacodinae), Phytodietus vulgaris Cres-
son and then Netelia sp. (both Tryphoninae). Nine of the 29 groupings in Table 3 were
supported (including Pimpliformes) as well as 3 others that would be monophyletic if
equivocally classied taxa were included or excluded (Banchinae, Metopiinae, and the
Phrudus group of genera). Apart from the base of the tree, the overall topology more
closely resembled the total-evidence parsimony analysis (Fig. 117), rather than the
parsimony analysis with only morphological and biological characters (Fig. 118). is
implies that the molecular data contributed more signal to the “middle” nodes of the
tree than the morphological data.
Bayesian analysis
Total-evidence
e total-evidence Bayesian analysis majority credibility tree is shown in Figure 120.
e topology at the base of the tree diered from the total-evidence parsimony analysis
(Fig. 117). (Xoridinae was not sister to all other Ichneumonidae and Orthopelmatinae
was not sister to all species except the xoridines). Instead, the Bayesian tree was similar
to the parsimony analysis with only molecular characters (Fig. 119), in that its base
had a grade of taxa: Neorhacodes enslini + (Netelia sp. + Phytodietus vulgaris) + (Lyco-
rina glaucomata + Idiogramma longicauda (Cushman) + the remaining Tryphoninae).
Apart from the base of the tree, there were some similarities between the parsimony
and Bayesian total-evidence analyses. For the Bayesian analysis, 11 of the 29 groupings
in Table 3 were unequivocally supported (BPP = 100) as well as 5 others (Banchinae,
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)61
Table 3. Comparison of the monophyly of selected taxa with dierent phylogenetic analyses and data-
sets. See footnotes and introduction for composition of selected taxa. “Yes” indicates that all taxa were
supported in all equally parsimonious trees or had a support value of 100 in the Bayesian majority cred-
ibility tree. “No” indicates lack of monophyly in at least one most parsimonious tree or a support value of
less than 100 in the Bayesian analysis. Pars. = parsimony; all = all characters; morph. = morphological and
biological characters only; mol. = molecular characters only; Bayes = Bayesian analysis.
Taxon Pars. (all) Pars. (morph.) Pars. (mol.) Bayes (all) Bayes (mol.)
Pimpliformes Yes No Ye s Ye s Ye s
Ichneumoniformes No1No No No No
Ophioniformes Yes No No No No
Acaenitinae No Yes No No No
Anomaloninae Yes Ye s No No No
Banchinae No2Yes No2No2No2
Campopleginae Yes No Ye s Ye s Ye s
Cremastinae Yes Yes Yes Ye s Yes
Cryptinae Yes No No Ye s Ye s
Ctenopelmatinae No3No No No No
Diplazontinae Yes Yes Yes Ye s Yes
Ichneumoninae Yes Ye s Yes9Yes Yes9
Labeninae Yes No Ye s Ye s Ye s
Mesochorinae No4Yes No No4 No4
Metopiinae No5Yes No5No5 No5
Nesomesochorinae Yes No No No No
Ophioninae Yes Ye s No Ye s No
Orthocentrinae No Yes No No No
Phrudus group No6No No6No6No6
Phygadeuontinae Yes Ye s No No No
Pimplinae No No No No No
Poemeniinae Yes Yes Ye s Yes No
Rhyssinae Yes Ye s Yes Yes Yes
Sisyrostolinae No No No No No
Stilbopinae No No No No No
Tersilochinae s.l. No7No No No7 No
Tersilochinae s.s. Ye s Yes Yes Yes Yes
Tryphoninae No8No No No No
Xoridinae No Yes No Ye s No
1 Ichneumoniformes of Wahl (1993) ((Ichneumoninae including Alomya) + Cryptinae (including Phygadeuontinae) +
Brachycyrtinae)) shared a common ancestor, but ancestor shared with Clasis, Pedunculus, Labeninae, Agriotypus, Euce-
ros, Adelognathus, and Microleptes (this group called Ichneumoniformes s.l.).
2 All Banchinae shared a common ancestor, but ancestor shared with Notostilbops (Stilbopinae).
3 All Ctenopelmatinae shared a common ancestor, but ancestor shared with Hybrizon, Lycorina, Oxytorus, and Tatogaster
as well as Chineater (Mesochorinae) and Scolomus (Metopiinae).
4 All Mesochorinae shared a common ancestor except for Chineater (see 3, above).
5 All Metopiinae shared a common ancestor except for Scolomus (see 3, above).
6 Phrudus and Peucobius shared a common ancestor, but ancestor shared with Erythrodolius (Sisyrostolinae).
7 All Tersilochinae and Sisyrostolinae shared a common ancestor (albeit with very low support).
8 All Tryphoninae shared a common ancestor, but ancestor shared with Neorhacodes (Neorhacodinae).
9All Ichneumoninae shared a common ancestor, but Alomya was not sister group to this grouping.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
62
Figure 117. Part 1. Total-evidence parsimony analysis. Strict consensus cladogram (14 nodes collapse).
Number of most parsimonious cladograms = 1728, length = 9917, CI = 0.15, RI = 0.44. Morphological char-
acters optimized on tree using ACCTRAN. Open boxes are homoplasiously derived character states. Closed
boxes are uniquely derived character states. Small numbers above boxes are character numbers. Small numbers
below boxes are character states. Large numbers in squares above characters are total number of supporting
characters (morphological and molecular). Large numbers in squares below characters are Bremer support val-
ues. Taxon names reect classication prior to study (taxa with asterisks after name are formally re-classied in
current study). “A” continued on part 2 of Fig. 117; “B–D” continued on part 3; “E–G” continued on part 4.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)63
Figure 117. Part 2. Total-evidence parsimony analysis strict consensus cladogram continued from part 1
of Fig. 117. Pimpliformes group of subfamilies. See Fig. 117, part 1 gure heading for description of gure.
Mesochorinae, Metopiinae, the Phrudus group and Tersilochinae s.l.) that would be
monophyletic with the inclusion or exclusion of equivocally classied taxa. Pimpli-
formes was unequivocally supported, but not Ichneumoniformes (either strictly or
broadly dened) or Ophioniformes. Neither was there support for Pimpliformes +
Ichneumoniformes s.l. is was because Labeninae was recovered as sister group to
Pimpliformes + Ichneumoniformes s.l. e remainder of the subfamilies in Ichneu-
moniformes s.l., did group with Pimpliformes with a high support value (BPP = 98).
In general, the basal nodes of the tree were weakly supported (BPP < 90), suggesting
that more data are required for these regions of the tree.
Molecular characters only
Similar to the total-evidence Bayesian analysis and the parsimony analysis with only
molecular characters, the base of the tree for the Bayesian analysis with only molecular
characters (Fig. 121) consisted of a grade of Ophioniformes species (Neorhacodinae,
Lycorininae and Tryphoninae). e analysis found unequivocal support for 8 of the
29 groupings in Table 3, including Pimpliformes. Banchinae, Mesochorinae, Metopii-
nae and the Phrudus group would also be supported with inclusion or exclusion of
problematic taxa. Ichneumoniformes s.l. except for Labeninae was moderately well
supported (BPP = 95) and was unequivocally the sister group of Pimpliformes. Labe-
ninae was the sister of these two groupings with a much higher support value (BPP =
99) than the total-evidence Bayesian analysis (BPP = 66) (Fig. 120), suggesting that
the morphological and molecular data were conicting with respect to the placement
of Labeninae.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
64
Figure 117. Part 3. Total-evidence parsimony analysis strict consensus cladogram continued from part 1
of Fig. 117. Ichneumoniformes s.l. group of subfamilies. See Fig. 117, part 1 gure heading for descrip-
tion of gure and Table 3 (footnote 1) for denition of Ichneumoniformes s.l.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)65
Figure 117. Part 4. Total-evidence parsimony analysis strict consensus cladogram continued from part
1 of Fig. 117. Ophioniformes group of subfamilies (base of clade). See Fig. 117, part 1 gure heading for
description of gure. “F” continued on part 5 of Fig. 117; “G” continued on part 6 of Fig. 117.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
66
Figure 117. Part 5. Total-evidence parsimony analysis strict consensus cladogram continued from part 4 of
Fig. 117. Ctenopelmatinae and related subfamilies. See Fig. 117, part 1 gure heading for description of gure.
Support/relationships of taxa
Ichneumonidae
It was not the purpose of this study to examine relationships outside of Ichneumo-
nidae, therefore only minimal outgroup sampling was used; however, all analyses did
recover a monophyletic Ichneumonidae (Figs 117–121). In the total-evidence parsi-
mony analysis, Ichneumonidae was supported by a Bremer support of greater than
10 steps and 56 synapomorphies, 9 of which were morphological, including two that
were uniquely derived: character 57, state 1: fore wing with antero-medial exion line
basally with the anterior fold running posterior to vein M (basal vein of areolet without
a bulla); and character 62, state 1: hind wing vein 1r-m opposite or apical to separation
of veins R1 and Rs (Fig. 4 compared to Fig. 49 for both of these characters).
Sister group to all other Ichneumonidae
e following taxa were sister group to all other Ichneumonidae depending on the analysis:
Aplomerus sp. (Xoridinae): total-evidence parsimony analysis (Fig. 117);
Agriotypus armatus (Agriotypinae): morphology-only parsimony analysis (Fig. 118);
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)67
Figure 117. Part 6. Total-evidence parsimony analysis strict consensus cladogram continued from part 4
of Fig. 117. Metopiinae to Campopleginae. See Fig. 117, part 1 gure heading for description of gure.
Lycorina glaucomata (Lycorininae): molecular-only parsimony analysis (Fig. 119);
Neorhacodes enslini (Neorhacodinae): Bayesian analyses (Figs 120–121).
Our total-evidence parsimony analysis found the three Xoridinae species at
the base of Ichneumonidae; however, they were not monophyletic with Aplomerus
Provancher sister group to all other ichneumonids and (Odontocolon Cushman + Xo-
rides Latreille) sister to all the rest (Fig. 117). In contrast, Xoridinae was monophyl-
etic in the morphology-only parsimony analysis (Fig. 118) and both Bayesian analyses
(Figs 120–121), albeit not as sister to the rest of Ichneumonidae. e biology of Xo-
ridinae (ectoparasitoids of wood-boring beetles) is consistent with the hypotheses of
Handlirsch (1907) and Gauld (1988a) with respect to the evolution of parasitoidism
beginning with idiobiont ectoparasitoids in concealed substrates.
In our morphological parsimony analysis, the clade comprising all ichneumonids
except Agriotypus armatus was supported by 11 synapomorphies, of which one was
uniquely derived: character 87(0) (T2 and T3 separate, with exion line allowing move-
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
68
ment) (Fig. 78). e Bremer support value was only 1. In all of our other analyses,
Agriotypinae was placed within Ichneumonidae, with the fusion of T2 and T3 evolving
in parallel in Braconidae and Agriotypinae. Agriotypinae are idiobiont ectoparasitoids
of pupal and pre-pupal Trichoptera in fast-running streams (Bennett 2001).
e evidence that Lycorininae is sister group to all other ichneumonids is based on
36 uniquely derived molecular substitutions that support the clade comprising all ich-
neumonids except Lycorina glaucomata in the molecular parsimony analysis (Fig.119).
Among our ve analyses, the placement of Lycorininae was one of the least stable
of any taxon. e total-evidence parsimony analysis placed L. glaucomata within the
Ctenopelmatinae and relatives clade as sister to Hybrizontinae (see section on Hybri-
zontinae for details on support). In the two Bayesian analyses, it was placed within a
grade near the bottom of the cladogram along with Neorhacodes enslini (Neorhacodi-
nae) and various species of Tryphoninae (Figs 120–121).
e biology of Lycorina is not completely known, but species for which oviposition
and development have been observed are koinobionts (Coronado-Rivera et al. 2004) that
oviposit in the anus of Lepidoptera larvae and complete development feeding externally
on the host and pupating inside the host cocoon (Shaw 2004) (our character 138, state 2).
Neorhacodinae was sister group to all other Ichneumonidae in both Bayesian analy-
ses on the basis of posterior probabilities of 100 supporting the grouping comprised of
all ichneumonids except Neorhacodes enslini (Figs 120–121). e parsimony analysis
with only molecular characters placed N. enslini close to its placement in the Bayesian
analyses, as the sister taxon to all Ichneumonidae except Lycorina glaucomata (Lycorini-
nae) (part 1 of Fig. 119). Conversely, the total-evidence parsimony analysis placed N.
enslini within Tryphoninae (as sister to Phytodietini) (part 4 of Fig. 117). e biology of
Neorhacodinae is not completely known. Neorhacodes spp. have been reared from nests
of aculeate Hymenoptera (Horstmann 1968; Danks 1971) and are probably endopara-
sitoids (Wahl 1993c), but it is not clear whether they are idiobionts or koinobionts.
In terms of previous studies, Quicke et al. (1999) using 28S D2–D3 sequence
data analyzed with parsimony for a limited taxon sampling of Ichneumonoidea found
that Xoridinae was sister group to all other Ichneumonidae. Similarly, the analyses of
Klopfstein et al. (2019) using transcriptomes from 6 braconids and 19 ichneumonids
found that Xorides praecatorius (Fabricius) was sister to all other ichneumonids and
this same placement was also found in all of their anchored enrichment analyses of 84
taxa, including 10 non-ichneumonid ougroups. Quicke (2015) summarized his “best-
guess” by placing both Xoridinae and Labeninae unresolved as sister taxa to all other
Ichneumonidae, and this arrangement was also presented by Broad et al. (2018). Apart
from Xoridinae and Labeninae, Agriotypinae (Agriotypus Curtis) has previously been
accorded family group status within Ichneumonoidea (e.g., Ashmead 1900) which
could be consistent with a sister group relationship with all other Ichneumonidae,
although all recent studies have concluded that it belongs within Ichneumonidae and
most likely as part of Ichneumoniformes sensu lato (Quicke et al. 2009; Santos 2017).
Similarly, Hybrizontinae (Hybrizon Fallén and two fossil genera) has been given fam-
ily group status within Ichneumonoidea (e.g., Marsh 1989), but more recent studies
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)69
Figure 118. Part 1. Parsimony analysis (morphological and biological characters only: Chs 1-141). Strict
consensus cladogram (75 nodes collapse). Characters optimized on tree using ACCTRAN. Number of
most parsimonious cladograms = 3872, length = 1527, CI = 0.15, RI = 0.60. See Figure 117 gure head-
ing for description of character support. Taxon names reect classication prior to study (taxa with aster-
isks after name are formally re-classied in current study). “A” continued on part 2 of Fig. 118.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
70
Figure 118. Part 2. Parsimony analysis (morphological and biological characters only) strict consensus
cladogram continued from part 1 of Fig. 118. See Fig. 118, part 1 gure heading for description of gure.
“B” continued on part 3 of Fig. 118.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)71
Figure 118. Part 3. Parsimony analysis (morphological and biological characters only) strict consensus
cladogram continued from part 2 of Fig. 118. See Fig. 118, part 1 gure heading for description of gure.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
72
place it within Ichneumonidae and more specically, within Ophioniformes (Quicke
et al. 2009, Broad et al. 2018). ere was no evidence in the current study that Hy-
brizontinae was sister group to the rest of Ichneumonidae. Neorhacodinae (currently
comprised of Neorhacodes Hedicke, Romaniella Cushman and Eremura Kasparyan) has
been classied as a subfamily in both Ichneumonidae (e.g. Townes 1969) and Braconi-
dae (Fahringer 1936), but it has never been given family group status within Ichneu-
monoidea, nor has it ever been suggested that it is the sister group of all other Ichneu-
monidae. is is also the case for Lycorininae. Both of these taxa have most recently
been placed within Ichneumonidae and, more specically, within Ophioniformes
(Quicke et al. 2009; Broad et al. 2018). In summary, the only previously hypothesized
sister group to all other Ichneumonidae that was supported in the current study was
Xoridinae, and the only analysis that supported this (total-evidence parsimony), did
not recover the subfamily as monophyletic (Fig. 117). Future studies should include a
greater number of outgroups from Braconidae and outside Ichneumonoidea, in order
to examine this question.
Subfamily groupings
Ophioniformes
Ophioniformes (including Tryphoninae) was supported in the total-evidence parsi-
mony analysis by 20 total characters, of which 5 were morphological: 36(0) anterior
transverse carina of propodeum complete (Fig. 38); 54(0) areolet obliquely rhombic
to subtriangular (Fig. 51); 78(0) glymma present and shallow (Fig. 5); 133(0) larval
salivary orice u-shaped (Fig. 7g); and 141(0) larval-pupal oviposition-emergence. e
Bremer support value of this node was 6 steps (part 1 of Fig. 117). None of the other
analyses supported Ophioniformes as monophyletic and in general, Ophioniformes
species formed a grade leading to the Ichneumoniformes and Pimpliformes taxa (e.g.,
Bayesian total-evidence tree: part 1 of Fig. 120).
In terms of the arrangement within Ophioniformes in the total-evidence parsimony
analysis, Tryphoninae (including Neorhacodes enslini) was sister to all other taxa (part 4
of Fig. 117), which was similar to the ndings of Quicke et al. (2009), albeit the latter
study had taxa of some other subfamilies clustering within Tryphoninae (i.e., Euceroti-
nae, Sisyrostolinae, Stilbopinae, but not Neorhacodinae). Our total-evidence parsimony
analysis next found a grouping of Sisyrostolinae and Tersilochinae as sister to all remain-
ing Ophioniformes, followed by a clade without resolution comprised of the following
three groups: 1) Mesochorinae (except Chineater masneri Wahl) (part 4 of Fig. 117); 2)
Ctenopelmatinae and related subfamilies (part 5 of Fig. 117); and 3) (Metopiinae + Stil-
bops + Banchinae including Notostilbops) + the higher Ophioniformes. Higher Ophioni-
formes was a clade of three groups with equivocal relationships among the equally par-
simonious trees: Nesomesochorinae/ (Anomaloninae + Ophioninae)/ (Cremastinae +
Campopleginae)) (part 6 of Fig. 117). In the total-evidence parsimony analysis, higher
Ophioniformes was moderately well supported by 31 synapomorphies, of which 10
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)73
were morphological (none uniquely derived) and a Bremer support of 5. e group was
also quite well-supported in the total-evidence Bayesian analysis (BPP = 98).
e topology within Ophioniformes in the current total-evidence parsimony anal-
ysis is similar to that of Quicke et al. (2009), with the following major exceptions: 1)
Orthopelmatinae and Microleptinae never belonged to Ophioniformes in our study
(equivocal placement in Quicke et al. 2009, but within Ophioniformes in both of
their presented cladograms); 2) Tersilochinae was associated with Sisyrostolinae as op-
posed to related to Ctenopelmatinae and Mesochorinae in Quicke et al. (2009); 3)
Mesochorinae and Metopiinae were not paraphyletic with respect to Ctenopelmati-
nae in our analysis; 4) Ctenopelmatinae could be monophyletic based on our results
with the inclusion of four small subfamilies (Hybrizontinae, Lycorininae, Oxytorinae
and Tatogastrinae) and inclusion of two enigmatic genera-C hineater Wahl (Mesochori-
nae) and Sc olomus Townes & Townes (Metopiinae); 5) Hybrizontinae clustered with
the Ctenopelmatinae exemplars in our study as opposed to related to Skiapus Morley
(Ophioninae) and Anomaloninae in Quicke et al. (2009).
e anchored enrichment study by Klopfstein et al. (2019) included 12 exemplars
of Ophioniformes with the following topology: Tryphoninae + (Banchinae + (Ter-
silochinae + (Mesochorinae + (Ctenopelmatinae + (Metopiinae + (Anomaloninae +
(Cremastinae + (Ophioninae + Campopleginae)))))))). e main similarities between
the current total-evidence parsimony analysis and the results of Quicke et al. (2009)
and Klopstein et al. (2019) are: 1) Tryphoninae is sister to the rest of Ophioniformes;
2) Anomaloninae, Cremastinae, Ophioninae and Campopleginae cluster together as
part of the higher Ophioniformes. e placement of the other subfamilies diered
somewhat between these three studies and will be discussed in the relevant subfamily
sections in Support/ relationships of subfamilies (below).
Pimpliformes
Pimpliformes was monophyletic in all analyses with the exception of parsimony us-
ing only morphological characters (Table 3). In the total-evidence parsimony analysis
it was supported by 29 characters, of which 11 were morphological, including the
uniquely derived character 118(2) (larval hypostomal spur fused to form a hypostom-
al-stipital plate) (part 1 of Fig. 117). e Bremer support value was 10 steps. Most
previous analyses have also supported Pimpliformes using either morphological data
(Wahl and Gauld 1998), sequence data (Belshaw et al. 1998; Klopfstein et al. 2019) or
combined morphology and sequence data (Quicke et al. 2009).
In the current study, the topology within Pimpliformes was equivocal, depending
on the method of analysis. e total-evidence parsimony and molecular parsimony
analyses recovered Diplazontinae as sister to all other taxa, followed by the orthocen-
trine genera (not clustering together) and the rest of the taxa (part 4 of Fig. 117, part
2 of Fig. 119). In contrast, the Bayesian total-evidence analysis placed the taxa in two
separate clades: 1) the “higher Pimpliformes” of Quicke et al. (2009) = Pimplinae,
Poemeniinae and Rhyssinae; and 2) all other exemplars (part 2 of Fig. 120). Higher
Pimpliformes was strongly supported in the parsimony total-evidence analysis with
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
74
Figure 119. Part 1. Parsimony analysis (molecular characters only). Strict consensus cladogram (10
nodes collapse). Number of most parsimonious cladograms = 104, length = 8126, CI = 0.16, RI = 0.42.
Numbers above branches are number of substitutions supporting each node or taxon. Taxon names reect
classication prior to study (taxa with asterisks after name are formally re-classied in current study). “A”
continued on part 2 of Fig. 119.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)75
Figure 119. Part 2. Parsimony analysis (molecular characters only). Strict consensus cladogram contin-
ued from part 1 of Fig. 119. See Fig. 119, part 1 gure heading for description of gure.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
76
Figure 120. Part 1. Total-evidence Bayesian analysis maximum clade credibility tree. Numbers to the
right of nodes are posterior probabilities. “EN” = change from ectoparasitoid to endoparasitoid (character
138); “EC” = change from endoparasitoid to ectoparasitoid; “E2” = change from ectoparasitoid to develop-
ment inside hind gut with nal ectoparasitoid phase; “I” = change from koinobiont to idiobiont (character
137); “K” = change from idiobiont to koinobiont. Taxon names reect classication prior to study (taxa
with asterisks after name are formally re-classied in current study). “B” is continued on part 2 of Fig. 120.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)77
Figure 120. Part 2. Total-evidence Bayesian analysis maximum clade credibility tree continued from part
1 of Fig. 120. Numbers to the right of nodes are posterior probabilities. See Fig. 120, part 1 gure heading
for description of gure.
29 synapomorphies, 17 of which were morphological and one of these was uniquely
derived: character 118, state 1: larval hypostomal spur meeting stipital sclerite near
median end of stipital sclerite (Fig. 102). e Bayesian analysis with only molecular
characters was mostly unresolved for Pimpliformes (part 2 of Fig. 121).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
78
In terms of previous hypotheses of internal Pimpliformes relationships, Wahl and
Gauld (1998), using morphology-based parsimony recovered (Acaenitinae + (Dia-
critinae + (Cylloceriinae + (Diplazontinae + Orthocentrinae)))) + (Pimplinae + (Rh-
yssinae + Poemeniinae)). Quicke et al. (2009) had Diacritinae as sister group to all
other taxa which were divided into two sister clades: 1) Acaenitinae + (Cylloceriinae +
(Orthocentrinae + (Diplazontinae + Collyriinae))); 2) (Pimplinae + (Rhyssinae + Po-
emeniinae)). Finally, Klopfstein et al. (2019) had equivocal results depending on their
analysis. eir transcriptome analysis recovered their diplazontine exemplar, Syrpho-
philus tricinctorus (unberg) as sister taxon to the other nine species of Pimpliformes.
Some of the topologies found in their anchored enrichment analyses were similar to
the transcriptome topology with Diplazontinae as sister to all other taxa, whereas oth-
ers more resembled the current total-evidence Bayesian analysis and Wahl and Gauld
(1998) with two main clades—the higher Pimpliformes and a clade including Acae-
nitinae and the y-parasitizing subfamilies. Regardless of the analysis, Klopfstein et al.
(2019) found very short branch lengths close to the base of Pimpliformes, which they
hypothesized suggests a rapid radiation. e ambiguous nature of the current results
and those of Klopfstein et al. (2019) indicate that resolving ancestral Pimpliformes
relationships may be one of the most challenging aspects of future phylogenetic studies
within Ichneumonidae.
Ichneumoniformes
Ichneumoniformes sensu stricto (of Wahl 1993a) was not recovered in any analyses
(Table 3), although in the total-evidence parsimony analysis (part 3 of Fig. 117), these
subfamilies (Brachcyrtinae, Ichneumoninae including Alomyinae, and Cryptinae in-
cluding Ateleutinae and Phygadeuontinae) were recovered as part of a larger group
that included seven other subfamilies (Adelognathinae, Agriotypinae, Claseinae, Euc-
erotinae, Labeninae, Microleptinae and Pedunculinae). is grouping is hereby called
Ichneumoniformes sensu lato. None of the other analyses recovered either Ichneu-
moniformes s.s. or Ichneumoniformes s.l. In the total-evidence parsimony analysis,
Ichneumoniformes s.l. was only supported by 15 synapomorphies, of which 4 were
morphological: 56(0) areolet sessile anteriorly (Figs 4, 56); 131(0), larval antenna pre-
sent and with central papillus (Fig. 7n); 137(0) idiobiont timing of maturation and
138(0) ectophagous location of development (part 1 of Fig. 117). e Bremer support
value was only 2 and none of the four morphological characters had a consistency
index above 0.16. With respect to specic topologies in our other analyses, in the
molecular-only parsimony analysis (part 3 of Fig. 117) and the total-evidence Bayesian
analysis (part 2 of Fig. 120), a subset of Ichneumoniformes s.l. was strongly supported
that included the following: Microleptinae, Adelognathinae, Ateleutinae, Cryptinae,
Phygadeuontinae, Alomyinae and Ichneumoninae) (BPP = 98 in the total-evidence
Bayesian analysis). We have chosen our denition of Ichneumoniformes s.l. (which
includes thirteen subfamilies) based on support for this grouping in the total-evidence
parsimony analysis. Future studies may lead us to propose a more restricted denition
of Ichneumoniformes s.l. (e.g., the subset listed above). More discussion on the rela-
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)79
tionships within Ichneumoniformes is made in the section Support/ relationships of
subfamilies (below), especially with respect to Claseinae.
Apart from the study of Quicke et al. (2009), Ichneumoniformes has also been stud-
ied previously in a strictly molecular phylogenetic study of Laurenne et al. (2006) and
more recently, by a combined morphological and seven gene study by Santos (2017).
e latter study focused on the relationships of Cryptini, but included outgroup taxa
from other tribes of Cryptinae as well as Pimpliformes, Ophioniformes, Xoridinae
and all subfamilies in our Ichneumoniformes s.l except Alomyinae and Pedunculinae.
e combined, maximum likelihood analysis of Santos (2017) found the following
topology: Labeninae + (Claseinae + (Eucerotinae + Brachycyrtinae) + (Agriotypinae +
((Cryptini + Aptesini) + (Phygadeuontini including Ichneumoninae, Hemigaster Brul-
lé, Microleptes Gravenhorst, Adelognathus Holmgren and Ateleute Förster)))))). Accord-
ingly, Santos (2017) raised Phygadeuontini and Ateleutina to subfamily status in order
to maintain Ichneumoninae as a subfamily, and restricted Cryptinae to only two tribes.
He moved Hemigaster to Phygadeuontinae, but did not sink Microleptes or Adelogna-
thus within Phygadeuontinae. Furthermore, he stated that more study was required to
determine the relationships of various phygadeuontine taxa relative to Ichneumoninae.
Overall, the relationships within Ichneumoniformes s.l. in our study are quite similar
to the results of Santos (2017), especially the nding that Ateleute does not cluster
within Cryptini, as was classied prior to Santos (2017), and that Ichneumoninae were
derived from within Cryptinae s.l., a notion rst postulated by Gokhman (1988).
Relationship of Ophioniformes, Pimpliformes and Ichneumoniformes
e total-evidence parsimony analysis was the only one that recovered Pimpliformes,
Ophioniformes and Ichneumoniformes s.l. as monophyletic (Table 3, Fig. 117) with
Ophioniformes as the sister group to Ichneumoniformes s.l. + Pimpliformes. Both
Bayesian analyses (Figs120, 121) had a grade of Ophioniformes leading to a grouping
as follows: Labeninae + (Ichneumoniformes s.l. (except Labeninae) + Pimpliformes).
erefore, apart from the lack of monophyly of Ophioniformes in the Bayesian analy-
ses, the relative relationships of the three major subfamily groupings was similar in
both our total-evidence analyses.
e study of Quicke et al. (2009) proposed the following topology: Xoridinae +
(Labeninae + (Pimpliformes + ((Claseinae + (Pedunculinae + Brachycyrtinae) + (Ich-
neumoniformes + Ophioniformes))))). erefore, Quicke et al. (2009) supported
Pimpliformes as sister group to the other two groupings whereas Santos (2017) and
Klopfstein et al. (2019) generally supported Ophioniformes as sister group to Pimpli-
formes + Ichneumoniformes albeit with a reduced number of outrgroups compared to
the current study. e other main dierence between the current study and Quicke et
al. (2009) was the latter's placement of Labeninae as sister group to all ichneumonids
except for Xoridinae. See section on Labeninae (below) for discussion of its equivocal
placement in the current study.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
80
Figure 121. Part 1. Bayesian analysis (molecular characters only) maximum clade credibility tree. Num-
bers to the right of nodes are posterior probabilities. Taxon names reect classication prior to study (taxa
with asterisks after name are formally re-classied in current study). “B” is continued on part 2 of Fig. 121.
Support/ relationships of subfamilies
Acaenitinae
In the total-evidence analyses (parsimony and Bayesian), the two exemplars of Acae-
nitinae (Spilopteron occiputale (Cresson) and Coleocentrus rufus Provancher) did not
cluster together. Coleocentrus rufus was sister to Collyria catoptron Wahl (Collyriinae),
whereas S. occiputale had various placements within Pimpliformes, such as sister to
Cylloceria melancholica (Gravenhorst) (Cylloceriinae) in the total-evidence parsimony
analysis (part 2 of Fig. 117), with two of the orthocentrines in the molecular parsi-
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)81
Figure 121. Part 2. Bayesian analysis (molecular characters only) maximum clade credibility tree contin-
ued from part 1 of Fig. 121. Numbers to the right of nodes are posterior probabilities. See Fig. 121, part
1 gure heading for description of gure.
mony analysis (part 2 of Fig. 119) and in a grouping with C. melancholica, Diacri-
tus incompletus Momoi (Diacritinae) and the pair of Coleocentrus rufus and Collyria
catoptron in the total-evidence Bayesian analysis (part 2 of Fig. 120). e only analysis
in which the two Acaenitinae exemplars were sister taxa was in the morphological
parsimony analysis (part 1 of Fig. 118). is grouping was supported by six morpho-
logical synapomorphies of which one was uniquely derived character 94(3) (female
hypopygium extending far beyond apex of posterior tergites, strongly triangular in
prole) (Fig. 87).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
82
Wahl and Gauld (1998) stated that “the unusual and highly autapomorphic female
hypopygium make the Acaenitinae one of the most distinctive of all ichneumonid
subfamilies.” eir analysis; however, did not test the monophyly of the subfamily as
it was scored as a single line of code in their phylogenetic matrix. Quicke et al. (2009)
analyzed the subfamilies as three groups: Procinetus Förster, Coleocentrus Gravenhorst
and “other Acaenitinae”. eir morphology-only analysis and total-evidence analysis
recovered Acaenitinae as paraphyletic as follows: Diacritinae + (Procinetus + (((Cole-
ocentrus + other Acaenitinae) + (Cylloceriinae + ((Diplazontinae + Collyriinae + Hyper-
acmus Holmgren) + Orthocentrinae))). ey noted an additional morphological syna-
pomorphy of the subfamily: three venom gland insertions (instead of one or two) (see
g. 9C, D in Quicke et al. 2009), although Procinetus was not coded for this character.
Finally, Klopfstein et al. (2019) included ve species of Acaenitinae in their anchored
enrichment analysis and found strong support for monophyly of their four Acaeni-
tini exemplars, but Coleocentrus excitator (Poda) clustered inconsistently with various
groups within Pimpliformes, but almost never shared a unique, common ancestor with
Acaenitini. So is Acaenitinae monophyletic?
e current analysis and Klopfstein et al. (2019) did not include Procinetus, there-
fore its placement within Acaenitinae cannot be commented on except subjectively to
say that the female does have an elongate, triangular hypopygium, although as Townes
1971 observed, this structure has a deep, medial notch resembling the form in at-
rophine Banchinae. With respect to the other genera of Acaenitinae, the results of
Quicke et al. (2009) generally supported their monophyly, whereas the current analysis
and Klopfstein et al. (2019) generally do not. It must be stated that Spilopteron spp. are
somewhat aberrant molecularly relative to other Acaenitinae (see Genbank sequences
from Quicke et al. (2009); Ito et al. (2015)). For example, the D2 region of 28S of S.
occiputale is only 74.5% similar to that of C. rufus (C. rufus is 96.6% similar to our
Perithous divinator (Rossi) sequence and of comparable similarity to other species of
Pimpliformes in our analysis). It is possible that use of a dierent Acaenitini exemplar
instead of S. occiputale may have resulted in support of Acaenitinae in the current
study, but the study of Klopfstein et al. (2019) included Spilopteron occiputale and
it always clustered with the other three Acaenitini species, therefore monophyly of
Acaenitinae appears to be more an issue of whether Coleocentrini and Acaenitini share
a common ancestor, rather than monophyly of Acaenitini. More information on the
hosts, biology and larvae of Acaenitinae may also help elucidate the monophyly of the
family. Known hosts are stem or wood-boring beetles (e.g. Finlayson 1970; Shaw and
Wahl 1989), but biology and larval morphology are unknown for most genera and
substantiation of existing host records is required.
Adelognathinae
e total-evidence parsimony analysis found Adelognathinae to be the sister group to
((Microleptinae + Ateleutinae) + ((Aptesini + Cryptini including Echthrus reluctator
(Linnaeus)) + (Phygadeuontinae + (Alomya debellator (Fabricius) + Ichneumoninae)))
(part 3 of Fig. 117). is grouping was supported by 3 morphological synapomorphies
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)83
(15 total) including the uniquely derived character 9(1) (agellum of male with ellip-
tical or raised, longitudinal, ridge-like tyloids on ventral surface) (Fig. 19). Note that
contrary to Townes (1969), some male Adelognathus species have tyloids, including
our exemplar specimen. e total-evidence Bayesian analysis was also similar, although
the relationships of Adelognathus sp., Microleptes sp. and Ateleute sp. nov. at the base of
this clade were not unequivocally resolved (part 2 of Fig. 120). e morphology-only
parsimony analysis provided no clear placement of Adelognathus sp. (it was unresolved
near the base of the tree) (Fig. 118).
Townes (1969) implied that Adelognathinae was related to Pimplinae, Tryphoni-
nae, Labeninae and Xoridinae. Presumably, this was because of the medial placement
of the spiracle of T1 and the lack of a dorsal, subapical notch on the ovipositor. Both of
these character states are plesiomorphic in Ichneumonidae, and therefore of no use in
ascertaining phylogeny. Quicke et al. (2009) most usually found the following: Agrio-
typinae + (Adelognathinae + Cryptinae) and included these three subfamilies in their
Ichneumoniformes grouping along with Alomyinae and Ichneumoninae. Most of our
analyses placed Adelognathinae within Ichneumoniformes s.l., although its exact place-
ment is equivocal at this point depending on the type of phylogenetic analysis and the
characters used. Some of the analyses of Santos (2017) recovered Adelognathus among
his Phygadeuontinae exemplars but none of our results supported this arrangement.
Agriotypinae
e total-evidence parsimony analysis found that Agriotypus armatus was sister spe-
cies to Euceros sp. nov. (Eucerotinae) and these two species were sister group of the
clade listed above under Adelognathinae , (i.e., Adelognathinae… to Ichneumoninae)
(part 3 of Fig. 117). Agriotypinae + Eucerotinae was supported by 29 characters states,
of which 8 were morphological, including one that was uniquely derived: oviposi-
tion into Trichoptera cases (character 140(6)) with a state change to oviposition on
leaves for Eucerotinae (character 140(8)). e Bremer support value was 4 steps. e
total-evidence Bayesian analysis was similar in that Agriotypinae and Eucerotinae were
placed unresolved as sister group to a clade including Microleptinae, Adelognathinae,
Cryptinae and Ichneumoninae, although this clade was very poorly supported (BPP
= 59) (part 2 of Fig. 120). In stark contrast to both of the total-evidence analyses,
the morphological parsimony analysis recovered Agriotypinae as the sister taxon to all
other Ichneumonidae (Fig. 118).
e monotypic Agriotypinae is morphologically aberrant in that it has strongly
sclerotized posterior metasomal tergites, which is an autapomorphy within Ichneu-
monoidea. ey are also biologically unusual in that they are aquatic idiobiont ec-
toparasitoids of prepupae and pupae of Trichoptera in fast-running streams (Bennett
2001). Earlier classications (e.g., Haliday 1838) placed Agriotypus Curtis within its
own monotypic family. is family status was maintained by some relatively recent
authors (e.g., Mason 1971; Chao 1992); however, Townes (1969) placed the genus
within Ichneumonidae, and Sharkey and Wahl (1992) concurred, stating that Agrio-
typus shared the two autapomorphies of Ichneumonidae: the apical displacement of
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
84
vein Rs of the fore wing to form the characteristic ichneumonid areolet and the short-
ening or loss of vein Rs+M in the fore wing (our character 60, states 1 and 2) (Fig.
4). Wahl and Gauld (1998) recovered Agriotypinae in a clade as follows: Labeninae
+ (Agriotypinae + (Brachycyrtinae + (Cryptinae + Ichneumoninae))). Note that this
study used a limited number of subfamilies as outgroups, their purpose being to es-
tablish character polarity within Pimpliformes. Bennett (2001) using a morphological
cladistic analysis with limited outgroups found Agriotypinae to be sister group to La-
beninae. Quicke et al. (2009) found various placements for Agriotypinae depending
on the analysis, but concluded that it was likely part of Ichneumoniformes, or perhaps
associated with Brachycyrtinae.
With respect to the putative relationship of Agriotypinae and Eucerotinae, of the
eight morphological synapomorphies, ve of them undergo transformations/ reversals
in one taxon or the other. For example, the uniquely derived character 140(6) (ovipo-
sition into Trichoptera cases) which supports both taxa, changes to character 140(8)
(oviposition on to leaves) in Eucerotinae. Given the extremely dierent morphology
and biology of these two subfamilies, it appears likely that these two highly derived
taxa have clustered together because of coincidental homoplasious traits and the lack
of any phylogenetic signal linking them to another group. Having said that, both the
parsimony and Bayesian total-evidence analyses placed Agriotypinae in relatively the
same part of the tree (i.e. somewhere within Ichneumoniformes s.l.), which is similar
to the conclusions of Quicke et al. (2009) and Santos (2017).
Alomyinae
In the total-evidence parsimony and Bayesian analyses (Figs 117, 120) and the mor-
phological parsimony analysis (Fig. 118), Alomya debellator was sister taxon to Ichneu-
moninae. Both molecular-only analyses placed A. debellator close to Ichneumoninae
(along with various cryptine exemplars), but not as its sister taxon (Figs 119, 121).
Since the beginning of the 20th century, Alomya has been recognized as closely
associated with Ichneumoninae. It has been treated variously as a separate subfamily
by Perkins (1959a, 1959b) and Constantineanu (1965), as an ichneumonine tribe
consisting solely of Alomya (Schmiedeknecht 1902, Morley 1915, Kasparyan 1981),
or as part of a tribe including Phaeogenes Wesmael and its relatives (Townes et al. 1961,
Yu and Horstmann 1997). ese decisions were based solely upon adult morphology
in a non-phylogenetic framework. Hinz and Short (1983) reared and described the
last instar larva commenting that “larval characters generally indicate an anity with
Ichneumoninae, particularly in the disc-shaped maxillary and labial palps each bear-
ing ve sensilla of about equal size” (our Character 123, state 2) (Figs 109, 125). ey
did; however, conclude that bearing in mind the unusual biology (mummication
of the host), it should be placed in its own tribe (Alomyini) within Ichneumoninae.
Wahl and Mason (1995), in communication with H.K. Townes, stated that Alomya
was related to Centeterus Wesmael and Colpognathus Wesmael, genera placed within
the ichneumonine tribe Phaeogenini which should therefore take the name Alomyi-
ni. More recently, Laurenne et al. (2006) performed a molecular parsimony analysis
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)85
including Cryptinae, Ichneumoninae, Alomya and a species of the putatively related
Pseudalomya Telenga and found that Alomya was never recovered within Ichneumoni-
nae, whereas Pseudalomya clustered with the Phaeogenini exemplars. ey therefore
formally re-established Alomyinae to encompass Alomya as well as the morphologically
similar Megalomya. ey did not include Pseudalomya within Alomyinae. e addition
of adult morphological characters to these sequences by Quicke et al. (2009) found
that Alomya was the sister group of Ichneumoninae (and therefore could be postulated
to be included within Ichneumoninae. In the same study, Pseudalomya still clustered
within Phaeogenini. What do our current results indicate about the placement and
status of Alomyinae?
Our study, with three genes and a large morphological data set, generally places
Alomya as the sister group of the Ichneumoninae (both total-evidence analyses and par-
simony with only morphological characters). Based on these results, it would be possi-
ble to expand Ichneumoninae to encompass Alomya (as a tribe), although maintenance
of Alomyinae is equally acceptable. We prefer to classify Alomya and the closely related
genus Megalomya Uchida as a tribe within Ichneumoninae, and therefore formally
synonymize Alomyinae with Ichneumoninae. Since both classications are equally ac-
ceptable, there is no need for a discussion of similarities and dierences between Ich-
neumoninae and Alomya as this would not justify the rank of Alomyini/ Alomyinae
one way or the other. A detailed re-description of the larva of Alomya is presented in
Appendix 1 (Fig. 125).
Anomaloninae
e two Anomaloninae exemplars (Anomalon picticorne (Viereck) and erion texanum
(Ashmead)) clustered together in the total-evidence and morphology-only parsimony
analyses (Figs 117, 118). irty-one total characters supported Anomaloninae in the
total-evidence parsimony analysis, including nine morphological, of which one was
uniquely derived: character 134(2) (egg with a wide, pedunculate, ventral protrusion
and an apical, sinuous stalk) (Fig. 114). e Bremer support was 4 steps. It should
be noted that not all anomalonines have this egg structure and the egg of A. picti-
corne was scored as unknown. In terms of diagnostic characters for Anomaloninae,
character 47(1) (propodeum with reticulate sculpture) (Fig. 42) was a synapomorphy
for the subfamily, but this character state also evolved independently in yreodon
sp. (Ophioninae) and Casinaria grandis Walley (Campopleginae), therefore it must be
used in concert with other characters to distinguish Anomaloninae.
Anomaloninae was the sister group of Ophioninae in the total-evidence parsimony
analysis, supported by 33 characters (13 morphological) including the uniquely de-
rived character 54(2): cell 1 +2Rs (areolet) of fore wing with vein Rs absent so that the
only cross-vein is distad vein 2m-cu (Fig. 53) (with a reversal in erion texanum). e
Bremer support was only 3. e Bayesian total-evidence analysis also recovered Anom-
aloninae, but only with a posterior probability of 84 (Fig. 120) and as sister group to
Nonnus sp. (Nesomesochorinae) (posterior probability of 82). Anomaloninae was not
supported in either of the molecular-only analyses (Figs 119, 121).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
86
Previous morphological analyses (e.g., Gauld 1976) supported the monophyly of
Anomaloninae. Quicke et al. (2009) coded morphology at the tribal level for Anom-
aloninae and found that Anomalonini was the sister group to Gravenhorstiiini in both
their morphological and total-evidence parsimony analyses. Whereas it is possible that
Anomalonini (i.e., Anomalon picticorne) and Gravenhorstiini (as represented by e-
rion texanum) are not sister taxa, the weight of evidence supports this relationship.
Lack of congruence between our molecular and total-evidence analyses may be because
of our choice of exemplars or genes which should be examined by addition of more
Gravenhorstiini species and additional gene regions in future studies.
Ateleutinae
Ateleute sp. nov. was placed wihin Ichneumoniformes s.l. in all of our analyses, except
parsimony with only morphological characters in which it was sister species to Nonnus
sp. in a portion of the tree that lacked resolution (part 1 of Fig. 118). Ateleute was sister
species to Microleptes sp. (Microleptinae) in the other two parsimony analyses (part
3 of Fig. 117, part 2 of Fig. 119), sister species to Adelognathus sp. (Adelognathinae)
in the total-evidence Bayesian analysis (part 2 of Fig. 120) or in a clade that lacked
internal resolution with Adelognathus sp., Microleptes sp., Alomya debellator, Cryptinae,
Ichneumoninae and exemplars of Phygadeuontinae (Bayesian molecular-only analysis:
part 2 of Fig. 121). In summary, in all analyses except for parsimony with only mor-
phological characters, it grouped with exemplars of the six subfamilies listed above, but
at no time did it group within Cryptinae or any other subfamily.
Previously, Townes et al. (1961) placed Ateleute within Phygadeuontini, but later
moved it to Cryptini (Townes 1970a) within its own subtribe (Ateleutina). e mo-
lecular analysis of Laurenne et al. (2006) also found equivocal placement for Ateleute.
Depending on alignment parameters, it was sometimes placed as sister to: ((most of
Hemigastrini) + Cryptini), or in an unresolved clade of Ateleute/ Phygadeuontini/
(Hemigastrini + Cryptini), or even as sister to Ichneumoninae. e combined mor-
phology and molecular analysis of Quicke et al. (2009) coded morphological charac-
ters for Ateleute separately from all other Cryptinae species and recovered Ateleute in a
clade of ve species that was sister to a clade including all Hemigastrini and Cryptini
exemplars. In the latter analysis, Ateleute spp. clustered with exemplars of a second ge-
nus of Ateleutinae (Tamaulipeca Kasparyan) as well as Handaoia Seyrig and Austriteles
Gauld (both Phygadeuontini). More recently, Santos (2017) recovered a clade of six
exemplars of Ateleute and Tamaulipeca as sister group to Adelognathinae in his parsi-
mony analysis and nested with some of his Phygadeuontini exemplars in his maximum
likelihood analysis. On the basis of our parsimony and Bayesian analyses, we concur
with the raising of Ateleutina to subfamily status by Santos (2017), but its exact place-
ment within Ichneumoniformes s.l. is still equivocal.
Banchinae
e four exemplar species of Banchinae were closely related in all analyses. e two
Glyptini species (Apophua simplicipes (Cresson) and Sphelodon phoxopteridis (Weed))
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)87
were always sister species and Atrophini (Lissonota scutellaris (Cresson)) was generally
sister to Banchini (Exetastes bioculatus Cresson). In the total-evidence parsimony analy-
sis, Glyptini, (Atrophini + Banchini) and Notostilbops sp. (Stilbopinae) were found in
a clade that lacked internal resolution (part 6 of Fig. 117). is grouping was strongly
supported: 47 total characters (7 morphological) of which 2 were uniquely derived-
character 95(1) (hind margin of hypopygium with median apical notch) (Fig. 88);
character 114(1) (larval posterior struts of inferior mandibular processes greater than
two times length of anterior struts and connected by a band) (Fig. 103). e Bremer
support was 10+ for this node. Moving Notostilbops sp. so that it was sister species to
Stilbops vetulus resulted in a tree that was 13 steps longer (9930). Note that Notostilbops
sp. was scored as 0 for character 95 (apical notch of hypopygium absent) and as un-
known for character 114 (larva of Notostilbops Townes is not known). Stilbops vetulus
(Gravenhorst) (Stilbopinae) was sister to the clade comprised of Notostilbops/ Atro-
phini + Banchini/ Glyptini. e total-evidence Bayesian analysis had Notostilbops sp.
as the sister of the four banchine species (posterior probability of 100), but Banchinae
was only supported with a posterior probability of 92 (part 1 of Fig. 120). Both analy-
ses with only molecular characters found Notostilbops to be sister to Lissonota, cluster-
ing within Banchinae (Figs 119, 121). e morphological parsimony analysis was the
only one that found unequivocal support for the monophyly of Banchinae (without
Notostilbops) (Fig. 118). e strict consensus tree for this analysis had equivocal place-
ment of Notostilbops, but in 98 % of the 3872 equally parsimonious trees, it was sister
to Stilbops vetulus and in 88% of the trees, these two taxa formed a sister group to the
eight Tryphoninae species (and no trees had either of the stilbopines sister group to
Banchinae). To summarize our results, the parsimony analysis with only morphologi-
cal characters supported Banchinae with no evidence that either stilbopine exemplar
was related to Banchinae (Fig. 118); molecular evidence found that Notostilbops is a
banchine (and Stilbops is sister to Banchinae) (Figs 119, 121) and this was the same
result as the total-evidence analyses, except that the relationships in the Notostilbops +
Banchinae clade was equivocally resolved (Figs 117, 120).
Wahl (1988) commented on the placement of Notostilbops. He stated that most
Notostilbops females have a membranous region apically in the hypopygium where the
notch is present in Banchinae, although some N. fulvipes (Townes) have a distinct
notch. In terms of the ovipositor, all Notostilbops females have a distinct dorsal subapi-
cal notch which is present in Banchinae, but absent in the two other genera currently
assigned to Stilbopinae: Stilbops and Panteles Förster. On the basis of these two apomor-
phic character states and the weight of evidence in our study, Notostilbops appears better
placed in Banchinae (either within Atrophini or incertae sedis). We formally transfer
Notostibops Townes to tribe Atrophini of Banchinae. Its tribal placement is based on
the fact that it does not possess synapomorphies that would place it within Glyptini
(e.g., T2–T4 of metasoma with chevron-shaped grooves) or Banchini (e.g., character
63, state 1: hind wing vein 2/Cu much closer to vein M than A). e monophyly of
Atrophini relative to Banchini and Glyptini has not been thoroughly tested with a
morphological, cladistic analysis and this would be required to conrm monophyly of
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
88
Atrophini, and placement of Notostilbops within it. Wahl (1988) stated that knowledge
of the larva of Notostilbops would help determine its placement (presence of the band
connecting the larval mandibular processes would support its placement in Banchinae).
Quicke et al. (2009) generally recovered Banchinae as monophyletic near the base of
Ophioniformes, but not in a sister-group relationship with Stilbopinae (which clus-
tered with Tryphoninae). ey did not include Notostilbops in their analyses.
Brachycyrtinae
e placement of Brachycyrtus wardae Bennett varied somewhat between our analyses.
Total-evidence parsimony placed it as the sister to Labeninae, supported by 32 char-
acters (6 homoplasious morphological) with a Bremer support of 10 (part 3 of Fig.
117). is pairing was sister to (Claseinae + Pedunculinae) and together these taxa
were sister to the rest of Ichneumoniformes s.l. e total-evidence Bayesian analysis
recovered (Brachycyrtinae + (Claseinae + Pedunculinae)) with a posterior probability
of 97 (part 2 of Fig.120). e exact relationships of this grouping to Agriotypinae, Eu-
cerotinae and the rest of Ichneumoniformes s.l. is unclear because of very low posterior
probabilities (54 to 59) for the nodes in this part of the tree. Brachycyrtinae was not
related to Labeninae in the total-evidence Bayesian analysis, with Labeninae placed as
sister group to a well-supported clade (posterior probability of 98) comprised of Pim-
pliformes + Ichneumoniformes s.l..
As noted in the Introduction, Wahl (1993a) placed Brachycyrtinae within his Ich-
neumoniformes s.s. as the sister group to (Cryptinae + Ichneumoninae). Our results do
not support this precise relationship; however, our total-evidence parsimony analysis
(part 3 of Fig. 117) suggests that Brachycyrtinae belongs within Ichneumoniformes
s.l. Quicke et al. (2009) found that Claseinae and Pedunculinae usually clustered with
Brachycyrtinae and sometimes also with Eucerotinae and Microleptinae. eir Brachy-
cyrtiformes: (Claseinae + (Pedunculinae + Brachycyrtinae)), was not supported in our
total-evidence parsimony analysis without Labeninae nested within as sister to Brachy-
cyrtinae (Bremer support of 10 steps). e total-evidence Bayesian analysis did support
it, but not unequivocally (BPP = 97). Since both our total-evidence parsimony and
Bayesian analyses did not support the group unequivocally, we prefer not to recognize
Brachycyrtiformes exactly as Quicke et al. (2009) proposed it until the relationship of
Labeninae to these taxa can be more clearly dened. See the sections below for Clasei-
nae, Labeninae and Pedunculinae for more discussion on the relationships of these taxa.
Campopleginae
Both total-evidence analyses strongly supported the monophyly of the eight exemplar
species of Campopleginae. In the parsimony analysis, the subfamily was supported by
43 synapomorphies (5 morphological, none of which were uniquely derived) with a
Bremer support value of 10+ (part 6 of Fig. 117). e Bayesian analysis also supported
the subfamily with a posterior probability of 100 (part 1 of Fig. 120). Both molecular-
only analyses supported the monophyly of Campopleginae (Figs 119, 121), whereas
the morphological parsimony analysis found that Casinaria grandis and Dusona egregia
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)89
(Viereck) did not cluster with the other six species (Fig. 118). Cremastinae was the
sister group to Campopleginae in both total-evidence analyses although the support in
the parsimony analysis was relatively low (26 characters including 3 morphological of
which none were uniquely derived and a Bremer support value of 1). Internally, both
total-evidence analyses found the same topology, with Campoplex sp. sister to the other
seven species and Rhimphoctona macrocephala (Provancher) sister to the rest.
Townes (1970b) divided Campopleginae into four tribes. Wahl (1991) comment-
ed on these tribes from a cladistic viewpoint and recommended suspension of Townes’s
tribal classication, instead recognizing ve informal genus groups. He also hypoth-
esized that Cremastinae was the sister group to Campopleginae. Miah and Bhuiya
(2001) performed a morphological cladistic analysis nding that Townes’s tribes Hell-
wigiini and Nonnini (= Nesomesochorini) did not belong in Campopleginae. Later,
Quicke et al. (2005) based on morphology and molecular data transferred Hellwigiini
(Skiapus and Hellwigia Gravenhorst) to Ophioninae and resurrected Nonninae for
Nonnus Cresson and Nesomesochorinae for Chriodes Förster and Klutiana Betrem.
Quicke et al. (2009) placed the latter two genera together within Nesomesochorinae.
e latter study found that either Cremastinae or Nesomesochorinae was sister to
Campopleginae, depending on how gaps were treated in the molecular data. In con-
trast, the anchored enrichment study of Klopfstein et al. (2019) recovered Cremastinae
+ (Ophioninae + Campoplegeinae).
e current results strongly support the monophyly of Campopleginae (i.e., the
group comprised of the genera that were previously classied in Townes’s Campoplegini
and Porizontini). ey also support the removal of Hellwigiini and Nesomesochorini
from Campopleginae. In terms of the sister-group relationship, both total-evidence
analyses support Cremastinae as sister to Campopleginae with Nesomesochorinae
and (Ophioninae + Anomaloninae) also related, albeit more distantly. With respect
to internal relationships, Townes’s Campoplegini and Porizontini were not supported
(Campoplex sp. was sister to all other genera, but the other Campoplegini exemplar,
Casinaria grandis, clustered within the six Porizontini species. Likewise, there was no
support for the genus groups of Wahl (1991). For example, the two exemplar species
from Wahl’s Bathyplectes genus group (Bathyplectes infernalis (Gravenhorst) and Rhim-
phoctona macrocephala) were not sister taxa. A more comprehensive analysis is required
to dene natural groups within the subfamily.
Claseinae
Claseinae (Clasis sp. nov.) was sister group to Pedunculinae (Pedunculus sp. nov.) in all
analyses except the morphology-only parsimony analysis in which it was unresolved
near the base of Ichneumonidae (part 1 of Fig. 118). In the total-evidence parsimony
analysis, (Claseinae + Pedunculinae) was supported by 17 synapomorphies, 4 of which
were morphological (none uniquely derived) and a Bremer support of 9 (part 3 of
Fig.117). e Bayesian total-evidence analysis supported this relationship with a pos-
terior probability of 100 (part 2 of Fig. 120). See Brachycyrtinae (above) for more
discussion of the relationships of these two subfamilies to other taxa.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
90
Clasis Townes was originally placed within the cryptine tribe Phygadeuontini
(Townes and Townes 1966) and then later, Townes (1969) moved it to Labeninae as
a tribe (Clasini) along with the newly described monotypic Ecphysis Townes. Gauld
(1983) moved Clasini back into Cryptinae as its own tribe. Porter (1998) raised the
group to subfamily status. Quicke et al. (2009) found that Claseinae was the sister
group of (Pedunculinae + Brachycyrtinae) in most of their analyses. Santos (2017)
never recovered his three Clasis species within Phygadeuontini or Cryptinae but in-
stead, they clustered together as sister to Agriotypinae, (Agriotypinae + Labeninae) or
(Brachycyrtinae + Eucerotinae), depending on the method of analysis.
e fact that our total-evidence parsimony analysis supports the monophyly
of Labeninae as it was dened by Townes (1969) (i.e., including Clasis, Pedunculus
Townes and Brachycyrtus Kriechbaumer) is intriguing, considering how much work
has been done studying and ultimately dividing this group. Certainly, the arrangement
of Townes (1969) is not exactly the same as our parsimony results (e.g., Townes placed
Pedunculus, Brachycyrtus and Poecilocryptus Cameron into a single tribe), but the fact
that all eight of the species we chose from the Labeninae of Townes (1969) clustered
together in our total-evidence parsimony analysis raises the question, should Labeni-
nae be re-established to include Brachycyrtinae, Claseinae, Pedunculinae and Labe-
ninae as it is currently dened? One of the arguments against this change is that our
total-evidence Bayesian analysis recovered Labeninae (in the current sense) unrelated
to (Brachycyrtinae + (Claseinae + Pedunculinae)) (as sister to Pimpliformes + Ichneu-
moniformes s.l. except for Labeninae). In addition, Townes (1969) did not provide any
characters that dene his concept of Labeninae. Since the relationships of Labeninae,
Brachycyrtinae and (Claseinae + Pedunculinae) are equivocal among our ve analyses,
and the results of Santos (2017) were similarly equivocal, it seems prudent to maintain
the subfamily status of all four of these subfamilies, rather than sink them back into
Labeninae. Nevertheless, it is interesting that this study has recovered one of Townes’s
previously recognized groupings, similar to the study of Klopfstein et al. (2019) that
moved Pseudorhyssa Merrill back into Pimplinae and resurrected tribe eroniini.
Collyriinae
Both total-evidence analyses (Figs 117, 120) and both molecular-only analyses
(Figs119, 121) found that Collyria catoptron was sister species to Coleocentrus rufus
(Acaenitinae) within Pimpliformes. Coleocentrus rufus was not however, closely related
to the other acaenitine exemplar: Spilopteron occiputale (see Acaenitinae, above). e
total-evidence parsimony analysis supported (Collyria catoptron + Coleocentrus rufus)
based on 23 synapomorphies (6 morphological of which none were uniquely derived)
with a Bremer support of only 1. e relative placement of this sister-group pairing
within Pimpliformes is not clear because of major dierences in the overall topology
of the group depending on the phylogenetic method used (see Pimpliformes section,
above). e placement of Collyriinae in the morphological parsimony analysis was also
not clearly resolved (Fig. 118).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)91
Historically, the taxonomic placement of Collyria has been contentious. Dalla
Torre (1902) and Morley (1908) related it to Acaenitus Latreille and Arotes Graven-
horst (Acaenitinae), but the latter noted that previous British catalogues placed it with-
in Ophioninae (i.e. Ophioniformes) related to Pristomerus vulnerator (Panzer) (Cre-
mastinae). Cushman (1924) placed it in a new tribe, Collyriini within Pimplinae (i.e.,
Pimpliformes). Townes (1971) stated: “Neither the adult nor the larva, however, have
any real resemblance to the acaenitines” and he placed Collyria in a separate subfamily,
arranged close to Orthopelma Taschenberg (Orthopelmatinae) and Orthocentrinae (al-
though this part of his Genera of Ichneumonidae seems to be where he placed taxa of
uncertain anity). Short (1978) simply stated it was “isolated on both larval and adult
characters”. Wahl and Gauld (1998) did not include it in their analysis of the Pimpli-
formes; however, Belshaw et al. (1998) and Quicke et al. (2009) recovered Collyiinae
within Pimpliformes, the latter study placing it within the Diptera-parasitizing clade
(Diplazontinae, Orthocentrinae and Cylloceriinae). Note that species of Collyria are
egg-larval, koinobiont endoparasitoids of Cephidae (Hymenoptera) (Salt 1931; Wahl
et al. 2007), whereas the few known records of Acaenitinae show that they are larval
koinobiont endoparasitoids of Coleoptera (Shaw and Wahl 1989).
More recently, Kuslitzky and Kasparyan (2011) described a second genus of Col-
lyriinae: Aubertiella Kuslitzky & Kasparyan, from the Middle East and Sheng et al.
(2012) described a third genus (Bicurta Sheng, Broad & Sun) from southeastern Chi-
na. e latter study also re-examined the phylogenetic analysis of Wahl and Gauld
(1998) with the addition of Collyria and Bicurta and found that they clustered to-
gether within Pimpliformes, but in terms of their placement, relationships in their un-
weighted parsimony analysis were largely unresolved. Searching with implied weights
(Golobo 1993) with values ranging from k = 1 to k = 10 resulted in a single topology
in which Bicurta + Collyria was the sister group to Rhyssinae. Sheng et al. (2012) did,
however, note that Wahl and Gauld (1998) coded all Acaenitinae at the subfamily level
in their matrix and suggested that re-coding all genera of Acaenitinae separately could
reveal dierent patterns of relationships within Pimpliformes, especially relative to
Collyriinae. ey also noted some similar general characteristics between Collyriinae
and some Acaenitinae and Poemeniinae namely, short antennae, median tubercle on
the clypeus (our character 3, state 1), lack of transverse carinae of the propodeum (our
characters 36 and 38, state 3) and hind wing vein 2/Cu originating close to vein M (our
character 63, state 1). Characters 3, 36 and 63 supported the grouping of Coleocentrus
+ Collyria in our total-evidence parsimony analysis (part 2 of Fig. 117). Most recently,
the transcriptome analysis of Klopfstein et al. (2019) found a sister-group relationship
of Collyria trichophthalma (omson) and Coleocentrus excitator (Poda), the only ex-
emplars of these two subfamilies in this analysis. eir anchored enrichment analyses
found the placement of Collyria to be unstable with some analyses placing it as sister
to all other Pimpliformes and in others it was related to Coleocentrus or Acaenitini. In
summary, the relationships of Collyriinae are still equivocal, but it may be related to
Acaenitinae. Finally, it is noted that the description of the nal larval instar cephalic
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
92
sclerites of Collyria coxator (Villers) by Short (1959) is inaccurate. We have examined
the slide mount used by Short. e mandibles are completely absent, and there is no
trace of the antenna. A whole larva of Collyria catoptron has been photographed (Fig.
112) and a revised description of the cephalic sclerites of the mature larva of Collyria
is provided in Appendix 1.
Cremastinae
e two species of Cremastinae, Eiphosoma pyralidis Ashmead and Xiphosomella setoni
Johnson, clustered together in all analyses with very strong support. e total-evidence
parsimony analysis supported this grouping with 61 synapomorphies (5 morphologi-
cal) and a Bremer support value of 10+ (part 6 of Fig. 117). Character 71, state 1 (apex
of middle and hind tibiae with sclerotized bridge separating insertion areas) (Fig. 65)
was uniquely derived. Cremastinae was sister group to Campopleginae in both total-
evidence analyses (Figs 117, 120) and these two subfamilies grouped with Nesomeso-
chorinae and (Anomaloninae + Ophioninae) in the higher Ophioniformes.
e monophyly of Cremastinae has generally gone unquestioned, supported
largely by the unique synapomorphy (within Ichneumonidae) of the sclerotized
bridge of the middle and hind tibiae separating the insertion points of the tarsus and
tibial spurs (Gauld et al. 2000). Quicke et al. (2009) coded morphology separately for
the Belesica group (Belesica Waterston and Eurygenys Townes) relative to “other Cre-
mastinae”. ey stated that Cremastinae was monophyletic in all individually aligned
analyses, but when they combined these data into a single data set (the elision strategy
of Wheeler et al. 1995), Eurygenys sp. did not cluster with the other Cremastine, but
was sister to a clade comprised of Skiapus, Hybrizontinae, Anomaloninae, Ophioni-
nae, Cremastinae, Nesomesochorinae and Campopleginae. We were not able to in-
clude a representative of the Belesica group in our analysis, therefore the relationships
of this group to other genera of Cremastinae remains ambiguous. See Campopleginae
(above) for discussion of prior hypotheses of relationships of Cremastinae, Campople-
ginae and Nesomesochorinae.
Cryptinae sensu stricto and Cryptinae sensu lato
e seven species of Cryptinae sensu stricto, i.e., members of the tribes Cryptini and
Aptesini (formerly Hemigastrini), grouped together in both of the total-evidence anal-
yses and the Bayesian (molecular-only) analysis (Table 3). e total-evidence parsi-
mony analysis had moderately low support for Cryptinae with 17 synapomorphies (5
morphological, including one uniquely derived: sternaulus posteriorly ending anterior
to posterolateral corner of mesopleuron (character 27(2)) (Fig. 28). e Bremer sup-
port value was 3 (part 3 of Fig. 117). ere was much stronger support for Cryptinae
in the total-evidence Bayesian analysis (BPP = 100) (part 2 of Fig. 120).
In the analyses in which Cryptinae s.s. was monophyletic, it was always related to
species in the subfamilies Ateleutinae, Microleptinae, Phygadeuontinae, Alomyinae,
Ichneumoninae and Adelognathinae. e specic relationships of each of these sub-
families are discussed more fully in the section above on Ichneumoniformes, as well as
in the respective subfamily sections.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)93
e 11 species of Cryptinae sensu lato (species of Ateleutinae, Phygadeuontinae
and Cryptinae s.s.) never shared a unique, common ancestor, regardless of the analysis.
is was caused by: 1) placement of Ateleute sp. nov. (Ateleutinae) away from the other
species; 2) paraphyly of the other 10 species of Cryptinae s.l. with respect to Alomyinae
+ Ichneumoninae. In summary, we found no evidence to support the monophyly of
Cryptinae s.l. (= Gelinae) of Townes (1970a).
Regarding Phygadeuontinae, in the total-evidence parsimony analysis, the three
species (Endasys patulus (Viereck) + (Acrolyta sp. + Mastrus sp.)) grouped together with
weak support (13 synapomorphies and a Bremer support value of 1) (part 3 of Fig.
117). is group was also supported in the Bayesian total-evidence analysis, but not
unequivocally (BPP = 90) (part 2 of Fig. 120). Both of these analyses placed Phyga-
deuontinae as the sister group to (Alomyinae + Ichneumoninae) (18 synapomorphies
and a Bremer support value of 2 for the parsimony analysis and p.p of 100 for the
Bayesian analysis). erefore, in terms of the monophyly and placement of Phyga-
deuontinae (Phygadeuontini prior to Santos 2017), our analysis provided some sup-
port for its monophyly; however, we included only three species and the more rigorous
study of Santos (2017) has shown that this group is most likely not monophyletic. Its
raising to subfamily status by the latter study was necessitated by its paraphyly with
Ichneumoninae, but it may be a “dumping ground” for all the “non-Aptesini” and
“non-Cryptini” taxa that were previously placed within Cryptinae. See the section on
Phygadeuontinae (below) for more discussion of this taxon.
With respect to the relationship between Cryptinae s.s. and Ichneumoninae,
Townes (1969) stated that they were not related on the basis of dierences in larval
morphology. Gauld (1991) disagreed, placing the two families together in his “Phyga-
deuontoid” subfamilies. Wahl (1993a), in his discussion on the relationships of his
Ichneumoniformes commented on the opinion of Townes (1969) stating: “e larvae
are indeed very dissimilar but this is because, at the subfamilia level, Phygadeuontinae
[= Cryptinae s.l.] larvae are plesiomorphic in almost every respect while larvae of Ich-
neumoninae are extremely specialized endoparasitoids. Larvae of Ichneumoninae can
be easily derived from a Phygadeuontinae-like precursor.” Nevertheless, Wahl (1993a)
did not explicitly suggest paraphyly of Cryptinae and Ichneumoninae. e rst author
to suggest this was Gokhman (1988) who argued that the ichneumonine tribe Phaeo-
genini provided evidence for an “evolutionary pathway” between Ichneumoninae and
Phygadeuontini.
In terms of more recent, sequence-based studies, some of the analyses of Laurenne
et al. (2006) (with high gap costs) found Ichneumoninae nested within most of Phyga-
deuontini. e combined analysis of Quicke et al. (2009) had similar results, although
their two presented cladograms propose Ichneumoninae as sister group to (Agriotypi-
nae + (Adelognathinae + Cryptinae s.l.)).
Finally, in terms of support for the tribes of Cryptinae s.s., the total-evidence parsi-
mony analysis had strong support for Cryptini (including Echthrus reluctator) with 30
synapomorphies and a Bremer support of 6, and Aptesini had 25 synapomorphies and
a Bremer support of 9. e Bayesian total-evidence analysis also supported both tribes
(BPP = 100 for each) (part 2 of Fig. 120).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
94
Ctenopelmatinae
Ctenopelmatinae was never recovered as monophyletic (Table 3). e 14 species of
Ctenopelmatinae did share a relatively recent common ancestor in the total-evidence
parsimony analysis (part 5 of Fig. 117) along with the following small subfamilies and
enigmatic genera nested in the same clade: Hybrizon rileyi (Ashmead) (Hybrizontinae);
Lycorina glaucomata (Lycorininae); Oxytorus albopleuralis (Provancher) (Oxytorinae);
Tatogaster nigra Townes (Tatogastrinae); Chineater masneri (Mesochorinae) and Sco-
lomus sp. (Metopiinae). is grouping was relatively weakly supported by 18 syna-
pomorphies (4 morphological of which none were uniquely derived) and a Bremer
support of 2. In the strict consensus cladogram it was placed within Ophioniformes
in a clade with equivocal relationships as follows: (Mesochorinae except Chineater) /
(Ctenopelmatinae and related taxa) / ((Metopiinae + (Stilbops + Banchinae includ-
ing Notostilbops) + higher Ophioniformes). Of interest, the clade was supported by
only 12 synapomorphies including the presence of a tooth on the fore tibia (character
68(1)) (Fig. 63) with a reversal back to the lack of a tooth in Metopiinae to Cam-
popleginae. In other words, the one morphological character that has been used to
dene Ctenopelmatinae in the past did not dene Ctenopelmatinae (by itself) in our
analysis. Sixty-seven percent of the most parsimonious trees supported a sister-group
relationship of (Mesochorinae except Chi neater + Ctenopelmatinae and related taxa).
In comparison to the parsimony analysis, the total-evidence Bayesian analysis recov-
ered a grouping that included all 14 Ctenopelmatinae species as well as Hybrizon and
Tatogaster and all four species of Metopiinae, but this group did not include Oxytorus
or Lycorina (part 1 of Fig. 120). e support for this clade, however, was very low (BPP
= 52). None of the other analyses recovered Ctenopelmatinae as monophyletic, with or
without Metopiinae, Mesochorinae or the exemplars of the small subfamilies.
In terms of support for the ctenopelmatine tribes, of the ve for which multiple spe-
cies were included, only two (Perilissini and Mesoleiini) had their species clustering to-
gether in the total-evidence parsimony analysis. e other three large tribes (Pionini, Eu-
ryproctini and Ctenopelmatini) were not recovered as monophyletic (part 5 of Fig.117).
Previous studies have questioned the monophyly of Ctenopelmatinae. Gauld and
Wahl (2006) stated that it is possible that Ctenopelmatinae may represent a basal grade
within Ophioniformes. Our total-evidence parsimony analyses did not support this
hypothesis, but the subfamily’s paraphyly with respect to many other small subfamilies
and the lack of resolution of most of the ctenopelmatine tribes agrees with the conclu-
sions of Gauld et al. (1997) who stated that the classication of the group is the least
satisfactory of any ichneumonid subfamily. Belshaw and Quicke (2002) using the 28S
D2–D3 region found that their ve ctenopelmatine exemplars were paraphyletic with
respect to Mesochorus sp. (Mesochorinae) and Colpotrochia cincta (Scopoli) (Metopii-
nae). e much more extensive analysis of Quicke et al. (2009) found Tryphoninae as
the sister group to a grade of Ctenopelmatinae leading to the rest of Ophioniformes.
e position of the various Ctenopelmatinae groupings relative to themselves and
the other Ophioniformes subfamilies varied greatly, depending on whether gaps were
treated as informative or not. Based on the current and previous studies, is there a way
forward to create a natural classication of the Ctenopelmatinae and related taxa?
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)95
Our total-evidence analyses indicate that the taxa currently comprising Ctenopel-
matinae belong within Ophioniformes and yet not within the “higher Ophioniformes”
(Anomaloninae, Campopleginae, Cremastinae, Nesomesochorinae, Ophioninae).
Ctenopelmatinae may be related to Mesochorinae (part 4 of Fig. 117), (perhaps meso-
chorines could even be derived from within it) (part 1 of Fig. 120) and several small
superfamilies may also need to be placed within it (e.g., Tatogastrinae, Oxytorinae)
(part 5 of Fig. 117). It may be related to Metopiinae (part 1 of Fig. 120), or it may not
(part 4 of Fig. 117). Beyond this, the subfamily is not dened by any morphological
synapomorphy. Taxa in several other subfamilies have the fore tibial tooth including
Mesochorinae (Gauld and Wahl 2006), Sisyrostolinae (Bennett et al. 2013) and some
Tryphoninae (Bennett 2015), and the distinctiveness of the tooth varies within Cten-
opelmatinae. e 28S D2–D3 gene by itself does not seem to provide clear resolution
of this part of the ichneumonid phylogeny, as evidenced by the major dierences in
arrangement of ctenopelmatines based on diering gap treatments and costs in Quicke
et al. (2009). Addition of COI barcoding region and EF1a in the current study may
have helped us nd molecular characters to support Ctenopelmatinae (including some
of the small subfamilies), but the results of our total-evidence parsimony analysis may
have also been aected by our relatively low number of exemplar ctenopelmatines. It
is possible that adding more exemplar species may create instability in the topology as
was seen in Quicke et al. (2009). In terms of monophyly of the tribes of Ctenopel-
matinae, we think it likely that their monophyly in some of the analyses of Quicke
et al. (2009) was an artefact of the coding of morphology at the tribal level for Cten-
opelmatinae. e major dierences in topology among our ve analyses and previous
studies corroborate Gauld et al. (1997) that internal relationships of Ctenopelmatinae
and relationships of these taxa to other subfamilies are one of the least clearly resolved
parts of the ichneumonid phylogeny.
Cylloceriinae
In the total-evidence parsimony analysis, Cylloceriinae (Cylloceria melancholica) was
sister taxon to Spilopteron occiputale (Acaenitinae) in the middle of our Pimpliformes
grouping (part 2 of Fig. 117). is relationship was supported by 22 synapomor-
phies, of which only one was morphological: character 13, state 1: occiput with medial
notch present near foramen magnum, a trait evolved independently in Poemenia albi-
pes (Cresson) (Poemeniinae), Coleocentrus rufus (Acaenitinae) and a clade containing
most of Pimplinae. e Bremer support value was 9. e morphology-only parsimony
analysis had C. melancholica as sister to Diacritus incompletus (Diacritinae) with these
two species sister group to Acaenitinae (part 1 of Fig. 118). ere were only three char-
acters supporting C. melancholica + D. incompletus and the Bremer support value was
only 1. Conversely, the molecular-only parsimony analysis supported a grouping of
C. melancholica + eronia bicincta (Cresson) (Pimplinae), based on 14 substitutions
(part 2 of Fig. 119). In the total-evidence Bayesian analysis, C. melancholica was in a
clade that lacked resolution with S. occiputale, D. incompletus and (Coleocentrus rufus
+ Collyria catoptron). e support for this grouping was low (BPP = 75). e Bayesian
analysis with only molecular characters placed C. melancholica within Pimpliformes,
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
96
but the relationships at the base of this clade lacked resolution with low posterior prob-
abilities (part 2 of Fig. 121).
Wahl and Gauld (1998) found the following relationship based on a morphologi-
cal parsimony analysis: Acaenitinae + (Diacritinae + (Cylloceriinae + (Diplazontinae +
Orthocentrinae). e grouping of Cylloceriinae + (Diplazontinae + Orthocentrinae)
makes sense biologically because all species for which hosts are known are endopha-
gous in Diptera (Wahl 1990). It was expected that our morphology-only parsimony
analysis would nd the same results as Wahl and Gauld (1998), but their study coded
Acaenitinae and Diplazontinae at subfamily level and their character set was designed
specically to analyze Pimpliformes, not all of Ichneumonidae. It should be noted
that when we analyzed only the morphological characters with a Bayesian approach,
we found the following: Cylloceriinae + (a grade of Orthocentrinae + Diplazontinae),
but with a posterior probability of only 69 (results not shown). More recently, most of
the analyses of Klopfstein et al. (2019) found that Cylloceriinae formed a clade with
Orthocentrinae and Diacritinae.
e combined analyses of Quicke et al. (2009) generally recovered Diacritinae +
(the acaenitinae Procinetus + ((higher Pimpliformes) + (other Acaenitinae + (Cylloceri-
inae + (Orthocentrinae + (Diplazontinae + (Collyriinae + Hyperacmus))). As exemplars
of Cylloceriinae, Quicke et al. (2009) included two species of Cylloceria and Allomacrus
arcticus (Holmgren) and these species clustered together. ey did not include any
species of Rossemia Humala. Most of their analyses (including both cladograms they
provide) recovered a sister-group relationship of Hyperacmus with Collyriinae, not Cyl-
loceriinae. Only when high gap costs were applied (not shown) did Hyperacmus cluster
with Cylloceriinae. Nevertheless, Quicke et al. (2009) formally transferred Hyperacmus
to Cylloceriinae. One of their rationales for this move was based on the fact that the
venom resevoir of Cylloceria and Hyperacmus possess the uniquely derived state of be-
ing comprised of two symmetric parts. In addition, Quicke et al. (2009) point out that
the venation of the two genera is similar, males of both have concave tyloids on rather
basal agellomeres, and the propodeum is elongated with strong latero-median carinae
(shared characters also summarized by Broad et al. 2018). Alternate placements for
Hyperacmus include Orthocentrinae (Wahl and Gauld 1998) and related to Microleptes
(Humala 2003). Unfortunately, we were not able to include sequence of Hyperacmus in
the current study. In addition, the larva of Hyperacmus is not known and this knowl-
edge would be instructive in conrming the placement of Hyperacmus. We were also
not able to include specimens of Rossemia or Allomacrus Förster.
In our study, all the exemplars of Diacritinae, Acaenitinae, Collyriinae, Cylloceri-
inae, Diplazontinae and Orthocentrinae clustered together in only one analysis: the
total-evidence Bayesian analysis (part 1 of Fig. 120) and only with weak support (BPP
= 89). Neither of our total-evidence analyses recovered the relationship of Cylloceri-
inae with Orthocentrinae, Diplazontinae and Collyriinae, but this may have partly
been because of the aberrant 28S sequence of S. occiputale which may have aected re-
lationships in this region of the tree (see Acaenitinae, above). In summary, our analyses
unequivocally conrm previous results that Cylloceria belongs to Pimpliformes (Wahl
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)97
and Gauld 1998; Quicke et al. 2009). Its precise placement within Pimpliformes is
uncertain and depends on the characters used and the type of analysis, but it certainly
appears more likely to be related to Acaenitinae, Collyriinae, Diacritinae, Diplazonti-
nae and Orthocentrinae, as opposed to the higher Pimpliformes.
Diacritinae
e total-evidence parsimony analysis recovered our single exemplar of Diacritinae
(Diacritus incompletus) in a clade within Pimpliformes with equivocal relationships
as follows: Diacritus/ Coleocentrus rufus + Collyria catoptron/ all species of Pimplinae,
Poemeniinae and Rhyssinae (part 2 of Fig. 117). is clade was supported by 15 syna-
pomorphies, of which 5 were morphological, and a Bremer support value of only 1.
See the section on Cylloceriinae (above) for more description of the placement of
Diacritinae in our analyses.
Previous analyses have found Diacritinae as either sister to all Pimpliformes (Quicke
et al. 2009), to all Pimpliformes except for Acaenitinae (Wahl and Gauld 1998), or
related to Orthocentrinae and Cylloceriinae (Klopfstein et al. 2019). Our conclusions
about the placement of Diacritinae are similar to that of Cylloceriinae: it most likely
belongs to the grouping with Acaenitinae, Collyriinae, Cylloceriinae, Diplazontinae
and Orthocentrinae, but the current study does not clarify its relationships within this
group. Nothing is known of the biology or larva of any of the three included genera
and this information could help to place Diacritinae more precisely.
Diplazontinae
e monophyly of Diplazontinae (Diplazon laetatorius (Fabricius) and Woldstedtius a-
volineatus (Gravenhorst)) was supported in all of our analyses, regardless of the data used
or the method of analysis (Table 3). In the total-evidence parsimony analysis (part 2 of
Fig. 117), Diplazontinae was supported by 43 synapomorphies including 16 morpho-
logical of which 3 were uniquely derived: 5(4) mandibles tridentate (Fig. 16); 107(1)
larval pleurostoma and mandible location shifted ventrally inferior to mandibular pro-
cess opposite labial palpus (Fig. 100); and 126(1) larval labial sclerite with ventral mar-
gin produced as a spine (Fig. 100). e Bremer support value was more than 10 steps.
As described above in the section on Cylloceriinae, all previous studies have placed
Diplazontinae within Pimpliformes, generally as sister group to Orthocentrinae (Gauld
and Wahl 1998; Quicke et al. 2009). Our total-evidence parsimony analysis did not
support this grouping as the arrangement of Pimpliformes was “upside-down” (with
Diplazontinae as sister group to all other taxa) similar to the transcriptome and maxi-
mum likelihood anchored enrichment analyses of Klopfstein et al. (2019). e current
Bayesian total-evidence analysis did recover the three species of Orthocentrinae in a
clade with Diplazontinae, but Orthocentrinae formed a grade leading to Diplazonti-
nae and support for the grouping was low (BPP = 76) (part 2 of Fig. 120). e generic
relationships of Diplazontinae are relatively well-studied on the basis of a phylogenetic
analysis using morphological characters and four genes (Klopfstein et al. 2011) as are
the species concepts (e.g., Dasch 1964; Klopfstein 2014).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
98
Eucerotinae
As described in the section above on Agriotypinae, in the total-evidence parsimony
analysis part 3 of (Fig. 117), Euceros sp. nov. was sister taxon to Agriotypus arma-
tus, these two taxa being sister group to the remainder of Ichneumoniformes sensu
lato except for ((Claseinae + Pedunculinae) + (Brachycyrtinae + Labeninae)). is was
similar to the molecular-only parsimony analysis except that Euceros sp. nov. was in a
clade as follows: (Agriotypus armatus + (Brachycyrtus wardae + Euceros sp. nov.) (part
2 of Fig.119). Euceros sp. nov. occupied a similar position in both Bayesian analyses:
close to A. armatus and near the base of Ichneumoniformes s.l. except for Labeninae,
Brachycyritinae and related subfamilies (part 2 of Fig. 120, part 2 of Fig. 121). e
only dierent hypothesized relationship for Euceros sp. nov. was in our morphology-
only parsimony analysis in which Euceros sp. nov. was sister to Neorhacodes enslini
(Neorhacodinae) with 18 synapomorphies of which 4 of them were uniquely derived,
although all of the uniquely derived character states described the egg and biology of
Euceros sp. nov. with reversals/ transformations in N. enslini (part 2 of Fig. 118). Op-
timization of these characters using DELTRAN changed these four characters to be
autapomorphies of Euceros sp. nov. ere was no resolution in this part of the tree to
be able to determine relationships of this pairing.
Euceros Gravenhorst is unique in Ichneumonidae in that species lay eggs on vegeta-
tion which hatch into planidial larvae (Tripp 1961). It has previously had an uncertain
placement in Ichneumonidae. Viereck (1918) included Euceros within his Ctenopelmi-
nae (Ctenopelma Holmgren, etc.), but later (Viereck 1919) raised the taxon to subfam-
ily status as “Eucerinae”. Townes (1945) placed it as a tribe within Ctenopelmatinae,
but later as a tribe in Tryphoninae (Townes et al. 1965, Townes 1969). Short (1959)
placed Euceros as a tribe (Euceratini) in Ctenopelmatinae. Perkins (1959a) reverted
the rank of Euceros to a subfamily (“Euceratinae”) and Short (1978) concurred with
this placement on the basis of larval characters. It is now recognized that the apparent
similarities between Euceros, Tryphoninae and Ctenopelmatinae are based on symple-
siomorphies such as the non-petiolate T1 (character 76, state 0) with spiracle placed
anterior to middle (chareacter 77, state 0) (Fig. 72). Furthermore, it is not believed
that the stalked egg of Tryphoninae (Fig. 113) is homologous to the stalked egg of
Eucerotinae (Figs 115–116) (Gauld and Wahl (2002). e egg in Tryphoninae is an
extension of the chorion (Kasparyan 1973); whereas, the stalk of Euceros is a secretion
that hardens allowing the egg to be stuck to vegetation (Tripp 1961).
Previous phylogenetic studies have attempted to ascertain the relationships of Euc-
erotinae within Ichneumonidae. A morphological analysis by Gauld and Wahl (2002),
using a limited number of outgroups, found that Eucerotinae was sister group to La-
bium (Labeninae) + Brachycyrtus. e combined morphological and molecular studies
of Quicke et al. (2000a) (using 28S D2) and Quicke et al. (2009) (using 28S D2–D3)
generally found that Euceros was sister to Brachycyrtus with this pairing often associ-
ated with Claseinae, Pedunculinae, and Microleptinae within Ichneumoniformes s.l.
except Labeninae. Similar results were found by Santos (2017) with seven genes and
morphology. Overall, our analyses generally concur with the ndings of Quicke et al.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)99
(2009) and Santos (2017) that Euceros is placed near the base of Ichneumoniformes
s.l. ere are no morphological characters that support this placement and the unique
biology of Euceros also oers no clues as to whether it is correct.
Hybrizontinae
Hybrizon rileyi, the exemplar of Hybrizontinae in our study, was sister to Lycorina glau-
comata (Lycorininae) in the total-evidence parsimony analysis and was nested within
the Ctenopelmatinae and relatives clade (part 5 of Fig. 117). e pairing was support-
ed by 41 synapomorphies, of which 6 were morphological with a Bremer support value
of 7 steps. None of the morphological characters supporting this pair were uniquely
derived or even had a consistency index above 0.2. e total-evidence Bayesian analysis
was similar to the total-evidence parsimony analysis: H. rileyi was within the Ctenopel-
matinae and relatives clade in a region with equivocal relationships: Perilissini/ (Rhorus
bartelti Luhman + Ctenopelmatinae Genus NZ/ (Westwoodia sp. + (Onarion sp. + H.
rileyi)) (part 1 of Fig. 120). e support for this clade was only 84 and H. rileyi had
an extremely long branch length. e molecular-only parsimony analysis recovered
H. rileyi in a clade as follows: (Labeninae + (Brachyscleroma sp. + Aplomerus sp.) +
(Tersilochinae s.s. + (Mesochorus sp. + (Onarion sp. + H. rileyi)))) (part 2 of Fig.119).
Finally, the molecular-only Bayesian analysis placed H. rileyi in a similar position to the
molecular-only parsimony analysis: not clustering with most members of Ctenopel-
matinae, but rather unresolved with members of Tersilochinae, Mesochorinae, Sisyros-
tolinae and Cremastinae at the base of a clade containing Pimpliformes and members
of Ichneumoniformes s.l. (part 1 of Fig. 121).
Similar to Agriotypus, Hybrizon Fallén and its relatives have had a varied placement
over time: included in Braconidae (Achterberg 1976), Ichneumonidae (Gauld 1984),
or as a family itself: Hybrizontidae or Paxylommatidae (Marsh 1971, 1989). e dif-
ferent family-level placements have been proposed because of wing venation, primarily
because of the lack of fore wing vein 2m-cu (character 51, state 1) (as in Fig. 49) in
Hybrizon, a character that denes all of Braconidae except Apozyx Mason (Sharkey and
Wahl 1992). Nevertheless, other ichneumonids lack 2m-cu (e.g., Neorhacodes Hedicke)
and the fossil hybrizontine Tobiasites striatus Kasparyan possesses this vein (Kasparyan
1988), indicating that presence of the vein may be the ground plan state for the group.
Furthermore, Mason (1981) noted that Hybrizon does not have fusion of metasomal
tergites 2 and 3, therefore excluding it from Braconidae. Currently, it is believed that
Hybrizon and its relatives are correctly placed within Ichneumonidae as a subfamily
(Sharkey and Wahl 1992) and our results support this: H. rileyi did not cluster within
the outgroups, nor was it ever placed as sister to the rest of Ichneumonidae.
In terms of proposed placement within Ichneumonidae, Sharkey and Wahl (1992)
suggested that on the basis of the lack of vein 2m-cu and similar host biology (endo-
parasitoids of Aculeata), Hybrizontinae may be the sister of Neorhacodinae. Hybrizon
spp. are known to parasitize ants (Donisthorpe 1913, Gómez Durán and Achterberg
2011), whereas Neorhacodes spp. parasitize stem-nesting Crabronidae (Horstmann
1968; Danks 1971). None of our results support this relationship. More recent studies
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
100
using sequence data and morphology (Quicke et al. 2009) often recovered a relation-
ship of Hybrizon with Lycorina Holmgren (Lycorininae), but that study stated that the
placement of Hybrizon was highly variable depending on the analysis (although gener-
ally related to Ophioniformes taxa). In the end, Quicke et al. (2009) suggested that
Hybrizon may be a derived Anomaloninae. In summary, our combined analyses suggest
Hybrizontinae may be related to Ctenopelmatinae, whereas our molecular-only analy-
ses place it somewhere within Ophioniformes (but not the higher Ophioniformes).
Certainly its biology does not lend support to the notion that it is a ctenopelmatine
which are mostly parasitoids of sawies, but neither does it suggest it is an anomalo-
nine, which parasitize Lepidoptera (Gauld et al. 1997).
Ichneumoninae
e following discussion pertains to the 13 exemplar species of Ichneumoninae ex-
cluding Alomyini. See the section on Alomyinae (above) for the rationale for moving
Alomya and Megalomya within Ichneumoninae (as Alomyini).
e 13 species of Ichneumoninae were monophyletic in all analyses (Table 3). e
total-evidence parsimony analysis had 32 synapomorphies supporting Ichneumoni-
nae, of which 9 were morphological, including the uniquely derived character state
84(1) gastrocoelus present (Fig. 77). e Bremer support value was greater than 10
steps. (Ichneumoninae + Alomya debellator) was the sister of Phygadeuontinae in both
total-evidence analyses and these were sister group to Cryptinae s.s. As discussed in
the discussion of Ichneumoniformes (above), various other taxa were associated with
this grouping, including Adelognathinae, Agriotypinae, Brachycyrtinae, Claseinae,
Eucerotinae, Microleptinae and Pedunculinae as well as Labeninae in a more distant
relationship.
In terms of the tribes, all analyses recovered the two species of Platylabini together
(Cyclolabus impressus (Provancher) + Linycus exhortator (Fabricius)) and the two species
of Heresiarchini (Coelichneumon eximius (Stephens) + Protichneumon grandis (Brullé))
were also always monophyletic, although the latter pair was always nested within Ich-
neumonini (5 species), as was the single exemplar of Listrodromini (Dilopharius otomitus
(Cresson)). All analyses except parsimony with only morphological characters recovered
Phaeogenini as monophyletic (Stenodontus sp. nov. + (Centeterus euryptychiae (Ashmead)
+ Phaeogenes hebrus (Cresson))), and (Platylabini + Phaeogenini) was sister to all other
species in the total-evidence and molecular-only parsimony analyses (Figs117, 119).
In terms of tribal relationships, Quicke et al. (2009) summarized their ndings by
stating that they found Phaeogenini and Platylabini “in basal positions” within Ich-
neumoninae, although their consensus cladogram with gaps treated as informative had
Platylabini in the middle of Ichneumoninae and their analysis with gaps treated as miss-
ing data had some members of Phaeogenini separated from the rest and nested within a
clade comprised predominantly of Ichneumonini species. More recently, the maximum
likelihood total-evidence analysis of Santos (2017) found that all ve species of Phaeo-
genini clustered together as sister group to the other eight Ichneumoninae species, but
this same analysis did not recover a monophyletic Platylabini. We accept the hypothesis
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)101
supported by the majority of our analyses, that Phaeogenini and Platylabini are sister
groups and these two groups form a sister group to the rest of Ichneumoninae except for
Alomyini. We do concede that our low taxon sampling may be presenting a simplied
view that may not be supported by future studies with additional taxa.
With respect to monophyly and relationships of the other tribes of Ichneumoni-
nae, none of the studies of Laurenne et al. (2006), Quicke et al. (2009), Santos (2017)
or our analyses have found support for Heresiarchini relative to Ichneumonini. We
did not include any of the morphologically distinct Callajoppa group (Sime and Wahl
2002), which would need to be done to study the relationships of Heresiarchini and
Ichneumonini further. Sime and Wahl (2002), using morphology alone, recovered
Heresiarchini as monophyletic, but only included one non-heresiarchine as an out-
group (Ichneumon caliginosus Cresson), therefore it could not draw conclusions regard-
ing the monophyly of Heresiarchini relative to Ichneumonini as a whole. In summary,
it appears as though more taxa, characters and knowledge of biology will need to be
assessed to determine the internal structure of Ichneumoninae.
Labeninae
Labeninae was monophyletic in all analyses except parsimony using only morphology
(Table 3). In the total-evidence parsimony analysis, Labeninae was strongly supported
by 52 synapomorphies, of which 8 were morphological (none uniquely derived) and
a Bremer support value of greater than 10 steps (part 3 of Fig. 117). Labeninae was
sister to Brachycyrtinae (Bremer support of 10) and these two subfamilies were sister
to (Claseinae + Pedunculinae) (Bremer support of 8). Together these four subfamilies
were sister group to all other taxa within Ichneumoniformes s.l. In contrast, neither of
the Bayesian analyses recovered a sister-group pairing of Brachycyrtinae and Labeninae
but rather, Labeninae was sister group to a clade comprised of the remaining exemplars
of Icheumoniformes s.l. + Pimpliformes (part 2 of Fig. 120, part 2 of Fig. 121). ere
was low support for this relationship in the total-evidence Bayesian tree (BPP = 66),
but strong support in the molecular-only analysis (BPP = 99).
Some previous studies have suggested that Labeninae may be sister group to all
ichneumonids except Xoridinae, for example, most analyses in Quicke et al. 2009, the
unweighted parsimony analysis of Santos (2017) and two of ve anchored enrichment
analyses in Klopfstein et al. (2019). is placement was not supported by the current
results. e latter study found a lack of stability in the placement of Labeninae, for ex-
ample, their maximum likelihood analysis with amino acids placed Labeninae as sister
to Ichneumoniformes s.l. + Pimpliformes, whereas the likelihood analysis analyzing
all nucleotides placed Labeninae as sister to Pimpliformes. In terms of the relationship
of Labeninae to Brachycyrtinae, Claseinae and Pedunculinae, Quicke et al. (2009)
generally recovered the latter three subfamilies as monophyletic but as sister group to
the rest of Ichneumoniformes, not Labeninae. is was similar to the maximum likeli-
hood analysis of Santos (2017) who found Labeninae + (Claseinae + (Eucerotinae +
Brachycyrtinae)) + (the rest of Ichneumoniformes). Note that both Santos (2017) and
Klopfstein et al. (2019) only included one species of Labeninae in their analyses. In
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
102
summary, with respect to the placement of Labeninae, the current study either found
that Labeninae is part of the sister group to Ichneumoniformes s.l. (with Brachcyrti-
nae, Claseinae and Pedunculinae) or as sister group by itself to a clade comprising Ich-
neumoniformes s.l. + Pimpliformes. Based on the equivocal placement of Labeninae
in the current study, including apparent strong support as sister to Brachycyrtinae in
the total-evidence parsimony analysis, we do not currently recognize the higher group
Labeniformes of Quicke et al. (2009).
With respect to tribal relationships within Labeninae, our analysis only included
exemplars of three tribes (no Xenothyrini exemplars). In the consensus tree of the
total-evidence parsimony analysis, the tribes Labenini (Labena grallator (Say) + Ape-
choneura sp.), Orthognathelini (= Groteini) (Grotea anguina Cresson + Labium sp.)
and Poecilocryptini (Poecilocryptus nigromaculatus) had equivocal relationships (part 3
of Fig. 117). e Bayesian analyses both supported the following topology: (Orthog-
nathelini + (Poecilocryptini + Labenini)) which is ths same as the hypothesis of Gauld
and Wahl (2000). is topology contradicts the relationships hypothesized by Wahl
(1993a) and Quicke et al. (2009): Poecilocryptini + (Orthognathelini + Labenini).
Lycorininae
e placement of Lycorininae (Lycorina glaucomata) was one of the least stable of any
taxon in our analyses. e total-evidence parsimony analysis placed L. glaucomata
within the clade of Ctenopelmatinae and relatives as sister to Hybrizontinae (see sec-
tion on Hybrizontinae for details on support). In the parsimony analysis with only
molecular characters, L. glaucomata was sister to the rest of Ichneumonidae (part 1 of
Fig. 119), and in the two Bayesian analyses it was placed within a grade along with
Neorhacodes enslini (Neorhacodinae) and various exemplars of Tryphoninae (part 1 of
Fig. 120, part 1 of Fig. 121).
Quicke et al. (2009) also found inconsistent placement of Lycorininae, including:
1) sister group to Hybrizontinae; 2) grouping with Townesion Kasparyan (Banchinae:
Glyptini), and with these two taxa as sister group to the rest of Banchinae; and 3)
grouping with Tersilochinae s.l. as sister group to Banchinae. ey dismissed the as-
sociation of Lycorininae with Hybrizontinae as “long-branch attraction”, but did point
to the presence of an aulaciform rod of the ovipositor (see Quicke et al. 1994) as evi-
dence that Lycorininae belong to Ophioniformes.
What is known of the biology of Lycorina is that they are koinobionts (Corona-
do-Rivera et al. 2004) that oviposit in the anus of Lepidoptera larvae and complete
development externally on the host and pupate inside the host cocoon (Shaw 2004)
(our character 138(2)). e egg of Lycorina is stalked with an anchor, similar to most
Tryphoninae, but Coronado-Rivera et al. (2004) note three dierences between the
eggs and method of oviposition. First, lycorinine eggs are much narrower than eggs of
Tryphoninae (0.3 mm average width (for 10 species in 5 tribes) versus 0.1 mm for two
species of Lycorina. Second, during oviposition, the stalk and/or anchor of almost all
tryphonine eggs travel down the ovipositor while the body of the egg exits the female
from the genital opening at the base of the ovipositor (character 136(1)). is process
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)103
was not witnessed in Lycorininae (Shaw 2004), and it is therefore likely that the entire
egg travels down the ovipositor (character 136(0)). ird, the eggs of Tryphoninae
have a more strongly sclerotized chorion than Lycorininae. Whereas our two Bayesian
analyses placed L. glaucomata near Tryphoninae, Lycorininae was never nested within
Tryphoninae, which agrees with the ndings of Quicke et al. (2009). e current study
and Quicke et al. (2009) therefore support the hypothesis that the stalked eggs of Ly-
corininae and Tryphoninae have evolved independently.
In summary, the majority of our analyses agreed with Quicke et al. (2009) that
Lycorininae is related to Ophioniformes. Our total-evidence parsimony analysis sug-
gested a relationship with Ctenopelmatinae, whereas Townes (1970b) and Quicke et
al. (2009) support a relationship with Banchinae.
Mesochorinae
e ve species of Mesochorinae only clustered together in the morphology-only par-
simony analysis (part 3 of Fig. 118) based on 15 synapomorphies, of which one was
uniquely derived: character 140(9): oviposition into host inside host (i.e., internal hy-
perparasitoid). In both Bayesian analyses and the total-evidence parsimony analysis,
only four of the ve mesochorine species clustered together, with Chineater masneri
consistently paired with Scolomus sp. (Metopiinae) and associated with Tatogaster nigra
(Tatogastrinae) and various ctenopelmatine species. Chineater masneri has not been
included in a phylogenetic analysis since the morphological analysis of Wahl (1993b)
when it was described, but the latter study included a generalized outgroup, thus forc-
ing monophyly of Mesochorinae (including C. masneri). e current study suggests
that it may be misplaced in Mesochorinae.
Chineater masneri does have a large, rhombic areolet (character 54(1)) (Fig. 52),
which is characteristic of most mesochorines (although obliquely quadrangular in Ci-
daphus paniscoides (Ashmead)). A large, rhombic areolet is rare in Ctenopelmatinae
(generally the areolet is obliquely quadrangular or open). e ovipositor of C. masneri
is thin and needle-like (character 99(2)) (Fig. 85) as in all mesochorines, but it is rela-
tively short for a mesochorine. Most ctenopelmatines have a dorsal, subapical notch on
the ovipositor, but a thin, needle-like ovipositor is known in most Pionini (e.g., Rhorus
bartelti) as well as some Perilissini and Ctenopelmatini, therefore this character does not
help in the subfamily placement of C. masneri. As discussed under Ctenopelmatinae,
the apical tooth of the fore tibia (character 68(1)) is not diagnostic of Ctenopelmatinae
by itself and, in fact, this character state is present in all ve of our mesochorine species,
including C. masneri. What may help decide the placement of C. masneri would be
knowledge of either: a) the male gonoforceps – if rod-like (character 102(1)), then this
would support placement in Mesochorinae, or; b) oviposition location – if an internal
hyperparasitoid (character 140(9)), then this would also support the hypothesis that C.
masneri is correctly placed in Mesochorinae. Until one or both of these characters are
known, we defer transfer of Chineater and maintain it within Mesochorinae.
With respect to the four other mesochorine species, the total-evidence parsimony
analysis placed them in a clade with equivocal relationships within Ophioniformes as
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
104
follows: Mesochorinae except Chineater/ Ctenopelmatinae and relatives/ Metopiinae
to Campopleginae (part 4 of Fig. 117). e clade “Mesochorinae except Chineater”
was supported by 45 synapomorphies, of which 9 were morphological, including the
uniquely derived character 140(9): oviposition into a host inside a host. e Bremer
support was 10+ steps. Our Bayesian total-evidence analysis had a similar placement
for the group (Mesochorinae except Chineater): related to a clade containing ((Cten-
opelmatinae and relatives including Metopiinae) + the higher Ophioniformes) (part
1 of Fig. 120). In terms of relationships within Mesochorinae, in the total-evidence
parsimony analysis, Mesochorus sp. was sister to the other three exemplars (Astiph-
romma sp. nov., Cidaphus paniscoides and Lepidura collaris Townes) that had equivocal
relationships. is arrangement contradicts Wahl (1993b) who found that Cidaphus
Förster was sister group to all other genera. e Bayesian total-evidence analysis fa-
voured C. paniscoides as the sister to the other three species, but only with weak support
(BPP = 69).
ere have been some previous studies that suggested that Mesochorinae may ren-
der Ctenopelmatinae paraphyletic (Belshaw and Quicke 2002; Quicke et al. 2009),
but this hypothesis was not supported in any of our ve analyses. Neither was the
hypothesis of Quicke et al. (2009) that Tatogaster nigra Townes (Tatogastrinae) belongs
to Mesochorinae. Owing to the lack of resolution of natural groups within Cten-
opelmatinae, future phylogenetic studies including Ctenopelmatinae, Mesochorinae,
Metopiinae and Tatogastrinae are denitely warranted which will hopefully clarify the
placement of Mesochorinae.
Metopiinae
Similar to Mesochorinae, all four species of Metopiinae only clustered together in the
morphology-only parsimony analysis (part 3 of Fig. 118), supported by 20 synapomor-
phies (none uniquely derived) and a Bremer support of 2. In the other analyses, three
of the four species (Exochus semirufus Cresson, Metopius pollinctorius (Say) and Seticor-
nuta terminalis (Ashmead)) shared a common ancestor with strong support (Table 3),
but Scolomus sp. was placed elsewhere within Ophioniformes. In the total-evidence
parsimony analysis, the three Metopiinae species that clustered together were support-
ed by 46 synapomorphies, including 17 morphological (none uniquely derived), and a
Bremer support of greater than 10 steps (part 6 of Fig. 117). Metopiinae (except Scolo-
mus sp.) was the sister group to (Stilbops vetulus + the unresolved clade (Notostilbops sp.
nov./ Lissonota scutellaris + Exetastes bioculatus/ Glyptini). See sections on Banchinae
and Stilbopinae for further description of these relationships. Together this group-
ing was the sister group to the higher Ophioniformes. In contrast, the total-evidence
Bayesian analysis placed Metopiinae (except Scolomus sp.) in an unresolved clade as
follows: Metopiinae (except Scolomus)/ Ctenopelma sanguineum (Provancher)/ (Tato-
gaster nigra + (Chineater masneri + Scolomus sp.)) and a cluster of six Ctenopelmatinae
(part 1 of Fig. 120). is grouping was, however, very weakly supported (BPP = 71).
Based on the support values of this part of the tree, the Bayesian analysis only tells us
that Metopiinae belongs to Ophioniformes, but not within the higher Ophioniformes.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)105
Gauld and Wahl (2006) suggested that Metopiinae may have arisen from within
Ctenopelmatinae. Our total-evidence parsimony analysis refuted this hypothesis, but
our Bayesian total-evidence analysis had some weak support for the relationship, albeit
with a general lack of resolution in this part of the tree. In summary, the most well-
resolved hypothesis of the placement of Metopiinae from the current study is that it is
related to Stilbopinae and Banchinae, in contrast to the hypothesis of Gauld and Wahl
(2006) and the results of Quicke et al. (2009). Biologically, Metopiinae, Stilbopinae
and Banchinae share parasitism of Lepidoptera (Wahl 1993c) which is much less com-
mon in Ctenopelmatinae – a few Holarctic species of Lathrolestes Förster have been
reared from Eriocraniidae (Heath 1961) and some species of Megaceria Szépligeti in
Australia parasitize Geometridae (Morley 1913) and Notodontidae (Gauld 1984).
In terms of the placement of Scolom us, Gauld and Wahl (2006) synonymized the
metopiine genus Apolophus Townes, 1971 with the ctenopelmatine genus Scolomus
(tribe Pionini) with the name Scolomus Townes & Townes, 1950 having priority. Be-
cause the morphological evidence supporting placement in either subfamily was equiv-
ocal, they placed Scolomus within Metopiinae on the basis of the one host record for
Scolomus: S. borealis (Townes) reared from Schrekensteinia festaliella (Hübner) (Lepi-
doptera: Schrekensteiniidae) (Broad and Shaw 2005). Quicke et al. (2009) stated that
the placement of Scolomus was “associated with various Ctenopelmatinae” and in only
a few analyses was it recovered as sister to Metopiinae. On the basis of all of our analy-
ses except parsimony (morphology-only), the species of Scolomus that we included in
our analysis does not seem to be well-placed with our other exemplars of Metopiinae.
But where is it best placed?
e current total-evidence parsimony analysis placed Scolomus within the Cten-
opelmatinae and relatives grouping (part 5 of Fig. 117) and not closely related to the
other three Metopiinae species. e total-evidence Bayesian analysis was less clear as
Scolomus was placed in a clade that included the three other metopiine species and sev-
en ctenopelmatines (part 1 of Fig. 120), but with low support (BPP = 71). Whereas it
is tempting to suggest that Scolomus should be moved to Ctenopelmatinae on the basis
of the parsimony total-evidence results, the fact that the analyses are placing it next to
several other enigmatic taxa makes this decision dicult, especially with respect to the
decision of which ctenopelmatine tribe it should be placed. It is also possible that the
synonymy of Scolomus and Apolophus by Gauld and Wahl (2006) was not correct. Our
exemplar specimen would have been placed in Apolophus prior to 2006 on the basis of
the lack of horns on the subtegular ridge. Prior to any decision on the subfamily place-
ment of Scolomus, it would be prudent to undertake a revision of the genus (including
description of new species that may be intermediate between S. borealis and S. viridis
Townes & Townes) in order to conrm its monophyly. For now, we delay a decision
on the placement of Scolomus until this work has been completed.
Unfortunately, we were not able to include any other of the problematic genera of
Metopiinae in our analysis: Bremiella Dalla Torre, Ischyrocnemis Holmgren, and Lapton
Nees; therefore we cannot comment on their relatedness to the four exemplar metopi-
ines we analyzed. Quicke et al. (2009) found their placements unstable, but stated that
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
106
Ischyrocnemis was consistently recovered within Pimpliformes, Bremiella sometimes
was a sister group to Metopiinae or associated with various Ctenopelmatinae and Lap-
ton was sometimes recovered with a grouping including Ophioninae, Campopleginae,
Anomaloninae and Mesochorinae.
Microleptinae
Microleptinae (Microleptes sp.) was sister to Ateleute sp. nov. (Ateleutinae) in the par-
simony total-evidence analysis, supported by 37 synapomorphies (7 morphological,
none of which were uniquely derived) and a Bremer support of 6. ese two taxa
were sister group of (Cryptinae + (Phygadeuontinae + (Alomyinae + Ichneumoninae)))
(part 3 of Fig. 117). e Bayesian total-evidence analysis was similar, with Microleptes
sp. in a well-supported clade (BPP = 98) that lacked internal resolution, but included
(Adelognathus sp. + Ateleute sp.) and (Cryptinae + (Phygadeuontinae + (Alomyinae +
Ichneumoninae))) (part 2 of Fig. 120).
Previous studies were equivocal in their placement of Microleptinae. Wahl (1986)
described the larva stating that the reduced hypostomal spur, shape of the stipital scle-
rite and small size of the labial sclerite was similar to the larvae of Metopiinae and
Anomaloninae (Ophioniformes), but stated that these similarities may be convergenc-
es based on similar larval behaviour (spinning imsy cocoons inside the host pupa).
e morphological character analysis in Quicke et al. (2000a) placed Microleptinae
in a clade with Orthocentrinae and Diplazontinae (Pimpliformes) which is consistent
with their biology as endoparasitoids of Diptera larva (Microleptes has been reared from
Stratiomyidae: Wahl 1986). e combined morphology and 28S D2–D3 sequence
analysis of Quicke et al. (2009) suggested that Microleptinae belonged to Ophioni-
formes as sister group to Orthopelmatinae, with these two taxa being the sister group
to either Tersilochinae (gaps treated as missing) or (when gaps treated as informative),
nested within Ctenopelmatinae in a clade as follows: Perilissini + (Oxytorinae + (Seleu-
cini + (Microleptinae + Orthopelmatinae). Conversely, the molecular-only analysis of
Quicke et al. (2009) placed Microleptinae as sister group to Eucerotinae near the base
of the Ichneumoniformes (close to the placement of the current study). Santos (2017)
also recovered Microleptes within Ichneumoniformes, its precise placement dependent
on the method of analysis (parsimony versus maximum likelihood).
Our study provides support for the placement of Microleptinae near the base of
Ichneumoniformes s.l. In terms of morphology, there are no compelling characters for
this placement – the only uniquely derived character in this region of the tree is Char-
acter 9 (state 1): central agellomeres of male with elliptical or longitudinal ridge-like
tyloids which supports Adelognathinae + ((Microleptinae + Ateleutinae) + (Cryptinae
+ (Phygadeuontinae + (Alomyinae + Ichneumoninae)))). is character; however, has
a reversal in Microleptinae + Ateleutinae (part 3 of Fig. 117). e support, therefore,
comes mainly from the molecular characters. Both of our total-evidence analyses and
both of our analyses with only molecular characters supported the monophyly of the
seven subfamilies listed directly above (e.g., BPP of 100 in Bayesian analysis with only
molecular characters) (part 2 of Fig. 121).
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)107
Neorhacodinae
Neorhacodinae (Neorhacodes enslini) was perhaps the most unstable taxon in our analyses.
e total-evidence parsimony analysis placed N. enslini within Tryphoninae (as sister to
Phytodietini) (part 4 of Fig. 117). e parsimony analysis with only molecular characters
placed N. enslini as sister to all Ichneumonidae except Lycorina glaucomata (Lycorininae)
(part 1 of Fig. 119) and the two Bayesian analyses were similar, except that Neorhacodes
enslini was sister to all other Ichneumonidae (part 1 of Fig. 120, part 1 of Fig. 121).
Originally, Ruschka (1922) described Rhacodes Ruschka in its own subfamily in
Braconidae. Hedicke (1922) noted that Rhacodes was preoccupied by the crustacean
Rhacodes Koch and renamed the taxon Neorhacodes Hedicke, changing the subfamily
name to Neorhacodinae. e reason why it was placed within Braconidae is the appar-
ent lack of vein 2m-cu of the fore wing. Roman (1923) using reected light concluded
that vein 2m-cu was present and therefore moved Neorhacodes to Ichneumonidae, plac-
ing it within Pimplinae. Cushman (1940) described a second genus (Romaniella Cush-
man). Townes (1945) listed Neorhacodes under “genera of uncertain subfamily” before
moving it to Banchinae as a tribe (Neorhacodini) (Townes and Townes 1951). Townes
(1971) later raised Neorhacodini to subfamily status “placed between the Lycorininae
and the Banchinae”. More recently, Quicke et al. (2009) found that Neorhacodes enslini
clustered with exemplars of Tersilochinae and the “Phrudus group” of Phrudinae and
subsequently formally synonymized Neorhacodinae (and the Phrudus group) within
Tersilochinae. Finally, Broad (2016) considered Neorhacodinae as a separate subfamily,
rather than a synonym of Tersilochinae.
Given the equivocal placement of Neorhacodes enslini in the current study, we are
not able to make any precise statements with respect to the relationships of Neorhaco-
dinae. ere are no compelling morphological or biological characters in our study that
link Neorhacodinae to Tryphoninae. e egg of Neorhacodinae is not known, and de-
termining whether it bears a stalk or not would help greatly in determining whether the
sister-group relationship of Neorhacodinae and Phytodietini is artefactual or not. e
current study coded the host of Neorhacodinae as Hymenoptera, which is similar to
most Tryphoninae, although Phytodietini are parasitoids of Lepidoptera. Furthermore,
one could argue that coding the hosts for Neorhacodes (aculeate Hymenoptera) (Horst-
mann 1968; Danks 1971) the same state as for most Tryphoninae (sawies) (Kasparyan
1973; Bennett 2015) is not correct and they should be given dierent states for this
character. Similarly, there was no evidence of a close relationship with Neorhacodes and
Banchinae (as proposed by Townes and Townes 1951), Lycorininae (Townes 1971) or
Tersilochinae (Quicke et al. 2009). e most precise statement of anity that we can
make for Neorhacodinae is that it appears to belong incertae sedis within Ophioni-
fromes because N. enslini was most often associated with taxa belonging to Ophioni-
formes, and never clustered within Pimpliformes or Ichneumoniformes in our analyses.
Nesomesochorinae
Nesomesochorinae (Nonnus sp. and Chriodes sp.) was only recovered as monophyletic
in the total-evidence parsimony analysis (part 6 of Fig. 117) (Table 3). It was sup-
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
108
ported by 31 synapomorphies (6 morphological) and a Bremer support of 2. Character
16 (reduction of maxillary palpomeres from 5 to 4) is a relatively rare synapomorphy
in our data set (C.I. = 0.33) and therefore is a good character state supporting the
monophyly of these two taxa. Having said this, the parsimony analysis with only mor-
phological characters did not recover these two taxa together: Chriodes sp. was placed
in the higher Ophioniformes (part 3 of Fig. 118), but the placement of Nonnus sp. was
not clearly resolved (part 1 of Fig. 118). e other three analyses all had Nonnus sp.
and Chriodes sp. clustering near each other along with the exemplars of Anomaloninae
and Ophioninae, although Nonnus sp. and Chriodes sp. were never sister taxa to each
other. In terms of their placement within Ichneumonidae, both total-evidence analyses
placed Nonnus sp. and Chriodes sp. within the higher Ophioniformes (part 6 of Fig.
117; part 1 of Fig. 120) (posterior probability of 98 in the Bayesian tree). e relation-
ships of Nesomesochorinae within the higher Ophioniformes were not precisely clear
in the parsimony total-evidence analysis because this group was unresolved as follows:
Nesomesochorinae/ Anomaloninae + Ophioninae/ Cremastinae + Campopleginae.
Similarly, the Bayesian total-evidence analysis does not help resolve their placement, as
they were placed as follows: (Chriodes sp. + ((Nonnus sp. + Anomaloninae) + Ophioni-
nae)), but this clade only had a posterior probability of 61. All that is suggested by the
Bayesian analysis is that Chriodes sp. and Nonnus sp. do not cluster within Campople-
ginae + Cremastinae because the sister-group relationship of these two subfamilies is
very strongly supported (BPP = 99) (part 1 of Fig. 120).
Nesomesochorini was proposed by Ashmead (1905) to include Nesomesochorus Ash-
mead (= Chriodes). Nonnini was proposed by Townes et al. (1961), comprised of Nonnus.
Townes (1970b) placed Nonnus and Chriodes together in Nonnini within Campoplegi-
nae. Miah and Bhuiya (2001) and later Quicke et al. (2005) showed that these two genera
did not belong to Campopleginae. Quicke et al. (2009) established that they belonged
together in one subfamily with the oldest family group name having priority (Nesomeso-
chorinae). In terms of anity, Quicke et al. (2009) found that Nesomesochorinae be-
longed to the higher Ophioniformes as either sister group of (Cremastinae + Campoplegi-
nae) or sister group of Campopleginae (depending on gap treatment). Our total-evidence
analyses do not refute a sister-group relationship of Nesomesochorinae to (Cremastinae
+ Campopleginae), but the lack of resolution means that other relationships within the
higher Ophioniformes are also possible (e.g., Anomaloninae + Ophioninae). Our results
do not support a sister-group relationship of Nesomesochorinae + Campopleginae.
Ophioninae
Ophioninae (Enicospilus avostigma Hooker, Hellwigia obscura, Ophion sp. Skiapus sp.
and yreodon sp.) was supported in both total-evidence analyses and the parsimony
analysis with only morphological characters (Table 3). e subfamily was supported
in the total-evidence parsimony analysis by 32 characters (8 morphological) and a
Bremer support of 4. Character 37 (state 1): anterior transverse carina of propodeum
forming more or less smooth arc (Fig. 38) was a rare synapomorphy in our study (C.I.
= 0.5). In addition, character 121 (1): larval cardo present as a slightly sclerotized oval
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)109
(Fig.104) and character 128 (1): 8 or more sensilla on larval prelabium, both had C.I.s
of 0.33; however these characters are not known for Hellwigia obscura or Skiapus sp.
e parsimony analysis with only molecular characters supported Ophioninae except
for Skiapus sp., which clustered with the nesomesochorines and Anomalon picticorne.
(Anomaloninae) as the sister group to the other ophionines (part 1 of Fig. 119). e
Bayesian analysis with only molecular characters had all ve ophionines clustering to-
gether, but with a low posterior probability (BPP = 84) (part 1 of Fig. 121).
e monophyly of the majority of the genera of Ophioninae has long been estab-
lished on the basis of the relatively rare (in Ichneumonidae) fore wing areolet lacking
vein Rs so that the only cross vein is distad vein 2m-cu (character 54, state 2) (Fig.53),
along with possession of pectinate claws and presence of hind wing vein 2/Cu (Gauld
1988b). e inclusion of the genera Hellwigia and Skiapus within Ophioninae is more
equivocal. Quicke et al. (2009) found that Hellwigia generally clustered with the other
exemplars of Ophioninae, whereas the position of Skiapus was unstable – sometimes
included within Ophioninae or recovered as the sister taxon to the rest of Ophioninae,
or in a minority of analyses, clustering with Anomalon Panzer and Hybrizontinae. e
majority of our analyses place Skiapus and Hellwigia within Ophioninae (e.g., in the
total-evidence parsimony analysis, Skiapus sp. + Hellwigia obscura are sister group to
the other three exemplars) (part 6 of Fig. 117). Knowledge of the larva of Skiapus and
Hellwigia would provide additional evidence to support or refute this placement.
Orthocentrinae
Orthocentrinae (Megastylus sp. nov., Orthocentrus sp. and Proclitus speciosus Dasch) was
only recovered as monophyletic in the parsimony analysis using only morphological
characters (part 2 of Fig. 118) (Table 3). Orthocentrinae was supported by 18 mor-
phological characters, of which one was uniquely derived: Character 188, state 3: larval
hypostomal-stipital plate reduced to narrow strip (Fig. 106) (this character unknown
for P. speciosus). See the section on Pimpliformes (above) for a description of the rela-
tionships of the orthocentrine species to the rest of Pimpliformes.
Previous denitions of Orthocentrinae have diered depending on whether au-
thors considered Orthocentrus Gravenhorst and relatives (the Orthocentrus group of
genera) to be related to Helictes Haliday and relatives (the Helictes group of genera).
Townes (1971) placed the groups in two separate subfamilies. His Orthocentrinae
was comprised of the Orthocentrus group and his Microleptinae included the Helictes
group, although he stated that his Microleptinae was a “wastebasket” group and later
studies removed several genera to other subfamilies (e.g., Gupta 1988; Wahl 1990).
Wahl (1990), on the basis of larval synapomorphies, joined these two groups together
in an expanded Orthocentrinae and stated that Orthocentrinae was closely related to
Diplazontinae, both of which belonged to the informal grouping Pimpliformes. e
morphological cladistic analysis of Pimpliformes by Wahl and Gauld (1998) supported
the fact that the Orthocentrus and Helictes groups shared a common ancestor which was
sister taxon to Diplazontinae. In addition, their analysis supported that Orthocentri-
nae and Diplazontinae belonged to the following grouping: Acaenitinae + (Diacritinae
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
110
+ (Cylloceriinae + (Orthocentrinae + Diplazontinae))). Quicke et al. (2009) also recov-
ered Orthocentrinae as monophyletic (except they removed Hyperacmus to Cylloceri-
inae). In their study, Orthocentrinae had a placement within Pimpliformes as follows:
(Acaenitinae except for Procinetus + (Cylloceriinae + (Orthocentrinae + (Diplazontinae
+ (Collyriinae + Hyperacmus)))). More recently, Klopfstein et al. (2017) found strong
support for seven species of Orthocentrinae in their anchored enrichment analyses,
although the two species of Hemiphanes Förster did not cluster with the other species
and were subsequently formally transferred to Cryptinae. In the latter study, Ortho-
centrinae was most often sister group to Diacritinae and this pairing was sister group
to Cylloceriinae.
Given the strong support of Orthocentrinae in other studies, it is likely that the
lack of monophyly of Orthocentrinae is artefactual, perhaps because of low taxon sam-
pling and, as discussed by Quicke et al. (2009), relatively high sequence divergence of
the 28S D2–D3 region in Orthocentrinae. Addition of more taxa as well as knowledge
of larvae including Proclitus spp. would help to determine whether Orthocentrinae is
monophyletic as well as its relationships within Pimpliformes. In terms of internal rela-
tionships within Orthocentrinae, Wahl and Gauld (1998) found that the Orthocentrus
group was nested within the Helictes group as follows: Aperileptus Förster + ((Entypoma
Förster + Orthocentrus group) + (all other Helictes group genera)). None of our results
supported a sister-group relationship of the Orthocentrus and Helictes groups (i.e., Or-
thocentrus sp. + (Megastylus sp. nov. + Proclitus speciosus). When two orthocentrine
species clustered together, it was either Orthocentrus sp. + Megastylus sp. nov. (part 2 of
Fig. 117) or Orthocentrus sp. + Proclitus speciosus (e.g., part 2 of Fig. 118).
Orthopelmatinae
e total-evidence parsimony analysis placed Orthopelmatinae as sister group to all
other Ichneumonidae except the exemplars of Xoridinae (part 1 of Fig. 117). In the
Bayesian total evidence analysis, Orthopelmatinae was sister group to Xoridinae + (La-
beninae + (all exemplars of Ichneumoniformes and Pimpliformes)) (part 2 of Fig. 120).
Previous analyses have had trouble discerning the precise relationships of Orthopel-
matinae. Barron (1977) suggested that it was the sister group to Cryptinae, and in turn
these two taxa were sister group to Ichneumoninae. Gauld et al. (1997) placed Or-
thopelmatinae in his Labeniformes, which also included Xoridinae, Labeninae, Agrio-
typinae, Brachycyrtinae, Cryptinae and Ichneumoninae. Quicke et al. (2000a) using
morphological and 28S D2 ribosomal DNA found Orthopelmatinae to be sister group
of Ophioniformes, but with no morphological synapomorphies supporting this rela-
tionship, and they therefore proposed the informal higher group Orthopelmatiformes
for the subfamily. e placement of Orthopelmatinae in Quicke et al. (2009) was un-
stable as the two combined cladograms placed it with Microleptinae and Oxytorinae
either within Ctenopelmatinae (gaps treated as informative) or within Tersilochinae
(gaps treated as missing). Quicke et al. (2009) also stated that the sister-group relation-
ship of Orthopelmatinae and Ophioniformes was recovered “with many parameter
combinations”. Finally, their analysis with only morphological characters found the
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)111
following: (Oxytorinae + (Microleptinae + Orthopelmatinae) + (Neorhacodinae + Ter-
silochinae))) and this clade was sister group to the remainder of Ophioniformes. In
summary, Quicke et al. (2009) suggested that Orthopelmatinae was either sister taxon
to Ophioniformes or placed somewhat “basally” within Ophioniformes. eir sum-
mary table maintained Orthopelmatinae by itself within Orthopelmatiformes.
None of our analyses recovered a sister-group relationship of Orthopelmatinae and
Ophioniformes, although it is noted that moving O. mediator as sister to Ophioniformes
only lengthened the total-evidence parsimony tree by 9 steps (9926). e parsimony
analysis with only morphological characters (part 3 of Fig. 118) found a relationship
as follows: Orthopelma mediator + (Phrudus sp. + (Allophrys divaricata Horstmann +
(Stethantyx nearctica Townes + Tersilochus sp.))). It was supported by 15 morphological
characters of which 1 was relatively strong: character 28 (state 1): foveate groove of mes-
opleuron present (C.I. = 0.33) (Fig. 29). is character is one of the important diagnos-
tic characters for Tersilochinae sensu stricto (Tersilochinae of Townes 1971); however
it is also present in some of the Phrudus group (synonymized with Tersilochinae from
Phrudinae by Quicke et al. 2009), as well as sporadically found in other taxa, includ-
ing Orthopelma mediator (but not all species of Orthopelma) (Barron 1977). Biologi-
cally, Tersilochinae are koinobiont endoparasitoids most often associated with beetles
(Khalaim and Broad 2013), but have also been reared from Xyelidae (Hymenoptera)
(Khalaim and Blank 2011) and Eriocraniidae (Lepidoptera) (Jordan 1998). Consider-
ing the dierences between the hosts of Tersilochinae and Orthopelmatinae (endopara-
sitoids of cynipid gall wasps) (Blair 1945), as well as the fact that the foveate groove is
not present in all Orthopelma spp., it is likely that the relationship postulated between
O. mediator and these exemplars of Tersilochinae is artefactual. Similarly, none of our
results indicated a close relationship of Orthopelmatinae with Cryptinae or Ichneu-
moninae as postulated by Barron (1977). e placement of O. mediator as sister group
to all ichneumonids except the exemplars of Xoridinae (part 1 of Fig. 117) or related to
Ichneumoniformes s.l. + Pimpliformes (part 2 of Figs 120, 121) was not expected. In
terms of whether to recognize the higher group Orthopelmatiformes, despite ambiguity
in its precise relationships, both of our total-evidence analyses found Orthopelmatinae
to be sister group to a large number of other subfamilies, therefore maintainence of the
higher group Orthopelmatiformes seems valid, at least until such time that more cor-
roborated evidence is found to place Orthopelmatinae more precisely.
Oxytorinae
Our analyses generally placed Oxytorinae (Oxytorus albopleuralis) with exemplars of
Ophioniformes; however, its placement within this group changed depending on the
analysis. In our total-evidence parsimony analysis, Oxytorinae clustered within a clade
comprised of all 14 Ctenopelmatinae species as well as Hybrizontinae, Lycorininae,
Tatogastrinae, Chineater masneri (Mesochorinae) and Scolomus sp. (Metopiinae) (part
5 of Fig. 117). See the discussion on Ctenopelmatinae (above) for supporting char-
acters for this clade. In the total-evidence Bayesian analysis, Oxytorinae was placed
unresolved in a large clade with exemplars of Ctenopelmatinae, Hybrizontinae, Meso-
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
112
chorinae, Metopiinae, Tatogastrinae and the higher Ophioniformes; however, the sup-
port for this group was very low (BPP = 53) (part 1 of Fig. 120).
Prior to Townes (1971), Oxytorus Förster was considered to be related to genera
now classied within Ctenopelmatinae (e.g., within the Mesoleptini of Ashmead 1900).
Townes (1971) placed it provisionally in his Microleptinae (questioning whether it be-
longed there), and Wahl (1990) proposed that it should be placed in its own subfamily
because of the lack of characters linking it with other ichneumonid subfamilies. e
larva and host are not known, but Wahl (1990) commented that H.K. Townes believed
that its notched ovipositor suggested it is probably an endoparasitoid. Gauld et al.
(1997) included Oxytorinae in their unplaced subfamilies. Molecular studies have con-
sistently placed Oxytorinae within Ophioniformes. Belshaw and Quicke (2002) using
the 28S D2–D3 region and a limited taxon sampling found Oxytorus sp. was sister to
Banchus volutatorius (Linnaeus) (Banchinae) and related to exemplars of Tryphoninae,
Lycorininae and Orthopelmatinae. Quicke et al. (2009) generally recovered Oxytori-
nae within Ophioniformes, related to Banchinae, Ctenopelmatinae, Metopiinae, Ne-
orhacodinae, Stilbopinae, Tersilochinae and Tryphoninae. For example, their combined
analysis with gaps treated as missing placed Oxytorinae as sister group to (Tersilochinae
+ (Microleptinae + Orthopelmatinae)) and more distantly related to Ctenopelmatinae,
Tatogastrinae, Mesochorinae and Metopiinae). Our results agree with the placement of
Oxytorus within Ophioniformes and likely most closely related to Ctenopelmatinae. A
more precise placement of Oxytorinae can only be determined by a more comprehen-
sive study of the relationships of Ctenopelmatinae and its relatives.
Pedunculinae
Pedunculinae (Pedunculus sp. nov.) was strongly supported as sister group to Claseinae
(Clasis sp. nov.) in all analyses except the parsimony analysis with only morphological
characters in which its relationships were unclear. In both total-evidence analyses, these
two subfamilies were placed near the base of Ichneumoniformes s.l. See the sections on
Brachycyrtinae, Claseinae and Labeninae (above) for discussion of support of this node
and further relationships of Pedunculinae.
Townes (1969) described Pedunculus, placing it within Brachycyrtini (Labeninae).
Wahl (1993a) raised Brachycyrtini (including Pedunculus) to subfamily status. Porter
(1998) removed Pedunculus to its own subfamily and later, Gauld et al. (2000) included
Adelphion Townes and Monganella Gauld in Pedunculinae. Pedunculinae appear to be
supported by presence of a smooth posterior face of the hind tibia (Fig. 69), although
this condition has evolved independently in other taxa including Microleptes (Microlep-
tinae), some Phygadeuontinae (e.g., Cisaris Townes) and some Ctenopelmatinae. Quicke
et al. (2009) found that Pedunculinae was sister group to Brachycyrtinae and these two
subfamilies were sister group to Claseinae in most of their analyses. As was noted in the
discussion of Claseinae, most of our analyses supported a relationship of (Pedunculus sp.
nov. + Clasis sp. nov.) with Brachycyrtus wardae, and sometimes these three taxa grouped
with Labeninae, but we maintain the subfamily status of all four because of dierences in
their relationships depending on the characters used and the method of analysis.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)113
Phygadeuontinae
As discussed above in the section on Cryptinae, Phygadeuontinae (Acrolyta sp., Endasys
patulus and Mastrus sp.) was supported in both total-evidence analyses (part 3 of Fig.
117, part 2 of Fig. 120), but only moderately so, and was not supported in any other
analyses. When supported, it was the sister group of (Alomyinae + Ichneumoninae).
e only morphological character supporting this grouping in the total-evidence par-
simony analysis was character 53, state 0: fore wing vein 2m-cu with two bullae (C.I. =
0.07) (Fig. 50) and the Bremer support was only 2 steps, but this sister-group relation-
ship was unequivocally supported in the Bayesian total-evidence analysis (BPP = 100).
Our total-evidence analyses results, albeit with very limited sampling, concur
with that of Santos (2017) that Phygadeuontinae (previously Phygadeuontini) is not
a tribe within Cryptinae. We did not include specimens of Hemigaster, which Santos
(2017) moved from Cryptinae (Hemigastrini) to Phygadeuontini, nor did we include
specimens of Helcostizus Förster which Broad (2016) moved from Phygadeuontini to
Cryptini. Whether Phygadeuontinae is monophyletic or needs to be further divided
into smaller, natural groups will require future analyses with more taxa. Our analysis
certainly concurs with Santos (2017) that Phygadeuontinae is closely related to Cryp-
tinae, Ateleutinae and Ichneumoninae.
Pimplinae
e seven species of Pimplinae (Perithous divinator, Acrotaphus wiltii (Cresson), Clistopy-
ga recurva (Say), Dolichomitus irritator (Fabricius), Zaglyptus pictilis Townes, Pimpla an-
nulipes Brullé and eronia bicincta) never clustered together with unequivocal support
in any of our analyses (Table 3); although the total-evidence Bayesian analysis did have
moderate support for the monophyly of the subfamily (BPP = 93) (part 2 of Fig.120).
In the total-evidence parsimony analysis, six of the seven species grouped together, the
exception being Pimpla annulipes (Pimplini), which was part of an unresolved clade
including Rhyssinae, Poemeniinae, and the six other species of Pimplinae (part 2 of
Fig.117). Examination of the 1728 equally parsimonious cladograms found that P. an-
nulipes was either sister taxon to the rest of the higher Pimpliformes (33% of trees) or sis-
ter taxon to Rhyssinae (67% of trees). Moving P. annulipes so that it was sister species to
the other six species of Pimplinae resulted in an increase in tree length of only three steps
(9920). Both analyses using only molecular characters recovered a polyphyletic Pimpli-
nae (part 2 of Figs 119, 121). Finally, the parsimony analysis with only morphological
characters recovered the higher Pimpliformes, but the relationships among the Pimpli-
nae species were equivocal (only Pimpla and eronia were sister species in all trees) (part
1 of Fig. 118). Examination of the individual equally parsimonious trees found that
Pimplinae was monophyletic in 87 % of the 3872 trees, as opposed to 13% that had D.
irritator as sister taxon to Rhyssinae, the latter topology supported by characters associ-
ated with parasitism of wood-boring hosts, e.g., character 96(2): ovipositor longer than
length of metasoma and character 140(1): oviposition through lignied tissue.
Historically, Pimplinae in the broad sense (i.e., including related taxa such as Po-
emeniinae and Rhyssinae) was one of the ve traditional subfamilies of Ichneumonidae
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
114
(Holmgren 1857). e morphology-based classication of Townes (1969) used a tribal
classication within Pimplinae (his “Ephialtinae”) to attempt to dene natural groups.
Some of these tribes were later raised to subfamily status (e.g., Diacritinae, Poeme-
niinae, Rhyssinae) (Eggleton 1989, Gauld 1991). More recent morphological phylo-
genetic studies analyzed the relationships within Pimplinae (Wahl and Gauld 1998,
Gauld etal. 2002b). Both of these studies provided strong support for the monophyly
of Pimplinae. In contrast, recent molecular studies have found varied levels of sup-
port for Pimplinae. Belshaw et al. (1998) using a limited taxon sampling of Pimplinae
never recovered the subfamily as monophyletic. e study of Quicke et al. (2009) does
not explicitly comment on the monophyly of Pimplinae in their analyses with only
molecular characters, but they do present data on the monophyly of Pimplini with
diering gap extension and opening costs, and the majority of these molecular analyses
did not recover Pimplini as monophyletic. Finally, the study of Klopfstein etal. (2019)
had varied results. eir transcriptome analysis with ve species of Pimplinae using
amino acids recovered Pimplinae, but the similar analysis with nucleotides did not.
In addition, none of their hybrid enrichment analyses recovered Pimplinae because
Xanthopimpla varimaculata Cameron never clustered with all of the other 24 pimpline
exemplars. eir three hybrid enrichment analyses with amino acids did recover the
other 24 exemplars as monophyletic but the two analyses with nucleotides did not.
Klopfstein et al. (2019) speculated that the placement of Xanthopimpla in their analyses
may be because of a long branch of their exemplar species, or it may indicate an actual
relationship requiring formal recognition of a new tribe or subfamily. In terms of for-
mal changes in Pimplinae, Klopfstein et al. (2019) resurrected eroniini, comprised
of the eronia group of genera, which did not generally cluster with Pimplini. In
summary, most previous morphological analyses have supported Pimplinae, although
the current analysis is equivocal. In contrast, most molecular analyses have not found
strong support for Pimplinae, regardless of the genes used or the method of analysis.
With respect to the placement of Pimplinae in the current study, when there was
some support for the family (in 87% of the trees in the morphology-only parsimony
analysis and the Bayesian total-evidence analysis with BPP = 93), Pimplinae was sister
to (Poemeniinae + Rhyssinae). is is the same as the relationship postulated by the
morphological analysis of Wahl and Gauld (1998), the combined morphology and
molecular analysis of Quicke et al. (2009) and all analyses using amino acids in Klopf-
stein et al. (2019).
Concerning tribal monophyly and their relationships, the following previous hy-
potheses have been postulated:
1) (Delomeristini (not including Perithous Holmgren) + (Ephialtini + (Perithous +
Pimplini including the eronia group)) (morphological parsimony analysis of
Wahl and Gauld 1998);
2) (Pimplini + (Delomeristini including Perithous) + Ephialtini)) (morphological par-
simony analysis of Gauld et al. 2002b);
3) (Delomeristini (including Perithous) + (Pimplini + Ephialtini)) (combined mor-
phological and molecular parsimony analysis of Quicke et al. 2009);
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)115
4) (Delomeristini (including Perithous and Pseudorhyssa) + eroniini) + (Pimplini
+ Ephialtini), with Xanthopimpla clustering outside Pimplinae) (anchored enrich-
ment analysis using amino acids of Klopfstein et al. 2019).
e current study supported monophyly of Ephialtini in all studies except parsi-
mony with only morphological data. For example, the Bayesian total-evidence analysis
had the following topology: (Perithous divinator + eronia bicinta) + (Pimpla annuli-
pes + (Dolichomitus irritans + (Acrotaphus wiltii/ Clistopyga recurva/ Zaglyptus pictilis))).
(part 2 of Fig. 120). e latter four species comprise Ephialtini and the support for this
tribe was unequivocal (BPP = 100). e total-evidence parsimony analysis was similar
but more resolved: (D. irritator + (Z. pictilis + (A. wiltii + C. recurva))) with 13 syna-
pomorphies and a Bremer support of 5 steps (part 2 of Fig. 117). Relative to the four
previous hypotheses of relationships listed above, the current Bayesian total evidence
analysis supported the relationships of Klopfstein et al. (2019) in that eronia bicincta
(eroniini) was sister to Perithous divinator (Delomeristini), not sister to Pimpla an-
nulipes (Pimplini).
Poemeniinae
Poemeniinae (Neoxorides caryae (Harrington) and Poemenia albipes) was supported un-
equivocally in all analyses except the Bayesian analysis using only molecular characters
(Table 3), and even the latter analysis still had moderate support with a posterior prob-
ability of 94 (part 2 of Fig. 121). e subfamily was supported by 26 synapomorphies
(9 morphological) in the total-evidence parsimony analysis with a Bremer support of 5
steps (part 2 of Fig. 117). One of the morphological characters was uniquely derived:
character 15(1): foramen magnum laterally expanded.
In terms of relationships, there was strong support for Poemeniinae being the sis-
ter group to Rhyssinae (e.g., Bayesian total-evidence, BPP = 99) (part 2 of Fig. 120).
e parsimony total-evidence analysis did not contradict this grouping, although the
strict consensus was unresolved in this part of the tree with the following clade with
equivocal relationships: Poemeniinae/ Pimpla annulipes/ Rhyssinae/ other Pimplinae
(part 2 of Fig. 117). irty-three percent of the shortest trees recovered Poemenii-
nae + Rhyssinae. Furthermore, most analyses placed Poemeniinae within the higher
Pimpliformes (e.g., Bayesian total-evidence had a posterior probability of 98 for this
grouping). See discussion of Pimpliformes (above) for support of this grouping in the
parsimony total-evidence analysis.
Historically, Poemenia Holmgren was placed within the traditional “Pimplinae” of
early authors, e.g., Holmgren (1860). Townes (1969) considered Poemenia and rela-
tives as a tribe within Ephialtinae (= Pimplinae), and it was only with the study of
Gauld (1991) based on the thesis of Eggleton (1989) that the group was raised to
subfamily status. Wahl and Gauld (1998) conrmed the subfamily status within Pim-
pliformes with a phylogenetic analysis of morphological characters that found the fol-
lowing relationship: Pimplinae + (Rhyssinae + Poemeniinae). ey also dened three
tribes: Pseudorhyssini comprised of Pseudorhyssa, Rodrigamini comprised of Rodri-
gama Gauld and Poemeniini comprised of all other genera. e current study was only
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
116
able to include species of Poemeniini. Quicke et al. (2009) included exemplars of all
three tribes. eir morphological analysis hypothesized that Pseudorhyssa belonged to
Pimplinae, not Poemeniinae, a placement that was previously suggested (e.g., Townes
1969). In contrast, the combined morphology and sequence analyses of Quicke et
al. (2009) had equivocal placement for Pseudorhyssa, including related to Pimplinae,
Rhyssinae, or Poemeniinae, as sister to (Rodrigamini + Poemeniini)). ey left Pseudo-
rhyssa as unplaced in their summary table.
More recently, Pseudorhyssa clustered within Pimplinae in all of the full-data-set
analyses of Klopfstein et al. (2019) which led them to formally move the genus back
to Pimplinae. Since the current analysis did not include Pseudorhyssa or Rodrigama, we
cannot comment on these taxa, but we can state that there was strong support for the
monophyly of Poemeniini and for the relationship of Poemeniini (at least) to Rhyssinae.
Rhyssinae
Similar to Poemeniinae, Rhyssinae (Megarhyssa greenei Viereck, Rhyssa crevieri
(Provancher) and Rhyssella nitida (Cresson) was well-supported – it was unequivocally
monophyletic in all of our analyses (Table 3). In the total-evidence parsimony analysis,
Rhyssinae was supported by 56 synapomorphies including 13 morphological, of which
two were uniquely derived: character 92, state 1: apical segment of female metasoma
elongate with a horn or boss (Fig. 82); and character 93 state 1: posterior sternites of
female metasoma with tuberculate ovipositor guides (Fig. 84). e Bremer support
was greater than 10 steps. Rhyssinae is likely the most well-supported subfamily within
Ichneumonidae. All of our analyses placed Rhyssinae within the higher Pimpliformes
(with Poemeniinae and Pimplinae) and when there was resolution within this group,
the sister group for Rhyssinae was Poemeniinae (e.g., part 1 of Fig. 120).
As described above for Poemeniinae, Rhyssa Gravenhorst and its relatives were
also historically placed in the traditional Pimplinae (Holmgren 1860) (= equals our
higher Pimpliformes). Phylogenetic studies have conrmed this placement (Wahl
and Gauld 1998; Quicke et al. 2009, Klopfstein et al. 2019, and most analyses in
the current study). Based on the strength of evidence supporting the higher Pim-
pliformes, it could be argued that a reversion to a previous concept of Pimplinae
is warranted (including poemeniines and rhyssines). Considering that the limits of
Poemeniinae were just changed by the removal of Pseudorhyssa and the fact that we
were not able to include Rodrigama in our analysis, we believe this move would be
premature. Maintainence of these taxa in three subfamilies is more prudent until
additional studies are able to conrm the current denitions and relationships of all
groups within higher Pimpliformes.
Sisyrostolinae
Sisyrostolinae (Brachyscleroma sp. and Erythrodolius calamitosus Seyrig) was not recov-
ered as monophyletic in any of our analyses (Table 3). Having said this, these two
species often clustered in close proximity to each other along with exemplars of Ter-
silochinae. For example, in the total-evidence parsimony analysis, all ve tersilochine
species, together with the two sisyrostoline species formed a clade that was supported
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)117
by 20 synapomorphies (of which 4 were morphological), with a Bremer support of 2
(part 4 of Fig. 117). Two of these characters had a relatively high consistency index:
character 109, state 1: larval mandible conical and with small, apical tooth (CI = 0.80)
(Fig. 111), and character 139, state 3: Coleoptera host (CI = 0.27). Similarly, these
seven species clustered together in the total-evidence Bayesian analysis, but with a low
support value (BPP = 78) (part 1 of Fig. 120). e larvae of both Brachyscleroma Cush-
man and Erythrodolius Seyrig are unknown, as is the host of Erythrodolius.
e genera to which our two exemplars of Sisyrostolinae belong were, until re-
cently, included in the subfamily Phrudinae (e.g., Townes 1971; Gauld et al. 1997).
e relatedness of Tersilochinae and Phrudinae was implied by their placement next
to each other in Townes (1971). e latter author did; however, express doubt re-
garding the monophyly of Phrudinae, and Gupta (1994) in his revision of Brachy-
scleroma stated “e Phrudinae contains a heterogenous assemblage of genera which
are certainly not related.” Conversely, Gauld et al. (1997) stated with respect to the
small, temperate genera (i.e., the Phrudus group of genera) and the large, mostly
Afrotropical Erythrodolius group of genera that they were “correctly associated” with
each other. e latter study cited “the peculiarly narrow proboscidial fossa” as an
autapomorphy of Phrudinae.
More recent phylogenetic studies investigated the monophyly of Phrudinae.
Quicke et al. (2009) included 12 phrudine exemplars. In all their analyses, three Eryth-
rodolius species clustered with their other two members of the Erythrodolius group
(Melanodolius sp. and Icariomimus sp.) and the sister taxon of this group was Brachyscl-
eroma sp. e relationship of this clade to the Phrudus group; however, was equivocal.
In their combined analysis with gaps treated as missing, the Phrudus group was mono-
phyletic and clustered with Tersilochinae, whereas (Brachyscleroma sp. + the Erythro-
dolius group) was placed separate to Tersilochinae (near Tryphoninae). In contrast, in
their combined analysis with gaps treated as informative, exemplars of two genera of
the Phrudus group (Phrudus Förster and Astrenis Förster) were sister group to Brachy-
scleroma sp. + the Erythrodolius group). Whereas these are only two of many analyses
that Quicke et al. (2009) performed, it illustrates the fact that there may (or may not)
be a relationship between the Erythrodolius group + Brachyscleroma and at least some
of the Phrudus group. Despite this ambiguity, Quicke et al. (2009) formally divided
the Phrudinae of Townes (1971), placing all of the Phrudus group within Tersilochinae
and resurrecting Brachyscleromatinae Townes to accommodate Brachyscleroma and the
Erythrodolius group as well as the Oriental and Eastern Palaearctic Lygurus Kasparyan.
Since that time, Sheng and Sun (2011) described another genus in this group: Laxiare-
ola Sheng & Sun from the Oriental region. Bennett et al. (2013) noted the priority of
the name Sisyrostolinae for this higher group. Quicke et al. (2009) provided a diagno-
sis for Sisyrostolinae as follows: 1) sternites mostly sclerotized and laterotergites large;
2) scape cylindrical (rather long and narrow); 3) proboscidial fossa strongly narrowed;
4) ovipositor lacking notch; 5) hind wing vein M + Cu long relative to vein 1-M.
Our analyses do not uphold the monophyly of Sisyrostolinae, nor its separate sta-
tus from Tersilochinae (including the Phrudus group). It is likely that the Erythrodolius
group is monophyletic (Melanodolius Saussure and Icariomimus Seyrig are very closely
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
118
related based on morphology, for example, the frons in all three genera bears a lon-
gitudinal ridge, and the latter may even be paraphyletic with respect to Erythrodolius
(Bennett et al. 2013). Whether the Erythrodolius group is only distantly related to
Tersilochinae or nested within Tersilochinae is unclear at present. e sister-group
relationship of Brachyscleroma to the Erythrodolius group was not upheld by this study,
and this needs to be re-examined. Similarly, the relationship of the Phrudus group to
Sisyrostolinae needs to be studied (see Tersilochinae, below). is statement is based
on the fact that all of our analyses and some of Quicke et al. (2009) did not recover a
monophyletic Phrudus group, as well as the fact that some taxa putatively placed with-
in the Phrudus group have never been assessed cladistically (e.g., Notophrudus Porter).
Similarly, Lygurus and Laxiareola have not been sequenced or coded for morphology
to examine where they t. Finally, with respect to the ve diagnostic characters that
Quicke et al. (2009) used to dene Sisyrostolinae, none of them are convincing au-
tapomorphies of the group because all of them also occur in members of the Phrudus
group, for example, most Astrenis spp. have much more sclerotized sternites than any
member of Sisyrostolinae. It should be noted that despite careful examination of many
specimens of the Erythrodolius group, the Phrudus group and the Tersilochinae sensu
stricto, we were unable to code the proboscidial fossa character of Gauld et al. (1997).
Because of the large amount of work still remaining to be done on this part of the tree,
we refrain from making any formal changes at this time. We do, however, concur with
Townes (1971) and Quicke et al. (2009) that Sisyrostolinae belongs to Ophioniformes,
not Pimpliformes (= the traditional Pimplinae) as Seyrig (1932) proposed. Our study
placed them within Ophioniformes, but not within the higher Ophioniformes which
is in accordance with the ndings of Quicke et al. (2009).
Stilbopinae
e two species of Stilbopinae (Stibops vetulus and Notostilbops sp. nov.) were never
sister taxa in any of our analyses (Table 3). Notostilbops sp. nov. clustered with the four
species of Banchinae in all analyses except the parsimony analysis with only morpho-
logical characters and consequently we have formally moved Notostilbops to Banchinae.
See Banchinae section (above) for justication of this taxonomic change.
Tatogastrinae
Tatogastrinae (Tatogastra nigra) was one of the small subfamilies that clustered within
the “Ctenopelmatinae and related subfamilies” clade in the total-evidence parsimony
analysis (part 5 of Fig. 117). It was placed in a clade that lacked internal resolution
as follows: Oxytorinae/ Tatogastrinae/ (Chineater masneri + Scolomus sp.) based on 39
synapomorphies (six of which were morphological) and a Bremer support of 2 steps. It
occupied a similar position in the Bayesian total-evidence analysis (part 1 of Fig. 120),
as sister species to (Chineater masneri + Scolomus sp.) in a very poorly supported group
(posterior probability = 55). See the discussion on Ctenopelmatinae (above) for ad-
ditional discussion of the relationships of Tatogaster to Ctenopelmatinae, Metopiinae
and Hybrizontinae in the Bayesian total evidence analysis.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)119
In terms of previous hypotheses concerning the relationships of Tatogastrinae,
Wahl (1991) performed a morphological phylogenetic analysis and proposed that
Tatogastrinae was the sister group of Ophioninae on the basis of four synapomorphies:
1) fore wing with spurious vein originating at distal end of vein 1A; 2) glymma of T1
absent and T1 enveloping S1; 3) prole of propodeum not angulate; and 4) ovipositor
short, about equal in length to the depth of the metasoma. e current analysis did
not code the spurious vein. It is present in Tatogaster and in our ve ophionine species
including Hellwigia obscura, but apparently absent in Hellwigia elegans Gravenhorst.
e vein also appears to be present in some taxa outside of Ophioninae, especially in
larger-bodied species (e.g., Metopius pollinctorius, Megarhyssa greenei, Netelia sp.), and
therefore it may be related to species size as much as phylogeny. e current analysis
coded the fusion of T1 and S1 (character 81) for Tatogaster as state 1: fused, but suture
visible, compared to Ophioninae as state 2: fused, suture not visible (i.e., character
coded somewhat dierently than in Wahl 1991). In terms of prole of the propodeum
(character 35), the current analysis coded about two thirds of the exemplar taxa as state
1: rounded to attened without separate dorsal and posterior faces and the consistency
index of this character is very low (0.03) with multiple parallelisms and reversals which
makes it dicult to determine its apomorphic state. Ovipositor length (character 96)
has a similarly low consistency index (0.05). Moving Tatogaster nigra as sister group to
Ophioninae increased the tree length to 9955 (+ 38 steps).
e morphological analysis of Quicke et al. (2009) and their combined morphol-
ogy and 28S D2–D3 analysis found Tatogastrinae to be the sister group to Mesochori-
nae with both of these subfamilies related to various tribes of Ctenopelmatinae. In
terms of morphology, the similarly large, rhombic areolet of Tatogastrinae and Meso-
chorinae was noted as a possible synapomorphy of these two taxa although several dif-
ferences were also noted (presence of a dorsal notch in the ovipositor of Tatogastrinae,
lack of a glymma, and lack of rod-like gonoforceps). Moving T. nigra as sister group to
Mesochorinae (except for Chineater masneri) in our analysis increased the tree length
to 9941 (+ 24 steps). In summary, the current analysis found no evidence supporting a
sister-group relationship to Ophioninae or Mesochorinae (except the enigmatic genus
Chineater), but it did suggest a relationship of Tatogastrinae with our exemplars of
Ctenopelmatinae, albeit with weak support.
Tersilochinae
As discussed in Sisyrostolinae (above), the ve species of Tersilochinae sensu lato (Al-
lophrys divaricata, Phrudus sp., Peucobius fulvus Townes, Stethantyx nearctica and Te r -
silochus sp.) did not cluster together in any analyses, except in a grouping that also
included the two species of Sisyrostolinae (in both total-evidence analyses) (Table 3).
See the section on Sisyrostolinae for a discussion of the support for this grouping.
In contrast, the Tersilochinae sensu stricto, which is equivalent to the Tersilochinae
of Townes (1971), is a well-supported group in all analyses (Table 3). For example,
in the total-evidence parsimony analysis, this clade – Stethantyx nearctica + (Allophrys
divaricata + Tersilochus sp.) was supported by 63 characters, 18 of which were mor-
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
120
phological, and a Bremer support of more than 10 steps. Despite the fact that none
of the morphological synapomorphies were uniquely derived, several had a relatively
high consistency index, for example, character 4, state 1: clypeal margin with uniform
fringe of setae (C.I. = 0.25) (similar to Fig. 12); character 16, state 1: maxillary palpus
four-segmented (C.I. = 0.33); and character 64, state 1: basal 0.6 of hind wing vein M
+ Cu spectral (C.I. = 0.33) (Fig. 58).
Our study generally supports a relatively close relationship of the Phrudus group and
Tersilochinae sensu stricto; however, Erythrodolius and Brachyscleroma (Sisyrostolinae)
clustered within this clade as follows: (Phrudus sp. + (Erythrodolius calamitosus + Peuco-
bius fulvus)) + (Brachyscleroma sp. + Tersilochinae sensu stricto) (e.g., part 4 of Fig, 117,
part 1 of Fig. 120). More work is needed to determine whether Tersilochinae sensu lato
needs to be broadened to include some or all of the genera currently placed in Sisyros-
tolinae. Paramount in these studies is increased knowledge of the larva in this clade. e
current study reports the rst larval description of the Phrudus group of genera (Appen-
dix 1) including a putative synapomorphy for the Phrudus group and Tersilochinae sensu
stricto: character 109, state 1: larval mandible cone-shaped with small, apical tooth (C.I.
= 0.8) (Fig. 111). Examination of the larva of other Phrudus group specimens and Sisyr-
ostolinae would be very helpful to determine the relationships within this clade. Another
character that requires additional examination in the Phrudus group, Tersilochinae sensu
stricto and Sisytrostolinae are the modied sensory structures of the sub-basal agel-
lomeres reported by Vikberg and Koponen (2000), which were not coded in the current
study. In our exemplar species, they are present in Phrudus sp., Stethantyx nearctica and
Tersilochus sp. and possibly in Allophrys divaricata (hard to score because of setae and
small size), but apparently absent from Brachyscleroma sp., Erythrodolius calamitosus, and
Peucobius fulvus. Finally, our results agree with Broad (2016), that Neorhacodinae is not
a synonym of Tersilochinae as Quicke et al. (2009) proposed, but should be treated as a
separate subfamily (see Neorhacodinae, above).
Tryphoninae
Tryphoninae (Eclytus sp., Idiogramma longicauda, Zagryphus nasutus (Cresson), Netelia
sp., Phytodietus vulgaris, Cteniscus sp., Cycasis rubiginosa (Gravenhorst) and Polyblastus
sp.) was not supported in any of our analyses (Table 3); however, the total-evidence
parsimony analysis did nd that all eight tryphonine species shared a common ances-
tor, but also including Neorhacodes enslini (Neorhacodinae) (part 4 of Fig. 117). is
grouping was supported by 24 synapomorphies, of which 7 were morphological, in-
cluding one uniquely derived: character 136, state 1: egg exits body ventral to oviposi-
tor and stalk travels down lumen of ovipositor. e Bremer support was 6 steps. Note
that egg morphology and method of oviposition are unknown for N. enslini (and were
therefore coded as “?”). e parsimony analysis using only morphology did not sup-
port any groupings within Tryphoninae, except for Phytodietini (Phytodietus vulgaris
+ Netelia sp.) (part 2 of Fig. 118). e other three analyses all placed the tryphonine
exemplars near the base of the tree, often in a grade. For example, the total-evidence
Bayesian analysis had Neorhacodes enslini as sister to all other Ichneumonidae, followed
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)121
by Phytodietini and then a clade of equivocal relationships comprised of Lycorina glau-
comata/ Idiogramma longicauda/ (Zagryphus nasutus + (Eclytus sp. + (Polyblastus sp. +
(Cteniscus sp. + Cycasis rubiginosa)))) (part 1 of Fig. 120).
Historically, Tryphoninae was one of the ve major groups of Ichneumonidae
(Holmgren 1857), but this included many taxa that were later removed to their own
subfamilies (e.g., Ctenopelmatinae, Metopiinae, etc.) by Townes et al. (1961) and later
authors. Townes et al. (1961) presumably based the denition of Tryphoninae sensu
stricto on possession of stalked eggs, a trait recognized as an important indicator of
phylogeny as early as Hartig (1837). Short (1978), studying the larva of Euceros spp.
(Eucerotinae), conrmed the conclusions of Perkins (1959a) that Eucerotinae (which
also has a stalked egg) does not belong to Tryphoninae. Later, Shaw (2004) and Cor-
onado-Rivera et al. (2004) described the stalked egg of Lycorina spp. (Lycorininae),
which raised the possibility that Lycorina should be moved to Tryphoninae. See the
Lycorininae section (above) for the reasons against this move.
In terms of phylogenetic analyses, Belshaw et al. (1998) using the 28S D2 region
found that Netelia sp. was paraphyletic with respect to the other ve tryphonine exem-
plars. e later, more comprehensive, combined morphological and molecular analysis
of Quicke et al. (2009) found that all of their 62 tryphonine species shared a com-
mon ancestor, but species of Sisyrostolinae, Stilbopinae, Eucerotinae and Ischyrocnemis
(Metopiinae) were also nested in this clade. Bennett (2015) using only morphological
characters and a limited number of outgroups, did recover Tryphoninae as monophyl-
etic with three uniquely derived synapomorphies: the clypeal fringe of setae, the larval
mandible lacking denticles on the dorsal surface of the blade and stalked eggs.
Based on the current study, Quicke et al. (2009) and Bennett (2015), there is
some evidence for the monophyly of Tryphoninae; however, more knowledge is need-
ed about taxa that may be related (or may belong) to Tryphoninae (e.g., Neorhacodi-
nae, Lycorininae, Sisyrostolinae, Stilbopinae). Knowledge of whether the body of the
egg travels down the lumen of the ovipositor in these taxa could alter their placement
relative to Tryphoninae, as occurred previously for the genus Acaenitellus Morley (see
Gupta 1988). In addition, an increase in our knowledge of Tryphoninae larval char-
acters and hosts would also help clarify whether Tryphoninae is monophyletic (host
order is only known for 29 of the 54 extant genera) (Bennett 2015). With respect to
Neorhacodes, the known host of N. enslini (Spilomena spp.) (Hymenoptera: Crabroni-
dae) was coded the same (character 139, state 1) as most tribes of Tryphoninae which
parasitize sawies. Perhaps coding this character dierently for Aculeata as opposed
to sawies would be appropriate and would modify the placement of Neorhacodes
relative to Tryphoninae.
With respect to the ndings of Belshaw et al. (1998) that Phytodietini may be
related to, but not included within Tryphoninae, the current study is equivocal. Both
Bayesian analyses and the parsimony analysis with only morphological characters
found that Phytodietini did not cluster with the other six exemplars of Tryphoninae,
but the total-evidence parsimony analysis did. In order to accept the notion that Phy-
todietini do not belong to Tryphoninae, one has to postulate that evolution of the stalk
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
122
of the egg travelling down the lumen of the ovipositor during oviposition has evolved
twice. A future study including the morphological characters of Bennett (2015) and
sequence data obtained by next generation sequencing will address this issue.
Relationships within Tryphoninae based on the total-evidence parsimony analy-
sis were as follows: (Neorhacodinae + Phytodietini) + (Idiogrammatini + (Polyblastus
group of Tryphonini + (Eclytini + Oedemopsini) + Exenterus group of Tryphonini)))
(part 4 of Fig. 117). Ignoring the placement of Neorhacodinae, the relationships dier
from the morphological cladistic analysis of Bennett (2015) in two ways: 1) Phytodi-
etini is the sister group to the rest of Tryphoninae (Idiogrammatini was the sister group
in the latter study); 2) Tryphonini (including the Exenterus group) is not monophyletic
(the Exenterus group of genera clustered within Tryphonini in the latter study). It is
dicult to draw conclusions on relationships within Tryphoninae from the current
analysis because of the low sample size (only 8 of 54 extant genera in ve of seven
tribes). Future studies will include a greater number of taxa including exemplars of
Sphinctini and Ankylophonini.
Xoridinae
Xoridinae (Aplomerus sp., Odontocolon albotibiale (Bradley) and Xorides stigmapterus
(Say)) was recovered as monophyletic in the parsimony analysis using only morpho-
logical characters, as well as both Bayesian analyses. In the morphological parsimony
analysis (part 1 of Fig. 118), lack of resolution near the base of the tree precludes any
statements about its placement within Ichneumonidae, except that it does not belong in
the higher Ophioniformes. In both Bayesian analyses, Xoridinae was related to Ichneu-
moniformes and Pimpliformes, not Ophioniformes. e total-evidence Baysian analy-
sis placed Xoridinae within the Ichneumoniformes/ Pimpliformes grouping as follows:
Orthopelmatinae + (Xoridinae + (Labeninae + (remainder of Ichneumoniformes s.l. +
Pimpliformes))) (part 2 of Fig. 120). e Bayesian analysis with only molecular charac-
ters had a similar topology as follows: (Orthopelmatinae + Xoridinae) + (Labeninae +
(Ichneumoniformes s.l. except Labeninae + Pimpliformes)) (part 2 of Fig. 121). In con-
trast, the total-evidence parsimony analysis found that Aplomerus sp. was sister taxon to
all other Ichneumonidae as follows: Aplomerus sp. + ((Odontocolon albotibiale + Xorides
stigmapterus) + (Orthopelma mediator + all other Ichneumonidae))) (part 1 of Fig. 117).
With respect to the monophyly of Xoridinae, on the basis of morphology alone,
Xoridinae is well-suppported, with 23 synapomorphies, including one uniquely de-
rived: character 113, state 1: larval mandible with spines at base of blade (part 1 of
Fig. 118). A previous morphological cladistic analysis supports this assertion (Gauld
et al. 1997). Similarly, the combined morphological and molecular analysis of Quicke
et al. (2009) recovered Xoridinae as monophyletic when treating gaps as missing or
informative, although the latter analysis included specimens of Xorides, Odontocolon
and Ischnoceros Gravenhorst, but not Aplomerus, which Gauld et al. (1997) found to
be the sister group to the other three genera. Quicke et al. (2009) also coded mor-
phology at the subfamily level for Xoridinae, and some of their analyses with only
molecular data did not support the monophyly of the subfamily. In summary, based
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)123
on morphological evidence and the majority of our results, is it likely that Xoridinae is
monophyletic. e lack of monophyly of Xoridinae in our total-evidence parsimony
analysis was possibly because of how the parsimony algorithm dealt with the sequence
data (as evidenced by the fact that Xoridinae was monophyletic in the Bayesian total-
evidence analysis). Note that the larva of Aplomerus is unknown, and if it is conrmed
that Aplomerus larvae also bear spines at the base of their mandible, this would help
conrm the monophyly of the subfamily.
In terms of the placement of Xoridinae within Ichneumonidae, the total-evidence
parsimony analysis provides some support that Xoridinae (or a subset of xoridine taxa)
is the sister group of all other Ichneumonidae. Quicke et al. (1999) using only 28S
DNA sequence data for 24 ichneumonoids and two aculeate outgroups found that
Xorides praecatorius (Fabricius) was sister species to all other ichneumonids. Similarly,
the transcriptome analysis of Klopfstein et al. (2019) with six braconid outgroups and
their anchored enrichment analyses with six braconids and three non-ichneumonoids
also had X. praecatorius as sister to all other ichneumonids. erefore there is evidence
that Xoridinae is sister-group to all other Ichneumonidae, but the results of our Bayes-
ian analyses refute this, and therefore, future analyses involving only ichneumonid taxa
should investigate the eects of dierent rootings on ingroup topology, rather than
only root their trees with Xoridinae. In terms of the recognition of the higher group
Xoridiformes, because both of our total-evidence analyes found that Xoridinae is the
sister group to a large number of other subfamilies, this seems valid at this point.
Biological transitions
Inclusion of biological characters in our data matrix allows an examination of the evo-
lution of these characters within Ichneumonidae, at least with respect to the exemplar
taxa used in this analysis. In terms of the validity of this kind of analysis, we agree that
biological characters can be complex and our unweighted, unordered analysis may not
take into account dierences in the likelihood of particular character state changes
evolving relative to others. Despite this, we believe that there is value in this kind of
analysis. An unweighted, unordered analysis is objective. It does not place pre-con-
ceived notions on the direction of evolution, nor does it make subjective decisions on
the relative importance of characters. Whether the current analyses of the evolution of
biological characters in Ichneumonidae is realistic or over-simplistic is a question that
will hopefully foster discussion on the evolution of these interesting traits, producing
hypotheses that can be tested by future analyses.
ree biological characters have been optimized on to the total-evidence parsi-
mony strict consensus cladogram as follows: character 137: timing of larval maturation
(Fig.122); character 138: location of larval maturation (Fig. 123); and character 139: host
order/ source of larval nutrition (Fig. 124). In addition to optimization on these characters
on the parsimony tree, a comparison is made of dierences and similarities of the evolu-
tion of each character hypothesized by the total-evidence Bayesian analysis (Fig. 120).
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
124
Timing of larval maturation
In the total-evidence parsimony analysis, character 137, timing of larval maturation,
had a length of 8 steps (Fig. 122). e following transitions occurred: koinobiosis to
idiobiosis (ve times): 1) Doryctes erythromelas (Braconidae); 2) at base of (Odontoco-
lon albotibiale + Xorides stigmapterus); 3) at base of higher Pimpliformes; 4) at base of
Ichneumoniformes s.l.; 5) Cratichneumon w-album (Cresson); idiobiosis to koinobiosis
(three times): 1) Acrotaphus wiltii; 2) Euceros sp. nov.; 3) Ichneumoninae including
Alomya debellator. Optimization of the character using ACCTRAN or DELTRAN did
not change the number and placement of transitions.
e ancestral state for Ichneumonidae favours koinobiosis, although this requires
some discussion. e state is unknown for Aplomerus sp. (Xoridinae) and is equivocal for
the next node (the other two xoridines which are both idiobionts). ere is strong mor-
phological evidence that Aplomerus Provancher belongs to Xoridinae (Gauld et al. 1997)
and therefore, it is likely to be an idiobiont. If this is true, then the ancestral state for Ich-
neumonidae would be idiobiosis for timing of larval maturation. Additional taxa, for ex-
ample, a species of Ischnoceros Gravenhorst (Xoridinae) should be included to re-evaluate
this question, and hopefully also additional knowledge of biology of our exemplar species.
In terms of the direction of evolution of this character in the parsimony analysis,
it has transitions in both directions, slightly favoured in the direction of koinobiosis
to idiobiosis (ve times) compared to vice versa (three times). e transition from a
supposedly more specialized koinobiont to a less specialized strategy (idiobiosis) was
not hypothesized by Gauld (1988a). Considering the size and age of Ichneumonidae
(at least 85 mya) (Kopylov 2012), it is, perhaps, not surprising that transitions appear
to have arisen in both directions in this character over the course of evolution of the
family. Estimates of the age at which parasitism rst evolved within Hymenoptera, i.e.,
the age of the taxon Vespina (= Orussoidea + Apocrita) is at least 164 mya (Rasnitsyn
and Zhang 2004; Ronquist et al. 2012). Based on these ages, there is no reason to as-
sume that the koinobiont life history strategy had not evolved prior to the origin of
Ichneumonoidea. In terms of a mechanism to explain transitions from koinobiosis to
idiobiosis, this simply requires a change in the timing at which the larva commences
feeding and/or a change in the host-searching behaviour of the female wasp. It has
been argued that delay in the commencement of larval feeding should be advantageous
to the parasitoid because it provides a larger host on which to feed and takes advantage
of host behaviours such as nding a secure location for pupation away from predators
and parasitoids (Gauld 1988a). It could be argued; however, that when there are high
populations of parasitoids and predators that specialize on nding large, exposed, wan-
dering larvae, reverting to an idiobiont strategy on younger larvae could be favourable
in order to avoid this pressure. In addition, the evolution from late larval-pupal koino-
bionts to pupal-pupal idiobionts could easily evolve by the female wasp delaying and
modifying its host-searching behaviour in order to search for pupae rather than late lar-
vae/ pre-pupae. Whereas pupae are generally more concealed than larvae and therefore
harder to nd, they lack the ability to defend themselves physically and are generally
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)125
less setose/ spinose, so if they can be found, they may be easier to parasitize successfully.
is type of transition appears to have evolved at least once in Ichneumonidae in our
parsimony analysis in Cratichneumon w-album (green to red transition in Fig. 122).
Comparing the evolution of this character in the total-evidence Bayesian analysis,
koinobiosis is favoured as plesiomorphic within Ichneumonidae (Fig. 120). e state
of the sister taxon of all other Ichneumonidae (Neorhacodes enslini) is not known,
but Phytodietini (sister taxon to all Ichneumonidae except Neorhacodes) are koino-
bionts, as are related taxa. e length of the character in the Bayesian analysis is 7
steps. ree transitions from koinobiosis to idiobiosis (indicated by the letter “I” in
Fig. 120) occur as follows: 1) the outgroup Doryctes erythromelas; 2) Cratichneumon
w-album; and 3) the ancestor of (Xoridinae + (Labeninae + (Ichneumoniformes s.l. +
Pimpliformes))). Four changes occur from idiobiosis to koinobiosis: 1) Euceros sp.; 2)
Acrotaphus wiltii; 3) the ancestor of Ichneumoninae (including Alomya debellator) and
the ancestor of Acaenitinae, Orthocentrinae, Diplazontinae and related subfamilies
(shown in Fig.120 with a “K”). In summary, regardless of the method of phylogenetic
analysis, transitions have occurred in both directions with respect to timing of larval
maturation, and perhaps unexpectedly, koinobiosis appears more likely to be the ple-
siomorphic state within Ichneumonidae.
Location of larval maturation
Examination of the evolution of ectoparasitism versus endoparasitism (character
138) in the total-evidence parsimony analysis reveals that ectoparasitism is plesio-
morphic in both Braconidae and Ichneumonidae (Fig. 123). As discussed for tim-
ing of larval maturation (above), our limited outgroups aected the plesiormorphic
state for Braconidae (in this case with two ectoparasitoids versus one endoparasitoid)
which in concert with the state for (Odontocolon albotibiale + Xorides stigmapterus)
made the state at the base of Ichneumonidae unequivocally ectoparasitoidism. e
length of the character is 12 steps. Unlike in character 137, the evolution of this
character diered based on the type of character optimization used. Under AC-
CTRAN, transitions from ectoparasitism to endoparasitism occurred eight times: 1)
Aleiodes terminalis (Braconidae); 2) ancestor of all Ichneumonidae except Xoridinae;
3) Pimpla annulipes; 4) eronia bicincta; 5) Euceros sp. nov. 6) Microleptes sp.; 7)
Ichneumoninae including Alomya debellator; 8) Neorhacodes enslini. Transitions from
endoparasitism to ectoparasitism occurred three times: 1) ancestor of higher Pimpli-
formes; 2) ancestor of Ichneumoniformes s.l.; 3) ancestor of Tryphoninae (includ-
ing Neorhacodes enslini). In addition, within Ophioniformes, Lycorininae (Lycorina
glaucomata) had a transition from endoparasitism (state 1) to endoparasitism with a
nal ectoparasitoid phase followed by pupation within the host cocoon (Shaw 2004)
(state 2, not shown in Fig. 123).
In contrast, under DELTRAN optimization (not shown), transitions from ec-
toparasitism to endoparasitism occurred ten times: 1) Aleiodes terminalis (Braconidae);
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
126
Figure 122. Optimization of character 137 (timing of larval maturation) on total-evidence parsimony
analysis strict consensus cladogram using ACCTRAN. See Legend for description of colour coding for
character states. Character length = 8 steps.
2) Orthopelmatinae; 3) ancestor of Pimpliformes; 4) Pimpla annulipes; 5) eronia
bicincta; 6) Euceros sp. nov. 7) Microleptes sp.; 8) Ichneumoninae including Alomya
debellator; 9) Neorhacodes enslini; 10) ancestor of Ophioniformes. Only one transi-
tion from endoparasitism to ectoparasitism occurred in the ancestor of higher Pimpli-
formes. Lycorininae had the same transition to state 2 as for ACCTRAN.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)127
Figure 123. Optimization of character 138 (location of larval development) optimized on total-evidence
parsimony analysis strict consensus cladogram using ACCTRAN. See Legend for description of colour
coding for character states. Character length = 12 steps.
Gauld (1988a) provided several hypotheses regarding the evolution of endoparasit-
ism, all of which postulated that it evolved from ectoparasitism. ese hypotheses are
mostly supported by the transitions observed in the total-evidence parsimony analysis.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
128
Gauld (1988a) did not discuss the possibility that ectoparasitism could evolve via a
reversal from an endoparasitoid state, although the results of Sharanowski et al. (2011)
did question the hypothesis that ectoparasitism was plesiomorphic in Braconidae. In-
tuitively, the transition from endoparasitism to ectoparasitism appears more dicult
to explain than a reversal from koinobiosis to idiobiosis. Evolution of endoparasitism
can involve changes to the method of oviposition by the female wasp (Boring et al.
2009) and structure of the ovipositor (Belshaw et al. 2003; Quicke et al. 2000b),
but also changes in the ovaries and egg morphology (Iwata 1960), venom properties
(Moreau and Asgari 2015) and in some groups, co-evolution with polydnaviruses that
alter host development via endocrinological changes (Tanaka and Vinson 1991; Pen-
nacchio and Strand 2015), not to mention, major changes in larval wasp morphology
(Short 1978; Wahl 1986, 1988, 1990). It is hard to imagine that any parasitoid lineage
would be able to revert back to ectoparasitism following evolution of all the specialized
attributes of an endoparasitoid lifestyle, although intuitively, some of the traits listed
above may be just as easy or easier to lose, than to gain (e.g., association with polyd-
naviruses). Regardless, according to the parsimony total-evidence analysis, transitions
from endoparasitism to ectoparasitism appears to have occurred at least once (DEL-
TRAN optimization) or three times under ACCTRAN optimization. In comparison,
the total-evidence Bayesian analysis contradicts the total-evidence parsimony analysis
with respect to the topology of Pimpliformes. In the Bayesian analysis, the ectopara-
sitoid higher Pimpliformes is sister group to the remaining endoparasitoid subfami-
lies (Acaenitinae, Orthocentrinae, Diplazontinae, etc.), therefore there is no transition
from endoparasitism to ectoparasitism in the Pimpliformes. at is not to say that the
Bayesian analysis unequivocally supports the hypothesis that endoparasitism evolves
from ectoparasitism and never the reverse. In Fig. 120, this character has 11 steps,
of which there are nine transitions from ectoparasitism to endoparasitism (nodes or
taxa indicated by “EN”) and one transition from endoparasitism to ectoparasitism in
the node that supports Xoridinae + (Labeninae + (all remaining Ichneumoniformes +
Pimpliformes))) (indicated by “EC”). In addition, there is one change from ectopara-
sitism to the state in Lycorininae (indicated by “E2”). In summary, ectoparasitism is
plesiomorphic within Ichneumonidae, regardless of the analysis. e transition from
ectoparasitism to endoparasitism is far more common than the reverse, but there is at
least one transition from endoparasitism to ectoparasitism hypothesized in both of our
total-evidence analyses, despite the fact that the mechanism by which this transition
could evolve is not easily explained intuitively.
Host/ source of larval nutrition
e order of host/ source of larval nutrition used by our exemplar taxa (character
139) is optimized on the total-evidence parsimony strict consensus tree in Fig. 124
using ACCTRAN. e length of the character is 28 steps and the ancestral state for
Ichneumonidae is parasitism of Hymenoptera. Under DELTRAN optimization (not
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)129
shown), the ancestral state for Ichneumonidae is Lepidoptera. However, if the host
of Aplomerus (Xoridinae) is coded as Coleoptera rather than unknown, based on its
morphological similarity to known Xoridinae which are beetle parasitoids, the state
at the base of Ichneumonidae changes to Coleoptera for the total-evidence parsimony
analysis, regardless of the type of optimization. Finally, the Bayesian total-evidence
analysis hypothesizes that Lepidoptera parasitism is plesiomorphic for Icheumonidae
(Fig. 120, character optimization not shown). Even though the sister group of all other
Ichneumonidae (Neorhacodes enslini: Neorhacodinae) is a parasitoid of aculeate wasps
(Hymenoptera), the next two “basal” taxa in the Bayesian analysis parasitize Lepidop-
tera (Lycorininae and Phytodietini (Tryphoninae)) as do two of the three outgroups
(Aleiodes terminalis and Rhysipolis sp.).
In terms of additional evidence supporting one of these three host orders as plesio-
morphic for Ichneumonidae, all easily pre-date the origin of Ichneumonidae (at least
85 mya) (Kopylov 2012). Based on the fossil record, Coleoptera is the oldest of the
three, rst appearing in the Permian (290 mya) (Kukalová-Peck and Beutel 2012) and
it was highly speciose and well-diversied by the upper Cretaceous (Smith and Marcot
2015). Hymenoptera is of similar age, with estimates that the order begain to diversify
281 mya (Peters et al. 2017). In contrast, the oldest known Lepidoptera fossil is lower
Jurassic (190 mya) (Whalley 1985). erefore based on the fossil record, it has been
assumed that Lepidoptera is the youngest of the insect orders and diversied with the
radiation of angiosperms (Wahlberg et al. 2013), although the relatively recent origin
and diversication has been questioned because of poor preservation of Lepidoptera
relative to other orders (Sohn et al. 2015). Regardless, hosts of all three orders were
present at the origin of Ichneumonidae, therefore any could have been the ancestral
host order for Ichneumonidae.
A comparison of the relative frequencies of host use of the four major holometabol-
ous orders in our parsimony analysis shows that Lepidoptera is the most prevalent host
(for 35 % of our 131 exemplar ichneumonid species), compared to Hymenoptera (30
%), Coleoptera (12 %) and Diptera (5 %). ese percentages are comparable to the
known host use by ichneumonids at the subfamily level: Lepidoptera (18 subfamilies,
43 % of total); Hymenoptera (16 subfamilies, 38 %); Coleoptera (13 subfamilies, 31 %)
and Diptera (8 subfamilies, 19%) (Wahl 1993c; Yu et al. 2016; Bennett, unpublished).
Examination of the dierent transitions that occur within this character in the
parsimony total-evidence tree reveals that of the 28 state changes, there were 13 dier-
ent types of transitions, (e.g., Lepidoptera to Coleoptera, Hymenoptera to Coleoptera,
etc). e order that was most often plesiomorphic in the state changes was Hyme-
noptera with the following apomorphic states and number of changes: changes to
Lepidoptera (8); Coleoptera (5); Diptera (1); Neuroptera (1); Trichoptera (1) and
facultatively herbivorous (1). e next most common order that was plesiomorphic in
these transitions was Lepidoptera, as follows: changes to Coleoptera (4); Hymenoptera
(2) and Diptera (1). irdly, there were two transitions from Diptera: one to Coleop-
tera and one to Hymenoptera. Lastly, there was one transition from Coleoptera to egg
predation and one change from egg predation to parasitization of spiders. erefore,
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
130
Figure 124. Optimization of character 139 (host) optimized on total-evidence parsimony analysis strict
consensus cladogram using ACCTRAN. See Legend for description of colour coding for character states.
Character length = 28 steps.
ichneumonids that parasitize Hymenoptera appear much more likely to switch to dif-
ferent host orders compared to, for example, an ichneumonid that parasitizes Lepi-
doptera, Diptera or Coleoptera. In fact, over half of all of the total host transitions (17
of 28 state changes) in Fig. 124 have Hymenoptera as the plesiomorphic state. is
implies that when an ichneumonid group parasitizes Hymenoptera, it may somehow
be better adapted to host-switch to another order; or stating this another way, there
may be impediments to host switching when an ichneumonid evolves to parasitize, for
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)131
example, Diptera or Coleoptera. It is not clear what characters may be associated with
the ability/ inability to switch hosts. Of course, this analysis is on a very broad scale
and a more in-depth analysis including more species may reveal a dierent pattern.
Conclusions
Overall, the two total evidence analyses obtained the most resolution of relationships,
followed by the molecular analyses and nally, the parsimony analysis with only mor-
phological and biological characters. ere was general congruence between the par-
simony and Bayesian total-evidence analyses, except for at the base of Ichneumonidae
(described below).
e relative support of dierent groupings within Ichneumonidae is shown in Ta-
ble 3. Of the three major subfamily groupings, Pimpliformes was most well-supported
(four of ve analyses). A large portion of Ichneumoniformes s.l. (i.e., the group com-
prised of Cryptinae, Ichneumoninae, Phygadeuontinae, Ateleutinae, Adelognathinae
and Microleptinae) was supported in both total evidence analyses, although the rela-
tionship to other subfamilies that have previously been placed in Ichneumoniformes
(e.g., Agriotypinae) was equivocal, depending on the analysis. e Ophioniformes was
only supported in the total-evidence parsimony analysis, whereas in the Bayesian total
evidence analysis it formed a grade at the base of Ichneumonidae. With respect to in-
ternal arrangements within the three major groupings, the core of Ichneumoniformes
Figure 125. Alomya semiava Stephens. Cephalic sclerites and spiracles of mature larva. Australian Na-
tional Insect Collection. Scale bars: 0.1 mm. Structures are drawn as seen on slide (not duplicated bisym-
metrically) because of distortion of the sclerites.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
132
s.l. (listed above) was the most consistently recovered across analyses, whereas many of
the relationships within Ophioniformes and especially, within Pimpliformes diered
between the parsimony and Bayesian analyses. e ambiguity of relationships within
Pimpliformes in the current study mirrored those of Klopfstein et al. (2019).
In both total evidence analyses, Pimpliformes was sister group to Ichneumoni-
formes s.l., which agrees with Santos (2017) and Klopfstein et al. (2019), but disagrees
with Quicke et al. (2009) which supported Pimpliformes + (Ophioniformes + Ichneu-
moniformes s.l.). e sister group of all other Ichneumonidae was equivocal depend-
ing on the analysis. Xoridinae was only sister group in the total-evidence parsimony
analysis and was not monophyletic in this analysis. Labeninae was related to / included
in Ichneumoniformes s.l., not sister group to all other Ichneumonidae or sister to all
ichneumonids except Xoridinae.
ere were several other well-supported groupings of subfamilies including high-
er Pimpliformes, higher Ophioniformes, (Claseinae + Pedunculinae) and (Stilbops +
Banchinae including Notostilbops). At the subfamily level, some subfamilies were well-
supported across analyses: Banchinae (including Notostilbops), Campopleginae, Cre-
mastinae, Diplazontinae, Ichneumoninae (including Alomya), Labeninae, Mesochori-
nae (excluding Chineater), Metopiinae (excluding Scolomus), Poemeniinae, Rhyssinae
and Tersilochinae s.s. Moderate support (i.e., support in two to three analyses) was
found for Anomaloninae, Cryptinae, Ophioninae, Phygadeuontinae and Xoridinae.
Weak support (i.e., in only one analysis) was found for Acaenitinae, Nesomesochori-
nae and Orthocentrinae.
In contrast, the following subfamilies were never supported: Ctenopelmatinae,
Pimplinae, Sisyrostolinae, Stilbopinae, Tersilochinae s.l. and Tryphoninae. Ctenopel-
matinae was supported in the total-evidence parsimony analysis with the inclusion
of Hybrizontinae, Lycorininae, Oxytorinae and Tatogastrinae. Tryphoninae was also
supported in this analysis with the inclusion of Neorhacodinae. e most equivocally-
placed subfamilies were Lycorininae, Neorhacodinae, Orthopelmatinae and Xoridinae.
Optimization of biological characters on the total evidence phylogenies hypothesized
that for Ichneumonidae, ectoparasitism is plesiomorphic to endoparasitim. e ancestral
state for timing of larval maturation is koinobiosis in both analyses; however, the lack of
data for the sister taxon to all other ichneumonids in the parsimony analysis (Aplomerus)
raises some doubt regarding this hypothesis. If Aplomerus is an idiobiont (as expected),
then the parsimony analysis would support idiobiosis as plesiomorphic to koinobiosis.
Finally, the ancestral host for Ichneumonidae is hypothesized to be Hymenoptera or Lep-
idoptera, although if the host of Aplomerus is determined to be Coleoptera (as expected),
then Coleoptera would be the hypothesized ancestral host in one of the ve analyses.
Acknowledgements
e authors would like to thank the curators of the institutions listed in the methods sec-
tion for loan/ deposition of specimens and larval slides. In addition, Dr. G. Broad (Natu-
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)133
ral History Museum, London) provided host remains from which the larval exuvium of
Phrudus defectus could be extracted. Dr. T. Shanower (US Department of Agriculture,
Albany, California) provided larval specimens of Collyria catoptron. Cambridge Univer-
sity Press gave permission to copy the gures of the egg of Euceros frigidus (Figs 115,
116). Dr. A. Polaszek (Natural History Museum, London) provided permission to copy
line drawings of the larval cephalic sclerites of Diplazon laetatorius (Fig.3), Spilopteron
sp. (Fig. 31b), Megastylus sp. (Fig. 31d) and Dusona sp. (Fig. 36). Ms. Diana Barnes (Ag-
riculture and Agri-Food Canada) is greatly thanked for taking most digital photographs,
assembling the plates and helping prepare the cladograms and text of the manuscript. Dr.
B. Santos (United States National Museum) and Dr. G. Broad reviewed the manuscript
which greatly improved the published work. Funding for this study was provided by
operating grants from Agriculture and Agri-Food Canada to AMRB, as well as an NSF
grant to Dr. M. Sharkey (University of Kentucky) (NSF Grant Number EF-0337220).
References
Achterberg C van (1976) A preliminary key to the subfamilies of the Braconidae (Hyme-
noptera). Tijdschrift voor Entomologie 119: 33–78. https://www.biodiversitylibrary.org/
item/89772#page/7/mode/1up
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) “Basic local alignment search
tool.” J. Mol. Biol. 215: 403–410. https://doi.org/10.1016/S0022-2836(05)80360-2
Ashmead WH (1900) Classication of the Ichneumon ies, or the superfamily Ichneumo-
noidea. Proceedings of the United States National Museum 23: 1–220. https://doi.
org/10.5479/si.00963801.23-1206.1
Ashmead WH (1905) Additions to the recorded hymenopterous fauna of the Philippine Is-
lands, with descriptions of new species. Proceedings of the United States National Museum
28: 957–971. https://doi.org/10.5479/si.00963801.28-1413.957
Barron JR (1977) Nearctic species of Orthopelma (Hymenoptera: Ichneumonidae). Systematic
Entomology 2: 283–299. https://doi.org/10.1111/j.1365-3113.1977.tb00377.x
Belshaw R, Quicke DLJ (1997) A molecular phylogeny of the Aphidiinae (Hymenoptera: Bra-
conidae). Molecular Phylogenetics and Evolution 7: 281–293. https://doi.org/10.1006/
mpev.1996.0400
Belshaw R, Quicke DLJ (2002) Robustness of ancestral state estimates: evolution of life history
strategy in ichneumonoid parasitoids. Systematic Biology 51: 450–477, gs 1–9. https://
doi.org/10.1080/10635150290069896
Belshaw R, Fitton M, Herniou EA, Gimeno CP, Quicke DLJ (1998) A phylogenetic recon-
struction of Ichneumonoidea (Hyemenoptera) based on the D2 variable region of 28S
ribosomal DNA. Systematic Entomology 23: 109–123. https://doi.org/10.1046/j.1365-
3113.1998.00046.x
Belshaw R, Grafen A, Quicke DLJ (2003) Inferring life history from ovipositor morphology in
parasitoid wasps using phylogenetic regression and discriminant analysis. Zoological Journal
of the Linnean Society 139: 213–228. https://doi.org/10.1046/j.1096-3642.2003.00078.x
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
134
Bennett AMR (2001) Phylogeny of the Agriotypinae with comments on the subfamily rela-
tionships of the basal Ichneumonidae. Systematic Entomology 26: 329–356. https://doi.
org/10.1046/j.0307-6970.2001.00155.x
Bennett AMR (2015) Revision of the world genera of Tryphoninae. Memoirs of the American
Entomological Institute 86: 1–387.
Bennett AMR, Sääksjärvi IE, Broad GR (2013) Revision of the New World species of Eryth-
rodolius (Hymenoptera: Ichneumonidae: Sisyrostolinae), with a key to the world species.
Zootaxa 3702: 425–436. https://doi.org/10.11646/zootaxa.3702.5.2
Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW
(2017) GenBank,Nucleic Acids Research 45(D1): D37–D42, https://doi.org/10.1093/
nar/gkw1070
Blair KG (1945) Notes on the economy of the rose-galls formed by Rhodites (Hymenoptera,
Cynipidae). Proceedings of the Royal Entomological Society of London (A) 20: 26–31.
https://doi.org/10.1111/j.1365-3032.1945.tb01046.x
Boring, CAM, Sharkey MJ, Nychka JA (2009) Structure and functional morphology of
the ovipositor of Homolobus truncator (Hymenoptera: Ichneumonoidea: Braconi-
dae). Journal of Hymenoptera Research 18: 1–24. https://www.biodiversitylibrary.org/
item/109446#page/3/mode/1up
Branstetter MG, Danforth BN, Pitts JP, Faircloth BC, Ward PS, Bungton ML, Gates MW,
Kula RR, Brady SG (2017) Phylogenomic insights into the evolution of stinging wasps and
the origins of ants and bees. Current Biology 27: 1019–1025. https://doi.org/10.1016/j.
cub.2017.03.027
Bremer K (1994) Branch support and tree stability. Cladistics 10: 295–304. https://doi.
org/10.1111/j.1096-0031.1994.tb00179.x
Broad GR (2016) Checklist of British and Irish Hymenoptera - Ichneumonidae. Taxonomic
Paper Biodiversity Data Journal 4: e9042. https://doi.org/10.3897/BDJ.4.e9042
Broad GR, Shaw MR (2005) e species of four genera of Metopiinae (Hymenoptera: Ichneu-
monidae) in Britain, with new host records and descriptions of four new species. Journal of
Natural History 39: 2389–2407. https://doi.org/10.1080/00222930500102074
Broad GR, Shaw MR, Fitton MG (2018) Ichneumonid wasps (Hymenoptera: Ichneumoni-
dae): their classication and biology. Handbooks for the Identication of British Insects
7(12): 1–418.
Brothers DJ, Carpenter JM (1993) Phylogeny of Aculeata: Chrysidoidea and Vespoidea (Hy-
menoptera). Journal of Hymenoptera Research 2: 227–304. http://research.amnh.org/iz/f/
Brothers_Carpenter_1993.pdf
Chao HF (1992) A new genus and three new species of Agriotypidae from China (Hymenop-
tera: Ichneumonoidea). Wuyi Science Journal 9: 325–332.
Constantineanu MI (1965) Familia Ichneumonidae, subfamiliile Phaeogeninae si Aloymyinae.
Fauna Republicii Populare Romane 9: 1–508.
Coronado-Rivera J, Gonzalez Herrera A, Gauld ID, Hanson P (2004) e enigmatic biology of
the Ichneumonid subfamily Lycorininae. Journal of Hymenoptera Research 13: 223–227.
https://core.ac.uk/download/pdf/4516700.pdf
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)135
Cushman RA (1924) On the systematic position of the genera Collyria Schiødte and Ischnoceros
Gravenhorst (Hymenoptera). Proceedings of the Entomological Society of Washington.
26: 229–231. https://www.biodiversitylibrary.org/item/54672#page/273/mode/1up
Cushman RA (1940) e Ichneumon-ies of the subfamily Neorhacodinae, with descriptions
of a new genus and three new species. Proceedings of the United States National Museum
88: 523–527. https://doi.org/10.5479/si.00963801.88-3088.523
Dalla Torre CG de (1902) Catalogus Hymenopterorum. Volumen III. Trigonalidae, Megalyri-
dae, Stephanidae, Ichneumonidae, Agriotypidae, Evaniidae, Pelecinidae. Guilelmi Engel-
mann. Lipsiae 1901: 1–544; 1902: 545–1141.
Danks HV (1971) Biology of some stem-nesting aculeate Hymenoptera. Transactions
of the Royal Entomological Society of London 122(1970): 323–395. https://doi.
org/10.1111/j.1365-2311.1971.tb00526.x
Dasch CE (1964) Ichneumon-ies of America north of Mexico 5: subfamily Diplazontinae.
Memoirs of the American Entomological Institute 3: 1–304.
Donisthorpe H (1913) Myrmecophilous notes for 1912. e Entomologist’s Record and Jour-
nal of Variation 25: 89–97. https://ia802706.us.archive.org/32/items/entomologistsrec-
251913tutt/entomologistsrec251913tutt.pdf
Eggleton P (1989) e phylogeny and evolutionary biology of the Pimplinae (Hymenoptera:
Ichneumonidae). PHD esis. University of London, London, 1–295. https://spiral.impe-
rial.ac.uk/bitstream/10044/1/47421/2/Eggleton-P-1989-PhD-esis.pdf
Finlayson, T (1970) Final-instar larval characteristics of Coleocentrus rufus (Hymenoptera:
Ichneumonidae. e Canadian Entomologist 102: 905–907. https://doi.org/10.4039/
Ent102905-7
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplication
of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.
Molecular Marine Biology and Biotechnology 3(5): 294–299. http://citeseerx.ist.psu.edu/
viewdoc/download?doi=10.1.1.453.7442&rep=rep1&type=pdf
Gauld ID (1976) e classication of the Anomaloninae (Hymenoptera: Ichneumonidae).
Bulletin of the British Museum (Natural History), Entomology Series 33: 1–135. http://
direct.biostor.org/reference/113561
Gauld ID (1983) e classication, evolution and distribution of the Labeninae, an ancient
southern group of Ichneumonidae (Hymenoptera). Systematic Entomology 8: 167–178.
https://doi.org/10.1111/j.1365-3113.1983.tb00477.x
Gauld ID (1984) An introduction to the Ichneumonidae of Australia. British Museum (Natu-
ral History), Publication No. 895, 1–413.
Gauld ID (1988a) Evolutionary patterns of host utilization by ichneumonoid parasitoids (Hy-
menoptera: Ichneumonidae and Braconidae) Biological Journal of the Linnean Society 35:
351–377. https://doi.org/10.1111/j.1095-8312.1988.tb00476.x
Gauld ID (1988b) A survey of the Ophioninae (Hymenoptera: Ichneumonidae) of tropical
Mesoamerica with special reference to the fauna of Costa Rica. Bulletin of the British
Museum (Natural History), Entomology Series 57: 1–309. http://direct.biostor.org/refer-
ence/113931
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
136
Gauld ID (1991) e Ichneumonidae of Costa Rica, 1. Introduction, keys to subfamilies,
and keys to the species of the lower Pimpliform subfamilies Rhyssinae, Poemeniinae,
Acaenitinae and Cylloceriinae. Memoirs of the American Entomological Institute 47:
1–589.
Gauld ID, Wahl DB (2000) e Labeninae (Hymenoptera: Ichneumonidae): a study in phylo-
genetic reconstruction and evolutionary biology. Zoological Journal of the Linnean Society
129: 271–347. https://doi.org/10.1111/j.1096-3642.2000.tb00015.x
Gauld ID, Wahl DB (2002) e Eucerotinae: a Gondwanan origin for a cosmopolitan
group of Ichneumonidae? Journal of Natural History 36: 2229–2248. https://doi.
org/10.1080/00222930110096500
Gauld ID, Wahl DB (2006) e relationship and taxonomic position of the genera Apolophus
and Scolomus (Hymenoptera: Ichneumonidae). Zootaxa 1130: 35–41. http://mapress.
com/zootaxa/2006/zt01130p041.pdf
Gauld ID, Sithole R, Gómez JU, Godoy C (2002a) e Ichneumonidae of Costa Rica 4. In-
troduction and keys to species of the subfamilies: Metopiinae and Banchinae. Memoirs of
the American Entomological Institute 66: 1–768.
Gauld ID, Wahl D, Bradshaw K, Hanson P, Ward S (1997) e Ichneumonidae of Costa
Rica 2. Introduction and keys to species of the smaller subfamilies, Anomaloninae, Cten-
opelmatinae, Diplazontinae, Lycorininae, Phrudinae, Tryphoninae (excluding Netelia) and
Xoridinae, with an appendix on the Rhyssinae. Memoirs of the American Entomological
Institute 57: 1–485.
Gauld ID, Wahl DB, Broad GR (2002b) e suprageneric groups of the Pimplinae (Hyme-
notpera: Ichneumonidae): a cladistic re-evaluation and evolutionary biological study.
Zoological Journal of the Linnean Society 136: 421–485. https://doi.org/10.1046/j.1096-
3642.2002.00031.x
Gauld ID, Ward S, Mallet V (2000) e Ichneumonidae of Costa Rica 3. Memoirs of the
American Entomological Institute 63: 1–453.
Gillespie DR, Finlayson T (1983) Classication of the nal-instar larvae of the Ichneumoninae
(Hymenoptera: Ichneumonidae). Memoirs of the Entomological Society of Canada 124:
1–81. https://doi.org/10.4039/entm115124fv
Gillespie JJ, Yoder MJ, Wharton RA (2005) Predicted secondary structure for 28S and 18S
RNA from Ichneumonoidea (Insecta: Hymenoptera: Apocrita): impact on sequence align-
ment and phylogeny estimation. Journal of Molecular Evolution 61: 114–137. https://doi.
org/10.1007/s00239-004-0246-x
Gokhman VE (1988) Ecological and morphological aspects of the origin and evolution of
Ichneumoninae (Hymenoptera: Ichneumonidae). Entomologicheskoe Obozrenie 67:
821–825. [in Russian] [Entomological Review. 69 (1990): 40–44].
Golobo PA (1993) Estimating character weights during tree search. Cladistics 9: 83–91.
https://doi.org/10.1111/j.1096-0031.1993.tb00209.x
Golobo PA (1999) NONA, version 2.0. Program and documentation. Published by the au-
thor, Tucuman, Argentina.
Golobo PA, Farris J, Nixon K (2003) TNT: A free program for phylogenetic analysis. Version
1.1. Version 1.5 now available at http://www.lillo.org.ar/phylogeny/tnt/
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)137
Gómez Durán J-M, Achterberg C van (2011) Oviposition behaviour of four ant parasitoids
(Hymenoptera, Braconidae, Euphorinae, Neoneurini and Ichneumonidae, Hybrizonti-
nae), with the description of three new European species. ZooKeys 106: 59–106. https://
doi.org/10.3897/zookeys.125.1754
Goulet H, Huber JT (Eds) (1993) Hymenoptera of the world: an identication guide to fami-
lies. Research Branch of Agriculture Canada, Publication 1894/E: 1–668. http://publica-
tions.gc.ca/pub?id=9.811261&sl=0
Gupta VK (1988) Relationships of the genera of the Tryphonine tribe Oedemopsini and a
revision of Acaenitellus Morley. In: Gupta VK (Ed.) Advances in Parasitic Hymenoptera
Research. E.J.Brill, Leiden/New York, 243–258.
Gupta VK (1994) A review of the genus Brachyscleroma with descriptions of new species from
Africa and the Orient (Hymenoptera: Ichneumonidae: Phrudinae). Oriental Insects 28:
353–382. https://doi.org/10.1080/00305316.1994.10432311
Haliday AH (1838) Essay on the classication of parasitic Hymenoptera. Entomological maga-
zine 5: 209–248. https://www.biodiversitylibrary.org/item/35925#page/234/mode/2up
Handlirsch A (1907) Die Fossilen Insekten und die Phylogenie der Rezenten Formen. Ein
Handbuch für Palaeontologen und Zoologen. Wilhelm Engelmann, Leipzig, 1–1430.
https://doi.org/10.5962/bhl.title.5636
Hartig T (1837) Ueber die gestielten Eier der Schlupfwespen. Archiv für Naturgeschichte 3:
151–159. https://doi.org/10.5962/bhl.part.10048
Heath J (1961) Some parasites of Eriocraniidae (Lep.). Entomologist’s Monthly Magazine
97: 163.
Hedicke H von (1922) Nomina nova. Deusche Entomologische Zeitschrift 1922: 426–428.
https://doi.org/10.1002/mmnd.192219220418
Heraty J, Ronquist F, Carpenter JM, Hawks D, Schulmeister S, Dowling AP, Murray D, Mun-
ro J, Wheeler WC, Schi N, Sharkey M (2011) Evolution of the hymenopteran mega-
radiation. Molecular Phylogenetics and Evolution 60: 73–88. https://doi.org/10.1016/j.
ympev.2011.04.003
Hinz R, Short JRT (1983) Life-history and systematic position of the European Alomya species
(Hymenoptera: Ichneumonidae). Entomologica Scandinavica 14: 462–466. https://doi.
org/10.1163/187631283X00236
Holmgren AE (1857) Försök till uppställning och beskrifning af de i sverige funna Tryphon-
ider (Monographia Tryphonidum Sueciae). Kongliga Svenska Vetenskapsakademiens Han-
dlingar, Ny Följd [new series] bd 1 (1855): 93–246. https://www.biodiversitylibrary.org/
item/20272#page/255/mode/thumb
Holmgren AE (1860) Försök till uppställning och beskrifning af Sveriges Ichneumonider. Tred-
je Serien. Fam. Pimplariae. Kongliga Svenska Vetenskapsakademiens Handlingar NF bd
3(10): 1–76. https://www.biodiversitylibrary.org/item/20199#page/7/mode/1up
Horstmann K (1968) Zur Systematikund Biologie von Neorhacodes enslini (Ruschka) (Hym.,
Ichneumonidae). Entomologische Nachrichten 12: 33–6.
Humala AE (2003) [Ichneumon-ies of the fauna of Russia and surrounding countries. Sub-
families Microleptinae & Oxytorinae (Hymenoptera: Ichneumonidae)] [in Russian], Rus-
sian Academy of Sciences, Moscow, 1–175.
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
138
Ito M, Watanabe K, Maeto K (2015) Molecular evidence resolving the confusion of two
species of Spilopteron. European Journal of Entomology 112(3): 543–556. https://doi.
org/10.14411/eje.2015.068
Iwata K (1960) e comparative anatomy of the ovary in Hymenoptera. Part V. Ichneumoni-
dae. Acta Hymenopterologica 1: 115–169.
Jordan T (1998) Tersilochus curvator Horstmann und Tersilochus sp. n. (Ichneumonidae, Ter-
silochinae), neue Parasitoiden der an Birken minierenden Trugmotten (Lepidoptera, Eri-
ocraniidae). Bonner Zoologische Beiträge 47(3–4): 411–419. https://www.biodiversityli-
brary.org/item/155938#page/427/mode/1up
Kasparyan DR (1973) Fauna of the USSR Hymenoptera Vol.III Number 1. Ichneumonidae
(Subfamily Tryphoninae) Tribe Tryphonini. Nauka Publishers, Leningrad. [Translated
from Russian. Amerind Publishing Co. Ltd., New Delhi, (1981) 1–414.] https://www.zin.
ru/labs/insects/hymenopt/personalia/Kasparyan/pdf/1981-Fauna-USSR-1.pdf
Kasparyan DR (1981) A guide to the insects of the European part of the USSR. Vol. III. Hyme-
noptera. Part 3. Family Ichneumonidae. Opredeliteli Faune SSSR 129: 1–688. [in Russian]
Kasparyan DR (1988) [New taxa of ichneumonids of the family Paxylommatidae (Hymenop-
tera, Ichneumonidae) from Baltic amber] (in Russian). Trudy Vsesoyuznogo Entomolog-
icheskogo Obshchestva 70: 125–131.
Khalaim AI, Blank SM (2011) Review of the European species of the genus Gelanes Horstmann
(Hymenoptera: Ichneumonidae: Tersilochinae), parasitoids of Xyelid sawies (Hymenop-
tera: Xyelidae). Proceedings of the Zoological Institute, Leningrad 315: 154–166. https://
www.zin.ru/labs/insects/Hymenopt/personalia/khalaim/pdf/khalaim-069.pdf
Khalaim AI, Broad GR (2013) Tersilochinae (Hymenoptera: Ichneumonidae) of Costa Rica,
part 2. Genera Megalochus gen. nov. and Stethantyx Townes. Zootaxa 3693: 221–266.
https://doi.org/10.11646/zootaxa.3693.2.8
Klopfstein S (2014) Revision of the Western Palaearctic Diplazontinae (Hymenoptera: Ichneu-
monidae). Zootaxa 3801(1): 1–143. https://doi.org/10.11646/zootaxa.3801.1.1
Klopfstein S, Quicke DLJ, Kropf C, Frick H (2011) Molecular and morphological phylog-
eny of Diplazontinae (Hymenoptera, Ichneumonidae). Zoologica Scripta 40: 379–402.
https://doi.org/10.1111/j.1463-6409.2011.00481.x
Klopfstein S, Ronquist F (2013) Convergent intron gains in hymenopteran elongation factor-
1α. Molecular Phylogenetics and Evolution 67: 266–276. https://doi.org/10.1016/j.
ympev.2013.01.015
Klopfstein S, Langille B, Spasojevic T, Broad GR, Cooper SJB, Austin AD, Niehuis O (2019)
Hybrid capture data unravel a rapid radiation of pimpliform parasitoid wasps (Hymenop-
tera: Ichneumonidae: Pimpliformes). Systematic Entomology 44: 361–383. https://doi.
org/10.1111/syen.12333
Kopylov DS (2012) New Ichneumonidae (Hymenoptera) from the Upper Cretaceous ambers
of the Taimyr Peninsula. Paleontologicheskii Zhurnal 4: 52–59. [Paleontological Journal.
46(4): 383–391]. [in Russian] https://doi.org/10.1134/S0031030112040041
Kukalová-Peck J, Beutel RG (2012) Is the carboniferous Adiphlebia lacoana really the “oldest
beetle”? Critical reassessment and description of a new Permian beetle family. European
Journal of Entomology 109: 633–645. https://doi.org/10.14411/eje.2012.075
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)139
Kuslitzky VS, Kasparyan DR (2011) A new genus of ichneumonid ies of the subfamily Col-
lyriinae (Hymenoptera: Ichneumonidae) from Syria and Israel. Zoosystematica Rossica 20:
319–324. https://www.zin.ru/journals/zsr/content/2011/zr_2011_20_2_Kuslitzky.pdf
Laurenne NM, Broad GR, Quicke DLJ (2006) Direct optimization and multiple alignment of
28S D2-3 rDNA sequences: problems with indels on the way to a molecular phylogeny of
the cryptine ichneumon wasps (Insecta: Hymenoptera). Cladistics 22: 442–473. https://
doi.org/10.1111/j.1096-0031.2006.00112.x
Maddison WP, Maddison DR (2001) MacClade 4: Analysis of Phylogeny and Character Evo-
lution. Version 4.03. Sinauer Associates, Sunderland, Massachusetts. http://macclade.org
Maddison WP, Maddison DR (2011) Mesquite: a modular system for evolutionary analysis.
Version 2.75. http://mesquiteproject.org
Marsh PM (1971) Keys to the Nearctic Genera of the Families Braconidae, Aphidiidae, and
Hybrizontidae (Hymenoptera). Annals of the Entomological Society of America 64: 841–
850. https://doi.org/10.1093/aesa/64.4.841
Marsh PM (1989) Notes on the Genus Hybrizon in North America (Hymenoptera: Paxylom-
matidae). Proceedings of the Entomological Society of Washington 91(1): 29–34. http://
biodiversitylibrary.org/page/16134767
Mason WRM (1971) An Indian Agriotypus (Hymenoptera: Agriotypidae). e Canadian Ento-
mologist 103: 1521–1524. https://www.cambridge.org/core/services/aop-cambridge-core/
content/view/40D494F8E9FF4A33808FF3CD6E4033E5/S0008347X00048124a.pdf
Mason WRM (1981) Paxylommatidae: the correct family group name for Hybrizon Fallen
(Hymenoptera: Ichneumonoidea), with gures of unusual antennal sensilla. e Canadian
Entomologist 113: 433–439. https://doi.org/10.4039/Ent113427-5
Miah MI, Bhuiya BA (2001) e relationship of subfamily Campopleginae (Hymenoptera:
Ichneumonidae) with its related subfamilies: A cladistic assesment. Proceedings of the Zoo-
logical Society of Calcutta 54(1): 27–37.
Morley C (1908) Ichneumonologia Britannica, iii. e Ichneumons of Great Britain. Pimpli-
nae. Brown, London, 1–328.
Morley C (1913) A revision of the Ichneumonidae based on the collection in the British Mu-
seum (Natural History) with descriptions of new genera and species. Part II. Tribes Rhys-
sides, Echthromorphides, Anomalides and Paniscides. London, British Museum, 1–140.
https://doi.org/10.5962/bhl.title.8761
Morley C (1915) A revision of the Ichneumonidae based on the collections in the British
Museum (Natural History) with descriptions of new genera and species. Part IV. Tribes
Joppides, Banchides and Alomyides. British Museum (Natural History), London, 1–167.
Moreau, SJM, Asgari S (2015) Venom proteins from parasitoid wasps and their biological func-
tions. Toxins 7: 2385–2412. https://doi.org/10.3390/toxins7072385
Nixon K (2002) WinClada version 1.00.08. Software published by the author, Ithaca, New York.
Pampel W (1913) Die weiblichen Geschlechtsorgane der Ichneumoniden. Zeitschrift für Wis-
senschaftliche Zoologie 108: 290–357.
Pennachio F, Strand MR (2006) Evolution of developmental strategies in parasitic Hyme-
noptera. Annual Review of Entomology 51: 233–258. https://doi.org/10.1146/annurev.
ento.51.110104.151029
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
140
Perkins JF (1959a) Hymenoptera. Ichneumonoidea. Ichneumonidae, key to subfamilies and
Ichneumoninae I. Handbooks for the Identication of British Insects 7(2ai): 1–116.
https://www.royensoc.co.uk/sites/default/les/Vol07_Part02a_i.pdf
Perkins JF (1959b): Hymenoptera. Ichneumonoidea. Ichneumonidae, key to subfamilies and
Ichneumoninae II. lchneumonidae, subfamilies lchneumoninae II. Alomyinae, Agriotypi-
nae and Lycorininae. Handbooks for the Identication of British Insects 7(2aii): 117–213.
https://www.royensoc.co.uk/sites/default/les/Archive%203/Vol07_Part02a_ii.pdf
Peters RS, Krogmann L, Mayer C, Donath A, Gunkel S, Meusemann K, Kozlov A, Podsiad-
lowski L, Petersen M, Lanfear R, Diez PA, Heraty J, Kjer KM, Klopfstein S, Meier R, Po-
lidori C, Schmitt T, Liu S, Zhou X, Wappler T, Rust J, Misof B, Niehuis, O (2017) Evolu-
tionary history of the Hymenoptera. Current Biology 27: 1–6. https://doi.org/10.1016/j.
cub.2017.01.027
Porter CC (1998) [Guide to the genera of Ichneumonidae of the Neantarctic region of south-
ern South America.] Guía de los géneros de Ichneumonidae en la región neantártica del sur
de Sudamérica. Opera Lilloana 42: 1–234.
Posada D (2008) jModelTest: phylogenetic model averaging. Molecular Biology and Evolution
25: 1253–1256. https://doi.org/10.1093/molbev/msn083
Quicke DLJ (2015) e braconid and ichneumonid parasitoid wasps: biology, systematics, evolu-
tion and ecology. Wiley Blackwell, Oxford, 1–681. https://doi.org/10.1002/9781118907085
Quicke DLJ, Achterberg C van (1990) Phylogeny of the subfamilies of the family Braconidae
(Hymenoptera: Ichneumonoidea). Zoologische Verhandelingen 258: 1–95. http://reposi-
tory.naturalis.nl/document/148935
Quicke DLJ, Fitton MG, Broad GR, Crocker B, Laurenne NM, Miah IM (2005) e parasitic
wasp genera Skiapus, Hellwigia, Nonnus, Chriodes and Klutiana (Hymenoptera, Ichneumo-
nidae): recognition of the Nesomesochorinae stat. rev. and Nonninae stat. nov. and transfer
of Skiapus and Hellwigia to the Ophioninae. Journal of Natural History 39: 2559–2578.
https://doi.org/10.1080/00222930500102546
Quicke DLJ, Fitton MG, Notton DG, Broad GR, Dolphin K (2000a) Phylogeny of the sub-
families of Ichneumonidae (Hymenoptera): a simultaneous molecular and morphological
analysis. In: Austin AD, Dowton M (Eds) Hymenoptera: Evolution, Biodiversity and Bio-
logical Control. CSIRO, Collingwood, Victoria, 74–83.
Quicke DLJ, Fitton MG, Tunstead JR, Ingram SN, Gaitens PV (1994) Ovipositor structure
and relationships within the Hymenoptera, with special reference to the Ichneumonoidea.
Journal of Natural History 28: 635–682. https://doi.org/10.1080/00222939400770301
Quicke DLJ, Laurenne NM, Fitton MG, Broad GR (2009) A thousand and one wasps: a 28S
rDNA and morphological phylogeny of the Ichneumonidae (Insecta: Hymenoptera) with
an investigation into alignment parameter space and elision. Journal of Natural History 43:
1305–1421. https://doi.org/10.1080/00222930902807783
Quicke DLJ, LeRalec A, Vilhelmsen L (2000b) Ovipositor structure and function in the para-
sitic Hymenoptera with an exploration of new hypotheses. Atti della Accademia Nazionale
Italiana di Entomogia, Rendiconti 47(1999): 197–239.
Quicke DLJ, Lopez-Vaamonde C, Belshaw R. (1999) e basal Ichneumonidae (Insecta: Hy-
menoptera): 28S D2 rDNA considerations of the Brachycyrtinae, Labeninae, Paxylom-
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)141
matinae and Xoridinae. Zoologica Scripta 28: 203–210. https://doi.org/10.1046/j.1463-
6409.1999.00010.x
Quicke DLJ, Mori M, Zaldivar-Riverón A, Laurenne NM, Shaw MR (2006) Suspended mum-
mies in Aleiodes species (Hymenoptera: Braconidae: Rogadinae) with descriptions of six
new species from western Uganda based largely on DNA sequence data. Journal of Natural
History 40: 2663–2680. https://doi.org/10.1080/00222930601121288
Rambaut A (2016) FigTree. Tree gure drawing tool. Version 1.4.3. Software program. Insti-
tute of Evolutionary Biology, University of Edinburgh, Scotland http://tree.bio.ed.ac.uk/
software/gtree/
Rasnitsyn AP (1988) An outline of evolution of the hymenopterous insects (0rder Vespida).
Oriental Insects 22: 115–145. https://doi.org/10.1080/00305316.1988.11835485
Rasnitsyn AP, Zhang H (2004) Composition and age of the Daohugou hymenopteran (In-
secta, Hymenoptera = Vespida) assemblage from Inner Mongolia, China. Palaeontology
47: 1507–1517. https://doi.org/10.1111/j.0031-0239.2004.00416.x
Roman A (1923) Ichneumonologische Notizen. Entomologisk Tidskrift 44: 169–174 https://
www.biodiversitylibrary.org/item/88747#page/821/mode/thumb
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19 (12): 1572–1574. https://doi.org/10.1093/bioinformatics/btg180
Ronquist F, Klopfstein, S, Vilhelmsen, L, Schulmeister, S, Murray DL, Rasnitsyn, AP (2012)
A total-evidence approach to dating fossils, applied to the early radiation of the Hymenop-
tera. Systematic Biology 61: 973–999. https://doi.org/10.1093/sysbio/sys058
Ross HH (1936) e ancestry and wing venation of the Hymenoptera. Annals of the Entomo-
logical Society of America 29: 99–111. https://doi.org/10.1093/aesa/29.1.99
Ruschka F (1922) In: Enslin E (Ed.) Eine neue merkwürdige Braconidengattung. Beiträge
zur Biologie der Hymenoptera I. Archiv für Naturgeschichte (A) 88(5): 138–139. https://
www.biodiversitylibrary.org/item/163226#
Salt G (1931) Parasites of the wheat-stem sawy, Cephus pygmaeus Linnaeus, in England. Bulletin
of Entomological Research 22: 479–545. https://doi.org/10.1017/S0007485300035355
Santos BF (2017) Phylogeny and reclassication of Cryptini (Hymenoptera, Ichneumonidae,
Cryptinae), with implications for ichneumonid higher-level classication. Systematic En-
tomology 42: 650–676. https://doi.org/10.1111/syen.12238
Schmiedeknecht O (1902) Opuscula Ichneumonologia, Fascicle I. Allgemeine Eintheilung.
Die Gattungen der Joppinen, Ichneumoninen, Listrodrominen, Heresiearchinen, Gyro-
dontinen und Alomyinen. Bestimmungstabelle der paläarktischen Arten der Gattung Ich-
neumon. Blankenburg i üringen, 1–80.
Seyrig A (1932) Les Ichneumonides de Madagascar. I. Ichneumonidae Pimplinae. Mémoires de
l’Académie Malgache 1, part 11: 1–183.
Sharanowski BJ, Dowling APG, Sharkey MJ (2011) Molecular phylogenetics of Braconidae
(Hymenoptera: Ichneumonoidea), based on multiple nuclear genes, and implications
for classication. Systematic Entomology 36: 549–572. https://doi.org/10.1111/j.1365-
3113.2011.00580.x
Sharkey MJ, Wahl DB (1992) Cladistics of the Ichneumonoidea (Hymenoptera). Journal of
Hymenoptera Research 1: 15–24. https://biodiversitylibrary.org/page/4489915
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
142
Sharkey MJ, Carpenter JM, Vilhelmsen L, Heraty J, Liljeblad J, Dowling APG, Schulmeister
S, Murray D, Deans AR, Ronquist F, Krogmann L, Wheeler WC (2012) Phylogenetic
relationships among superfamilies of Hymenoptera. Cladistics 28: 80–112. https://doi.
org/10.1111/j.1096-0031.2011.00366.x
Shaw MR (2004) Notes on the biology of Lycorina triangulifera Holmgren (Hymenoptera:
Ichneumonidae: Lycorininae). Journal of Hymenoptera Research 13: 302–308. https://
archive.org/details/biostor-340
Shaw MR, Bennett FD (2001) Host prepupal mummication by Colpognathus Wesmael (Hy-
menoptera: Ichneumonidae, Ichnemoninae). Entomologist’s Gazette 52: 201–203.
Shaw MR, Wahl DB (1989) e biology, egg and larvae of Acaenitus dubitator (Panzer) (Hyme-
noptera, Ichneumonidae: Acaenitinae). Systematic Entomology 14: 117–125. https://doi.
org/10.1111/j.1365-3113.1989.tb00269.x
Sheng M-L, Sun, S-P (2011) A new genus and species of Brachyscleromatinae (Hymenop-
tera: Ichneumonidae) from China, Laxiareola ochracea. Journal of Insect Science 11: 1–6.
https://doi.org/10.1673/031.011.0127
Sheng M-L, Broad GR, Sun S-P (2012) A new genus and species of Collyriinae (Hyme-
noptera, Ichneumonidae). Journal of Hymenoptera Research 25: 103–125. https://doi.
org/10.3897/JHR.25.2319
Short JRT (1959) A description and classication of the nal instar larvae of Ichneumoni-
dae. Proceedings of the United States National Museum 110: 391–511. https://doi.
org/10.5479/si.00963801.110-3419.391
Short JRT (1978) e nal larval instars of the Ichneumonidae. Memoirs of the American
Entomological Institute 25: 1–508.
Sime KR, Wahl DB (2002) e cladistics and biology of the Callajoppa genus-group (Hyme-
noptera: Ichneumonidae, Ichneumoninae). Zoological Journal of theLinnean Society 134:
1–56. https://doi.org/10.1046/j.1096-3642.2002.00006.x
Smith DM, Marcot JD (2015) e fossil record and macroevolutionary history of the beetles. Pro-
ceedings of the Royal Society B 282: 20150060. https://doi.org/10.1098/rspb.2015.0060
Sohn J-C, Labandeira CC, Davis DR (2015) e fossil record and taphonomy of butteries and
moths (Insecta, Lepidoptera): implications for evolutionary diversity and divergence-time es-
timates. BMC Evolutionary Biology 15: 1–15. https://doi.org/10.1186/s12862-015-0290-8
Tanaka T, Vinson SB (1991) Interaction between venom and calyx uids of three parasitoids,
Cardiochiles nigriceps, Microplitis croceipes (Hymenoptera:Braconidae), and Campoletis so-
norensis (Hymenoptera: Ichneumonidae) in aecting a delay in the pupation of Heliothis
virescens (Lepidoptera: Noctuidae). Annals of the Entomological Society of America 84:
87–92. https://doi.org/10.1093/aesa/84.1.87
ompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the Sensitivity of
Progressive Multiple Sequence Alignment through Sequence Weighting, Position Specic
Gap Penalties and Weight Matrix Choice. Nucleic Acid Research 25: 4673–4680. https://
doi.org/10.1093/nar/22.22.4673
Townes HK (1945) A catalogue and reclassication of the Nearctic Ichneumonidae (Hyme-
noptera). Part II. e subfamilies Mesoleiinae, Plectiscinae, Orthocentrinae, Diplazoninae,
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)143
Metopiinae, Ophioninae, Mesochorinae. Memoirs of the American Entomological Society
11(2): 480–925. https://www.biodiversitylibrary.org/page/38650196#page/13/mode/1up
Townes HK (1969) e genera of Ichneumonidae, Part 1. Memoirs of the American Entomo-
logical Institute 11: 1–300. https://doi.org/10.1007/BF02027741
Townes HK (1970a) e genera of Ichneumonidae, Part 2. Memoirs of the American Entomo-
logical Institute 12: 1–537.
Townes HK (1970b) e genera of Ichneumonidae, Part 3. Memoirs of the American Entomo-
logical Institute 13: 1–307.
Townes HK (1971) e genera of Ichneumonidae, Part 4. Memoirs of the American Entomo-
logical Institute 17: 1–372.
Townes HK, Townes M (1950) A revision of the genera and of the American species of Try-
phoninae Part II. Annals of the Entomological Society of America 42(1949): 397–447.
https://doi.org/10.1093/aesa/42.4.397
Townes HK, Townes M (1951) Family Ichneumonidae. In: Muesebeck CFW, Krombein KV
& Townes HK (Eds) Hymenoptera of America north of Mexico-Synoptic catalog. United
States Department of Agriculture Monograph 2: 184–409. https://www.biodiversityli-
brary.org/part/93187#/summary
Townes HK, Townes M (1960) Ichneumon-ies of American north of Mexico: 2 Subfam-
ily Ephialtinae, Xoridinae, Acaenitinae. United States National Museum Bulletin 216(2):
1–676. https://doi.org/10.5479/si.03629236.216.1-2
Townes HK, Townes M (1966) A catalogue and re-classication of the Neotropic Ichneumoni-
dae. Memoirs of the American Entomological Institute 8: 1–367.
Townes HK, Momoi S, Townes M (1965) A catalogue and reclassication of eastern Palearctic
Ichneumonidae. Memoirs of the American Entomological Institute 5: 1–661.
Townes HK, Townes M, Gupta VK (1961) A catalogue and reclassication of the Indo-Austral-
ian Ichneumonidae. Memoirs of the American Entomological Institute 1: 1–522.
Tripp HA (1961) e biology of a hyperparasite, Euceros frigidus Cress. (Ichneumonidae) and
description of the planidial stage. e Canadian Entomologist 93: 40–58. https://doi.
org/10.4039/Ent9340-1
Viereck HL (1918) A list of families and subfamilies of the Ichneumon-ies in the superfam-
ily Ichneumonoidea. Proceedings of the Biological Society of Washington 31: 69–74.
https://ia800306.us.archive.org/10/items/proceedingsofbio31biol/proceedingsofbio-
31biol.pdf
Viereck HL (1919) A list of families and subfamilies of the Ichneumon-ies in the super-
family Ichneumonoidea. Additions and corrections. Proceedings of the Biological Society
of Washington 32: 48, 198. https://ia800207.us.archive.org/27/items/proceedingsofbio-
32biol/proceedingsofbio32biol.pdf
Wahl DB (1986) Larval structures of oxytorines and their signicance for the higher classi-
cation of some Ichneumonidae (Hymenoptera). Systematic Entomology 11: 117–127.
https://doi.org/10.1111/j.1365-3113.1986.tb00171.x
Wahl DB (1988) A review of the mature larvae ofthe Banchini and their phylogenetic sig-
nicance, with comments on the Stilbopinae (Hymenoptera: Ichneumonidae). In: Gupta
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
144
VK (Ed.) Advances in parasitic Hymenoptera Research. Brill (Leiden, e Netherlands):
147–161.
Wahl DB (1990) A review of the mature larvae of Diplazontinae, with notes on larvae of
Acaenitinae and Orthocentrinae and proposal of two new subfamilies (Insecta: Hy-
menoptera: Ichneumonidae). Journal of Natural History 24: 27–52. https://doi.
org/10.1080/00222939000770041
Wahl DB (1991) e status of Rhimphoctona with special reference to the higher categories
within Campopleginae and the relationships of the subfamily (Hymenoptera: Ichneumon-
dae). Transactions of the American Entomological Society 117: 193–213. http://www.js-
tor.org/stable/pdf/25078548.pdf
Wahl DB (1993a) Cladistics of the genera of Labeninae (Hymenoptera: Ichneumonidae). En-
tomologia Generalis 18: 91–105. https://doi.org/10.1127/entom.gen/18/1993/91
Wahl DB (1993b) Cladistics of the genera of Mesochorinae (Hymenoptera: Ichneumonidae). Sys-
tematic Entomology 18: 371–387. https://doi.org/10.1111/j.1365-3113.1993.tb00673.x
Wahl DB (1993c) Family Ichneumonidae. In: Goulet H, Huber JT (Eds), Hymenoptera of the
world: an identication guide to families. Research Branch of Agriculture Canada, Publica-
tion 1894/E: 395–509. http://cfs.nrcan.gc.ca/pubwarehouse/pdfs/35617.pdf
Wahl DB, Gauld ID (1998) e cladistics and higher classication of the Pimpliformes (Hyme-
noptera: Ichneumonidae). Systematic Entomology 23: 265–298. https://doi.org/10.1046/
j.1365-3113.1998.00057.x
Wahl DB, Mason WRM (1995) e family-group names of the Ichneumoninae (Hymenop-
tera: Ichneumonidae). Journal of Hymenoptera Research 4: 285–293. http://biostor.org/
reference/510
Wahl DB, Shanower TG, Hoelmer KA (2007) A new species of Collyria Schiødte (Hymenoptera:
Ichneumonidae: Collyriinae), a parasitoid of Cephus fumipennis (Hymenoptera: Cephidae)
in China, and potential biological control agent for Cephus cinctus in North America.
Journal of the Kansas Entomological Society 80: 43–50. https://doi.org/10.2317/0022-
8567(2007)80[43:ANSOCS]2.0.CO;2
Wahlberg N, Wheat CW, Peña C (2013) Timing and patterns in the taxonomic diversica-
tion of Lepidoptera (butteries and moths). PLoS ONE 8(11): e80875. https://doi.
org/10.1371/journal.pone.0080875
Waterston J (1926) A note on Alomyia debellator Fab. Entomologist’s Monthly Magazine 62:
98–99.
Whalley PES (1985) e systematics and palaeography of the Lower Jurassic insects of Dorset,
England. Bulletin of the British Museum (Natural History), Geology Series 39: 107–189.
https://ia800206.us.archive.org/11/items/biostor-118603/biostor-118603.pdf
Wheeler WC, Gatesy J, DeSalle R (1995) Elision: a method for accommodating multiple mo-
lecular sequence alignments with alignment-ambiguous sites. Molecular phylogenetics and
evolution 4(1): 1–9. https://doi.org/10.1006/mpev.1995.1001
Yu DSK, Horstmann K (1997) A catalogue of World Ichneumonidae (Hymenoptera). Part 1:
Subfamilies Acaenitinae to Ophioninae. Memoirs of the American Entomological Institute
58(1): 1–763.
Yu DSK, Achterberg C van, Horstmann K (2016) Taxapad 2016, Ichneumonoidea 2015. Da-
tabase on ash-drive, Nepean, Ontario, Canada. www.taxapad.com
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)145
Appendix 1
Taxonomic descriptions
Cephalic sclerites of mature larva of Phrudus defectus Stelfox.
Fig. 111
Cephalic sclerites mostly well-sclerotized. Epistomal suture (character 105): region dis-
torted and not reconstructed in drawing, but possibly completely sclerotized and form-
ing epistomal band (coded as “?”). Labral sclerite (character 108) & clypeolabral plates
(character 130) unknown because labral region distorted (both scored as “?”). Stipital
sclerite present, more or less horizontal and median end contacting labial sclerite (char-
acter 119. state 0) and without lateral plate-like extension (character 120, state 0). Pleu-
rostoma only partially visible due to distortion; posterior struts of inferior mandibular
processes not connected by band (character 114, state 0); inferior mandibular process
dorsad to dorsal margin of labial sclerite (character 107, state 0); accessory pleuros-
tomal area (character 106) not discernible (coded as “?”). Hypostoma well-sclerotized
and long (character 115, state 0); lateral end simple, not divided or upcurved (character
116, state 0). Hypostomal spur present and long, about 2.0× as long as its basal width
(character 117, state 0), meeting stipital sclerite near middle (character 118, state 0).
Labial sclerite nearly circular (character 124, state 1), about as long as wide (character
125, state 0), not produced ventrally as a spine (character 126, state 0). Salivary orice
U-shaped (character 133, state 1). Prelabial sclerite absent (character 127, state 0).
Sclerotized plate ventrad labial sclerite absent (character 129, state 0). Maxillary and
labial palpi each bearing 2 sensilla (character 123, state 0). Mandible uniformly well-
sclerotized (character 111, state 0), cone-shaped and apex with small, tooth-like projec-
tion (character 109, state 1) (Fig. 111, upper left); blade without denticles (character
112, state 2), without accessory teeth (character 110, state 0) and without basal spines
(character 113, state 0). Antenna (character 131): unknown (coded as “?”). Spiracle
with closing apparatus separated by section of trachea (character 132, state 0 - coded as
“?” in matrix). Skin with numerous small triangular projections (10 μ long) and scat-
tered elongate setae (32 μ long).
Material examined: Phrudus defectus Stelfox last larval instar exuvium slides:
UNITED KINGDOM: Isle of Man, Laxey, Baldhoon Road, Crofton, SC4284; F.D.
Bennett; from Epuraea melanocephala in sycamore owers; exposed 1–2.vi.2008, adult
emerged 4.v.2009 [DBW preparation 28.I.2012b] (EMUS); UNITED KINGDOM:
Isle of Man, Laxey, Mooar Glen, SC43284; F.D. Bennett; from Epuraea melanocephala
in sycamore owers; collected 31.v.2008, adult emerged 11.v.2009 [DBW preparation
28.I.2012c] (EMUS).
Comments. Distortions of the two preparations (DBW preparations 28.I.2012b
and 28.I.2012c) do not allow clear views of the dorsal portion of the cephalic cap-
sule, and hence structures above the inferior mandibular processes are not shown. Fig-
ure111 is a composite of the two preparations listed above. is is the rst description
of the larva of the Phrudus group of Tersilochinae which is of interest because prior to
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
146
Quicke et al. (2009), the Phrudus group was part of its own subfamily (Phrudinae). e
shape of the mandible (apex with small, tooth-like projection) (character 109, state 1)
is a synapomorphy for the Tersilochus and Phrudus groups of genera, thereby support-
ing the inclusion of these two groups in Tersilochinae.
Cephalic sclerites of mature larva of Collyria spp.
Fig. 112
Cephalic sclerites mostly weakly sclerotized or absent. Epistomal suture unsclerotized
(character 105, state 0). Labral sclerite absent (character 108, state 1). Clypeolabral
plates absent (character 130, state 0). Stipital sclerite absent (character 119. state 2)
and without lateral plate-like extension (character 120, state 0). Pleurostoma dicult
to discern, but apparently not laterally expanded (character 106, state 0) and posterior
struts of inferior mandibular processes short and not obviously connected by band
(character 114, state 0). Hypostoma absent (character 115, state 2). Hypostomal spur
absent (character 117, state 2). Labial sclerite (character 124) dicult to discern ven-
trally, therefore shape scored as “?”. Salivary orice (character 133) not visible (scored
as “?”). Prelabial sclerite absent (character 127, state 0). Sclerotized plate ventrad labial
sclerite absent (character 129, state 0). Maxillary and labial palpi (character 123) not
visible (scored as “?”). Mandible (scored for C. coxator from the description of Salt
1931): uniformly sclerotized (character 111, state 0) and triangular (character 109,
state 0); blade without denticles (character 112, state 2), accessory teeth absent (char-
acter 110, state 0), basal spines absent (character 113, state 0). Mandible apparently
absent in C. catoptron (Fig. 112). Antenna absent (character 131, state 2). Spiracle with
closing apparatus separated by section of trachea (character 132, state 0). Skin with
numerous small bubble-like projections and lacking setae.
Material examined: Collyria coxator (Villers) last larval instar exuvium slide mount:
Locality unspecied. Label 1: Slide no. 284. Don G. Salt. Label 2: Collyria calcitrator
(Grav.) JRTS 1955 (NMNH); Collyria catoptron Wahl slit and macerated last instar
whole larva slide mount: CHINA, Gansu Province, Yuzhong County, ix.1998, ex. Ce-
phus fumipennis, T. Shanower et al. [DBW preparation 3.I.2011] (EMUS).
Comments: e nature of the cephalic sclerites of the mature larva of Collyria is
not straightforward. Salt (1931) gave a detailed description of the larval stages of Col-
lyria coxator (Villers). e mature larval head was characterized as “not at all darkened
or hardened, is without any noticeable facial rods, and appears to lack even mandibles.”
He went on to state: “Careful staining, however, shows that the mandibles and some of
the usual facial rods are represented, but not well developed… e mandibular struts
may be clearly distinguished, and there are vague sclerotic areas in the labral region, but
all parts are so poorly represented that it is dicult to homologize them”. Salt’s draw-
ing (his g. 13b), shows only the pleurostomae and mandibles (the mandibles drawn
with a ner line), all other cephalic sclerites being absent (the large square structure
below the mandibles is the suspensorium of the hypopharynx, as pointed out by Short
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)147
(1959)). Short (1959) illustrated another specimen of C. coxator and gave a detailed
description of it. Examination of the original slide (NMNH) reveals part of the draw-
ing to be imaginary: only the pleurostomae and suspensorium of the hypopharynx are
present, and the mandibles and antennae are absent. e mandibles in the drawing
may have been added to conform to Salt’s gure.
Between Salt’s detailed study and Short’s slide, Collyria appears to be quite unique
amongst the Ichneumonidae for the drastic reduction of the cephalic sclerites. Reduc-
tion of the sclerites is associated with not spinning a cocoon (such as in the Anom-
aloninae, Ichneumoninae, Metopiinae, and Pimplini), but never to such an extent as
in Collyria. Preserved larvae of a second species, Collyria catoptron Wahl, were available
for comparison. A number of larvae were longitudinally slit and macerated in sodium
hydroxide solution, with the resulting skins stained with acid fuschin and then slide
mounted. Whole larvae were also stained with acid fuschin and then examined. No
evidence of sclerotized structures could be found on the mounted skins. e stained
whole specimens showed the general mouthpart regions as convexities and furrows but
no sclerotized structures were present (Fig. 112).
In summary, Collyria lacks all cephalic sclerites except for the pleurostoma, part of
the labium and maxilla and the mandibles (at least in C. coxator). It might be noted
that Short depicted the spiracle’s closing apparatus as extremely long and narrow. e
spiracles in Short’s slide and the new specimens of catoptron are not nearly as long or
as narrow (his depiction of the closing apparatus being separated from the atrium is
accurate). Short apparently did not use a camera lucida or ocular grid, and his drawings
are often strikingly distorted.
Cephalic sclerites of mature larva of Alomya semiava Stephens
Fig. 125
e following description is based on a re-examination of two larval slides prepared by
J.R.T. Short (Hinz and Short 1983). Our gure of the last instar larva is depicted as
it appears on the slide (i.e., not reconstructed as bilaterally symmetrical, as per usual
practice) because the larva on the slide is distorted. In addition, the suspensorium of
the hypopharynx is not shown, as its presence is universal within ichneumonids and
its shape uniformative. See comments below for additional description of Short’s slide
preparation and how it was depicted in Hinz and Short (1983).
Cephalic sclerites with many prominent structures absent; remaining structures well-
sclerotized. Epistomal suture completely sclerotized, uncertain if forming epistomal band
because of distortion of larva, but coded as present (character 105, state 2). Labral scle-
rite absent (character 108, state 1); clypeolabral plates absent (character 130, state 0).
Stipital sclerite absent (character 119, state 2). Pleurostoma well-sclerotized, not laterally
expanded (character 106, state 0); posterior struts of inferior mandibular processes short
and not connected by band (character 114, state 0). Hypostoma long and well-sclerotized
(character 115, state 0), more or less straight, markedly angled ventrally towards cephalic
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
148
midline. Hypostomal spur absent (character 117, state 2). Labial sclerite absent (character
124), originally coded as present, (circular to ovoid: state 1), but re-assessed when manu-
script in press" (see comments, below). Region near salivary orice distorted, but pre-
sumably U-shaped (character 133, state 1). Prelabial sclerite absent (character 127, state
0). Plate ventrad labial sclerite absent (character 129, state 0). Maxillary and labial palpi
each bearing 5 sensilla (character 123, state 2). Mandible large, uniformly well-sclerotized
(character 111, state 0) and triangular (character 109, state 0); blade without denticles
(character 112, state 2). Antenna (character 131) not visible (coded as “?”). Spiracle with
closing apparatus adjacent to atrium (character 132, state 1, but coded as separated from
atrium, state 0). Skin smooth with scattered short setae.
Material examined: 1 last larval instar slide mount, larva reared under laboratory
conditions from mummied nal larval instar of Korscheltellus (= Hepialus) lupulinus
(Linnaeus, 1758), 1979, R. Hinz (ANIC). 1 penultimate stage larval slide mount.
Same data as nal instar (ANIC).
Comments: Alomya semiava, like other species in its genus, attack species of He-
pialidae (Lepidoptera) (Waterston 1926, Hinz and Short 1983). e wasp is a koino-
biont endoparasitoid, with the unusual habit of pupating within the hardened remains
of the host larva in contrast to most other ichneumonines which pupate within the
host pupa (Colpognathus spp. are also known to pupate in the host larval remains – see
Shaw and Bennett 2001). Short characterized both of his slide preparations as ‘nal
larval instars’, but one is clearly penultimate stage. Points of interest are as follows:
1) ere is no trace of the antennal disc.
2) e region of the epistomal suture is distorted, and it is not possible to determine
if an epistomal band is present (it could be there but thin and not well sclerotized).
e band is present in the penultimate larva slide, but ichneumonid larvae often
lose structures upon maturity (Wahl 1990).
3) Short reported cuticular folds bearing setae on the clypeolabrum but these could
not be seen. He apparently thought these to be analogous to the narrow clypeo-
labral plates found in Phaeogenini.
4) e maxillary apices are distorted and could not be reconstructed as depicted by
Short. Both maxillary palpi are rotated so that only lateral views were possible
(Fig.125) (and so the ve sensilla in Short’s gure were a reconstruction, albeit
probably correct). Wrinkles in the cuticle led Short to depict the presence of stipi-
tal sclerites; they are not present.
5) e region of the salivary orice is distorted and its shape cannot be determined
(although it is presumably U-shaped). What Short depicts as the ‘silk press’ is the
terminal end of the salivary duct.
6) Short shows the labial sclerite to be present, with the ventral section unsclerotized.
e actual specimen has a crescentic structure on the right side in the vicinity of
the labium (Fig. 125, crescentic fold of cuticle) but there is not a corresponding
structure on the left side. Given the general distortion of the specimen, the cres-
centic structure is interpreted as an extended cuticular wrinkle.
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)149
7) e orientation of the epistoma+pleurostoma+hypostoma is dicult to determine,
given the preparation’s distortion. e left-side hypostoma has broken o from
the pleurostoma. e slide of the penultimate instar has the orientation of Short’s
gure but the right side of the mature larval specimen belies that reconstruction.
e actual arrangement is probably similar to that of yrateles procax (Cresson) or
Trogus pennator (Fabricius) in Gillespie and Finlayson (1983).
In summary, the cephalic morphology of the nal-instar larva of A. semiava is that
of a standard ichneumonine, lacking only clypeolabral plates.
Appendix 2
Taxa sequenced, countries of collection, specimen voucher numbers and Genbank
accession numbers for molecular vouchers. All sequences were original to this study
except as noted by superscripts indicating literature reference: 1Heraty et al. (2011);
2Quicke et al. (2006); 3Quicke et al. (2009); 4Belshaw and Quicke (2002); Taxonomy
reects nomenclature prior to current study.
Taxa Country of
collection
Voucher
depository
Voucher number Genbank accession numbers
COI 28s D2 EF1a
Braconidae
Doryctes erythromelas (Brullé) ? UKY ?GQ3746271GQ3747091GQ4107061
Rhysipolis sp. ?UKY ?GQ3746261GQ3747081GQ4107051
Aleiodes terminalis Cresson ? UKY ? – GQ3747101GQ4107071
Aleiodes pictus (Herrich-Schäer) England ? ? EF1154642– –
Ichneumonidae
Acaenitinae
Spilopteron occiputale (Cresson) United States CNC CNC 422320 MK959483 MK851161 MK851398
Coleocentrus rufus Provancher United States CNC CNC 422321 MK959401 MK851078 MK851315
Adelognathinae
Adelognathus sp. United States CNC CNC 422322 MK959374 MK851051 MK851288
Agriotypinae
Agriotypus armatus Curtis Czech Republic CNC CNC 422323 MK959376 MK851053 MK851290
Alomyinae
Alomya debellator (Fabricius) Switzerland CNC CNC 422374 MK959378 MK851055 MK851292
Anomaloninae
Anomalonini
Anomalon picticorne (Viereck) United States CNC CNC 422324 MK959379 MK851056 MK851293
Gravenhorstiini
erion texanum (Ashmead) United States CNC CNC 422325 MK959490 MK851168 MK851405
Ateleutinae
Ateleute sp. nov. United States CNC CNC 422344 MK959384 MK851061 MK851298
Banchinae
Atrophini
Lissonota scutellaris (Cresson) United States CNC CNC 422326:
(COI, 28S D2);
CNC422489: (EF1a)
MK959436 MK851113 MK851350
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
150
Taxa Country of
collection
Voucher
depository
Voucher number Genbank accession numbers
COI 28s D2 EF1a
Banchini
Exetastes bioculatus Cresson United States CNC CNC 422327 MK959424 MK851101 MK851338
Glyptini
Apophua simplicipes (Cresson) Canada CNC CNC 422328 MK959382 MK851059 MK851296
Sphelodon phoxopteridis (Weed) United States CNC CNC 422329 MK959482 MK851160 MK851397
Brachycyrtinae
Brachycyrtus wardae Bennett Fiji CNC CNC 422490: (COI,
28S D2); CNC
422330: (EF1a)
MK959389 MK851066 MK851303
Campopleginae
Bathyplectes infernalis (Gravenhorst) United States CNC CNC 422331 MK959388 MK851065 MK851302
Campoletis sonorensis (Cameron) United States CNC CNC 422332 MK959391 MK851068 MK851305
Campoplex sp. United States CNC CNC 422333 MK959392 MK851069 MK851306
Casinaria grandis Walley United States CNC CNC 422334 MK959393 MK851070 MK851307
Dusona egregia (Viereck) United States CNC CNC 422335 MK959415 MK851092 MK851329
Hyposoter sp. United States CNC CNC 422336 MK959429 MK851106 MK851343
Olesicampe sp. United States CNC CNC 422491: (COI,
28S D2); CNC
422337: (EF1a)
MK959452 MK851129 MK851366
Rhimphoctona macrocephala
(Provancher)
Canada CNC CNC 422338 MK959474 MK851151 MK851389
Claseinae
Clasis sp. nov. Chile CNC CNC 422339 MK959398 MK851075 MK851312
Collyriinae
Collyria catoptron Wahl China CNC CNC 422340 MK959402 MK851079 MK851316
Cremastinae
Eiphosoma pyralidis Ashmead United States CNC CNC 422341 MK959418 MK851095 MK851332
Xiphosomella setoni Johnson United States CNC CNC 422342 MK959496 MK851174 MK851411
Cryptinae
Aptesini
Polytribax contiguus (Cresson) Canada CNC CNC 422349 MK959471 MK851148 MK851386
Rhytura pendens Townes United States CNC CNC 422350 MK959477 MK851155 MK851393
Cryptini
Agonocryptus chichimecus (Cresson) United States CNC CNC 422343 MK959375 MK851052 MK851289
Baryceros texanus (Ashmead) United States CNC CNC 422345 MK959386 MK851063 MK851300
Diapetimorpha brunnea Townes United States CNC CNC 422346 MK959411 MK851088 MK851325
Echthrus reluctator (Linnaeus) Germany CNC CNC 422348 MK959416 MK851093 MK851330
Lymeon orbus (Say) United States CNC CNC 422347 MK959438 MK851115 MK851352
Ctenopelmatinae
Ctenopelmatini
Ctenopelma sanguineum (Provancher) United States CNC CNC 422354 MK959405 MK851082 MK851319
Xenoschesis limata (Cresson) United States CNC CNC 422355 MK959495 MK851173 MK851410
Euryproctini
Euryproctus sentinis Davis United States CNC CNC 422356 MK959423 MK851100 MK851337
Mesoleptidea decens (Cresson) United States CNC CNC 422357 MK959443 MK851120 MK851357
Mesoleiini
Barytarbes honestus (Cresson) United States CNC CNC 422358 MK959387 MK851064 MK851301
Himerta luteofacia Leblanc United States CNC CNC 422359 MK959427 MK851104 MK851341
Perilissini
Lathrolestes asperatus Barron United States CNC CNC 422360 MK959433 MK851110 MK851347
Perilissus concolor (Cresson) United States CNC CNC 422361 MK959461 MK851138 MK851375
Pionini
Rhorus bartelti Luhman Canada CNC CNC 422362 –MK851152 MK851390
Sympherta fucata (Cresson) United States CNC CNC 281120 MK959487 MK851165 MK851402
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)151
Taxa Country of
collection
Voucher
depository
Voucher number Genbank accession numbers
COI 28s D2 EF1a
Scolobatini
Onarion sp. Bolivia CNC CNC 422365 MK959453 MK851130 MK851367
Seleucini
Seleucus cuneiformis Holmgren Japan CNC CNC 422364 MK959479 MK851157 MK851395
Westwoodiini
Westwoodia sp. Australia CNC CNC 422366 MK959493 MK851171 MK851408
Tribe indet.
Ctenopelmatinae Genus NZ New Zealand CNC CNC 422367 MK959406 MK851083 MK851320
Cyllocerinae
Cylloceria melancholica (Gravenhorst) United States CNC CNC 422368 MK959409 MK851086 MK851323
Diacritinae
Diacritus incompletus Momoi Japan CNC CNC 422369 MK959410 MK851087 MK851324
Diplazontinae
Diplazon laetatorius (Fabricius) Canada CNC CNC 422370 MK959413 MK851090 MK851327
Woldstedtius avolineatus (Gravenhorst) United States CNC CNC 422371 MK959494 MK851172 MK851409
Eucerotinae
Euceros sp. nov. United States CNC CNC 422372 MK959422 MK851099 MK851336
Hybrizontinae
Hybrizon rileyi (Ashmead) United States CNC CNC 422373: (COI,
28S D2); CNC
422392: (EF1a)
MK959428 MK851105 MK851342
Ichneumoninae
Heresiarchini
Coelichneumon eximius (Stephens) United States CNC CNC 422378 MK959400 MK851077 MK851314
Protichneumon grandis (Brullé) United States CNC CNC 422379 MK959473 MK851150 MK851388
Ichneumonini
Barichneumon neosorex Heinrich United States CNC CNC 422380 MK959385 MK851062 MK851299
Cratichneumon w-album (Cresson) United States CNC CNC 422381 MK959403 MK851080 MK851317
Orgichneumon calcatorius (unberg) United States CNC CNC 422382 MK959455 MK851132 MK851369
Patrocloides montanus (Cresson) United States CNC CNC 422383 MK959459 MK851136 MK851373
Joppocryptini
Plagiotrypes concinnus (Say) United States CNC CNC 422384 MK959468 MK851145 MK851382
Listrodromini
Dilopharius otomitus (Cresson) United States CNC CNC 422385 MK959412 MK851089 MK851326
Phaeogenini
Centeterus euryptychiae (Ashmead) Canada CNC CNC 422375 MK959394 MK851071 MK851308
Phaeogenes hebrus (Cresson) United States CNC CNC 422376 MK959464 MK851141 MK851378
Stenodontus sp. nov. United States CNC CNC 422377 MK959484 MK851162 MK851399
Platylabini
Cyclolabus impressus (Provancher) United States CNC CNC 422386 MK959408 MK851085 MK851322
Linycus exhortator (Fabricius) United States CNC CNC 422387 MK959435 MK851112 MK851349
Labeninae
Orthognathelini
Grotea anguina Cresson United States CNC CNC 422388 MK959426 MK851103 MK851340
Labium sp. Australia CNC CNC 422389 MK959432 MK851109 MK851346
Labenini
Apechoneura sp. Bolivia CNC CNC 422390 MK959380 MK851057 MK851294
Labena grallator (Say) United States CNC CNC 422391 MK959431 MK851108 MK851345
Poecilocryptini
Poecilocryptus nigromaculatus Cameron Australia ? (28s);
CNC
(EF1a)
? (28s); CNC 422392
(EF1a)
–AJ3029213MK851383
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
152
Taxa Country of
collection
Voucher
depository
Voucher number Genbank accession numbers
COI 28s D2 EF1a
Lycorininae
Lycorina glaucomata (Cushman) United States CNC CNC 422393 MK959437 MK851114 MK851351
Mesochorinae
Astiphromma sp. nov. United States CNC CNC 422394 MK959383 MK851060 MK851297
Chineater masneri Wahl Chile CNC CNC 422395 MK959395 MK851072 MK851309
Cidaphus paniscoides (Ashmead) United States CNC CNC 422396 MK959397 MK851074 MK851311
Lepidura collaris Townes Chile CNC CNC 422397 MK959434 MK851111 MK851348
Mesochorus sp. United States CNC CNC 422398 MK959442 MK851119 MK851356
Metopiinae
Exochus semirufus Cresson United States CNC CNC 422399 MK959425 MK851102 MK851339
Metopius pollinctorius (Say) United States CNC CNC 422400 MK959444 MK851121 MK851358
Scolomus sp. Chile CNC CNC 422401 MK959478 MK851156 MK851394
Seticornuta terminalis (Ashmead) United States CNC CNC 422402 MK959480 MK851158 MK851396
Microleptinae
Microleptes sp. South Korea CNC CNC 422403 MK959445 MK851122 MK851359
Neorhacodinae
Neorhacodes enslini (Ruschka) Spain CNC CNC 422434 MK959446 MK851123 MK851360
Nesomesochorinae
Chriodes sp. Madagascar CNC CNC 422404 MK959396 MK851073 MK851310
Nonnus sp. Argentina CNC CNC 422405 MK959449 MK851126 MK851363
Ophioninae
Enicospilus avostigma Hooker United States CNC CNC 422406 MK959420 MK851097 MK851334
Hellwigia obscura Gravenhorst France ? ? – AJ3028584–
Ophion sp. United States CNC CNC 422407 MK959454 MK851131 MK851368
Skiapus sp. Mozambique CNC CNC 422408 MK959481 MK851159 –
yreodon sp. Guyana CNC CNC 422409 MK959492 MK851170 MK851407
Orthocentrinae
Megastylus sp. nov. United States CNC CNC 422410 MK959441 MK851118 MK851355
Orthocentrus sp. United States CNC CNC 422411 MK959456 MK851133 MK851370
Proclitus speciosus Dasch United States CNC CNC 422412 MK959472 MK851149 MK851387
Orthopelmatinae
Orthopelma mediator (unberg) Sweden CNC CNC 422413 MK959457 MK851134 MK851371
Oxytorinae
Oxytorus albopleuralis (Provancher) United States CNC CNC 422414 MK959458 MK851135 MK851372
Pedunculinae
Pedunculus sp. nov. Chile CNC CNC 422415 MK959460 MK851137 MK851374
Phygadeuontinae
Acrolyta sp. United States CNC CNC 422351 MK959372 MK851049 MK851286
Endasys patulus (Viereck) United States CNC CNC 422352 MK959419 MK851096 MK851333
Mastrus sp. United States CNC CNC 422353 MK959439 MK851116 MK851353
Pimplinae
Delomeristini
Perithous divinator (Rossi) Canada CNC CNC 422416 MK959462 MK851139 MK851376
Ephialtini
Acrotaphus wiltii (Cresson) United States CNC CNC 422417 MK959373 MK851050 MK851287
Clistopyga recurva (Say) United States CNC CNC 422418 MK959399 MK851076 MK851313
Dolichomitus irritator (Fabricius) United States CNC CNC 422419 MK959414 MK851091 MK851328
Zaglyptus pictilis Townes United States CNC CNC 422420 MK959498 MK851176 MK851413
Pimplini
Pimpla annulipes Brullé Canada CNC CNC 422421 MK959467 MK851144 MK851381
eronia bicincta (Cresson) United States CNC CNC 422422 MK959491 MK851169 MK851406
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)153
Taxa Country of
collection
Voucher
depository
Voucher number Genbank accession numbers
COI 28s D2 EF1a
Poemeniinae
Neoxorides caryae (Harrington) United States CNC CNC 422423 MK959447 MK851124 MK851361
Poemenia albipes (Cresson) United States CNC CNC 422424 MK959469 MK851146 MK851384
Rhyssinae
Megarhyssa greenei Viereck Canada CNC CNC 422425 MK959440 MK851117 MK851354
Rhyssa crevieri (Provancher) Canada CNC CNC 422426 MK959475 MK851153 MK851391
Rhyssella nitida (Cresson) Canada CNC CNC 422427 MK959476 MK851154 MK851392
Sisyrostolinae
Brachyscleroma sp. Kenya CNC CNC 422428 MK959390 MK851067 MK851304
Erythrodolius calamitosus Seyrig Madagascar CNC CNC 422429 MK959421 MK851098 MK851335
Stilbopinae
Notostilbops sp. nov. Chile CNC CNC 422430 MK959450 MK851127 MK851364
Stilbops vetulus (Gravenhorst) Hungary CNC CNC 422431 MK959486 MK851164 MK851401
Tatogastrinae
Tatogaster nigra Townes Chile CNC CNC 422432 MK959488 MK851166 MK851403
Tersilochinae
Allophrys divaricata Horstmann United States CNC CNC 422493: (COI,
28S D2); CNC
422433: (EF1a)
MK959377 MK851054 MK851291
Peucobius fulvus Townes United States CNC CNC 422435 MK959463 MK851140 MK851377
Phrudus sp. South Korea CNC CNC 422436 MK959465 MK851142 MK851379
Stethantyx nearctica Townes United States CNC CNC 422437 MK959485 MK851163 MK851400
Tersilochus sp. United States CNC CNC 422438: (COI,
EF1a); CNC 422494:
(28s D2)
MK959489 MK851167 MK851404
Tryphoninae
Eclytini
Eclytus sp. United States CNC CNC 422495: (COI,
28S D2); CNC
422439: (EF1a)
MK959417 MK851094 MK851331
Idiogrammatini
Idiogramma longicauda (Cushman) United States CNC CNC 422440 MK959430 MK851107 MK851344
Oedemopsini
Zagryphus nasutus (Cresson) United States CNC CNC 422441: (COI,
EF1a); CNC 422496:
(28s D2)
MK959499 MK851177 MK851414
Phytodietini
Netelia sp. United States CNC CNC 422442 MK959448 MK851125 MK851362
Phytodietus vulgaris Cresson United States CNC CNC 422443 MK959466 MK851143 MK851380
Tryphonini
Cteniscus sp. United States CNC CNC 422444 MK959404 MK851081 MK851318
Cycasis rubiginosa (Gravenhorst) Switzerland CNC CNC 422445 MK959407 MK851084 MK851321
Polyblastus sp. United States CNC CNC 422446 MK959470 MK851147 MK851385
Xordinae
Aplomerus sp. United States UKY CNC 681999 (COI,
28s D2), CNC
MK959381 MK851058 MK851295
CNC 422447: (EF1a)
Odontocolon albotibiale (Bradley) United States CNC CNC 422497: (COI,
28s D2); CNC
422448: (EF1a)
MK959451 MK851128 MK851365
Xorides stigmapterus (Say) Canada CNC CNC 422449 MK959497 MK851175 MK851412
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
154
Supplementary material 1
Ichneumonidae complete phylogenetic matrix, molecular characters coded as 0123
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: phylogenetic data (nexus format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl1
Supplementary material 2
Ichneumonidae complete phylogenetic matrix, molecular characters coded as 0123
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: phylogenetic data (Hennig86 format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl2
Supplementary material 3
Ichneumonidae phylogenetic matrix, molecular characters only, coded as ACGT
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: phylogenetic data (nexus format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl3
Phylogeny of the subfamilies of Ichneumonidae (Hymenoptera)155
Supplementary material 4
Ichneumonidae phylogenetic matrix, molecular characters only, coded as ACGT
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: phylogenetic data (Hennig86 format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl4
Supplementary material 5
Total evidence parsimony trees
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: Phylogenetic trees (Winclada format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl5
Supplementary material 6
Morphology-only parsimony trees
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: Phylogenetic trees (Winclada format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl6
Andrew M.R. Bennett et al. / Journal of Hymenoptera Research 71: 1–156 (2019)
156
Supplementary material 7
Molecular-only parsimony trees
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: Phylogenetic trees (Winclada format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl7
Supplementary material 8
Bayesian total evidence trees
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: Phylogenetic trees (Winclada format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl8
Supplementary material 9
Bayesian molecular-only trees
Authors: Andrew M.R. Bennett, Sophie Cardinal, Ian D. Gauld, David B. Wahl
Data type: Phylogenetic trees (Winclada format)
Copyright notice: is dataset is made available under the Open Database License
(http://opendatacommons.org/licenses/odbl/1.0/). e Open Database License
(ODbL) is a license agreement intended to allow users to freely share, modify, and
use this Dataset while maintaining this same freedom for others, provided that the
original source and author(s) are credited.
Link: https://doi.org/10.3897/jhr.71.32375.suppl9
